TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3191-5p
miRNA Sequence: CUCUCUGGCCGUCUACCUUCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr12102368 2275 1903 891 486 405 396 342 307 301 21741 1726 42298 1636 1603 479 1322
NM_000084chrX96567 6481 6233 4863 4287 2641 1989 1560 649 22413 2401 11613 32477 1010 462
NM_000125chr653982 3964 2869 1397 343 1614 --22959 1058
NM_000216chrX73990 3801 3728 3313 3045 914 101 32933 1169 999 182 23263 658
NM_000259chr1595653 5084 4896 4560 4287 4106 1302 1257 559 25108 1560 21957 1349 --
NM_000330chrX81909 1786 1638 686 669 528 481 29 21756 915 --1210
NM_000332chr6106646 6336 5526 4957 4453 2883 2340 763 555 487 76783 5251 4832 4797 2413 1443 782 11974 --
NM_000346chr172585 309 --11665 1791
NM_000351chrX54055 1734 1428 241 150 42970 1500 1175 1064 --13622
NM_000408chr243363 2968 2432 581 --22195 65 --
NM_000461chr343150 3138 2903 1199 23758 807 --1706
NM_000555chrX97318 5972 5274 5104 3153 3071 1152 28 21 17696 1250 27716 2252
NM_000599chr2104096 3724 3537 2944 1586 1564 1503 1265 718 192 23689 264 23439 3111 22881 1778
NM_000609chr1072586 2548 2372 1048 949 583 91 12118 22526 2420 22408 1062
NM_000610chr1182932 2279 2249 942 805 639 361 57 12737 42089 2054 1954 1934 --
NM_000618chr1276570 5798 5476 5136 5129 2355 1980 16475 21458 1123 --
NM_000618chr1276570 5798 5476 5136 5129 2355 1980 16475 21458 1123 --
NM_000663chr16172680 2674 2655 2437 2325 2092 2053 1941 1096 1036 1030 911 873 813 483 287 96 22406 2001 1231 --
NM_000719chr12166541 6387 6257 6098 5651 5549 5231 5186 5163 4324 2444 2065 503 418 412 196 14994 34341 4306 482 16585
NM_000793chr1464830 3945 3540 3527 1356 763 1852 24453 894 --
NM_000813chr594460 2098 2092 1328 1001 857 644 564 288 2964 609 ----
NM_000831chr1226020 5451 5439 5202 4819 4754 4716 4460 4208 4038 3944 2025 1931 1440 1396 1328 1291 1229 664 332 302 103 31368 853 45 75970 5458 5425 2413 1206 1176 417 1783
NM_000875chr1596655 5218 5107 4752 2189 2133 2034 1380 644 15233 45075 4956 2228 1014 --
NM_000912chr893262 3004 2663 2209 1345 1090 464 390 123 32917 2906 2580 ----
NM_000959chr143604 2944 2486 1487 43443 1439 913 752 --1333
NM_001001389chr1182932 2279 2249 942 805 639 361 57 12737 42089 2054 1954 1934 --
NM_001001390chr1182932 2279 2249 942 805 639 361 57 12737 42089 2054 1954 1934 --
NM_001001391chr1182932 2279 2249 942 805 639 361 57 12737 42089 2054 1954 1934 --
NM_001001392chr1182978 2325 2295 988 851 685 407 103 12783 42135 2100 2000 1980 --
NM_001001938chr9103813 3278 3006 1502 1454 1158 1044 753 467 26 13390 1997 22811 249
NM_001002762chr1082791 2628 2291 2120 1848 1141 272 43 196 32765 882 174 1908
NM_001002860chr1474625 4320 3548 3112 3015 2994 544 11142 ----
NM_001004065chr9113705 3355 2793 2759 2531 1387 1348 1087 1013 461 376 ------
NM_001004317chr653184 2966 1209 948 523 33835 982 199 44193 2941 1339 1232 --
NM_001004441chr51636 146 --162
NM_001005473chr566259 6069 5815 1384 1264 702 36333 1704 1443 16475 --
NM_001005609chrX123411 2894 2690 2492 2481 2464 1369 1168 509 336 218 152 33163 680 115 23248 481 22837 351
NM_001005743chr145460 421 286 142 42 1964 --1192
NM_001005744chr145460 421 286 142 42 1964 --1192
NM_001005745chr145460 421 286 142 42 1964 --1192
NM_001007023chr1464830 3945 3540 3527 1356 763 1852 24453 894 --
NM_001007097chr9104774 4569 4261 4154 3710 3521 3479 1378 515 209 125 34912 3331 3137 --
NM_001008220chr5173584 3465 3380 2745 2545 2498 2479 2411 2390 1501 1203 1189 1177 913 579 178 133 13137 23175 2812 --
NM_001008222chrX81348 1318 1211 991 955 433 420 82 21280 896 1408 --
NM_001008701chr19102651 2585 2464 2446 2332 1109 1024 375 267 182 12723 42231 1130 470 41 1259
NM_001009554chr454339 995 581 553 255 1184 --14397
NM_001009554chr454339 995 581 553 255 1184 --14397
NM_001009899chr386316 5662 5475 5027 2319 2158 1512 1001 14465 24878 4031 --
NM_001010862chrX52531 2414 1108 1032 866 --13189 1841
NM_001010867chr1216598 6418 6386 6290 6186 5332 5018 4741 4718 4579 2383 2163 1857 1179 1163 1031 648 564 503 416 68 14052 --1226
NM_001010888chrX123570 3551 1648 1383 1189 772 715 595 503 373 327 217 54040 3158 2872 1306 178 14470 1359
NM_001010891chr586832 6343 6060 5742 5264 4453 4220 883 26381 6276 ----
NM_001010898chr1133675 3647 3377 3079 2998 2992 2981 2324 1395 1350 890 879 548 12590 11362 12683
NM_001012393chr1195008 4841 4178 3386 1912 1898 1486 640 70 23749 3403 ----
NM_001013693chr1122723 2560 2336 2226 2211 1956 1159 975 670 604 538 102 ----42514 2172 2059 528
NM_001013693chr1122723 2560 2336 2226 2211 1956 1159 975 670 604 538 102 ----42514 2172 2059 528
NM_001013839chr17122486 2453 2007 1789 1037 744 681 573 428 366 292 110 2418 380 31941 921 399 --
NM_001014797chr10137717 7700 7647 7045 6732 6614 6471 5402 5114 2761 1715 1423 1069 36007 5794 112 27172 5203 26901 6113
NM_001015045chr442402 976 714 303 3926 708 340 --160
NM_001017440chr7106096 5531 2748 2551 2403 2365 725 690 625 190 1766 47295 2681 2592 2228 36582 6154 295
NM_001017995chr5114279 4122 4083 4035 3186 3116 1597 1499 1240 740 22 22989 1075 21939 1693 23012 542
NM_001018050chr22163266 3132 3049 3040 2979 2855 2675 2626 2396 2386 2298 2262 2203 1352 1270 877 --23093 998 --
NM_001018052chr22163266 3132 3049 3040 2979 2855 2675 2626 2396 2386 2298 2262 2203 1352 1270 877 --23093 998 --
