TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3194-3p
miRNA Sequence: AGCUCUGCUGCUCACUGGCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51949 ------
NM_000067chr8--1625 ----
NM_000074chrX2919 747 ------
NM_000084chrX96568 6441 5552 4864 4286 2642 1561 1391 715 16483 11243 --
NM_000090chr2------1326
NM_000092chr274272 4248 3237 3192 1078 454 144 ------
NM_000112chr544364 2028 1819 187 12153 21486 170 --
NM_000114chr2061177 875 866 797 445 321 1904 ----
NM_000125chr643891 2879 983 342 11549 14074 1560
NM_000127chr81332 --190 --
NM_000141chr1041187 564 81 62 1361 ----
NM_000189chr222117 112 --1158 --
NM_000194chrX----1100 --
NM_000202chrX53695 3644 3619 2607 67 ------
NM_000208chr1951672 991 691 187 30 ----13793
NM_000214chr20132 11376 ----
NM_000221chr23716 639 217 2356 198 1189 --
NM_000259chr1575654 5085 4897 4561 4288 3941 1256 ------
NM_000266chrX143 ------
NM_000271chr181524 ------
NM_000280chr112631 110 ------
NM_000314chr10----13001 --
NM_000315chr11125 ------
NM_000330chrX91910 1785 687 527 482 270 203 90 46 ------
NM_000332chr6106647 5249 4958 4661 2339 1441 554 375 367 236 56338 5794 2447 546 489 24521 1433 --
NM_000351chrX94239 4229 4056 2968 1735 1498 1429 242 151 ------
NM_000362chr2253389 2849 2275 952 716 --11359 --
NM_000369chr1431865 1510 336 ------
NM_000379chr2----121 --
NM_000393chr21397 11784 ----
NM_000406chr442641 1049 463 155 1457 ----
NM_000408chr232431 2175 1217 23154 583 ----
NM_000421chr17153 ------
NM_000430chr1733314 2605 613 12937 ----
NM_000439chr521785 307 ----11800
NM_000448chr1152777 2551 853 676 265 ------
NM_000449chr1155 ------
NM_000461chr354314 3151 3139 2918 2902 24231 418 1402 --
NM_000493chr62694 340 ------
NM_000522chr711071 ------
NM_000525chr1191180 1123 602 556 535 469 282 255 70 --1636 --
NM_000555chrX86448 5103 3154 2466 1151 350 85 22 130 ----
NM_000599chr283588 3522 3055 3005 1565 1502 1264 396 --31771 1164 628 23330 1472
NM_000609chr1062790 2585 2116 950 299 280 2585 93 41022 589 549 97 --
NM_000615chr1111118 22092 61 22737 2719 --
NM_000617chr1241584 1407 758 39 ------
NM_000618chr1256473 5946 5799 5780 1398 24640 829 ----
NM_000618chr1256473 5946 5799 5780 1398 24640 829 ----
NM_000675chr222631 561 3695 684 321 2762 268 --
NM_000689chr9------1391
NM_000719chr12116258 5713 5187 4817 4325 2445 2283 2064 419 413 195 15252 2512 142 --
NM_000721chr162077 2070 1859 956 948 881 2532 482 --12455
NM_000767chr192402 243 ------
NM_000782chr201213 ----1805
NM_000793chr1453946 3825 762 742 85 --24840 4445 --
NM_000807chr42679 468 ------
NM_000813chr534461 1002 856 43917 2094 1027 744 --24182 749
NM_000816chr5--1240 ----
NM_000817chr2--1212 ----
NM_000827chr53829 713 298 12366 ----
NM_000831chr1156021 5683 5452 4820 4755 4461 1529 1366 1228 851 606 331 303 104 43 35204 2027 1330 35565 4782 594 15554
NM_000832chr95781 318 303 245 186 --4252 233 225 206 --
NM_000861chr341879 914 473 189 ------
NM_000875chr1576656 5251 4441 2751 2134 2049 2035 1277 35259 1911 1896 --
NM_000880chr8181 ------
NM_000910chr431957 254 44 --1160 --
NM_000933chr2011398 1587 1233 --
NM_000949chr5--162 ----
NM_000965chr311105 --11089 --
NM_001001132chr2151353 1326 1221 562 220 ----1160
NM_001001323chr122804 92 12690 1584 --
NM_001001342chr1021444 25 11089 ----
NM_001001395chr1232723 1970 182 21106 561 ----
NM_001001396chr143727 1464 717 265 11374 13175 --
NM_001001419chr544261 3566 1559 1508 34497 4072 3283 14524 1221
NM_001001420chr544261 3566 1559 1508 34497 4072 3283 14524 1221
NM_001001433chr2042335 2284 459 86 1589 --12688
NM_001001664chr223853 3456 ------
NM_001001790chr91367 ------
NM_001001791chr1081653 1487 1243 587 394 236 196 102 1186 1123 --
NM_001001928chr2288315 8102 5127 2998 2204 1383 1013 113 67889 7465 5759 5616 3082 2940 ----
NM_001001938chr973516 3388 3277 1455 1157 754 27 13008 12983 --
NM_001002233chr81686 12039 --11640
NM_001002296chr81115 188 165 --
NM_001002762chr1082792 2629 2119 1998 1849 607 94 44 22293 2195 1301 --
NM_001003406chr22123268 3122 2970 2954 2825 2481 2466 2291 1145 887 352 148 42424 2280 662 408 33088 2791 109 1119
NM_001003407chr1034991 4683 3560 41427 1193 557 228 ----
NM_001003408chr1034991 4683 3560 41427 1193 557 228 ----
NM_001003688chr41421 ------
NM_001003694chr31513 ------
NM_001003712chr121131 1859 ----
NM_001003760chr612575 1214 151 --
NM_001003794chr3113078 2791 2778 2534 2430 1111 887 833 604 58 47 32081 1235 495 --11986
NM_001003800chr952774 1004 965 668 256 --2811 734 13637
NM_001003810chr41793 ----1272
NM_001003940chr1563792 3568 3184 2845 1450 754 12360 1481 12432
NM_001003942chr1563792 3568 3184 2845 1450 754 12360 1481 12432
NM_001003943chr1563796 3572 3188 2849 1454 758 12364 1485 12436
NM_001004065chr983356 2794 2786 2530 1388 1349 1086 910 12761 ----
NM_001004127chr131238 --1890 1678
NM_001004360chr2--1504 ----
NM_001004419chr1243009 903 770 418 14076 21521 954 --
NM_001004441chr521382 637 ------
NM_001005473chr546331 6068 2208 1383 21533 1229 26433 4124 --
NM_001005609chrX63410 3172 2978 1368 508 113 1338 33305 2350 1121 11293
NM_001006115chr37881 768 607 518 426 284 48 22026 509 32030 386 346 --
NM_001006600chr5--21702 1516 1370 --
NM_001006636chr24692 143 104 60 ------
NM_001006932chr6102233 1292 1192 1069 1046 833 289 106 87 69 --1444 --
NM_001007023chr1453946 3825 762 742 85 --24840 4445 --
NM_001007075chr41745 ------
NM_001007094chr1043612 3387 3302 628 ----14291
NM_001007102chr61572 ----1319
NM_001007156chr1571756 1648 1427 726 514 264 187 11618 ----
NM_001007559chr1811800 ------
NM_001007565chr3----1362 1109
NM_001008222chrX21212 954 11320 11204 --
NM_001008239chr1853759 2490 2467 2332 1104 22842 2746 ----
NM_001008392chr31630 1360 12256 1882
NM_001008405chr741744 1617 448 232 --11281 --
NM_001008541chr10----1189 129
NM_001008541chr10----1189 129
NM_001008564chr1322237 1468 ----1433
NM_001008701chr1932652 2586 374 21111 1026 32599 727 59 21031 554
NM_001008800chr1164 --141 --
NM_001008883chr1164 --141 --
NM_001009185chr51522 ------
NM_001009812chr2173 ------
NM_001009899chr345476 5186 2157 1511 26318 2321 ----
NM_001009993chr294205 3810 3623 2979 2973 1536 1396 1359 27 21689 473 23696 1155 13723
NM_001010861chr1--22235 1884 ----
NM_001010862chrX52532 2415 1107 1033 867 ------
NM_001010867chr1166612 6417 5902 5615 5331 5163 5019 4742 4578 2384 2377 2162 1858 1178 1019 649 36388 6142 844 64735 1313 1110 1103 706 684 1702
NM_001010888chrX53339 1304 716 594 374 23572 1191 ----
NM_001010898chr1143648 3324 3202 2980 2498 2490 2325 1394 1351 1321 1224 556 549 526 33379 2994 892 ----
NM_001010922chr11667 21299 342 21354 186 --
NM_001010986chrX11751 --1998 --
NM_001011513chr41789 23018 1400 --12919
NM_001011515chr42980 342 ------
NM_001011516chr42980 342 ------
NM_001011537chr311912 ------
NM_001011666chr711354 --14367 --
NM_001011708chr212413 12547 12551 --
NM_001011722chr11168 ----1129
NM_001011722chr11168 ----1129
NM_001012393chr11104842 4601 4179 3747 3401 3227 1897 639 201 69 ----13440
NM_001012398chr163684 153 73 1315 ----
NM_001012420chr1522773 914 1887 ----
NM_001012423chr1522773 914 1887 ----
NM_001012426chr6103370 3285 2949 2726 2515 2475 389 333 222 174 --31228 302 23 --
NM_001012427chr6103370 3285 2949 2726 2515 2475 389 333 222 174 --31228 302 23 --
NM_001012751chr10------11342
NM_001012754chr1321966 449 ------
NM_001012756chr1932651 2517 1240 13179 ----
NM_001012979chrX1174 ------
NM_001013839chr1752485 2125 892 682 429 11867 31929 1888 410 32265 1783 336
NM_001014283chr1331718 1696 485 --3674 419 290 1319
NM_001014797chr10137718 7701 7646 7046 6567 6190 6142 5792 5403 5113 2762 1424 1070 36616 2564 1717 27988 1814 --
NM_001015045chr44977 706 538 302 1434 ----
NM_001015508chr81277 ------
NM_001017368chr1742815 1783 106 79 11051 ----
NM_001017415chr11195 ------
NM_001017416chr11195 ------
NM_001017440chr786417 6095 2749 2402 916 724 691 189 25002 2298 1643 --
NM_001017926chr81330 11804 ----
NM_001017961chr1185 ------
NM_001018037chr9--11211 ----
NM_001018065chr9106044 5929 4516 4239 4161 2093 1266 1156 849 767 35730 628 584 15522 22403 723
NM_001018066chr9106044 5929 4516 4239 4161 2093 1266 1156 849 767 35730 628 584 15522 22403 723
NM_001018091chr1552862 2796 2750 1908 28 ------
NM_001018108chr1532309 841 461 11942 21801 876 --
NM_001018111chr773734 895 454 369 353 136 37 2839 441 1497 --
NM_001020658chr141533 1377 590 90 ------
NM_001020658chr141533 1377 590 90 ------
NM_001023567chr1542165 922 540 104 1890 ----
NM_001024455chrX72570 2360 1856 1044 727 572 193 22379 2078 ----
NM_001024463chr1551030 924 891 284 93 1793 ----
NM_001024660chr31505 21161 639 ----
NM_001024858chr1482878 2372 2002 1197 1191 834 42 27 22511 2236 2730 601 --
NM_001024947chr51801 ------
NM_001025072chr322363 2204 --12604 --
NM_001025073chr322363 2204 --12604 --
NM_001025079chr322982 2687 24165 847 14169 --
NM_001025108chr253942 2905 2534 1214 23 --1909 1148
NM_001025595chr4----173 1474
NM_001025603chr1155 ------
NM_001025780chr911095 ------
NM_001029859chr1172465 2117 2084 1677 593 547 91 11552 1621 --
NM_001029875chr512340 ------
NM_001029891chrX2361 263 1215 ----
NM_001029896chrX----2132 48 --
NM_001030001chr141377 ------
NM_001031679chr1282579 1355 1113 1065 608 378 370 320 11419 1888 1394
NM_001031695chr22105174 4949 4365 4296 3996 2168 1362 1225 1177 76 13985 11821 --
NM_001031732chr432276 1211 972 13158 ----
NM_001031740chr151676 1220 1120 563 509 1594 11626 1310
NM_001031812chr51444 ------
NM_001032289chrX4862 128 90 28 ------
NM_001032296chr1362948 2538 2407 2010 1982 634 11057 12901 12184
NM_001033045chr244106 3321 562 160 21480 614 13271 --
NM_001033047chr421628 611 --22374 1038 --
NM_001033087chr2041226 994 963 631 23283 621 2729 625 --
NM_001033117chr384663 4542 3604 1852 1654 908 572 108 --24253 139 --
NM_001033507chr131784 750 661 11218 --1599
NM_001033518chr772783 2165 2047 992 915 109 34 --22725 2108 --
NM_001033519chr772783 2165 2047 992 915 109 34 --22725 2108 --
NM_001033520chr772783 2165 2047 992 915 109 34 --22725 2108 --
NM_001033551chr1752909 2537 1472 686 467 14030 23989 275 33326 2972 1157
NM_001033557chr23549 429 323 ------
NM_001033566chr171636 --1102 --
NM_001033568chr171636 --1102 --
NM_001033602chr1342132 1651 228 84 11703 --1898
NM_001033723chr852450 2108 989 891 28 11032 1610 --
NM_001033925chr1031547 1378 476 --11402 --
NM_001034841chr1674665 4581 4394 4199 3639 1295 339 14784 ----
NM_001034845chr41520 ------
NM_001035003chr411314 ------
NM_001035004chr411314 ------
NM_001035254chr962429 1975 1678 1037 904 367 11597 1451 --