NM_001018065chr9156043 5928 5728 4680 4517 4405 4240 2085 2013 1330 1265 1157 848 768 626 21547 452 24482 1275 --
NM_001018066chr9156043 5928 5728 4680 4517 4405 4240 2085 2013 1330 1265 1157 848 768 626 21547 452 24482 1275 --
NM_001018111chr783735 2561 1150 1087 896 439 352 135 --1936 13353
NM_001024455chrX92359 2076 1871 1855 1082 648 573 192 103 21820 1046 52600 2372 2302 873 171 --
NM_001024463chr156925 892 814 791 283 92 --21108 1000 --
NM_001024647chr12117071 6924 6098 6032 5690 5674 5348 5033 2292 2135 1381 25481 927 26700 625 --
NM_001024858chr1492851 2733 2509 2371 2234 2003 1196 563 43 22880 1874 1219 32982 2796 463
NM_001025077chr1096445 2808 2473 1864 1738 1289 983 700 464 288 79 11787 15786
NM_001025108chr283941 3458 2906 2533 1213 285 271 22 --13187 --
NM_001031679chr1262738 2610 377 371 351 321 32510 1357 610 --13276
NM_001031680chr182440 2132 1622 587 354 184 125 108 --21816 372 1688
NM_001031695chr22155173 5135 4950 4507 4366 4310 4297 3983 3425 2169 1950 1678 1363 1224 1178 11994 34161 3343 915 15162
NM_001033117chr3144662 4541 4353 3799 3676 1851 1653 1583 1278 909 821 573 109 54 13755 41498 1247 801 755 1221
NM_001033507chr171956 1730 1216 660 603 255 81 --11761 191
NM_001034841chr1675351 4782 4666 4582 3944 3638 201 41297 656 341 306 1884 1668
NM_001034954chr1092480 1309 1066 1000 835 644 575 354 124 1131 ----
NM_001034955chr1092480 1309 1066 1000 835 644 575 354 124 1131 ----
NM_001034956chr1092480 1309 1066 1000 835 644 575 354 124 1131 ----
NM_001034957chr1092480 1309 1066 1000 835 644 575 354 124 1131 ----
NM_001035511chr121417 436 2874 823 1845 1675
NM_001035512chr121524 543 ----1782
NM_001035513chr121524 543 ----1782
NM_001039547chr396276 6092 5231 4945 2796 1821 1796 1097 70 27245 1391 25243 1087 27855 7703
NM_001039585chr133861 3201 2743 53700 1696 1170 1009 241 --1590
NM_001039844chr1052726 2666 2635 827 281 1395 12896 22457 2391
NM_001040108chr1473135 2873 2798 2361 680 438 61 1627 12638 11326
NM_001040424chr2192889 2156 2027 1946 1187 924 877 204 38 21150 462 ----
NM_001040665chr744554 4037 3257 1144 --21562 1116 14518
NM_001042355chr1695353 5141 4999 4524 3996 3778 3417 2039 475 24430 2006 11934 --
NM_001042371chr16141988 1982 1973 1840 1708 1482 1424 789 781 646 436 392 369 300 11880 --11930
NM_001042412chr1695353 5141 4999 4524 3996 3778 3417 2039 475 24430 2006 11934 --
NM_001042413chr943999 3594 2744 1636 33797 3546 376 12856 1952
NM_001042555chr1224445 3294 ----11505
NM_001042599chr256992 5088 2297 1678 130 55709 4772 2541 1882 1871 56756 5028 3127 2850 1262 23043 260
NM_001100108chr1108067 7432 7424 6609 6559 3135 2823 1344 857 545 11133 11008 17459
NM_001106chr3138353 8258 8168 7539 6968 6814 6727 6042 3562 3535 3357 1121 423 38469 1578 1032 ----
NM_001113490chrX21241 796 --33039 2468 408 23538 600
NM_001204chr267705 7137 6524 5004 2986 1627 15904 11673 --
NM_001259chr786389 6368 6158 6114 2432 2314 2039 1746 25055 37 11035 11694
NM_001271chr1572737 2128 957 707 631 356 333 --22263 2180 2882 752
NM_001331chr1152730 2397 2235 640 479 21821 831 12712 12001
NM_001346chr372404 1856 1787 1020 716 499 475 22693 791 --1447
NM_001364chr11104553 4027 3965 3520 1771 1703 1266 1045 315 170 1523 11255 --
NM_001399chrX123411 2894 2690 2492 2481 2464 1369 1168 509 336 218 152 33163 680 115 23248 481 22837 351
NM_001419chr19114627 4615 3983 3661 3295 1689 1496 1397 1284 846 712 23315 693 23238 1850 1631
NM_001527chr664399 4236 3695 3082 959 946 34696 4513 3215 ----
NM_001543chr5174712 4273 4027 3827 3116 2958 2950 1930 1349 1251 1152 971 897 760 493 226 94 34097 3091 1270 11138 --
NM_001546chr641312 548 410 96 2473 81 153 --
NM_001609chr1093893 3458 3085 3023 2905 585 535 449 313 43975 3748 2861 697 ----
NM_001650chr1853235 3133 3045 2631 747 23325 2621 11658 --
NM_001742chr721301 549 11489 --11465
NM_001918chr1118063 8004 7488 7084 6944 5757 3559 3325 2569 1852 221 49172 8204 7865 810 --17433
NM_001969chr1473711 3140 3026 2958 2870 2510 1153 ----1734
NM_002025chrX79001 6763 6390 6290 3453 2917 2348 13641 --22268 621
NM_002033chr1164077 2878 2779 2705 167 29 43988 3897 3202 1444 23458 3436 --
NM_002111chr4133779 3716 3305 3019 2746 2393 1479 1289 1267 920 794 190 44 --23330 994 11350
NM_002158chr21700 22804 589 --13037
NM_002203chr573666 3264 2927 1638 1157 270 47 1721 12722 1801
NM_002264chr344126 1698 1557 465 ----11489
NM_002285chr283941 3458 2906 2533 1213 285 271 22 --13187 --
NM_002309chr22162822 2637 2330 2233 2148 1946 1188 1182 978 939 889 824 748 510 374 90 41259 1017 635 558 1452 --
NM_002336chr1264731 4588 3488 3130 1190 413 192 --14505
NM_002387chr555141 3175 1847 1451 882 14316 1196 11329
NM_002481chr1157440 7114 6851 6734 6535 6365 5971 5909 5774 5718 5632 5235 2719 1397 1243 12516 23009 1360 12705
NM_002545chr1195008 4841 4178 3386 1912 1898 1486 640 70 23749 3403 ----
NM_002547chrX83966 3757 2946 2932 2809 2704 2587 362 32791 2664 34 ----
NM_002581chr995626 4499 4464 3545 1247 700 402 317 255 11685 31574 1173 106 15033
NM_002613chr16144503 4327 3760 2055 1847 1675 1378 1118 1108 1020 928 899 893 115 14719 54219 1799 1267 1051 470 --
NM_002667chr61850 ----11275
NM_002737chr17125910 5780 5210 4861 4544 2369 2133 2074 1977 1814 826 458 26569 5446 45755 4108 2562 372 15085
NM_002745chr2284236 3486 3472 2861 1404 998 904 510 23089 26 1376 1191
NM_002747chr1851803 597 483 411 335 21881 267 1403 149
NM_002855chr11143327 3245 3125 2958 2537 2352 1108 1085 669 467 331 157 147 100 13132 33615 941 585 --
NM_002857chr151900 1800 1654 407 353 --11703 12493
NM_002957chr9123863 3416 3135 2682 2453 1551 1529 1267 1178 1007 790 197 13631 13580 --
NM_002959chr1143583 3574 3381 3320 3259 3238 3186 1685 1650 900 584 475 456 372 1749 11058 --
NM_003001chr121524 543 ----1782
NM_003034chr12117435 7068 6995 6803 6538 6192 6152 4971 1661 654 32 11595 37444 4942 2638 --
NM_003043chr3133484 2928 2839 2747 2697 2680 2662 1577 1528 939 886 573 347 33125 2819 929 43694 3133 828 813 --
NM_003045chr1373754 3650 3247 1779 1493 502 22 --21758 745 21391 55
NM_003108chr2126936 5970 5374 4661 2642 2511 2165 1255 1199 774 706 400 77291 7159 6080 6065 5232 2183 492 --14631
NM_003155chr81672 --11057 2778 712
NM_003216chr2283299 2966 2633 2213 1166 1134 792 751 --13223 12438
NM_003236chr253210 2777 918 790 782 12433 32726 802 81 1202
NM_003281chr1164563 4002 3475 3438 2151 2131 1879 1848 1741 1627 1380 1169 1149 621 541 493 11998 65056 4811 4159 4145 4032 1003 15169
NM_003298chr384991 4551 1428 1391 1339 1050 403 305 25214 4217 34533 2486 1230 --
NM_003392chr353794 1530 1254 978 691 24041 3020 --12838
NM_003458chr3143539 3138 2817 2545 2466 1295 1230 1193 1187 1100 1043 620 245 71 12849 1269 --
NM_003559chr1783627 3385 3213 1083 881 706 697 23 22459 782 3678 322 30 --
NM_003583chr1243179 1536 537 373 --33917 3244 1226 --
NM_003590chr253775 2644 1226 863 210 23609 3536 --1705
NM_003607chr1163877 3718 3707 3589 3573 3051 2880 2758 1599 1337 1133 842 727 707 131 106 44397 3760 2921 1514 ----
NM_003632chr174769 552 318 75 1637 --2841 114
NM_003644chr17135887 5650 5289 4438 2353 2068 2019 1214 887 861 566 379 274 12265 36091 5434 4596 --
NM_003744chr145460 421 286 142 42 1964 --1192
NM_003759chr453492 3475 3121 2906 1365 33358 705 447 23778 2868 12633
NM_003901chr10102510 2500 2360 2229 2183 2140 1849 863 673 372 1342 --1201
NM_003966chr595517 1869 1754 1397 1174 680 223 129 86 14943 13081 --
NM_004028chr1853235 3133 3045 2631 747 23325 2621 11658 --
NM_004094chr1442415 905 878 341 1574 32746 2512 237 --
NM_004132chr108804 471 433 294 131 95 86 24 11095 ----
NM_004171chr1198763 8367 8361 7801 7508 6652 2874 805 334 39049 8580 8530 37528 6811 368 16164
NM_004200chr11103029 3021 3008 2764 2525 2267 706 587 465 23 52985 2490 1277 1264 616 2316 128 12974
NM_004350chr182440 2132 1622 587 354 184 125 108 --21816 372 1688
NM_004380chr1612271 ----21833 714
NM_004412chr10105731 4971 4893 4844 3960 2013 1242 783 304 51 35707 4854 4794 --15951
NM_004586chrX64591 4578 4554 4520 3886 3415 22095 760 1743 --
NM_004588chr11123925 2539 1551 1387 1329 986 758 574 555 477 376 111 --23032 297 12953
NM_004745chr8136230 5716 5478 5112 5096 5085 4611 4391 1949 1652 1410 746 163 1295 25914 5106 11258
NM_004762chr17111827 1793 1631 1405 1324 1292 701 670 663 312 223 11530 1124 --
NM_004798chr2083071 1419 1281 1036 1007 873 75 23 21118 1070 ----
NM_004822chr17113540 3263 2910 1610 1270 1177 967 418 293 287 39 --53329 3308 1405 917 827 --
NM_004834chr253060 3022 2790 452 35 12393 --12133
NM_004845chrX83819 3146 2529 1566 1413 241 201 116 11256 33965 3760 284 --
NM_004863chr14104922 4483 4320 4063 3692 3649 2103 1312 772 464 34873 1927 25 14995 13390
NM_004947chr391683 978 883 644 633 467 391 385 177 --42175 825 101 93 --
NM_004976chr11205038 5006 4907 4700 4614 4608 4602 4564 4515 4277 3836 3517 3417 1546 1141 774 650 433 274 162 34687 3500 3211 54976 4877 4428 1902 120 24572 1168
NM_004992chrX208214 7992 7801 7756 6850 6455 6340 6322 6039 3023 2805 2064 1709 1628 873 778 725 474 360 227 26562 512 48101 7216 6233 6095 11578
NM_004992chrX208214 7992 7801 7756 6850 6455 6340 6322 6039 3023 2805 2064 1709 1628 873 778 725 474 360 227 26562 512 48101 7216 6233 6095 11578
NM_004999chr634052 4043 1257 22744 1401 13009 14209
NM_005065chr1485242 4741 4407 3978 1805 1004 282 170 33701 1613 1048 --1817
NM_005109chr352410 2248 1732 1603 208 1171 2963 779 1461
NM_005116chr20114551 3937 3268 2878 1181 524 437 366 359 331 116 11054 33883 3850 3393 13680
NM_005156chr944360 3962 2033 1246 14810 --24354 691
NM_005188chr11157250 6225 6105 6043 5816 5602 5524 5292 5268 5237 5032 1866 1848 1604 243 58170 6862 5281 1990 447 26679 5228 17758
NM_005235chr256992 5088 2297 1678 130 55709 4772 2541 1882 1871 56756 5028 3127 2850 1262 23043 260
NM_005338chr7103919 3657 3033 2824 1566 822 715 481 305 97 21477 1243 21589 1110 13411
NM_005359chr1885953 5663 5585 5115 4940 4588 2262 212 46373 4139 1211 390 14717 16399
NM_005397chr783735 2561 1150 1087 896 439 352 135 --1936 13353
NM_005436chr1044049 4041 2683 312 23142 1362 --11314
NM_005475chr1253086 2377 2249 536 316 2818 293 11240 22939 97
NM_005477chr15102487 2405 2378 2127 1966 1928 1776 1663 488 218 2760 366 11618 1274
NM_005477chr15102487 2405 2378 2127 1966 1928 1776 1663 488 218 2760 366 11618 1274
NM_005497chr17105771 5444 5340 5190 4877 4742 2295 1802 647 106 --21399 833 11999
NM_005504chr1286491 5698 4541 4069 1846 1519 972 888 45298 5277 2225 1717 11327 1162
NM_005578chr385060 4494 3984 3612 3503 1044 957 66 34153 3836 3574 ----
NM_005596chr9116179 6016 5475 4544 4481 4314 4115 1260 1194 872 538 ------
NM_005730chr1282728 2555 2432 2412 1361 1090 974 190 1884 23343 2898 23329 2387