NM_001037131chr21481 ------
NM_001037317chr1--22235 1884 ----
NM_001037324chr31710 1690 1203 --
NM_001037334chr1842436 1715 273 71 12004 --11606
NM_001037582chr43387 226 99 11566 ----
NM_001037954chr1141078 990 741 413 12930 ----
NM_001038633chr13890 374 318 ----11141
NM_001038640chr152989 180 1957 ----
NM_001038702chr52950 154 --12446 --
NM_001039348chr22971 339 ------
NM_001039349chr22971 339 ------
NM_001039465chr14--1508 ----
NM_001039538chr233588 2766 916 1558 ----
NM_001039547chr367639 4944 2795 2316 1795 896 14873 17589 --
NM_001039590chrX53158 1199 999 746 442 ------
NM_001039591chrX53158 1199 999 746 442 ------
NM_001039614chr15139 ------
NM_001039618chr1135763 5426 1461 ----14351
NM_001040110chr72544 63 ----11827
NM_001040152chr744827 4808 3494 526 11363 ----
NM_001040157chr442590 2565 1811 256 ------
NM_001040159chr421173 529 ------
NM_001040214chr61762 1863 ----
NM_001040284chr1635695 2096 65 --1322 --
NM_001040402chr41120 12430 12362 --
NM_001040424chr2182026 1947 1186 876 460 407 205 37 ----1131
NM_001040429chr1323273 427 23576 1239 ----
NM_001040441chr175272 5221 4717 3924 1844 654 22 ------
NM_001040619chr131555 628 567 1646 2447 34 --
NM_001040624chr862612 2584 2202 2185 1012 188 --130 11041
NM_001040625chr862612 2584 2202 2185 1012 188 --130 11041
NM_001040626chr862612 2584 2202 2185 1012 188 --130 11041
NM_001040627chr862612 2584 2202 2185 1012 188 --130 11041
NM_001040628chr862612 2584 2202 2185 1012 188 --130 11041
NM_001040629chr862612 2584 2202 2185 1012 188 --130 11041
NM_001040630chr862612 2584 2202 2185 1012 188 --130 11041
NM_001040653chr362314 2241 2191 1856 1043 920 --1855 --
NM_001040665chr741954 1814 1441 1145 1691 11082 --
NM_001040715chr1641126 975 873 257 ------
NM_001042357chr102472 297 ------
NM_001042358chr102472 297 ------
NM_001042360chr102472 297 ------
NM_001042363chr102472 297 ------
NM_001042371chr1691974 1841 780 647 497 437 391 301 262 51984 1710 1426 791 731 31995 1307 468 11496
NM_001042388chr18------1303
NM_001042389chr102472 297 ------
NM_001042390chr102472 297 ------
NM_001042392chr102472 297 ------
NM_001042395chr102472 297 ------
NM_001042413chr954000 3544 1637 1196 256 --33062 160 120 --
NM_001042437chr21817 ------
NM_001042473chr1011396 ------
NM_001042498chrX4999 265 227 165 ------
NM_001042555chr1234552 4446 1522 ----1163
NM_001042599chr266991 5213 4770 2521 2489 1869 16678 --12419
NM_001042632chr205752 711 281 264 155 --11997 --
NM_001042633chr205752 711 281 264 155 --11997 --
NM_001042683chr621537 1171 ----161
NM_001043318chr1483210 2795 2628 1226 1193 567 294 49 13813 --1346
NM_001043351chr142258 1584 1577 472 21766 1717 ----
NM_001044385chr263452 3192 2939 2577 1624 1369 ----1707
NM_001044722chr51444 ------
NM_001044723chr51444 ------
NM_001092chr1762298 2185 2128 1644 1609 720 --21977 1587 --
NM_001099678chr374948 4781 4513 3974 3916 382 67 45654 5000 942 739 ----
NM_001100108chr186610 6310 6259 5882 2822 1131 546 476 1859 25625 329 16851
NM_001106chr3129338 8467 6813 6728 6043 3561 3356 3332 3167 2257 1122 673 28170 701 --28515 6707
NM_001116chr1632257 759 261 ----12725
NM_001117chr18--11642 22183 914 --
NM_001122679chr51949 ------
NM_001148chr421650 882 1754 ----
NM_001167chrX136233 6224 6185 5661 5389 5352 4693 4677 4483 4400 4231 2036 1685 16628 14801 1998
NM_001174chrX5597 500 467 209 106 2629 218 3696 545 481 --
NM_001186chr2122121 478 --1508 --
NM_001191chr2011087 ------
NM_001203chr4------166
NM_001204chr266333 5089 5035 5003 974 258 44773 2988 1629 566 ----
NM_001206chr92926 813 --1690 --
NM_001220chr7131 ------
NM_001222chr1021290 437 --1586 --
NM_001241chr232066 974 682 ------
NM_001241chr232066 974 682 ------
NM_001256chr171357 22766 417 1996 --
NM_001259chr776369 5614 2431 1747 1565 82 35 12041 ----
NM_001265chr134858 739 697 367 ----127
NM_001271chr1572738 2218 2127 956 708 630 334 --12762 --
NM_001273chr121403 ------
NM_001289chrX41388 1342 1113 337 ------
NM_001310chr1252142 2129 2083 1221 279 22577 2465 ----
NM_001326chr111401 ------
NM_001346chr352691 1786 789 717 208 21022 501 31936 1870 517 --
NM_001351chr3------11232
NM_001364chr1173521 1805 1772 1763 1702 1267 316 21377 1229 1333 --
NM_001394chr8129 2578 210 ----
NM_001397chr182528 2490 2456 2184 2117 787 660 641 31662 553 74 ----
NM_001399chrX63410 3172 2978 1368 508 113 1338 33305 2350 1121 11293
NM_001402chr611859 ------
NM_001419chr1944616 3813 3660 713 21691 848 11434 --
NM_001420chr1972984 2898 2837 1199 316 182 43 --22637 758 12542
NM_001429chr221696 ------
NM_001438chr122693 2473 ----13663
NM_001440chr8102684 2623 2552 2474 2205 2111 512 199 109 36 1224 1268 11045
NM_001447chr551323 1160 987 509 196 1242 1336 --
NM_001448chrX----21729 1326 --
NM_001482chr15--1863 ----
NM_001489chr91195 ------
NM_001500chr6----149 --
NM_001527chr674694 4235 3696 3081 1888 960 947 ----14839
NM_001543chr5164711 4272 4095 3916 3826 3137 3115 3089 2959 2951 1350 1268 1151 1132 972 225 43981 3841 179 96 54073 1756 643 360 77 --
NM_001546chr621311 471 2970 412 ----
NM_001604chr112631 110 ------
NM_001609chr1043746 3086 1252 448 23025 587 ----
NM_001616chr212387 11188 12420 --
NM_001650chr1844022 3046 746 740 13237 ----
NM_001656chr52768 537 ------
NM_001679chr3--126 ----
NM_001682chr121518 12404 1298 --
NM_001690chr322310 1858 11021 ----
NM_001695chr843203 2936 788 237 14033 ----
NM_001701chr9--1390 ----
NM_001709chr1142190 1989 1822 613 1809 11146 --
NM_001755chr1621877 606 1787 ----
NM_001759chr1254140 4106 3988 1762 1561 14429 12121 1298
NM_001777chr322982 2687 24165 847 14169 --
NM_001826chr1----1168 --
NM_001839chr12688 590 ------
NM_001859chr963776 3483 3269 724 508 283 --2937 897 --
NM_001873chr41662 ------
NM_001895chr202946 33 --11089 --
NM_001904chr31356 ------
NM_001918chr1118696 8064 8003 7863 7083 5794 2618 2568 2056 1851 222 1560 27688 5852 37544 6049 1887
NM_001933chr1451232 1224 882 873 395 1433 --1134
NM_001938chr11646 --11824 --
NM_001939chrX53564 1339 1294 312 143 --43578 3315 2936 329 --
NM_001945chr551172 1157 883 169 75 1190 ----
NM_001949chr632634 916 673 1942 --12966
NM_001950chr163671 660 89 ----1188
NM_001963chr4------176
NM_001968chr4----188 --
NM_001969chr1453710 3306 3141 1264 1154 12960 11275 --
NM_001987chr1294279 3389 3119 1732 1236 691 486 210 127 180 ----
NM_002009chr1521931 36 ----12762
NM_002015chr1322633 2231 ------
NM_002032chr111370 ------
NM_002040chr21--150 1488 --
NM_002052chr851363 1162 1018 930 361 --11285 --
NM_002079chr102437 199 ------
NM_002086chr1751965 1723 1469 890 572 --22018 468 --
NM_002095chr8126 1322 ----
NM_002103chr194803 795 351 60 1389 ----
NM_002112chr15122 ------
NM_002114chr6----1381 --
NM_002126chr1733629 881 697 32809 1430 750 ----
NM_002129chr41148 ------
NM_002137chr741949 1785 466 168 1159 --1905
NM_002138chr41793 ----1272
NM_002140chr9--1430 1273 --
NM_002156chr21409 ------
NM_002193chr261747 674 501 478 439 189 1171 ----
NM_002202chr51291 ------
NM_002203chr543122 2841 1639 271 12929 ----
NM_002214chr745651 3498 1422 1344 ------
NM_002222chr3----11212 --
NM_002223chr1293954 3709 3626 3532 3387 2847 1357 309 277 21585 539 --11223
NM_002234chr121291 ----2641 84
NM_002247chr101654 ----1338
NM_002264chr324127 1699 31559 719 467 ----
NM_002268chr311883 ------
NM_002285chr253942 2905 2534 1214 23 --1909 1148
NM_002290chr61991 143 ----
NM_002293chr142108 918 149 61 11833 --1336
NM_002309chr2292547 2331 2232 1189 1183 823 798 773 633 52824 1948 980 891 92 41928 1199 368 186 --
NM_002313chr1034991 4683 3560 41427 1193 557 228 ----
NM_002336chr1244730 3410 1815 1606 1415 --14439
NM_002359chr17104144 3553 3373 3246 3121 1584 1344 993 284 261 --43968 3583 2808 1724 24164 800
NM_002360chr7112404 2220 2201 1994 1651 1617 961 732 582 191 162 21949 1750 21953 672 --
NM_002374chr233588 2766 916 1558 ----
NM_002382chr141966 --175 --
NM_002387chr584314 3695 3214 3176 1846 1178 1076 789 21453 884 2714 263 --
NM_002397chr51723 ------
NM_002399chr1521190 258 11007 --149
NM_002401chr1772320 1968 1001 654 505 161 48 21918 436 ----
NM_002444chrX11725 1104 ----
NM_002473chr225841 395 345 257 241 ----1322
NM_002480chr12----1523 --
NM_002481chr187115 6536 6366 5908 5717 5633 5234 1242 47442 5791 2312 756 12261 --
NM_002489chr7--1352 ----
NM_002507chr1741723 539 417 137 ------
NM_002520chr5----192 --
NM_002545chr11104842 4601 4179 3747 3401 3227 1897 639 201 69 ----13440
NM_002577chr384060 2676 2669 2509 1369 1216 1104 264 21289 383 ----
NM_002613chr16145417 4880 4542 4504 4161 3759 2054 2023 1674 1377 1119 1109 927 114 1895 --13864
NM_002655chr853589 3478 1395 920 805 ------
NM_002670chr321085 158 11627 ----
NM_002698chr1982668 2651 2478 1082 1046 683 388 280 32045 835 401 32506 2026 1896 12932
NM_002715chr5----11043 --
NM_002716chr1143689 3371 1347 1296 --12988 13237
NM_002731chr1----166 --
NM_002745chr2242977 2860 1403 997 34238 3474 512 --13546
NM_002748chr15--1220 ----
NM_002786chr11----199 --
NM_002823chr21104 ------
NM_002825chr7------1519
NM_002834chr12103968 2688 2679 2584 2483 1568 1296 1068 1038 949 34059 3743 2695 ----
NM_002837chr1254420 3889 3225 694 348 --1412 --
NM_002840chr161560 1363 1126 1006 635 551 11197 1528 1118
NM_002844chr6------1318
NM_002859chr1271461 1429 504 379 365 255 185 ------
NM_002863chr141144 ------
NM_002886chr344002 3184 1580 1018 --11044 --
NM_002895chr201821 ------
NM_002911chr1971476 1411 1221 1073 283 212 203 1312 1443 --
NM_002941chr31104 ------
NM_002942chr311134 ------
NM_002948chr311303 ------
NM_002959chr163239 3187 747 474 455 163 2708 374 13670 --
NM_002973chr122235 184 ------
NM_002990chr1652436 2278 2040 1962 724 31784 1657 693 ----
NM_002998chr821589 835 --12085 --
NM_003026chr9----11213 --
NM_003028chr983214 2560 1488 1267 924 917 720 33 2759 397 23653 1170 13507
NM_003042chr352102 1463 844 610 133 32219 1904 880 1508 --
NM_003043chr3144216 3731 3709 3483 3123 2840 2817 1729 1527 969 938 927 885 79 23374 1579 1256 --
NM_003045chr1374418 3873 3651 1780 1189 614 503 23522 3440 13914 --
NM_003051chr111314 21775 1471 ----
NM_003069chrX----197 --
NM_003081chr2021022 373 ------
NM_003106chr31424 ------
NM_003108chr2145969 4660 2641 2510 2500 2322 2181 1907 1256 1198 775 705 490 399 16747 37052 2548 42 11650
NM_003112chr732726 2367 2097 191 ----
NM_003130chr7------21273 841
NM_003137chr651774 900 766 447 25 ------
NM_003139chr111319 --1116 --
NM_003144chr631768 134 77 ------
NM_003149chr331116 556 355 11325 1235 --
NM_003150chr1732039 1783 802 --11912 11521
NM_003155chr82673 376 --12488 --