NM_005811chr126349 282 270 260 146 80 1289 ----
NM_005840chrX127314 6531 6419 6378 5679 5514 2985 1952 1867 1730 1067 24 11702 47643 6930 5962 2648 22678 448
NM_005935chr4104307 3533 1800 1230 1172 1126 1069 1027 662 198 24335 3453 1219 11835
NM_005937chr17154001 3973 3687 3493 3260 2631 1439 1356 1296 1241 1135 976 854 838 113 1235 3888 301 133 13471
NM_005941chr843952 3852 2663 1041 --23476 139 11652
NM_005955chr1145067 4957 4909 4107 3886 3427 2025 1726 1434 911 840 787 674 483 --23525 1694 --
NM_006011chr1554249 1272 1074 563 546 21495 430 1446 21439 977
NM_006076chr7122858 2773 2579 2432 2390 2190 1264 857 811 803 646 57 12647 11132 1875
NM_006283chr884650 4587 4347 4087 3346 1311 878 185 1100 11626 14065
NM_006371chr3125133 4781 3307 3255 1967 1417 1314 1156 1017 891 393 92 31538 1357 1119 11097 14501
NM_006420chr2032287 1361 882 3541 470 390 1989 12538
NM_006434chr1092480 1309 1066 1000 835 644 575 354 124 1131 ----
NM_006482chr1243179 1536 537 373 --33917 3244 1226 --
NM_006544chr1445208 2386 1525 1416 44623 4344 1815 45 --11609
NM_006546chr17126256 5306 5224 4964 4685 4538 4134 2355 2021 1989 1059 356 --24290 1975 --
NM_006599chr1668120 6508 6187 2523 987 656 1896 ----
NM_006621chr161936 1504 1312 822 533 428 21570 421 11291 --
NM_006650chr5173584 3465 3380 2745 2545 2498 2479 2411 2390 1501 1203 1189 1177 913 579 178 133 13137 23175 2812 --
NM_006654chr1224445 3294 ----11505
NM_006690chr20142272 2248 2177 2137 1858 1714 1565 746 599 282 275 191 93 59 21702 169 22164 1614 --
NM_007030chr5174679 4002 3971 3803 3733 3698 3663 3161 1553 1403 1392 1386 1348 776 530 47 41 11620 34253 1019 116 --
NM_007038chr2155156 4767 4320 2290 917 35735 5546 2424 12282 --
NM_007050chr20126714 6056 6043 5955 5854 5820 4991 3040 2486 2285 2211 27 36397 1889 738 97702 7405 6931 6013 5277 5214 2613 1328 35 25511 1764
NM_007114chr31263 12288 --2688 300
NM_007137chrX54996 4633 4160 3649 2089 11409 35247 2141 1957 13579
NM_007203chr9113705 3355 2793 2759 2531 1387 1348 1087 1013 461 376 ------
NM_007238chr20154795 4646 4253 4233 4037 4010 3722 3179 1806 1699 1123 1058 1052 359 115 1297 24805 4678 --
NM_007249chr13169206 9095 7761 7142 7058 6522 6039 3130 2289 1460 974 881 759 707 365 128 49181 7258 2281 1489 18808 18827
NM_007286chr551492 1469 1438 1426 655 1118 22052 100 21947 1877
NM_007347chr1562776 2411 2273 2123 920 709 ----12820
NM_012072chr2094468 3986 3681 3067 1478 1418 889 50 28 31602 1565 970 1767 --
NM_012104chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_012104chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_012137chr151799 1081 711 678 638 22881 2526 31824 739 429 --
NM_012164chr9116889 6612 5892 5434 2389 1878 1610 1393 756 156 149 17124 27413 6075 --
NM_012193chr11105041 4457 4425 4108 3802 3787 3555 1452 375 317 1844 33294 1768 887 --
NM_012249chr222257 442 12815 11101 12579
NM_012262chr125167 3947 54765 3773 3764 3579 1671 --13511
NM_012382chr584306 3734 3054 2894 1508 1494 1290 65 13487 --11585
NM_012398chr19142957 2852 2007 1924 1841 1803 1175 1154 837 460 268 181 87 25 12180 52767 1939 1900 1879 331 --
NM_013231chr1483555 3110 3062 2972 1515 843 758 728 23516 1651 13446 --
NM_013255chr767484 3118 2756 967 902 111 37295 5625 2315 --15602
NM_013286chr3113715 3516 3385 2696 2467 1414 1268 1143 885 775 337 33533 1492 314 31402 1039 844 12899
NM_013372chr1542186 1321 1014 95 1801 32100 1293 218 1198
NM_013374chr3137 1631 13036 1368
NM_013989chr1464830 3945 3540 3527 1356 763 1852 24453 894 --
NM_014048chr16124413 3897 3573 3399 1915 1727 1496 1175 881 495 472 73 13736 1463 14216
NM_014141chr765144 5027 4040 3259 1713 1174 14543 --21246 697
NM_014155chr1146130 1433 248 191 37489 5262 951 2590 229 16386
NM_014309chr22155163 5125 4940 4497 4356 4300 4287 3973 3415 2159 1940 1668 1353 1214 1168 11984 34151 3333 905 15152
NM_014381chr1473135 2873 2798 2361 680 438 61 1627 12638 11326
NM_014586chr21114388 4015 3953 3933 3861 1557 1069 987 482 405 208 33926 1116 532 21441 176 --
NM_014613chr531899 485 290 1478 21119 720 12741
NM_014634chr22133400 3265 2827 2806 2494 1407 1367 1258 620 591 550 462 132 12583 43105 2698 703 286 12468
NM_014659chr156925 892 814 791 283 92 --21108 1000 --
NM_014721chr6106623 6363 5382 5266 2599 2531 2353 1789 1513 29 1556 12565 34567 4517 930
NM_014730chr12134902 4742 4522 4147 3964 3665 1892 1389 1230 1117 1014 1006 159 2371 329 --24790 3573
NM_014730chr12134902 4742 4522 4147 3964 3665 1892 1389 1230 1117 1014 1006 159 2371 329 --24790 3573
NM_014732chr16125123 4493 4141 3805 3566 2346 1907 1824 1210 1084 708 112 34096 1815 797 44017 1504 1486 658 --
NM_014743chr472642 2340 2147 2130 1209 554 387 12920 --1922
NM_014767chr1083267 2947 1446 1391 1344 1294 1206 559 42917 2314 740 718 21230 767 1694
NM_014774chr1102743 2655 2223 1168 1049 982 652 615 396 334 1756 ----
NM_014826chr1163877 3718 3707 3589 3573 3051 2880 2758 1599 1337 1133 842 727 707 131 106 44397 3760 2921 1514 ----
NM_014828chr1442124 1660 270 150 1233 12016 2849 733
NM_014840chr1282378 2371 1173 905 885 758 266 250 12355 --11097
NM_014850chr3144662 4541 4353 3799 3676 1851 1653 1583 1278 909 821 573 109 54 13755 41498 1247 801 755 1221
NM_014860chr252446 2291 2181 583 351 21873 825 --1134
NM_014864chr164312 4294 3424 1299 666 184 146 --1806
NM_014873chr184139 4122 4085 3935 3794 1384 910 693 23974 3099 ----
NM_014877chr1796938 6341 6087 5432 5422 4819 4780 2894 1360 17014 14754 --
NM_014883chr442402 976 714 303 3926 708 340 --160
NM_014909chr14123734 3319 3304 3133 3104 2852 2844 2573 1332 1173 1156 194 21078 658 23422 1453 2686 501
NM_014921chr19102651 2585 2464 2446 2332 1109 1024 375 267 182 12723 42231 1130 470 41 1259
NM_014935chr1143286 3244 3127 2397 1455 1442 1084 776 725 528 418 307 255 141 11331 21386 650 32691 676 174
NM_014946chr221986 1223 1701 --12423
NM_014952chr1592046 1563 1452 537 523 516 189 167 97 --1686 --
NM_014982chr1474677 4528 4107 4087 4015 904 810 21276 874 15257 --
NM_014999chr1231673 417 148 11311 11433 1187
NM_015020chr1663876 2837 968 547 290 62 22892 727 --22787 1196
NM_015035chr20236090 5902 5852 5794 5616 5067 4760 4569 4342 4316 2694 2461 2232 1815 1489 1161 1138 1117 1079 990 965 277 153 34683 1941 498 24780 1571 11641
NM_015039chr184135 3909 3662 3492 3408 3173 3064 1020 33653 655 150 43502 3214 375 297 --
NM_015051chr973189 3115 2472 2358 2227 732 225 43092 2594 2259 829 11050 21094 1038
NM_015064chr1273658 3608 2934 1189 677 587 332 2693 247 22355 785 --
NM_015071chr5116455 5923 5858 5606 5517 5245 4745 4561 4442 3971 1575 22521 223 25337 4718 --
NM_015077chr17134673 4426 4393 3188 1878 1794 1788 1695 1472 1171 862 840 623 14078 64215 3589 3441 2861 1422 455 --
NM_015090chr1145830 5486 5145 4958 4768 4498 4151 3973 1776 1757 1600 1042 1014 684 56249 6119 4759 2150 1608 24015 927 24701 4251
NM_015094chr22134579 4242 4230 3816 3801 3538 2992 1578 1477 497 358 198 148 22918 456 11876 12858
NM_015113chr1782214 2148 2107 1958 1872 386 266 44 1834 1284 21663 578
NM_015178chr8182610 2551 2312 2242 2131 2041 1981 1905 1641 1005 665 618 527 322 293 206 98 92 22223 2208 52427 1780 359 163 123 12370
NM_015192chr2021130 940 11145 12180 2966 144
NM_015219chr17122486 2453 2007 1789 1037 744 681 573 428 366 292 110 2418 380 31941 921 399 --
NM_015247chr1695353 5141 4999 4524 3996 3778 3417 2039 475 24430 2006 11934 --
NM_015285chr1852377 2036 1815 193 93 --1257 22047 1772
NM_015288chr5113838 3398 3338 2700 1212 1025 570 553 493 391 143 43624 2760 1227 829 13146 --
NM_015299chr14123859 3213 3109 2976 2724 1609 1347 1288 1214 732 516 269 22573 129 2286 99 33457 1331 401
NM_015310chr8107530 7114 7103 6885 6452 6412 5673 2985 1410 464 47617 3247 1618 593 36075 5547 2312 11748
NM_015313chr1183407 3257 3220 1407 667 506 153 90 23037 105 ----
NM_015315chr573116 2373 2319 2301 1344 1100 165 33257 3194 2816 1682 --
NM_015326chr142460 1181 1163 600 22636 419 1257 22815 644
NM_015352chr20113099 2920 1325 1318 1243 959 547 344 327 176 44 22902 2810 2142 83 11525
NM_015385chr1092480 1309 1066 1000 835 644 575 354 124 1131 ----
NM_015535chr262570 1492 584 578 344 286 ----22798 1294
NM_015553chr694536 4277 4201 3922 3810 3342 1914 463 168 11470 --2699 320
NM_015568chr20123797 3689 3461 1424 1370 1316 1148 891 726 614 549 474 24032 123 23905 1012 --
NM_015602chr121636 77 21679 254 2409 65 --
NM_015686chrX52497 1878 704 386 193 1368 31970 1554 183 22057 333
NM_015695chr652013 1508 678 433 425 22078 57 2406 119 --
NM_015879chr18108482 8407 6396 5918 5335 2927 2432 2280 363 319 48145 7330 7195 5291 --185
NM_015981chr5112763 2295 2148 2066 1997 1976 1139 721 353 183 40 --22713 2028 22615 2530
NM_015995chr15164770 4088 3759 3742 3501 2025 1846 1693 1372 1125 1042 992 730 586 463 254 24856 1153 35014 4327 1636 --
NM_016032chrX81348 1318 1211 991 955 433 420 82 21280 896 1408 --
NM_016089chr391741 1707 1565 1410 548 500 272 141 80 3802 382 214 21992 1948 32037 466 46
NM_016206chr3108500 7569 7190 6831 6730 5731 5701 2671 2525 859 38521 1555 512 42821 1524 1330 910 11087
NM_016260chr285901 5145 4622 2604 2056 1175 481 379 13007 ----
NM_016275chr341765 1702 1073 566 ----1617
NM_016531chr443819 1312 816 353 11052 1401 12816
NM_016544chr253202 1290 1225 752 56 32663 985 389 --13637
NM_016605chr572419 2401 2072 1941 1737 372 221 2401 287 11698 21821 1812
NM_016621chr11114377 3966 3911 3784 3221 2808 1655 1573 1513 363 158 44439 1854 817 427 24417 125 --
NM_017456chr17111827 1793 1631 1405 1324 1292 701 670 663 312 223 11530 1124 --
NM_017637chr999039 8568 8364 6884 6428 5884 3564 1590 1221 48496 7126 3060 2277 28977 7530 --
NM_017644chr3115042 3958 3863 3847 3281 3203 1690 1384 1184 874 854 1384 14301 --
NM_017658chr1434167 3528 2835 --24216 3412 --
NM_017787chr1082610 2289 2213 480 473 303 95 44 --32654 2280 1908 11093
NM_017847chr11356 11740 --2849 36
NM_017994chr762555 2508 2236 1979 866 222 21128 402 --1287
NM_018036chr1484202 3999 3887 3812 3380 3278 3063 53 21786 75 ----
NM_018084chr232505 1224 528 1507 --11110
NM_018100chr6103398 3270 2946 2815 2643 2236 1351 1247 463 295 ----12142
NM_018167chr144343 330 68 62 ----1388
NM_018362chr1113353 --2889 169 145
NM_018373chr1445091 4533 4511 1045 12368 24828 4484 16334
NM_018440chr8148299 8270 7826 7604 6964 6747 6354 5916 3445 2101 1883 1598 870 171 ----11324
NM_018689chr15112359 2136 2050 1892 1825 1693 1061 961 869 839 154 12712 12161 --
NM_018847chr92550 335 ----1749
NM_018958chr1562766 2473 1251 1012 962 845 12813 23265 3008 12885
NM_018976chr12--1645 11054 21982 265
NM_019106chr2272783 2148 668 571 471 421 174 1560 --1949
NM_020182chr2052740 2253 752 726 709 23211 2939 32323 1105 1094 13010