NM_003173chrX41260 450 147 94 1428 --1924
NM_003174chr101113 ------
NM_003189chr142509 785 764 561 168 1532 --
NM_003246chr1541837 1648 1291 449 1316 ----
NM_003247chr61673 ----1774
NM_003257chr1511162 ------
NM_003262chr324591 648 12093 21595 509 --
NM_003281chr1154564 4425 4125 3968 3476 2152 2132 2066 1979 1878 1379 1168 622 494 212 84004 3595 3440 1743 1629 1511 817 781 23652 3599 --
NM_003286chr20----11088 --
NM_003298chr365212 5032 4992 4215 1429 1051 21341 716 --23795 474
NM_003320chr1194235 3714 3707 3260 1725 1356 1093 728 182 --32726 366 44 --
NM_003338chr10--132 ----
NM_003342chr1712813 ------
NM_003344chr741227 562 499 478 --11428 --
NM_003359chr42283 125 ------
NM_003360chr41212 ------
NM_003368chr11195 ------
NM_003371chr982001 1986 1559 1407 840 510 252 246 ----11463
NM_003374chr5--1618 ----
NM_003387chr262914 2823 2432 686 517 274 ------
NM_003392chr333018 2811 690 21532 980 1525 13701
NM_003394chr123525 498 293 ------
NM_003410chrX127 ------
NM_003413chrX11772 ------
NM_003418chr33703 669 203 1651 ----
NM_003421chr1043612 3387 3302 628 ----14291
NM_003453chr131555 ------
NM_003458chr393259 3137 2847 2467 1296 1231 1101 564 425 21189 601 --23313 288
NM_003463chr61866 ------
NM_003466chr282425 2226 2136 2045 1907 1869 1754 771 2818 380 ----
NM_003468chr263995 3561 3388 3283 2796 590 44106 3906 3436 1700 ----
NM_003474chr1022191 483 1798 ----
NM_003483chr1222049 802 1847 ----
NM_003487chr17157 ------
NM_003498chr1642455 881 701 494 1747 --1785
NM_003517chr1141 ------
NM_003557chr141487 1155 627 245 ------
NM_003559chr1773516 3386 3163 2457 1381 1082 24 33629 3215 2932 23666 105 --
NM_003566chr1212799 123 ----
NM_003574chr1834929 2000 319 --12007 --
NM_003576chr1362948 2538 2407 2010 1982 634 11057 12901 12184
NM_003583chr1242784 2754 2463 728 13181 ----
NM_003590chr21209 21228 865 13313 --
NM_003603chr4124 ----1150
NM_003607chr1103878 3588 1512 1338 1134 843 728 706 530 358 33720 3575 2701 33613 2734 803 --
NM_003620chr171265 ------
NM_003632chr172635 331 --1155 --
NM_003671chr92709 21 --21098 1062 --
NM_003681chr21185934 5794 5294 4512 4506 4487 4378 4300 3822 1808 1769 1728 1710 1610 1291 1184 1108 85 35091 4833 2440 45642 4025 2396 2362 --
NM_003713chr131166 298 214 --1416 --
NM_003714chr552018 578 513 435 353 --1344 1335
NM_003716chr3133 --1941 --
NM_003737chr11--1160 ----
NM_003740chr6121757 1740 1669 1608 1518 1406 1387 701 623 597 318 179 --1492 --
NM_003741chr3----1361 --
NM_003758chr151514 11101 ----
NM_003758chr151514 11101 ----
NM_003759chr473905 3877 2907 1364 593 574 445 13320 11594 11603
NM_003760chr1--1715 ----
NM_003762chr121249 395 ------
NM_003763chr2042335 2284 459 86 1589 --12688
NM_003768chr131205 713 493 --11730 --
NM_003774chr121176 ------
NM_003825chr152344 73 1133 11154 --
NM_003858chr142157 88 1200 --165
NM_003861chr1462404 2338 2269 916 782 114 ----11104
NM_003876chr171329 157 190 --
NM_003887chr2--12281 ----
NM_003895chr214877 425 144 48 ----12023
NM_003896chr21817 ------
NM_003908chr2021260 66 ------
NM_003913chr653695 3474 2986 742 483 ------
NM_003927chr182943 119 ------
NM_003938chr192374 335 --2889 798 2906 36
NM_003939chr1062644 1203 1147 1022 942 550 23265 516 1139 13370
NM_003966chr567457 7447 5518 1870 130 87 ----1676
NM_003972chr10------1242
NM_003983chr1643903 3399 3048 130 11710 14077 13883
NM_004024chr131464 537 476 1555 2356 34 --
NM_004028chr1844022 3046 746 740 13237 ----
NM_004050chr1462474 2319 2099 1688 245 122 --21774 813 --
NM_004056chr821003 317 ------
NM_004105chr22971 339 ------
NM_004114chrX----1126 --
NM_004130chr32439 68 ------
NM_004132chr1051195 472 130 87 25 ------
NM_004157chr32729 175 2692 659 ----
NM_004170chr91655 --11785 11224
NM_004171chr11138832 8764 7800 7507 7161 6290 6144 6088 3079 2746 1959 1604 806 59376 8786 8363 7134 3353 21247 1157 --
NM_004172chr511514 ----11863
NM_004200chr11143022 2765 2756 2526 2488 2283 2266 2244 2046 1275 1262 705 643 602 1467 ----
NM_004225chr821100 133 1363 1989 1959
NM_004227chr763116 2259 1262 1247 217 86 1125 32542 2424 2139 --
NM_004242chr6--1328 ----
NM_004251chrX----1260 --
NM_004272chr521800 408 11350 ----
NM_004317chr19----171 --
NM_004323chr951953 1906 1691 720 90 22094 525 ----
NM_004331chr821018 230 ------
NM_004360chr1621892 1339 1720 ----
NM_004365chr51214 ------
NM_004370chr632007 1692 1498 21430 557 ----
NM_004384chr51444 ------
NM_004389chr22260 222 ------
NM_004392chr131285 ------
NM_004393chr372137 1963 1837 1729 677 37 27 11695 ----
NM_004397chr1154066 2639 1176 924 627 ------
NM_004407chr41409 1935 ----
NM_004411chr7148 1553 ----
NM_004412chr1075730 4892 3959 2012 1782 1241 305 ------
NM_004420chr11102301 2157 1988 876 860 795 776 703 619 604 --11489 --
NM_004427chr161177 773 331 194 106 32 --155 11075
NM_004432chr912082 12274 ----
NM_004433chr141181 648 559 457 2466 387 ----
NM_004436chr11653 --1533 --
NM_004437chr132878 2758 494 11084 1602 --
NM_004438chr232422 2357 2149 12652 11110 --
NM_004440chr6------11680
NM_004441chr31354 ------
NM_004449chr211331 ------
NM_004451chr115669 662 643 531 250 1119 2112 76 1599
NM_004454chr352180 1683 1451 895 34 --12250 1647
NM_004458chrX12319 1241 1454 --
NM_004484chrX1133 ------
NM_004485chr1104230 3682 3398 3085 2926 1704 1476 1318 465 54 1404 ----
NM_004496chr14----1869 --
NM_004501chr133671 3493 2983 ------
NM_004504chr22550 460 ------
NM_004506chr6----1168 --
NM_004529chr911021 ------
NM_004530chr162927 244 2431 418 1824 1895
NM_004537chr122405 215 ------
NM_004569chr142499 135 1144 ----
NM_004586chrX64638 4577 4129 3321 1747 758 44622 4522 4402 3489 ----
NM_004588chr11103017 2963 2855 2538 1328 865 575 324 318 112 2557 479 11439 --
NM_004593chr3133 ------
NM_004596chr191149 ------
NM_004602chr2031098 449 138 --11085 --
NM_004612chr911294 23928 1714 11589 --
NM_004615chrX1232 2977 91 ----
NM_004634chr31513 ------
NM_004651chrX2328 286 ------
NM_004687chr1742008 673 155 102 ------
NM_004703chr1721780 409 157 --12407
NM_004709chrX31633 1594 1353 ------
NM_004726chrX105571 5135 4869 4165 4051 2011 1540 1458 1378 1268 21287 318 13595 --
NM_004744chr433483 2936 901 23231 61 23275 2534 13271
NM_004745chr8126229 5477 5111 4744 4612 4568 1950 1653 1411 745 173 164 --36428 1715 1614 15047
NM_004748chr1532882 998 480 --23655 1004 --
NM_004755chr14--1195 --11135
NM_004762chr17101632 1528 1462 1406 1325 702 669 662 313 224 21303 243 61416 794 578 306 247 89 21349 263
NM_004768chr11377 ------
NM_004772chr521484 363 21446 1285 --11106
NM_004788chr1121749 38 22519 510 --12196
NM_004789chr91280 1395 ----
NM_004798chr20103072 2682 2300 2249 1282 1116 1068 1035 74 24 22612 875 11158 --
NM_004807chr252365 2342 580 560 167 41735 259 245 143 21766 249 --
NM_004808chr1043169 2263 976 341 11160 2671 599 1549
NM_004817chr9----1508 --
NM_004822chr1783541 2909 2587 1611 1201 1178 417 40 1289 --33244 2672 477
NM_004834chr283023 2789 2391 1255 451 438 84 36 13062 ----
NM_004840chrX52352 1759 464 279 266 139 22209 783 --
NM_004845chrX73818 3145 2528 1481 1412 200 115 --21529 274 13984
NM_004869chr181129 ------
NM_004870chr171198 --2508 397 --
NM_004872chr1159 ------
NM_004898chr432160 1843 147 ------
NM_004904chr711354 --14367 --
NM_004923chr113329 271 143 --2320 264 3341 285 280
NM_004949chr1821980 575 ------
NM_004956chr754223 3914 1539 604 248 --23318 23 --
NM_004962chr10153 196 2487 39 --
NM_004976chr11175007 4908 4785 4685 4613 4607 4565 4516 4115 3722 3498 3430 3416 1883 1624 432 348 35040 4299 3838 24045 503 --
NM_004985chr1234119 3318 198 ------
NM_004992chrX178050 7991 7757 6851 6560 6456 6341 6321 6038 3165 3024 2899 2806 2414 1710 366 228 37803 875 375 17558 21731 839
NM_004992chrX178050 7991 7757 6851 6560 6456 6341 6321 6038 3165 3024 2899 2806 2414 1710 366 228 37803 875 375 17558 21731 839
NM_004999chr634051 4042 1399 13417 12785 --
NM_005011chr72544 63 ----11827
NM_005036chr2288315 8102 5127 2998 2204 1383 1013 113 67889 7465 5759 5616 3082 2940 ----
NM_005045chr71807 ------
NM_005056chr1275247 3422 1511 757 439 312 159 1570 ----
NM_005065chr1464742 4406 3699 1804 1498 796 1284 13332 --
NM_005077chr9------1380
NM_005095chr121988 434 ------
NM_005096chrX--1273 2987 370 --
NM_005109chr332411 2249 209 ------
NM_005110chr5165 2286 240 1121 --
NM_005116chr2074550 2814 1815 1182 436 332 117 --11257 11640
NM_005121chr1722650 1397 ----1740
NM_005134chr18------1303
NM_005151chr1842436 1715 273 71 12004 --11606
NM_005156chr934292 1354 1245 13964 14765 14269
NM_005180chr10--11280 ----
NM_005188chr11187251 6860 6754 6466 6224 6044 5817 5525 5291 5236 5031 2936 1988 1978 1849 1605 445 242 26510 1868 38179 7741 6567 12887
NM_005197chr1494461 4188 4149 4076 4025 4006 2398 2040 341 ------
NM_005219chr551173 650 555 256 204 11459 21598 37 1672
NM_005233chr332270 2138 1028 --1366 --
NM_005235chr266991 5213 4770 2521 2489 1869 16678 --12419
NM_005259chr21219 11100 ----
NM_005277chr421918 1830 ------
NM_005296chrX21001 141 ------
NM_005312chr9102483 2465 1921 1762 852 656 460 343 110 43 1213 22234 1000 1505
NM_005334chrX71709 1552 1199 403 223 205 65 --1298 --
NM_005359chr18106068 5954 5664 5586 5116 2261 1494 388 315 213 --16289 --
NM_005376chr11912 ------
NM_005384chr9--154 ----
NM_005397chr773734 895 454 369 353 136 37 2839 441 1497 --
NM_005399chr154286 3716 3022 2845 123 1500 ----
NM_005406chr181323 ----175
NM_005407chr1431527 1182 72 141 ----
NM_005417chr2031900 725 502 1716 11284 --
NM_005418chr11--2685 273 239 22 --
NM_005455chr12553 210 ------
NM_005460chr5159 ------
NM_005477chr15102486 2406 2379 2357 2126 1929 1742 489 305 164 21968 339 1603 --
NM_005477chr15102486 2406 2379 2357 2126 1929 1742 489 305 164 21968 339 1603 --
NM_005483chr19--150 1126 --
NM_005497chr17106129 5772 5680 5339 4883 4876 4434 2296 1801 648 15391 ----
NM_005504chr1236492 5296 1518 24828 974 ----
NM_005509chr521872 1564 ------
NM_005546chr542292 2274 1463 559 3630 571 72 ----
NM_005569chr2241440 1324 1198 23 --21044 79 --
NM_005573chr5----165 --
NM_005578chr323985 3611 11046 ----
NM_005585chr15----1354 --
NM_005587chr151315 1703 ----
NM_005596chr91555 24423 4316 ----
NM_005603chr181713 1471 1169 --
NM_005604chr622523 1999 12069 125 12074
NM_005610chr11352 ------
NM_005626chr11519 ------
NM_005637chr1811800 ------
NM_005639chr121164 1241 ----
NM_005652chr162268 108 --1498 --
NM_005665chr123901 678 --22989 1968 --
NM_005668chr514235 13079 --13142
NM_005682chr1661379 526 516 510 481 35 1498 ----
NM_005704chr151072 435 381 361 39 1888 3892 287 165 --
NM_005707chr151291 11156 11105 --
NM_005711chr51370 ------
NM_005730chr1262861 2433 1091 882 806 191 179 11062 --
NM_005735chr26798 603 574 331 310 53 2627 581 1272 --
NM_005751chr71424 ------
NM_005759chr234077 1488 1440 --13924 --
NM_005776chr14--1601 ----
NM_005801chr172620 283 --1683 --
NM_005808chr31630 1360 12256 1882
NM_005811chr123348 269 81 ------
NM_005822chr6------11810
NM_005826chr1----1213 --
NM_005828chr17104869 4792 4606 3834 3704 3440 1568 928 214 30 33692 3592 3220 1836 24053 4048
NM_005832chr31276 ----1130
NM_005840chrX92984 2779 2474 2129 1976 1700 1153 299 25 ------
NM_005843chr22507 374 ------
NM_005859chr5------11189
NM_005862chr3144 ------
NM_005868chr742240 2123 1823 1707 ----12465
NM_005880chr161154 ------
NM_005896chr21124 ------
NM_005900chr41421 ------
NM_005902chr1553444 3438 3077 1700 1308 --1429 14535
NM_005903chr544261 3566 1559 1508 34497 4072 3283 14524 1221
NM_005906chr6140 ------
NM_005920chr183454 2619 2571 1117 999 920 811 513 12400 13724 --
NM_005924chr73726 711 349 ------
NM_005933chr1172379 2345 2316 2113 1981 1875 186 12096 ----
NM_005935chr494744 4333 1231 1171 1127 1028 726 663 197 1852 1959 --
NM_005937chr17113972 3261 3084 2686 1301 1136 1071 1015 853 530 114 2978 840 53208 2851 2828 2817 308 --
NM_005941chr843896 2664 1540 1042 13854 --21622 929
NM_005955chr195068 4213 4108 3887 2024 1868 1647 788 673 1913 ----
NM_005962chr10----1189 129
NM_005962chr10----1189 129
NM_005984chr22144 ------
NM_005998chr1164 --141 --
NM_005999chr11285 ------
NM_006007chr943829 2930 1017 105 14475 ----
NM_006011chr1574248 2792 1271 1075 1067 585 545 ------
NM_006033chr1811475 1246 --1919
NM_006034chr1172281 2232 2141 661 220 128 43 --11651 11713
NM_006047chr2023509 762 21156 137 ----
NM_006067chr161175 --2787 716 --
NM_006070chr3----1362 1109
NM_006077chr101780 --270 59 --
NM_006094chr812298 --22358 2186 11510
NM_006133chr1142487 1797 663 180 --2830 614 --
NM_006134chr211538 11501 11395 --
NM_006136chr7--1140 ----
NM_006139chr252477 2434 2103 1082 1031 ------
NM_006141chr1632166 284 109 --1670 12294
NM_006158chr8----1202 1184
NM_006166chr1262533 2172 2003 1004 410 32 --12246 --
NM_006190chr21389 ------
NM_006206chr421009 81 --12167 --
NM_006210chr192435 292 ------
NM_006237chr1331654 295 283 ----11846
NM_006241chr332309 1781 290 1738 ----
NM_006243chr12684 666 2983 846 3904 757 36 --
NM_006252chr1106509 5935 5754 5074 4582 2321 2012 1905 1289 1135 15805 ----
NM_006258chr101516 ------
NM_006259chr41269 2797 86 ----
NM_006267chr2----1484 --
NM_006282chr20103217 3057 1726 1638 1510 1163 1094 951 494 243 --24203 556 --
NM_006283chr864588 4348 4088 1312 963 98 14564 ----
NM_006301chr12----1212 --
NM_006306chrX85841 5359 5325 4841 1330 1164 615 236 11137 ----
NM_006307chrX1251 ------
NM_006311chr171254 ------
NM_006313chr1211098 1621 ----
NM_006321chr35761 522 375 194 110 --32041 1940 1447 11407
NM_006330chr8150 ------
NM_006343chr21314 ------
NM_006386chr221429 --22073 978 --
NM_006403chr621822 1501 ----1599
NM_006416chr6156 ------
NM_006420chr201883 11363 1626 --
NM_006449chr251711 1372 875 224 79 --1678 --
NM_006457chr41789 23018 1400 --12919
NM_006465chr15112080 2067 1958 1813 1802 643 637 582 407 181 85 32165 653 303 32136 675 337 1491
NM_006469chr1157 --2607 556 1630
NM_006482chr1242784 2754 2463 728 13181 ----
NM_006488chr23716 639 217 2356 198 1189 --
NM_006509chr191374 ------
NM_006519chr61121 ------
NM_006526chr20--11424 --1829
NM_006534chr2033192 2077 1051 ----1872
NM_006544chr1445209 2385 2055 1417 11527 ----
NM_006546chr17116257 5307 4963 4282 4133 2597 2022 1990 1065 846 355 --11983 --
NM_006549chr1282590 2535 1969 1873 962 917 537 489 32224 892 512 31980 516 108 --
NM_006565chr161345 ------
NM_006574chr3177 ------
NM_006577chr2--11080 ----
NM_006609chr232669 2189 331 12483 ----
NM_006614chr333044 2442 1028 ----13180
NM_006628chr1543616 1827 638 160 23382 208 ----
NM_006646chr133879 732 392 12903 1866 12665
NM_006654chr1234552 4446 1522 ----1163
NM_006675chr12103305 3121 3051 2691 2681 2613 2459 2305 2086 1197 1900 32357 928 361 --
NM_006690chr2092391 2273 2136 1713 1700 873 281 167 94 12240 2633 103 --
NM_006698chr2031432 1352 489 --11060 --
NM_006699chr132328 2221 935 1346 22238 1803 22108 2045
NM_006703chr61451 ------
NM_006720chr1034991 4683 3560 41427 1193 557 228 ----
NM_006729chrX34129 1234 947 23792 2104 14775 --
NM_006734chr6----11030 --
NM_006736chr281608 1570 1545 1396 1298 1234 388 186 1229 21480 422 11476
NM_006750chr1665999 2479 2129 1778 1685 1232 17928 ----
NM_006769chr11230 ------
NM_006777chrX42930 794 180 47 --11964 --
NM_006791chr151248 ------
NM_006805chr5--11623 --11115
NM_006812chr12----1106 --
NM_006814chr2062076 1833 1650 938 497 157 31757 1035 767 ----
NM_006826chr21267 ----1989
NM_006851chr1211821 11082 12429 --
NM_006885chr16--13999 22951 297 --
NM_006888chr1422418 2135 --11165 1764
NM_006899chr20----1120 --
NM_006913chr61385 ------
NM_006920chr2--11888 ----
NM_006925chr14--1508 ----
NM_006930chr5--1321 --1474
NM_006939chr1411171 ------
NM_006940chr12------11647
NM_006955chr1073234 2948 2346 2197 1359 1131 53 23266 914 ----
NM_006980chr71197 ------
NM_006981chr942733 2475 900 723 --12897 1190
NM_006990chr152181 2067 1634 948 524 --1955 1471
NM_007006chr1672948 1212 934 877 670 663 515 11034 ----
NM_007010chr1721474 201 ------
NM_007011chr1595060 4905 4866 4378 2592 1668 501 242 120 26541 844 24689 2332 26399 4613
NM_007013chr81305 ------
NM_007027chr3--1122 ----
NM_007030chr5124369 4267 4003 3970 1554 1404 1349 1081 873 777 723 529 21388 43 41671 1559 1094 537 11541
NM_007038chr2135733 4768 918 24843 2292 23988 3724 --
NM_007054chr563641 2986 2827 2445 1380 246 ------
NM_007064chr31505 21161 639 ----
NM_007073chr6104205 3970 3452 1441 1374 1345 1303 826 750 453 ------
NM_007075chrX----2132 48 --
NM_007106chr1322212 648 ------
NM_007124chr631671 1543 1357 ------
NM_007146chr1731896 947 826 --11075 22627 1974
NM_007203chr983356 2794 2786 2530 1388 1349 1086 910 12761 ----
NM_007207chr12711 303 ------
NM_007214chr611141 ------
NM_007222chr81330 11804 ----
NM_007225chr177275 262 164 145 105 82 32 ----1926
NM_007249chr13109096 7666 7143 7059 3075 2494 1487 1459 973 706 36041 367 130 165 16577
NM_007283chr3113078 2791 2778 2534 2430 1111 887 833 604 58 47 32081 1235 495 --11986
NM_007285chr161179 ------
NM_007331chr421088 777 ----22518 586
NM_007345chr1812022 ------
NM_007347chr1572895 2777 2410 2248 919 710 278 12125 ----
NM_007353chr772920 2709 2237 2081 1990 1922 476 --21015 687 --
NM_007358chr131716 1544 1409 1348 ----
NM_012074chr141852 --2785 343 --
NM_012081chr523709 772 1708 ----
NM_012096chr363100 2940 2628 1173 943 670 ----1734
NM_012104chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_012104chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_012137chr12679 236 11083 ----
NM_012156chr2042845 2666 1364 1300 ----22303 227
NM_012158chr1321241 607 ------
NM_012164chr986890 5433 2388 2228 1918 1620 966 157 26614 6149 21855 615 --
NM_012175chr111194 ------
NM_012180chr4----1233 --
NM_012183chr11411 ------
NM_012193chr1184744 4533 4107 3399 1451 374 340 318 13380 ----
NM_012199chr164140 4089 3978 3085 1026 163 ----13990
NM_012210chr931154 285 197 --11436 --
NM_012215chr1031937 1725 422 ------
NM_012218chr1962807 2749 2600 1227 1066 244 --32859 2718 2591 --
NM_012233chr231170 915 826 ------
NM_012234chr353503 2942 2598 1341 1334 --1813 --
NM_012238chr10--192 ----
NM_012243chr12621 83 ------
NM_012248chr162636 34 1183 --1625
NM_012249chr231045 443 306 1991 ----
NM_012257chr7--2891 180 ----
NM_012259chr6151 ------
NM_012261chr20----1602 --
NM_012264chr2292022 1960 1838 1571 818 651 622 576 236 --1793 11628
NM_012264chr2292022 1960 1838 1571 818 651 622 576 236 --1793 11628
NM_012281chr7--21971 205 ----
NM_012288chr6105270 4614 4378 2144 1584 1568 973 780 445 48 --24202 2283 1792
NM_012290chr211571 ------
NM_012297chr4--12367 --12230
NM_012302chr1--1198 ----
NM_012308chr1131901 928 155 12093 21665 991 --
NM_012309chr1173831 3774 1332 1310 1300 569 46 1964 11894 --
NM_012316chr195484 5147 4824 2218 1812 1625 1433 1023 789 25519 4586 13904 --
NM_012319chr18--1855 ----
NM_012330chr101364 ------
NM_012334chr574295 4029 3027 1658 1499 384 99 14338 1709 --
NM_012382chr533485 2895 1509 ------
NM_012384chr20122359 2214 2078 2006 1944 932 844 581 336 75 64 36 --2352 85 --
NM_012398chr19132853 1925 1840 1802 1796 1176 902 862 768 459 182 88 26 22009 1969 21186 761 --
NM_012399chr22--21725 396 1235 --
NM_012402chr1151402 546 438 332 218 --11351 --
NM_012412chr72781 746 --1631 --
NM_012425chr1022400 234 12452 1960 --
NM_012448chr1751951 1819 1669 828 273 11968 12507 --
NM_013231chr1453880 3554 2973 722 654 --11553 11549
NM_013252chr72469 335 1306 12537 --
NM_013269chr1242936 830 697 345 14003 21448 881 --
NM_013275chr166669 553 542 337 232 76 --1533 --
NM_013279chr1182183 1588 1513 1494 913 779 432 351 1646 ----
NM_013286chr383716 3607 1504 1311 1269 867 689 338 31416 1145 1013 32976 2719 559 --
NM_013293chr7--1650 ----
NM_013309chr1522184 1630 21832 298 ----
NM_013341chr212413 12547 12551 --
NM_013377chr12158 ------
NM_013380chr191599 --1804 --
NM_013390chr931772 1691 1310 ----11446
NM_013411chr1177 12497 11763 --
NM_013423chrX------1154
NM_013427chrX------1154
NM_013943chr132946 2874 863 ----182
NM_013951chr282425 2226 2136 2045 1907 1869 1754 771 2818 380 ----
NM_013952chr282502 2303 2213 2122 1984 1946 1831 848 2895 457 ----
NM_013953chr282502 2303 2213 2122 1984 1946 1831 848 2895 457 ----
NM_013958chr8162 ------
NM_013959chr8162 ------
NM_013961chr8162 ------
NM_013962chr8162 ------
NM_013989chr1453946 3825 762 742 85 --24840 4445 --
NM_013992chr282502 2303 2213 2122 1984 1946 1831 848 2895 457 ----
NM_013999chr1731309 952 35 21442 135 ----
NM_014023chr1042602 1873 830 233 11911 22229 1807 --
NM_014028chr653074 2955 2667 2522 2338 1718 ----
NM_014079chr34808 680 182 146 --1311 1672
NM_014089chr1322237 1468 ----1433
NM_014106chr151751 ------
NM_014109chr81496 ------
NM_014112chr854351 3461 2120 466 104 24707 491 --14372
NM_014117chr163815 630 212 22665 701 ----
NM_014141chr735143 4372 881 21745 337 1565 --
NM_014154chr3----153 --
NM_014155chr1167487 6820 6567 6129 1432 249 24753 193 ----
NM_014157chr1663944 3741 3293 3222 2550 652 33051 893 213 13382 --
NM_014186chr1192291 2269 2141 1890 1690 593 502 277 122 1487 1477 --
NM_014216chr1431501 1484 1210 --135 143
NM_014240chr383937 3886 3281 1641 1182 628 602 30 21615 1297 23134 1301 --
NM_014267chr11--176 ----
NM_014280chr1--1153 ----
NM_014290chr91171 ------