NM_020338chr10163042 2781 2616 2551 2532 2510 2438 2314 1433 1154 1147 801 590 422 161 106 1655 12934 --
NM_020348chr1092258 2201 1940 1876 1854 784 777 531 42 --2805 703 12317
NM_020443chr186898 4677 4542 4358 4343 954 647 86 25253 751 1494 11231
NM_020451chr1102086 1943 1684 884 860 721 592 478 50 44 32497 1923 205 ----
NM_020452chr181584 1364 725 334 226 199 45 36 31859 1832 691 3703 434 375 --
NM_020456chr1361813 1677 873 643 604 329 32119 2052 1602 ----
NM_020673chr20126965 6933 6567 6149 5941 5889 5617 5219 2010 1867 1553 1377 32844 2531 717 --11849
NM_020686chr16172680 2674 2655 2437 2325 2092 2053 1941 1096 1036 1030 911 873 813 483 287 96 22406 2001 1231 --
NM_020766chrX84291 3710 3317 1675 1663 1278 250 110 ----11602
NM_020772chr1768284 3064 3027 2389 2047 1191 43214 2551 1251 101 16424 --
NM_020781chr752386 2207 1077 364 281 2815 327 32481 805 145 --
NM_020809chr1141788 598 270 258 2398 297 --1279
NM_020810chr1463489 2756 1461 959 721 606 32712 2433 269 --11322
NM_020814chr2101218 892 489 362 320 141 103 90 80 48 ----11267
NM_020850chr1692973 2798 2645 2265 1037 815 801 86 46 22964 758 32595 2458 1169 21289 782
NM_020890chr31416 ----1473
NM_020956chr19334717 4707 4537 4473 4448 4418 4091 4006 3965 3740 3720 3706 3545 3328 3293 3047 2972 1888 1864 1825 1787 1747 1708 1669 1630 1442 1361 1235 989 934 597 154 135 12884 111904 1880 1841 1811 1763 1733 1685 1655 1607 1592 1145 --
NM_021120chrX82420 2111 1933 1246 1240 884 865 287 43157 2462 2434 640 22189 788 22487 2001
NM_021629chr363630 3103 1929 1238 649 266 23960 3371 2917 642 --
NM_021638chr4123267 1539 1416 1276 1022 937 772 719 552 478 88 29 21480 391 1114 13906
NM_021647chr454339 995 581 553 255 1184 --14397
NM_021813chr654765 3610 1131 1123 274 --35352 1739 1281 11809
NM_021911chr594460 2098 2092 1328 1001 857 644 564 288 2964 609 ----
NM_021945chr6123194 2628 2529 1142 1135 1117 920 517 439 355 84 29 1591 21037 66 --
NM_021961chr1195062 4630 3005 2880 2754 2352 2330 1578 1495 17240 --11894
NM_021964chr335740 5229 2473 1405 --11136
NM_022048chr15146064 5476 5084 4513 4499 4397 2395 2191 2052 1852 1035 871 221 166 46011 5561 5091 4139 21315 1188 44486 1535 1138 890
NM_022114chr1114667 4090 3460 3038 3030 3011 2968 2904 1270 947 32 1869 13740 23294 79
NM_022166chr16135672 5381 4909 4373 4273 2359 2146 2065 2036 1778 1021 798 472 25192 1565 22246 55 --
NM_022456chr12117071 6924 6098 6032 5690 5674 5348 5033 2292 2135 1381 25481 927 26700 625 --
NM_022465chr12103034 2449 2420 2338 2230 2012 1924 1198 948 389 ----12031
NM_022497chr363726 3421 3062 3008 2966 685 33619 2816 2406 23052 579 179
NM_022719chr22103281 2882 2707 2554 1344 1305 1280 1244 1219 194 21121 69 11425 11467
NM_022748chr7102897 2652 2615 2569 2195 2143 2020 2013 1964 385 ----12186
NM_024076chr19112035 1880 1741 1602 621 576 499 456 422 102 50 52278 1488 592 558 321 ----
NM_024423chr1874081 3350 2625 1707 1554 1333 1319 --11173 11631
NM_024569chr172845 2171 1840 1005 543 206 44 32514 2248 2192 --11021
NM_024639chr672515 2111 1845 1151 935 854 91 42646 669 501 52 41933 214 155 116 1359
NM_024761chr9114289 4208 3913 3905 3836 3632 1878 1792 914 642 115 1703 13556 11801
NM_024770chr2136706 6699 6530 6310 6205 5088 4948 2396 2128 1607 992 530 420 16052 --35379 445 34
NM_024807chr6131784 1778 1456 1433 1336 755 536 391 287 231 215 48 37 1333 31390 476 146 --
NM_024811chr1141594 1229 439 207 41736 1478 703 290 21460 638 21796 137
NM_024881chr19113118 2598 2579 892 753 557 518 433 336 278 217 13365 --13842
NM_024900chr462157 2083 1485 288 282 44 11807 22303 392 --
NM_024900chr462157 2083 1485 288 282 44 11807 22303 392 --
NM_024949chr4114625 4342 4092 3758 3544 3316 3071 1190 898 746 719 --14200 --
NM_024963chr7115492 4242 3934 3835 3777 3755 2192 2163 1755 1447 1311 14442 55696 2067 1992 632 67 --
NM_024979chr1361429 1400 438 205 153 110 3230 216 136 1197 1349
NM_024991chr1092480 1309 1066 1000 835 644 575 354 124 1131 ----
NM_025074chr4112865 2355 2326 2307 1977 1110 1082 717 570 359 188 1653 22129 746 --
NM_025179chr1104676 4022 3308 3045 1969 1835 1613 653 524 98 24429 3159 13446 3689 516 232
NM_030579chr1663432 2812 2463 2331 865 179 1922 153 12278
NM_030648chr4145278 5126 4658 4602 4565 4425 4415 2081 1946 1759 1714 713 293 24 22069 321 24765 84 --
NM_030674chr1295816 5647 3802 3666 2038 1196 783 558 153 25171 983 21652 652 --
NM_030761chr162466 2398 2155 1737 583 182 1392 32535 2292 753 42234 2203 1674 46
NM_030806chr1208830 8562 8228 7726 7654 7615 7377 7149 6999 6969 6892 6873 6018 5715 5696 3519 2917 2738 1844 1791 57645 6785 3030 2975 556 47335 3367 3084 460 --
NM_030816chr121404 48 22470 653 --33002 2967 2394
NM_030918chr1125391 4935 4313 3689 3510 2162 2144 2011 1707 1592 801 107 25270 1388 14158 --
NM_031268chr16144503 4327 3760 2055 1847 1675 1378 1118 1108 1020 928 899 893 115 14719 54219 1799 1267 1051 470 --
NM_031453chr1041994 817 366 244 32177 1592 106 --1542
NM_031468chr7106096 5531 2748 2551 2403 2365 725 690 625 190 1766 47295 2681 2592 2228 36582 6154 295
NM_031469chr6113755 3691 3594 3519 1364 1287 1253 1139 1086 312 26 --12840 --
NM_031911chr452156 2139 2050 2021 1718 42788 1928 889 464 32739 1738 882 1725
NM_032105chr1167573 7247 6984 6867 6668 6498 6104 6042 5907 5851 5765 5368 2852 1530 1376 110 12649 33142 1493 79 12838