NM_014294chr8----1361 --
NM_014300chr152186 154 ------
NM_014309chr22105164 4939 4355 4286 3986 2158 1352 1215 1167 66 13975 11811 --
NM_014315chr14163 ------
NM_014333chr1111080 1653 ----
NM_014352chr1131427 1240 1019 ------
NM_014360chr146790 646 616 227 189 70 2758 697 164 --
NM_014372chr111289 ------
NM_014393chr832343 1703 931 ------
NM_014405chr1771849 1779 1702 1679 769 377 277 --12053 12045
NM_014415chr31188 ------
NM_014423chr521868 1119 13951 11291 --
NM_014447chr4----173 1474
NM_014462chr8199 ------
NM_014491chr7--11036 ----
NM_014494chr161243 11743 ----
NM_014577chr22--1327 ----
NM_014584chr1411467 ------
NM_014585chr2--144 ----
NM_014586chr21124389 4249 4014 3862 1800 1626 1556 1114 1070 481 453 52 2989 305 13902 1863
NM_014614chr22955 305 ------
NM_014635chr231472 576 502 ------
NM_014636chr983616 3129 2819 1655 1463 1187 437 337 12969 1858 1989
NM_014646chr1841277 1250 583 405 1639 32957 569 27 --
NM_014655chr12729 348 1569 158 --
NM_014659chr1551030 924 891 284 93 1793 ----
NM_014661chr1053744 3436 1002 802 422 32566 1065 897 32797 336 23 --
NM_014665chr8103493 3196 3139 2914 2746 2557 2451 1347 1038 746 1939 83446 3385 3178 3167 2674 1156 773 57 13024
NM_014667chr342319 2237 1634 776 ------
NM_014674chr353686 3579 2995 2537 1381 --12493 13515
NM_014676chr141533 1377 590 90 ------
NM_014677chr821135 1067 1517 1201 --
NM_014686chr1962407 1703 1652 201 76 47 ----1790
NM_014693chr31710 1690 1203 --
NM_014700chr1671612 1333 1034 286 216 177 120 1113 1251 11052
NM_014701chr1542829 2548 851 582 ------
NM_014705chr71702 ------
NM_014710chrX1179 ------
NM_014717chr191188 1672 ----
NM_014723chr20143226 2982 2820 2539 2113 1242 1214 849 654 521 307 249 202 162 1529 1920 11255
NM_014729chr812245 12225 ----
NM_014730chr12105180 4741 4521 3700 3198 1390 1231 1013 369 158 24904 4149 1150 --
NM_014730chr12105180 4741 4521 3700 3198 1390 1231 1013 369 158 24904 4149 1150 --
NM_014732chr16165124 4494 4112 4094 3804 3567 2347 1825 1733 1635 1211 1083 795 709 614 113 24480 1909 24830 4484 1996
NM_014747chr1114648 4615 4184 3994 3931 3891 1819 1648 936 661 646 44905 4282 2190 1515 21262 402 --
NM_014755chr253434 2906 1293 914 42 --1154 13644
NM_014757chr532154 794 153 --1119 --
NM_014758chr1172381 2225 2174 1721 484 280 40 1788 ----
NM_014765chr112576 --12463 --
NM_014766chr773674 3420 3252 2467 1395 1015 452 33093 1084 910 1668 --
NM_014767chr1072915 2471 1390 1345 738 716 558 --3880 270 44 13321
NM_014772chr1842280 1443 317 56 33518 3225 1031 32697 574 126 13368
NM_014783chr1551601 1357 690 416 245 21470 1449 ----
NM_014795chr21118 ------
NM_014820chr321931 1267 ------
NM_014824chr1111946 31712 323 106 1669 --
NM_014826chr1103878 3588 1512 1338 1134 843 728 706 530 358 33720 3575 2701 33613 2734 803 --
NM_014828chr1452004 1600 935 231 149 --1169 --
NM_014830chr1293574 3082 3059 2711 1107 1043 801 621 520 12973 21222 231 1491
NM_014850chr384663 4542 3604 1852 1654 908 572 108 --24253 139 --
NM_014853chr175955 396 199 60 48 --21466 32 1167
NM_014860chr21350 12448 --12350
NM_014864chr154295 3146 3034 467 121 43426 2909 1301 186 ----
NM_014872chr92711 592 --11913 --
NM_014873chr144084 3936 3097 1383 ------
NM_014876chr2242041 1922 1459 751 1459 1868 --
NM_014883chr44977 706 538 302 1434 ----
NM_014893chrY------1911
NM_014897chr1743276 2644 971 465 1404 23226 2485 --
NM_014900chr221025 809 ------
NM_014909chr14153801 3318 2914 2851 2843 2574 2446 1331 1155 1076 1066 798 780 656 513 --43670 3553 3238 1168 21059 106
NM_014912chr1022351 73 --1204 --
NM_014913chr1821500 1272 --1127 --
NM_014914chr21481 ------
NM_014917chr11861 ----1259
NM_014920chr641437 1142 1043 89 ----12919
NM_014921chr1932652 2586 374 21111 1026 32599 727 59 21031 554
NM_014926chr31847 ------
NM_014932chr311224 ------
NM_014935chr1113287 3245 3226 2398 1083 777 724 529 256 140 51 13129 23431 3133 12431
NM_014946chr221987 1222 1251 12694 --
NM_014947chr132588 1094 316 ----12190
NM_014952chr1561451 1442 1339 789 524 141 1539 21715 1693 --
NM_014969chr1------1762
NM_014991chr453229 2187 812 331 163 ------
NM_014996chr3155 ------
NM_014999chr1241672 1309 416 147 ------
NM_015000chr1211109 12102 ----
NM_015017chr12403 245 ------
NM_015020chr1653104 2890 967 450 40 13878 --12811
NM_015023chr13694 529 514 11290 1534 --
NM_015024chr83543 520 416 130 1188 --
NM_015027chr1611812 ------
NM_015035chr20195927 5851 5795 5789 5530 4376 4343 4315 2462 2233 1490 1359 1139 1116 991 966 496 278 154 14762 34730 4502 1547 11658
NM_015039chr194136 3651 3493 3409 3065 931 653 639 148 --11393 --
NM_015042chr1564093 3035 1583 734 713 706 ------
NM_015044chr16103227 3094 2851 2655 2266 703 691 483 228 90 ----12940
NM_015045chr1022119 1804 --1275 --
NM_015051chr963116 2665 2471 2228 870 827 ------
NM_015064chr1243607 2935 2366 691 21191 334 12910 --
NM_015071chr5115484 5246 4746 4560 4443 4402 4021 3970 1576 1462 221 15608 14451 15095
NM_015074chr164967 4416 4220 3757 1284 704 11336 13265 --
NM_015075chrX82160 1927 1910 1834 1460 1413 637 476 ----1511
NM_015076chr664381 3822 3305 2918 1420 1394 138 13394 --
NM_015077chr1774406 4394 4310 1789 1696 841 624 31796 1434 1173 --11816
NM_015078chr391084 502 449 279 224 203 138 106 37 --1235 --
NM_015090chr186117 5485 4959 4150 2056 1777 1043 683 11016 45497 4580 4330 4103 22215 1434
NM_015092chr1643213 2990 1778 338 --11728 23433 332
NM_015093chr621601 153 11501 ----
NM_015094chr22114580 4243 4229 2993 2916 1849 1561 759 454 149 83 13884 43809 1270 264 178 --
NM_015107chrX52026 1971 1710 570 327 2950 192 12331 --
NM_015113chr1722108 245 42216 1960 716 54 --12168
NM_015115chr41120 12430 12362 --
NM_015130chr42988 403 ------
NM_015132chr71322 11463 ----
NM_015143chr421281 1033 ------
NM_015144chr1632715 613 271 1338 1936 --
NM_015149chr121978 564 --140 --
NM_015155chr1093160 2375 2250 2059 615 602 572 477 457 1500 130 --
NM_015156chr1443587 1234 421 293 21167 342 ----
NM_015157chr115972 799 379 208 134 --1367 125
NM_015163chr14----2530 92 11803
NM_015178chr8132611 2292 2243 2221 2206 1982 1906 1642 823 666 528 323 205 22133 2043 12015 --
NM_015185chrX42347 1157 991 489 --12150 --
NM_015192chr20----12544 --
NM_015193chr841014 973 354 90 2494 390 3464 406 204 1564
NM_015194chr17111865 1585 1433 1420 1295 777 667 549 476 367 26 1329 2603 537 --
NM_015197chr1473044 2994 2586 1086 794 523 289 12218 62758 2363 1053 632 623 375 11329
NM_015199chr3--12776 ----
NM_015205chr1384290 3448 1876 1718 1385 885 410 109 34202 879 28 11327 14003
NM_015206chr1543705 1098 923 569 ------
NM_015215chr142579 715 656 72 12480 ----
NM_015219chr1752485 2125 892 682 429 11867 31929 1888 410 32265 1783 336
NM_015231chr11--1679 ----
NM_015233chr1342132 1651 228 84 11703 --1898
NM_015250chr91394 --1486 11939
NM_015254chr8132694 2639 2568 2208 2195 2019 1281 1149 1113 906 824 247 138 --2863 110 --
NM_015256chr51522 ------
NM_015267chr121734 11832 ----
NM_015270chr1292261 2118 1822 1804 820 377 296 272 84 1547 ----
NM_015277chr1851814 1776 1431 93 81 ------
NM_015282chr242526 2432 700 317 --12348 12388
NM_015288chr5123839 3622 3339 2758 2652 1201 1026 904 827 552 494 392 ------
NM_015291chr142504 1200 884 339 21324 96 ----
NM_015296chr131466 ----1411
NM_015299chr1473763 3017 2571 1467 1215 515 335 23215 2978 13838 12521
NM_015310chr897615 7531 7113 7104 5861 3245 1411 1369 591 15335 26654 3038 16881
NM_015313chr1184596 3408 3221 989 505 281 154 89 14089 13309 --
NM_015314chr74826 694 233 198 --11638 --
NM_015315chr5103255 3192 3074 2814 2589 2578 2372 1345 1288 1101 13118 ----
NM_015317chr212433 12251 ----
NM_015318chr1991674 1284 1216 734 660 605 386 321 157 21484 727 1404 --
NM_015326chr122694 2461 --22382 2289 12755
NM_015328chr721247 183 22306 1936 --11006
NM_015329chr1971163 447 416 253 240 203 111 1348 132 11842
NM_015335chr1242236 1902 912 177 ------
NM_015336chr1212064 ------
NM_015346chr1421336 250 1497 ----
NM_015347chr1211892 ------
NM_015361chr21215 ------
NM_015375chr1124460 4071 3647 3350 1998 1947 1631 955 904 763 564 147 --13862 24381 3408
NM_015397chr92563 22 ------
NM_015412chr322363 2204 --12604 --
NM_015429chr31796 ------
NM_015457chr1111029 ------
NM_015472chr3------177
NM_015472chr3------177
NM_015475chr2129 ------
NM_015483chr71872 ------
NM_015508chr321365 605 --1586 --
NM_015520chr382245 2223 580 451 421 366 289 120 1652 1496 --
NM_015542chr10--1487 1915 --
NM_015553chr654278 4200 4057 3343 169 1465 ----
NM_015560chr322480 782 12537 ----
NM_015564chr542838 2330 557 56 ------
NM_015568chr2083462 3232 2728 1661 1063 550 508 475 43799 3691 1150 90 11218 --
NM_015569chr123998 723 11513 11103 11359
NM_015576chr322674 268 --11868 --
NM_015577chr561409 1248 282 238 203 59 ----11664
NM_015601chr101830 ------
NM_015609chr142771 2655 2081 100 1756 32744 931 688 --
NM_015610chr772783 2165 2047 992 915 109 34 --22725 2108 --
NM_015626chr1711102 --3859 815 332 --
NM_015635chr941974 1527 733 232 ------
NM_015652chr101552 --1175 --
NM_015695chr632012 1509 377 --11316 150
NM_015852chr713019 13232 1242 --
NM_015878chr811934 ------
NM_015885chr11----2182 119 --
NM_015886chr834210 1663 762 15225 ----
NM_015907chr4--1267 ----
NM_015960chr101325 ------
NM_015980chr541603 1278 1254 508 ----2461 122
NM_015981chr572764 2736 2415 2294 1975 184 39 22706 1135 ----
NM_015990chr41745 ------
NM_015999chr1--1499 --1603
NM_016003chr772783 2165 2047 992 915 109 34 --22725 2108 --
NM_016009chr143568 3354 579 187 --11173 13665
NM_016025chr1631707 232 27 ------
NM_016032chrX21212 954 11320 11204 --
NM_016037chr12967 396 ------
NM_016041chr17----1300 --
NM_016061chr23543 200 88 --21049 261 --
NM_016075chr1383086 2690 755 684 456 325 246 50 ------
NM_016076chr122984 518 22696 2665 ----
NM_016083chr623560 2890 ------
NM_016099chr81115 188 165 --
NM_016107chr5----1502 --
NM_016120chrX----11159 --
NM_016129chr4--1145 ----
NM_016132chr1533346 2175 2108 11007 12288 --
NM_016133chr2------1362
NM_016152chr311105 --11089 --
NM_016157chrX171 ------
NM_016206chr338499 7568 2524 25733 2755 11717 --
NM_016210chr341402 1275 1240 56 11586 --11296
NM_016231chr173626 580 221 ----11389
NM_016252chr22950 864 ------
NM_016257chr173369 3303 2932 2362 2324 2279 382 --13271 22847 2377
NM_016264chr191379 ------
NM_016271chr1822323 1960 ------
NM_016275chr321766 1074 1568 ----
NM_016289chr221491 825 --2719 458 --
NM_016297chr273013 2958 2639 2377 2327 1126 74 ----1475
NM_016322chr92455 199 12436 ----
NM_016374chr11285 ------
NM_016374chr11285 ------
NM_016376chr1733326 2914 807 4954 942 354 84 1396 --