NM_032160chr1853052 1647 1408 1093 139 23240 3077 1352 --
NM_032174chr191459 1247 1143 1061 1005 985 378 186 82 1954 --1516
NM_032199chr1022647 1092 --1141 21035 508
NM_032552chr981660 1517 1391 748 674 506 465 408 21897 1352 31407 637 601 21725 1194
NM_032869chr841917 1879 1503 1309 2751 199 11375 1468
NM_032932chr17176361 6053 5828 5318 5253 5239 4377 3966 2557 2394 2092 1958 1888 1483 1086 521 249 44078 1947 926 625 26324 2139 25876 5092
NM_033133chr17133128 3106 2956 2719 2671 2502 1438 671 525 402 378 351 215 23082 448 32330 892 268 --
NM_033224chr786777 6434 6419 6141 5693 1278 341 116 37987 7296 2218 --22689 56
NM_033274chr5123463 3352 3216 2715 2668 2314 1247 1241 964 905 527 430 42618 1389 1167 53 1188 --
NM_033389chr1794143 3341 1891 1884 1591 1541 1413 574 480 24476 260 14277 --
NM_033430chr433693 2941 36 --12725 23378 1130
NM_033437chr433693 2941 36 --12725 23378 1130
NM_033505chr296344 5441 5267 5242 4713 4596 4298 2299 991 22703 1695 26393 2543 24566 4113
NM_033551chr573116 2373 2319 2301 1344 1100 165 33257 3194 2816 1682 --
NM_033656chr2165742 5358 4072 1733 734 723 35677 1582 97 ----
NM_052834chr1852377 2036 1815 193 93 --1257 22047 1772
NM_052906chr22225055 4568 4206 4137 4108 3922 3894 3487 3239 1981 1915 1566 1454 1406 1047 759 556 511 428 401 213 76 14022 64591 4462 1715 1214 278 37 1536
NM_052918chr1083217 2750 2656 2428 2349 2339 1393 818 13041 12570 --
NM_052934chr182038 1967 1828 901 757 691 419 113 --42203 894 542 176 --
NM_052978chr1461450 1271 456 445 283 111 ----1667
NM_078476chr661392 1266 438 165 119 77 2378 261 31288 1237 326 1269
NM_080669chr17164327 4103 4092 3938 3852 3613 3540 3412 3115 3097 1683 1344 1323 767 338 24 1240 54668 4141 4084 3288 345 1308
NM_130830chr3123742 3596 3564 3456 3157 2735 2511 1461 1315 1175 1038 905 43881 864 746 168 23579 2627 11077
NM_133170chr20126714 6056 6043 5955 5854 5820 4991 3040 2486 2285 2211 27 36397 1889 738 97702 7405 6931 6013 5277 5214 2613 1328 35 25511 1764
NM_133265chrX21241 796 --33039 2468 408 23538 600
NM_133474chr461542 1492 1394 1184 605 65 31129 650 534 --11046
NM_134325chr171573 1502 1363 511 436 292 226 2523 467 51738 659 614 429 77 --
NM_138286chr1963102 2748 1290 523 396 223 11665 ----
NM_138338chr22163266 3132 3049 3040 2979 2855 2675 2626 2396 2386 2298 2262 2203 1352 1270 877 --23093 998 --
NM_138348chr576604 6296 5411 4316 2444 1918 227 66245 5712 5513 2158 947 290 11353 --
NM_138468chr285824 5115 2449 2399 1779 1532 1166 522 1568 ----
NM_138713chr1668120 6508 6187 2523 987 656 1896 ----
NM_138714chr1668120 6508 6187 2523 987 656 1896 ----
NM_138959chr1126415 6353 5770 4937 4813 4709 4370 1941 926 838 380 50 21344 540 46241 5755 4511 71 --
NM_138971chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_138971chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_138972chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_138972chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_138973chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_138973chr1183619 3265 2420 1203 491 485 98 26 2619 413 1177 --
NM_139321chr2083646 3384 3194 2781 2717 1173 975 52 32742 1101 66 31501 517 240 --
NM_144578chr1454981 3774 1113 1010 907 55201 4023 3605 3587 134 ----
NM_144579chr282889 2825 2795 2678 2356 673 602 86 11033 12185 22457 595
NM_144590chr1042605 739 631 352 22336 2182 1802 12717
NM_144599chr15114901 4487 4480 3948 3719 1950 1549 582 361 167 161 11746 14500 --
NM_144775chr17124773 3812 3633 3286 1903 1892 1712 1567 1342 967 906 287 ------
NM_144973chr1244925 4873 4852 955 15035 12018 24333 1163
NM_145013chr1192368 2243 985 955 601 522 513 438 359 1146 --22035 247
NM_145259chr255103 4552 4334 1972 1033 25776 4707 ----
NM_145307chr1064393 4283 4167 3132 1598 58 44422 1821 1432 691 ----
NM_145686chr253060 3022 2790 452 35 12393 --12133
NM_145687chr253060 3022 2790 452 35 12393 --12133
NM_145799chrX72479 2133 2040 1958 1180 780 36 12681 21057 317 12329
NM_145912chr22144546 4430 4264 4146 4037 3371 3343 3333 3024 727 668 605 586 314 33228 1514 42 41720 1405 505 101 14014
NM_147150chr9113705 3355 2793 2759 2531 1387 1348 1087 1013 461 376 ------
NM_148957chr1362481 2307 1927 1896 764 395 32094 623 610 ----
NM_152253chr22114194 3867 3735 3592 3141 1519 1246 1047 892 425 304 11285 2987 626 22739 1028
NM_152263chr195742 5289 5135 4422 3903 1278 1224 1190 377 15950 16000 --
NM_152267chr2282181 2040 1655 538 460 329 299 146 1669 21858 614 1794
NM_152588chr125612 374 243 117 111 21403 1305 ----
NM_152629chr943999 3594 2744 1636 33797 3546 376 12856 1952
NM_152699chr363712 2865 2280 1022 852 536 13619 --13606
NM_152744chr7103568 2930 2924 2887 2565 1281 865 613 387 49 12615 33119 2953 2268 1433
NM_152765chr842036 1634 793 772 12098 22310 1671 12009
NM_152793chr744336 3659 3239 1402 44218 1106 402 332 34080 3258 3170 --
NM_152999chr744554 4037 3257 1144 --21562 1116 14518
NM_153456chr13125633 5293 5137 4897 4831 2220 2066 1667 1410 1250 917 343 14518 1611 25652 4932
NM_153487chr6174531 4481 3999 3750 3633 3606 3470 3411 3334 3018 1613 1074 613 514 238 165 97 41705 837 522 153 44353 4294 331 118 --
NM_153810chr1084877 4362 3279 1583 816 778 69 57 21535 1340 11368 --
NM_170665chr1284542 3666 3577 3433 3383 3230 3224 1588 31080 850 216 --14078
NM_170686chr752386 2207 1077 364 281 2815 327 32481 805 145 --