NM_016418chr2273774 3692 3644 1165 595 384 250 1776 124 1677
NM_016441chr21268 --1724 --
NM_016506chr11182 1265 ----
NM_016507chr1742478 520 254 89 11177 --12887
NM_016511chr12----130 --
NM_016513chr641437 1142 1043 89 ----12919
NM_016530chr1553201 2818 1066 629 416 13058 ----
NM_016531chr42817 732 33835 3821 355 ----
NM_016577chr374285 2907 2797 1705 1426 1087 607 --13792 23569 781
NM_016578chr11----1651 --
NM_016591chr5--1429 ----
NM_016592chr201289 ------
NM_016605chr572402 1942 885 853 666 285 195 42421 2074 223 126 --1500
NM_016613chr422613 520 2799 450 ----
NM_016620chr111403 1140 --1521
NM_016621chr11134437 3967 3785 2809 1623 1572 1134 815 557 425 372 362 159 24586 1657 44249 1767 1519 785 --
NM_016626chr181626 ------
NM_016628chr103884 270 239 ------
NM_016733chr2241440 1324 1198 23 --21044 79 --
NM_016734chr962018 1755 1616 1343 1261 543 11626 11518 1502
NM_016936chr1652060 2021 1746 1722 494 31657 386 376 1132 22035 323
NM_016950chr421173 529 ------
NM_016953chr262027 1368 676 506 202 164 35257 1385 821 22292 825 --
NM_017413chrX72211 1624 1550 907 821 616 467 1524 1918 --
NM_017420chr1433662 3528 3424 13697 ----
NM_017423chr421630 295 ------
NM_017440chr12--1208 ----
NM_017452chr2031098 449 138 --11085 --
NM_017453chr2031098 449 138 --11085 --
NM_017454chr2031098 449 138 --11085 --
NM_017456chr17101632 1528 1462 1406 1325 702 669 662 313 224 21303 243 61416 794 578 306 247 89 21349 263
NM_017488chr241410 418 131 69 11144 1556 --
NM_017510chr51590 --1624 --
NM_017540chr562103 1248 1221 952 272 230 22045 783 175 --
NM_017544chrX1724 --1806 182
NM_017548chr3--1860 11508 --
NM_017551chr1061779 1020 950 887 850 590 12007 151 --
NM_017582chr131687 561 319 11453 1687 --
NM_017590chr22132450 2274 2207 2130 1030 992 838 802 786 708 670 456 341 180 32317 1684 769 --
NM_017592chr1992230 2141 2005 1770 708 608 535 139 129 11822 21021 1016 --
NM_017594chr932564 2349 661 --11352 13202
NM_017610chr151609 ------
NM_017628chr444591 3803 1757 1571 34014 3902 3483 ----
NM_017629chr121530 546 ------
NM_017632chr41291 ------
NM_017633chr612424 ----11361
NM_017637chr969040 8494 6427 5885 3565 3010 38175 6523 264 ----
NM_017658chr1444424 4166 2836 430 ------
NM_017660chr19123250 3061 3055 2908 2747 2730 2157 811 683 643 179 140 12985 ----
NM_017680chr91997 ----1949
NM_017709chr163629 3547 3026 2704 936 562 11502 ----
NM_017740chr1631544 1467 166 195 41222 438 252 136 --
NM_017745chrX--1452 ----
NM_017752chrX11337 1850 ----
NM_017754chr673465 3189 2024 511 431 406 338 ------
NM_017763chr1731119 767 67 31049 982 857 ----
NM_017784chr3164 ------
NM_017786chr8157 ------
NM_017787chr1032885 1927 481 197 22551 2225 --
NM_017798chr2021175 1072 ------
NM_017807chr14--122 ----
NM_017813chr821962 1796 25431 5038 ----
NM_017824chr1051975 996 836 609 147 --1943 --
NM_017849chr232647 2459 697 11099 --1593
NM_017873chr972597 2529 2108 1262 645 346 257 43089 2614 2338 304 23130 141 --
NM_017880chr2----1414 --
NM_017887chr1----164 --
NM_017902chr10135306 5072 4974 4458 4327 4319 4249 4240 3757 1925 1430 1148 496 21362 1274 1490 1161
NM_017921chr1721986 1727 --21493 238 --
NM_017938chrX1816 ----1170
NM_017944chr111710 --22321 1162 1591
NM_017948chr9198 ------
NM_017958chr232939 1215 1011 12190 1961 167
NM_018014chr221244 130 --1140 --
NM_018018chr12--3710 554 243 --11776
NM_018025chr19186 ------
NM_018027chr1052213 2034 1020 992 878 ----13139
NM_018036chr1474203 4000 3888 3279 3114 3062 54 11052 11526 --
NM_018078chr41417 ------
NM_018084chr232506 2382 529 21226 164 ----
NM_018085chr1128071 7899 6364 6313 5776 5418 2679 2018 1805 1384 792 279 18058 12849 18028
NM_018086chr231216 89 74 11732 ----
NM_018094chrX1353 ------
NM_018095chr11182 1265 ----
NM_018105chr81880 ------
NM_018110chr1641289 863 453 430 --11330 --
NM_018112chr91179 1655 ----
NM_018113chr123349 162 119 1368 2413 130 --
NM_018116chr14542 446 191 77 ------
NM_018120chr81978 --11349 --
NM_018121chr1032273 2088 1048 --1231 12985
NM_018125chr11168 ----1129
NM_018126chr4--11584 ----
NM_018181chr181322 ------
NM_018184chr341435 588 577 120 1830 1252 --
NM_018202chr1----1327 --
NM_018205chr1062324 2077 1965 1769 1612 36 --31841 793 523 1621
NM_018239chr1062324 2077 1965 1769 1612 36 --31841 793 523 1621
NM_018254chr1--12062 1705 --
NM_018302chr422311 2082 2491 384 --1582
NM_018307chr171636 --1102 --
NM_018314chr111281 ------
NM_018325chr921311 447 --11124 --
NM_018334chr71446 ------
NM_018362chr1123352 3186 ------
NM_018403chr343660 3277 2961 2502 1456 129 13484
NM_018427chr1651340 1299 589 538 106 ------
NM_018439chr1842362 991 868 80 1274 ----
NM_018440chr888143 8068 7827 7603 6965 6353 3446 1882 26405 1600 36601 2659 1968 --
NM_018448chr12----11098 --
NM_018469chr1711351 ----1526
NM_018471chr2--1198 ----
NM_018489chr152180 1752 1642 1566 251 1924 ----
NM_018490chr11----1463 1270
NM_018553chr1721761 354 --21415 198 --
NM_018566chr164875 4820 4192 3796 3628 881 ------
NM_018571chr21453 1187 ----
NM_018640chr1232723 1970 182 21106 561 ----
NM_018644chr113768 297 224 1601 2700 367 --
NM_018652chr152989 180 1957 ----
NM_018689chr1542360 2137 1893 1692 ------
NM_018695chr5--21702 1516 1370 --
NM_018711chr1261516 1215 1175 534 509 316 11567 141 --
NM_018717chr451866 1832 699 427 283 --21770 999 1841
NM_018719chr711044 11187 11088 1185
NM_018834chr51241 ------
NM_018836chr13466 313 262 1193 1442 137
NM_018840chr201358 ------
NM_018844chr741986 1859 690 474 11357 11523 --
NM_018948chr14556 348 77 25 1143 ----
NM_018963chr211617 --1208 --
NM_018999chr1043679 1926 578 28 --24309 1190 --
NM_019006chr151250 ----190
NM_019027chr412087 ----1976
NM_019045chrX1342 ------
NM_019049chr1------1515
NM_019072chr511674 24010 2923 ----
NM_019083chr11562 11368 ----
NM_019106chr2282784 2473 2147 669 572 558 470 208 --12269 --
NM_019116chr1643240 2728 2612 86 ----1753
NM_019556chrX1504 ------
NM_019557chr11127 ------
NM_019596chr2162584 2530 693 635 376 215 11005 ----
NM_019610chr111596 ------
NM_020122chr295371 4908 4883 4033 3703 1256 871 730 214 12090 ----
NM_020123chr10--11003 ----
NM_020141chr121958 1681 --1239 --
NM_020144chr711732 ----11502
NM_020150chr1042179 1666 493 412 ------
NM_020177chr52939 673 --1298 --
NM_020182chr2083334 3145 2741 2594 751 725 710 580 --21130 805 --
NM_020193chr1111095 ------
NM_020199chr51181 --11171 --
NM_020205chr11317 23269 1311 2827 220 1951
NM_020225chr4--1175 ----
NM_020228chr11----176 --
NM_020240chr52950 154 --12446 --
NM_020338chr10102985 2550 2439 2313 1434 1148 781 653 423 107 11156 ----
NM_020348chr103783 532 43 22260 1942 12069 --
NM_020429chr782761 2240 2090 1077 817 473 87 23 ------
NM_020432chr711485 1595 ----
NM_020440chr162909 2277 1215 1045 948 369 22385 788 11320 11316
NM_020443chr166899 6585 4676 4342 1088 646 188 16409 --
NM_020449chrX1297 ------
NM_020452chr1101857 1830 1585 1519 1385 1365 724 689 443 46 138 --1222
NM_020456chr1352050 1812 1653 1509 336 2645 606 ----
NM_020673chr2096290 6148 5639 5218 2762 2529 1868 1554 715 36935 5943 1064 ----
NM_020699chr195115 4766 4415 4323 1927 1612 1585 1396 600 14676 34663 3868 3696 --
NM_020706chr21----150 --
NM_020708chr2071918 1630 1585 877 198 190 53 --11689 12247
NM_020713chr2072535 2455 2148 1970 1226 1215 1161 2747 190 32413 944 62 1308
NM_020717chrX174946 4895 4174 3874 3650 3175 1927 1774 1653 1353 1255 1150 1078 758 504 484 415 11368 ----
NM_020728chr743137 2874 2823 2218 ----22168 2126
NM_020734chr1242573 2087 1252 1195 ------
NM_020739chr1532882 998 480 --23655 1004 --
NM_020747chr5--1152 ----
NM_020752chr1012792 ------
NM_020760chr2--1401 ----
NM_020766chrX53318 3286 2822 181 111 23712 1684 ----
NM_020772chr1778283 2046 1687 1249 562 99 43 57419 3029 2885 1479 1193 ----
NM_020774chr1814694 14334 24273 1939 --
NM_020801chr5--1242 11022 --
NM_020804chr692493 2288 2247 2239 2198 1891 1768 832 157 32321 2155 165 21740 175 --
NM_020805chr1821284 672 ----11440
NM_020807chr16101692 1449 1204 1140 605 592 527 417 159 146 ------
NM_020810chr1432757 720 607 23491 961 1812 --
NM_020814chr261217 488 319 142 102 81 2894 50 11078 --
NM_020826chr1153226 2661 1075 598 294 1172 --22812 466
NM_020841chr121131 1859 ----
NM_020845chr1262315 2140 487 234 210 115 --22160 592 --
NM_020850chr1692974 2962 820 814 802 767 107 85 47 22800 753 23037 2124 --
NM_020868chr2--1504 ----
NM_020871chrX--1394 --12012
NM_020873chr3----1117 --
NM_020886chr1111216 ------
NM_020919chr221134 41 --1353 --
NM_020927chr1632334 1854 371 ------
NM_020935chr254511 1636 1585 1406 123 --11257 --
NM_020940chr1022122 1027 12662 --1554
NM_020951chr1931657 1507 395 ------
NM_020956chr19174716 4708 4090 3966 3739 3544 3238 3229 3046 1499 1441 1234 1035 988 940 598 136 23722 3708 11691 --
NM_020964chr1873792 3630 3550 3076 1331 749 603 13229 33786 276 94 --
NM_020967chr2041114 991 422 72 --11079 --
NM_020972chr48834 709 273 225 194 174 141 113 3404 258 133 1439 --
NM_020977chr421650 882 1754 ----
NM_020983chr1292261 2118 1822 1804 820 377 296 272 84 1547 ----
NM_021019chr12169 ------
NM_021020chr8123368 2810 2642 2470 2399 1343 1144 1128 1087 629 540 490 --33351 1326 50 --
NM_021033chr131458 1633 11058 --
NM_021069chr4124 ----1150
NM_021096chr22123268 3122 2970 2954 2825 2481 2466 2291 1145 887 352 148 42424 2280 662 408 33088 2791 109 1119
NM_021109chrX1333 ------
NM_021109chrX1333 ------
NM_021120chrX72652 2460 2441 2419 1175 866 288 23008 2601 --12549
NM_021135chr6102233 1292 1192 1069 1046 833 289 106 87 69 --1444 --
NM_021159chr411267 ------
NM_021183chrX------1695
NM_021189chr12665 378 182 3816 404 92 --
NM_021190chr12407 84 --1184 --
NM_021202chr2062780 2393 1240 1028 1016 749 --1512 32655 1062 758
NM_021229chr12--160 ----
NM_021238chr1221434 258 11489 ----
NM_021255chr1432754 1130 478 ----12901
NM_021629chr343369 1979 1928 267 13446 11723 --
NM_021738chr101113 ------
NM_021804chrX2668 605 1695 ----
NM_021813chr624764 1132 ----11486
NM_021911chr534461 1002 856 43917 2094 1027 744 --24182 749
NM_021943chr692137 1983 1879 1645 1457 1389 786 742 557 11725 ----
NM_021960chr132151 2128 1957 ------
NM_021961chr1147238 5061 4631 2755 21497 359 32847 1512 320 --
NM_021962chr1762298 2185 2128 1644 1609 720 --21977 1587 --
NM_021964chr356227 6129 2474 430 403 25231 923 ----
NM_021977chr633210 775 72 23388 147 ----
NM_022048chr1586009 5559 4512 2394 2190 1851 222 167 46066 5086 2027 1037 11942 --
NM_022054chr143780 303 26 135 ----
NM_022058chr211356 --1705 --
NM_022060chr1421051 993 1943 2517 115 --
NM_022079chr101830 ------
NM_022093chr11665 ------
NM_022114chr1104666 4091 3461 3039 3018 1269 946 272 189 33 --43684 1036 770 466 --
NM_022117chrX----1163 --
NM_022166chr1694908 4551 4372 2064 2035 1788 1563 1535 1022 45383 4193 1780 357 35423 2210 1892 --
NM_022171chr351552 1473 589 137 116 1641 ----
NM_022340chr372877 1400 1285 1170 723 427 96 1339 1987 --
NM_022459chr1346218 1419 964 479 --11655 --
NM_022461chr31109 ----1885
NM_022465chr1252450 2337 2231 1923 1197 22014 950 12090 12019
NM_022469chr111006 12744 12161 23390 652
NM_022474chr1442712 2131 1793 433 1257 ----
NM_022476chr163684 153 73 1315 ----
NM_022477chr2031276 1119 1095 11702 ----
NM_022491chr1233390 1405 493 22440 1220 ----
NM_022497chr323061 684 21392 1227 1925 --
NM_022648chr2114222 4102 3572 3087 1438 1189 920 730 476 157 21 13812 23803 1327 --
NM_022658chr1211156 ------
NM_022719chr2273282 2434 1343 510 195 67 39 32709 1282 1116 12478 149
NM_022726chr6--1530 ----
NM_022735chr11572 --1236 --
NM_022739chr171287 1870 168 --
NM_022748chr752614 2570 2019 1963 384 22899 2145 1563 --
NM_022755chr982289 2215 2029 1721 1710 1683 619 292 1613 ----
NM_022776chr321209 394 ------
NM_022780chr211818 ------
NM_022826chr21812 ------
NM_022831chr11163 ------
NM_022841chr151492 ------
NM_022842chr323173 320 --11014 145
NM_022845chr1621831 560 1741 ----
NM_022894chr21407 11254 ----
NM_022912chr212905 --1932 --
NM_022918chr1111487 ----1530
NM_022970chr1041187 564 81 62 1361 ----
NM_022977chrX12319 1241 1454 --
NM_023037chr1321062 813 ------
NM_023076chr1642325 1164 920 902 --22347 647 --
NM_023079chr1731656 314 266 --21348 480 11763
NM_023929chr822841 429 ------
NM_024007chr533097 194 78 ----12283
NM_024052chr173530 481 470 --23111 444 --
NM_024060chr111244 ------
NM_024076chr1982276 1956 1740 1673 500 455 319 51 --21756 1715 --
NM_024090chr431860 1189 298 1756 ----
NM_024297chr171463 --1579 --
NM_024345chr966072 5354 5097 1804 1753 1367 26128 2071 12030 --
NM_024411chr2041215 618 342 23 --1948 --
NM_024430chr1851321 582 337 325 180 2756 64 ----
NM_024490chr153396 387 171 ----1405
NM_024496chr14----1743 --
NM_024525chr11567 1421 1516 --
NM_024529chr1--1752 ----
NM_024567chr81466 ------
NM_024569chr162512 2312 2172 1060 1006 45 12631 ----
NM_024607chr854429 3692 3073 761 703 --31214 1164 29 --
NM_024659chr24692 143 104 60 ------
NM_024665chr354094 3858 3579 3484 179 1633 ----
NM_024674chr142643 2617 2266 359 12694 159 --
NM_024689chrX21276 545 ------
NM_024692chr211482 ------
NM_024698chr116995 294 139 132 125 116 180 2905 38 --
NM_024742chr1631905 583 255 11558 11623 --
NM_024744chr231734 953 867 12388 ----
NM_024761chr964209 3914 3906 1892 701 114 --1538 --
NM_024770chr276707 6700 5089 2127 1606 856 419 36312 4950 994 25284 4198 36274 5667 2685
NM_024786chr54290 188 134 80 --1343 --
NM_024804chr11358 ------
NM_024811chr1141734 1230 1203 701 11391 1743 --
NM_024857chr171272 ------
NM_024881chr1973363 3117 2597 1307 891 434 277 33696 755 338 1759 --
NM_024887chr131949 1827 47 --11706 1703
NM_024900chr442158 2082 1923 283 22346 46 --1541
NM_024900chr442158 2082 1923 283 22346 46 --1541
NM_024947chr348233 8075 7482 7192 26014 658 12677 15906
NM_024949chr484626 4343 4093 3997 3759 1822 745 718 --13217 --
NM_024953chr1212513 ------
NM_024979chr1371428 437 228 206 152 134 111 --11643 --
NM_024989chr298056 7845 6964 6943 6773 3163 2359 1519 573 --15318 --
NM_025054chr833576 2787 812 11267 --14051
NM_025076chr21521 ------
NM_025134chr16--12557 ----
NM_025146chr312485 --1337 --
NM_025151chr81686 12039 --11640
NM_025160chr134281 4191 1472 22811 860 ----
NM_025179chr1124677 4427 4353 4134 4089 3327 3307 3044 1968 1614 523 99 --13274 --
NM_025191chr111008 12679 ----
NM_025195chr811905 --11815 1284
NM_025221chr411314 ------
NM_025235chr101265 21608 832 ----
NM_025237chr1741569 1518 636 211 2439 122 --11261
NM_030576chr1772405 1747 1697 854 819 647 50 31758 1606 137 52477 2440 1682 552 141 1543
NM_030579chr1673431 2926 2833 2462 2332 367 180 1867 11031 --
NM_030621chr1443391 2602 1586 1530 ------
NM_030624chrX--155 ----
NM_030625chr101731 ------
NM_030627chr5--33097 2889 580 1716 --
NM_030647chr7106064 5290 4343 4305 4222 1935 1805 1062 764 261 11512 ----
NM_030650chr254236 4220 3403 3019 1506 1969 ----
NM_030670chr1231694 816 662 --1479 --
NM_030671chr1231694 816 662 --1479 --
NM_030762chr121701 --3480 75 37 --
NM_030796chr742107 1937 1392 343 22124 881 1817 --
NM_030799chr522007 801 --22147 607 --
NM_030802chr172740 695 1346 1810 --
NM_030806chr1209146 8561 8229 7616 7376 7285 7121 7088 6913 6874 5695 3304 3038 3028 2973 2916 2868 2737 1843 554 17728 21689 1211 --
NM_030820chr61343 11043 ----
NM_030881chr221429 --22073 978 --
NM_030918chr1125392 5110 4314 3710 3690 3509 2163 2143 2010 1708 1591 800 34488 3472 889 ----
NM_030920chr121913 193 ------
NM_030939chr62779 85 1469 ----
NM_030964chr573094 1275 850 839 653 255 249 --12473 --
NM_030971chr1051484 1183 583 554 101 1203 --11540
NM_031216chr18------11705
NM_031243chr741949 1785 466 168 1159 --1905
NM_031262chr9--1373 1216 --
NM_031263chr9--1430 1273 --
NM_031268chr16145417 4880 4542 4504 4161 3759 2054 2023 1674 1377 1119 1109 927 114 1895 --13864
NM_031296chr431946 608 250 1420 ----
NM_031309chr851843 1715 617 497 374 --31922 1498 418 1476
NM_031369chr41793 ----1272
NM_031370chr41793 ----1272
NM_031371chr11285 ------
NM_031371chr11285 ------
NM_031427chr14105615 5464 4627 4607 4346 3740 3707 1787 1736 1143 14398 14900 --
NM_031439chr82134 64 31826 1456 107 ----
NM_031442chrX42186 1263 406 342 22897 2048 22674 2017 --
NM_031453chr1052175 1995 367 104 41 172 ----
NM_031455chr101126 --31336 529 30 2617 282
NM_031461chr82713 648 190 ----
NM_031468chr786417 6095 2749 2402 916 724 691 189 25002 2298 1643 --
NM_031844chr133671 3493 2983 ------
NM_031845chr233588 2766 916 1558 ----
NM_031847chr233588 2766 916 1558 ----
NM_031886chr1951825 1805 1668 683 59 22501 2346 12082 12133
NM_032013chr2031276 1119 1095 11702 ----
NM_032041chr862612 2584 2202 2185 1012 188 --130 11041
NM_032102chr11--12908 1644 --
NM_032105chr1107248 6669 6499 6041 5850 5766 5367 4894 1375 111 47575 5924 2445 889 12394 --
NM_032144chr211316 ------
NM_032148chr12----1365 --
NM_032160chr1843053 1648 1409 254 ------
NM_032174chr161460 1248 1062 379 185 83 11145 1122 --
NM_032182chr1021033 636 ------
NM_032186chr111403 1140 --1521
NM_032213chr25906 821 222 183 68 --2857 264 --
NM_032221chr201166 --32049 1338 785 --
NM_032231chr15--1110 ----
NM_032242chr373005 2733 2724 798 754 347 52 32428 994 634 21077 454 --
NM_032281chr1972984 2898 2837 1199 316 182 43 --22637 758 12542
NM_032288chr311912 ------
NM_032311chr2231789 681 35 --11259 --
NM_032317chr751536 1490 705 291 232 --11122 11419
NM_032373chr101928 2965 585 ----
NM_032377chr191635 ------
NM_032438chr61572 ----1319
NM_032440chr1012352 --1294 --
NM_032445chr1542593 2261 2153 827 11838 ----
NM_032457chr413759 --11497 --
NM_032458chrX32981 2130 346 1660 ----
NM_032491chr12------1256
NM_032521chr2072643 2543 1262 1046 757 668 26 --1347 --
NM_032547chr41210 ------
NM_032580chr17266 43 --1446 --
NM_032590chr1221166 779 ------
NM_032594chr14--1190 ----
NM_032596chr9----1109 1139
NM_032632chr1411736 ------
NM_032689chr1951311 1299 1203 602 296 ----11394
NM_032711chr17104144 3553 3373 3246 3121 1584 1344 993 284 261 --43968 3583 2808 1724 24164 800
NM_032782chr52246 208 --2900 106 --
NM_032784chr61650 1857 ----
NM_032788chr241612 1055 996 509 --11562 --
NM_032801chr1162359 2343 2193 2089 98 31 ------
NM_032822chr24996 300 236 26 21083 897 ----
NM_032842chr71562 ------
NM_032873chr1123783 3688 22910 627 1453 --
NM_032900chr1063570 3078 2938 2443 1353 1248 21293 653 21540 1113 13761
NM_032932chr17126084 6054 5827 5758 5254 5238 4076 4068 3967 2395 1957 248 --34388 1489 615 123
NM_032968chrX53800 1210 958 702 260 ------
NM_032969chrX53800 1210 958 702 260 ------
NM_032973chrY53792 1210 958 702 260 ------
NM_033132chr131450 ------
NM_033133chr1773127 3080 1437 1135 379 352 214 22680 2504 12386 23414 3409
NM_033136chr531278 294 70 --21197 347 --
NM_033137chr531278 294 70 --21197 347 --
NM_033141chr1462176 2007 1964 1484 153 42 --3365 307 183 --
NM_033181chr623560 2890 ------
NM_033201chr162440 174 3789 767 220 ----
NM_033211chr5--21459 202 ----
NM_033224chr797721 7294 6776 6433 5867 5287 2216 1279 115 26143 343 37875 7803 5944 --
NM_033274chr561387 1165 1031 906 528 51 33465 1243 966 --1392
NM_033285chr872973 1747 1693 1371 1204 930 711 ----14123
NM_033305chr9--11211 ----
NM_033315chr1741476 814 471 44 1560 31970 1563 152 --
NM_033326chr1132388 848 544 21548 822 --1503
NM_033331chr92709 21 --21098 1062 --
NM_033334chr91195 ------
NM_033360chr1234240 3439 319 ------
NM_033375chr1761389 1255 1149 230 224 166 11038 --1396
NM_033389chr1783342 1892 1559 1542 1262 701 575 133 --34409 3754 1915 13750
NM_033393chr462377 2212 1085 916 851 631 --21794 697 --
NM_033425chr1141078 990 741 413 12930 ----
NM_033429chr1553130 2154 843 645 639 --21167 776 --
NM_033449chr582047 1746 1501 641 561 519 491 162 182 21972 721 --
NM_033503chr1563792 3568 3184 2845 1450 754 12360 1481 12432
NM_033551chr5103255 3192 3074 2814 2589 2578 2372 1345 1288 1101 13118 ----
NM_033631chr153814 3465 3243 2972 2800 13797 1129 1636
NM_033637chr1062644 1203 1147 1022 942 550 23265 516 1139 13370
NM_033642chrX----1126 --
NM_033656chr2145359 4506 973 916 33919 736 725 ----
NM_052840chr1531012 260 201 ----1217
NM_052847chr1973257 2542 2412 2393 994 724 482 12312 11241 180
NM_052885chr1223751 344 1463 ----
NM_052886chr821329 120 --1841 --
NM_052898chr8--185 21474 54 190
NM_052900chr811437 ------
NM_052904chr61463 1270 ----
NM_052906chr22174730 4020 3923 3893 3226 1982 1914 1894 1829 1453 1407 1046 760 427 400 77 31 --44851 4294 861 299 13203
NM_052910chr1331600 441 29 22084 706 ----
NM_052918chr1043216 2350 1237 817 13083 --11494
NM_052927chr532209 1883 1671 154 1625 --
NM_052934chr192037 1829 1806 692 420 195 114 94 33 --11999 --
NM_052978chr143519 446 85 1285 --11446
NM_053001chr81278 ------
NM_053046chr191564 ----1497
NM_053064chr1432402 906 53 11009 --11971
NM_054016chr11750 ------
NM_054016chr11750 ------
NM_054016chr11750 ------
NM_054025chr113768 297 224 1601 2700 367 --
NM_057158chr8129 2578 210 ----
NM_057178chr1742815 1783 106 79 11051 ----
NM_058172chr421164 727 ----1457
NM_058241chr241966 941 874 582 ------
NM_058241chr241966 941 874 582 ------
NM_080599chr10--1487 1915 --
NM_080618chr20----1838 --
NM_080626chr12--1300 ----
NM_080645chr632007 1692 1498 21430 557 ----