NM_170706chr184135 3909 3662 3492 3408 3173 3064 1020 33653 655 150 43502 3214 375 297 --
NM_171825chr5112763 2295 2148 2066 1997 1976 1139 721 353 183 40 --22713 2028 22615 2530
NM_172071chr176583 5790 5462 2827 2658 568 303 2492 107 1128 15527
NM_173065chr1113242 3094 2650 2287 1154 992 943 505 248 239 208 1108 22226 36 22756 653
NM_173214chr1668120 6508 6187 2523 987 656 1896 ----
NM_173468chr485494 5086 4610 2022 1822 1037 800 466 35769 5686 4809 ----
NM_173477chr1781823 1669 1480 1352 1335 745 664 605 11973 6738 729 497 425 296 185 --
NM_173531chr1953501 3016 1264 883 460 2828 665 2747 150 --
NM_173595chr12105084 4090 3899 3450 3409 1472 1237 525 224 196 --33968 1741 1191 34185 4109 3950
NM_173642chr1138729 8208 8189 7541 7137 7049 6808 6548 6476 3632 3050 2489 1209 29002 2572 59089 7183 6364 5860 2230 13071
NM_173689chr981621 1601 1479 1159 614 383 183 79 31172 599 176 21389 191 --
NM_173829chr564427 4341 4128 2049 1530 735 34603 4351 436 11136 25738 5429
NM_173832chr872742 2697 2625 2495 1016 353 196 101350 1325 1300 1275 1250 1225 1200 1175 1150 1125 62582 1094 701 310 303 241 --
NM_174934chr11163252 2939 2884 2677 2261 1355 1202 1166 1069 1021 802 641 618 206 143 30 13182 22692 190 --
NM_175058chr11121323 1167 1020 1012 955 480 323 189 172 49 31 25 1118 ----
NM_175623chr12117071 6924 6098 6032 5690 5674 5348 5033 2292 2135 1381 25481 927 26700 625 --
NM_175624chr12117166 7019 6193 6127 5785 5769 5443 5128 2387 2230 1476 25576 1022 26795 720 --
NM_175625chr12117166 7019 6193 6127 5785 5769 5443 5128 2387 2230 1476 25576 1022 26795 720 --
NM_176081chr10105731 4971 4893 4844 3960 2013 1242 783 304 51 35707 4854 4794 --15951
NM_176083chr10105731 4971 4893 4844 3960 2013 1242 783 304 51 35707 4854 4794 --15951
NM_176871chr883329 2954 2942 2739 2637 2333 1060 493 33246 2054 470 13064 23228 431
NM_177398chr171956 1730 1216 660 603 255 81 --11761 191
NM_177399chr171956 1730 1216 660 603 255 81 --11761 191
NM_177999chr993650 3568 3338 3175 3161 1207 908 865 150 --23497 758 22578 2305
NM_178037chr1273658 3608 2934 1189 677 587 332 2693 247 22355 785 --
NM_178038chr1273658 3608 2934 1189 677 587 332 2693 247 22355 785 --
NM_178151chrX97318 5972 5274 5104 3153 3071 1152 28 21 17696 1250 27716 2252
NM_178152chrX97318 5972 5274 5104 3153 3071 1152 28 21 17696 1250 27716 2252
NM_178153chrX97318 5972 5274 5104 3153 3071 1152 28 21 17696 1250 27716 2252
NM_178554chr373407 2998 1070 910 347 211 77 32230 1122 388 32270 921 55 1501
NM_181489chr3166703 6632 5069 5054 4840 2595 2459 2279 2268 2052 1157 1146 1053 904 854 736 34262 997 845 31085 957 725 24243 53
NM_181491chr9202977 2768 2731 2537 2201 2056 2012 1979 1252 1014 1004 933 765 719 480 425 366 178 140 122 1519 2620 434 --
NM_182487chr9154192 4111 4030 3874 2724 1471 1324 1161 998 926 833 457 294 255 108 33709 3316 3207 43661 1203 474 24 11349
NM_182503chr685343 4998 4842 4637 3988 1637 507 454 31849 1309 326 21800 346 14180
NM_182515chr19116679 6037 5835 5212 5074 5044 4758 2163 1454 56 24 11240 ----
NM_182799chr53293 87 53 --41488 1255 268 95 11189
NM_182801chr53293 87 53 --41488 1255 268 95 11189
NM_182935chr372334 1830 1028 682 529 322 253 11620 2620 600 --
NM_182970chr20164067 4042 3952 3664 3572 2860 2854 2616 1644 972 647 507 499 486 359 74 --53873 3686 3211 819 457 1265
NM_183004chr1473711 3140 3026 2958 2870 2510 1153 ----1734
NM_183397chr20155019 4870 4477 4457 4261 4234 3946 3403 2030 1923 1347 1282 1276 583 339 1521 25029 4902 --
NM_194286chr1273969 3948 2166 1957 1420 1283 1149 25712 4222 22491 1658 11571
NM_198147chr1751194 1019 964 353 91 --21179 828 1991
NM_198392chr651960 858 796 434 361 32244 1778 569 22103 404 11853
NM_198490chr3123483 3305 3283 3175 3130 2258 1285 1125 1099 850 445 76 12820 22863 380 1489
NM_198560chr3113088 2874 2832 2804 2733 2521 1340 1162 1012 653 439 53612 3035 2599 2334 1523 32749 934 317 --
NM_198595chr4123267 1539 1416 1276 1022 937 772 719 552 478 88 29 21480 391 1114 13906
NM_198859chr364999 4718 4340 3919 3770 1323 44606 1250 1223 805 25076 1283 11978
NM_199005chr93930 849 91 2669 52 3214 155 116 1359
NM_199169chr2052740 2253 752 726 709 23211 2939 32323 1105 1094 13010
NM_199170chr2052740 2253 752 726 709 23211 2939 32323 1105 1094 13010
NM_199171chr2052740 2253 752 726 709 23211 2939 32323 1105 1094 13010
NM_199262chr17132277 1518 1505 951 697 504 441 354 348 322 143 137 116 --21923 1652 --
NM_199355chr162610 34 11754 157 21542 1495
NM_199436chr221986 1223 1701 --12423
NM_199454chr1114667 4090 3460 3038 3030 3011 2968 2904 1270 947 32 1869 13740 23294 79
NM_201432chr17135887 5650 5289 4438 2353 2068 2019 1214 887 861 566 379 274 12265 36091 5434 4596 --
NM_201433chr17135887 5650 5289 4438 2353 2068 2019 1214 887 861 566 379 274 12265 36091 5434 4596 --
NM_203327chr20114551 3937 3268 2878 1181 524 437 366 359 331 116 11054 33883 3850 3393 13680
NM_206909chr8107530 7114 7103 6885 6452 6412 5673 2985 1410 464 47617 3247 1618 593 36075 5547 2312 11748
NM_206926chr1102086 1943 1684 884 860 721 592 478 50 44 32497 1923 205 ----
NM_207303chr1054059 3685 2824 701 108 21042 426 13756 --
NM_207306chr1164337 4324 4266 3911 3766 3628 2929 1138 1066 958 886 746 674 602 530 494 24560 4304 24279 378 --
NM_207406chr486465 6017 5675 5306 4795 1203 553 325 ----1547
NM_207577chr1151989 1779 1162 996 965 1428 22225 2111 11870