NM_080669chr17114326 3953 3939 3614 3539 3413 3096 1682 1343 768 238 34094 3854 1368 23348 3136 --
NM_080676chr2041226 994 963 631 23283 621 2729 625 --
NM_080678chr2--1655 ----
NM_080732chr191564 ----1497
NM_080738chr152044 1480 1256 660 613 ------
NM_080743chr622325 2261 1406 ----
NM_080759chr131285 ------
NM_080760chr131285 ------
NM_080829chr203942 241 122 1161 1290 --
NM_080872chr843712 410 327 25 --13828 --
NM_100264chr103884 270 239 ------
NM_100486chr103884 270 239 ------
NM_130438chr2121285 559 12239 ----
NM_130439chr10----1189 129
NM_130439chr10----1189 129
NM_130440chr161560 1363 1126 1006 635 551 11197 1528 1118
NM_130782chr11288 ------
NM_130798chr152344 73 1133 11154 --
NM_130808chr3124 ------
NM_130811chr2021022 373 ------
NM_130830chr3123971 3950 3597 3563 2926 2878 2736 2512 1314 1039 534 166 --23524 21 --
NM_130831chr322480 782 12537 ----
NM_130832chr322480 782 12537 ----
NM_130833chr322480 782 12537 ----
NM_130834chr322480 782 12537 ----
NM_130835chr322480 782 12537 ----
NM_130836chr322480 782 12537 ----
NM_130837chr322480 782 12537 ----
NM_133177chr151072 435 381 361 39 1888 3892 287 165 --
NM_133178chr151072 435 381 361 39 1888 3892 287 165 --
NM_133264chr1753268 1500 1488 1219 340 22657 2464 13236 23109 1194
NM_133370chr432276 1211 972 13158 ----
NM_133468chr722324 1784 2856 117 12563 --
NM_133486chrX----139 --
NM_133631chr31104 ------
NM_134265chr1711102 --3859 815 332 --
NM_134424chr1221033 170 11207 ----
NM_138288chr1421623 1408 ------
NM_138346chr11156 ------
NM_138357chr10----3495 328 99 --
NM_138444chr1374635 3966 3573 1504 740 534 66 ------
NM_138457chr6103370 3285 2949 2726 2515 2475 389 333 222 174 --31228 302 23 --
NM_138559chr221234 120 --1130 --
NM_138578chr2011087 ------
NM_138635chr732820 920 205 32037 929 179 --13220
NM_138693chr7189 1285 ----
NM_138694chr663305 3196 3143 933 505 322 ----11350
NM_138730chr6--1353 ----
NM_138773chr51859 ------
NM_138782chr53941 656 520 ------
NM_138795chr1101571 1379 1361 1352 1172 1164 1127 633 428 137 --11328 --
NM_138959chr1106685 6383 5254 4824 4812 2119 1372 1342 1209 171 35032 2598 1015 11360 --
NM_138967chr1561650 950 899 313 134 86 --2822 28 12291
NM_138971chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_138971chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_138972chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_138972chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_138973chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_138973chr1163620 3264 2551 1375 1204 411 23304 100 1983 --
NM_139035chrX----197 --
NM_139072chr21363 ------
NM_139157chr11--2685 273 239 22 --
NM_139168chr5--11957 ----
NM_139215chr17157 ------
NM_139241chr12----1175 --
NM_139244chr62390 295 ----1713
NM_139245chr361632 1268 631 593 478 264 ------
NM_139246chr931775 914 264 1214 22203 794 --
NM_139248chr3----1847 --
NM_139276chr1732039 1783 802 --11912 11521
NM_144570chr1682723 2570 2431 2307 2063 1907 700 25 13035 --1292
NM_144571chr435869 4402 2376 1501 ----
NM_144586chr2----2376 280 --
NM_144590chr1042833 2334 997 740 21091 354 ----
NM_144628chr2032268 896 105 22523 1883 1172 --
NM_144635chr341029 839 496 174 --4989 791 94 55 --
NM_144658chrX----1241 --
NM_144660chr10--1303 --1316
NM_144728chr12711 303 ------
NM_144729chr12711 303 ------
NM_144775chr17124774 4467 4184 3634 1902 1891 1566 966 907 615 607 323 1289 2819 725 1815
NM_144963chr812027 ------
NM_144973chr1235033 956 94 21884 1105 21833 1389 --
NM_145000chr51412 ------
NM_145011chr1022024 2002 1352 11921 --
NM_145013chr1152242 956 600 358 144 1566 32017 656 591 --
NM_145025chr61204 ------
NM_145055chr1853759 2490 2467 2332 1104 22842 2746 ----
NM_145112chr141966 --175 --
NM_145113chr1411238 --1347 --
NM_145165chr1452448 2348 1796 220 173 12105 --1671
NM_145176chr622866 575 33460 2830 289 ----
NM_145203chr13------130
NM_145246chr103858 378 261 ------
NM_145259chr225102 4553 52733 2624 1901 1284 414 ----
NM_145307chr1054284 4168 1819 1597 1550 13332 14274 --
NM_145686chr283023 2789 2391 1255 451 438 84 36 13062 ----
NM_145687chr283023 2789 2391 1255 451 438 84 36 13062 ----
NM_145698chr1011396 ------
NM_145756chr181436 ------
NM_145805chr15--1531 ----
NM_145808chr732142 2032 1085 ------
NM_145861chr152044 1480 1256 660 613 ------
NM_145891chr1631362 1098 305 --11356 --
NM_145892chr1631362 1098 305 --11356 --
NM_145893chr1631484 1220 427 --11478 --
NM_145912chr22144036 3901 3370 3344 3334 1533 1512 726 667 536 525 417 315 24 33075 1835 344 14163 13610
NM_147147chr6104205 3970 3452 1441 1374 1345 1303 826 750 453 ------
NM_147150chr983356 2794 2786 2530 1388 1349 1086 910 12761 ----
NM_147168chr9----1109 1139
NM_147171chr71424 ------
NM_147175chrX--1770 --11345
NM_147181chr411314 ------
NM_147182chr411314 ------
NM_147183chr411314 ------
NM_147185chr71424 ------
NM_148174chr811934 ------
NM_148898chr7--11036 ----
NM_148899chr7--11036 ----
NM_148960chr171681 1415 1285 1258 734 229 147 11981 ----
NM_148976chr11----199 --
NM_152237chr223541 255 86 --21756 1432 --
NM_152253chr2293591 1283 1245 1048 538 426 305 139 45 23737 1521 1587 13058
NM_152263chr195741 3902 2317 2030 1359 1277 1189 1173 378 35291 4583 4273 36009 4587 4222 --
NM_152267chr2251831 1656 537 298 147 1331 132 --
NM_152277chr51576 ------
NM_152278chrX--1596 ----
NM_152280chr133039 2143 408 --12940 12355
NM_152300chr1721474 201 ------
NM_152344chr1731394 1078 66 2540 460 --11330
NM_152388chr263452 3192 2939 2577 1624 1369 ----1707
NM_152406chr52653 608 1119 11328 --
NM_152414chr81122 ----1110
NM_152431chr113393 334 267 ----1383
NM_152446chr14------1641
NM_152470chr18103710 3393 3382 3137 2578 1621 905 834 286 101 1426 22760 853 13699
NM_152496chr141332 876 219 165 1250 11282 --
NM_152522chr2--1237 ----
NM_152523chr21222 ------
NM_152529chr244106 3321 562 160 21480 614 13271 --
NM_152556chr72127 116 --1198 --
NM_152588chr1221303 375 2245 113 1673 --
NM_152594chr152941 210 ------
NM_152599chr17121 ------
NM_152622chr543149 902 713 525 23046 603 1205 --
NM_152624chr554914 1933 1196 947 105 14858 ----
NM_152629chr954000 3544 1637 1196 256 --33062 160 120 --
NM_152695chrX22114 1931 ------
NM_152699chr343617 2864 2279 1101 2854 273 ----
NM_152709chr10------145
NM_152724chr1022400 234 12452 1960 --
NM_152744chr752531 2417 612 388 26 32926 2567 867 12901 --
NM_152749chr721007 805 --198 1188
NM_152774chr712574 ------
NM_152787chrX43429 2951 2945 205 23000 401 ----
NM_152793chr764628 3252 3240 1401 400 330 --14087 --
NM_152838chr2023509 762 21156 137 ----
NM_152890chr1153 ----1339
NM_152896chr9----1757 --
NM_152924chr1595060 4905 4866 4378 2592 1668 501 242 120 26541 844 24689 2332 26399 4613
NM_152989chr12------11647
NM_152991chr113465 125 63 ----1618
NM_152995chr41726 ----1254
NM_152999chr741954 1814 1441 1145 1691 11082 --
NM_153020chr61395 --1134 --
NM_153029chr16104092 1575 1448 1382 1325 1045 790 634 607 34 ------
NM_153035chr183257 2960 2786 2484 2184 584 526 34 12715 12140 22428 2419
NM_153184chr311258 --1335 --
NM_153251chr131197 ------
NM_153262chr112134 1815 1194 --
NM_153273chr37881 768 607 518 426 284 48 22026 509 32030 386 346 --
NM_153331chr32280 211 ------
NM_153341chr1185 ------
NM_153365chr452740 2532 2114 2061 1029 11810 --1782
NM_153367chr1063571 3352 1342 987 213 25 --13456 --
NM_153450chr112326 181 ------
NM_153456chr1395632 4499 4263 2219 2067 1622 1411 1251 918 25295 5139 ----
NM_153607chr542770 2296 782 502 1187 ----
NM_153619chr1532956 2826 318 11104 1123 --
NM_153649chr142258 1584 1577 472 21766 1717 ----
NM_153756chr131453 572 49 11981 1367 --
NM_153810chr1044951 4363 1584 56 44879 818 780 71 ----
NM_170665chr1243578 3384 3366 3225 23429 3232 23262 485 13085
NM_170674chr1521190 258 11007 --149
NM_170675chr151866 ------
NM_170676chr151866 ------
NM_170677chr1521190 258 11007 --149
NM_170706chr194136 3651 3493 3409 3065 931 653 639 148 --11393 --
NM_170731chr1142190 1989 1822 613 1809 11146 --
NM_170732chr1142190 1989 1822 613 1809 11146 --
NM_170733chr1142190 1989 1822 613 1809 11146 --
NM_170734chr1142190 1989 1822 613 1809 11146 --
NM_170735chr1142190 1989 1822 613 1809 11146 --
NM_171825chr572764 2736 2415 2294 1975 184 39 22706 1135 ----
NM_172069chr212030 22181 527 1501 --
NM_172071chr1116582 6532 5791 5749 5463 2828 2657 2120 998 569 304 ------
NM_172078chr7131 ------
NM_172079chr7131 ------
NM_172080chr7131 ------
NM_172081chr7131 ------
NM_172082chr7131 ------
NM_172083chr7131 ------
NM_172084chr7131 ------
NM_172127chr411893 11349 ----
NM_172169chr1021290 437 --1586 --
NM_172170chr1021290 437 --1586 --
NM_172171chr1021290 437 --1586 --
NM_172173chr1021290 437 --1586 --
NM_172216chr1282590 2535 1969 1873 962 917 537 489 32224 892 512 31980 516 108 --
NM_172315chr1521190 258 11007 --149
NM_172316chr1521190 258 11007 --149
NM_172373chr1311299 ------
NM_173054chr71807 ------
NM_173083chr111086 --11250 --
NM_173198chr942733 2475 900 723 --12897 1190
NM_173200chr942733 2475 900 723 --12897 1190
NM_173468chr445684 4611 1823 436 1468 22407 1770 11650
NM_173470chrX31093 924 39 ------
NM_173476chr1652163 2018 1995 310 139 2705 74 32261 1891 1419 22257 2252
NM_173495chrX52022 1682 869 592 568 21864 1772 --1460
NM_173500chr15--2905 228 ----
NM_173511chr222695 2458 ----13725
NM_173519chr831454 763 409 ------
NM_173576chr1042243 848 518 78 ------
NM_173582chr1134805 4729 1714 24510 48 --12134
NM_173595chr1294433 4089 3898 3846 3410 1236 225 178 116 --33498 1120 801 14597
NM_173642chr168934 8730 8614 6475 2948 2490 18210 68052 7805 6628 6097 2484 2204 22646 2222
NM_173654chr32838 304 ------
NM_173667chr532019 1624 871 --11511 --
NM_173683chr8------11508
NM_173794chrX189 ------
NM_173808chr121728 703 12944 24114 4019 --
NM_173809chr1021444 25 11089 ----
NM_173825chr342511 1995 615 299 ------
NM_173829chr594601 4593 4426 4342 4129 3845 2048 1728 734 --15561 --
NM_173832chr8152643 2624 2496 1348 1323 1298 1273 1248 1223 1198 1173 1148 1123 1015 195 32829 355 261 52833 2517 1479 1113 98 22540 912
NM_173851chr831477 724 684 13742 ----
NM_174856chr20----1120 --
NM_174911chr843049 2634 1299 422 13645 3548 483 21 22421 934
NM_174921chr411185 168 ----
NM_174934chr11113180 2940 2678 2260 1203 1165 642 619 180 144 29 --21309 329 --
NM_174958chr177940 853 835 641 237 208 27 --196 --
NM_175058chr1161322 954 479 190 50 24 ------
NM_175607chr31414 ------
NM_175610chr1511162 ------
NM_175612chr31414 ------
NM_175709chr2262981 2666 2626 2481 1991 878 32342 1172 239 12992 12495
NM_175734chr17163 ------
NM_175747chr6----1776 --
NM_175748chr1452001 1618 757 625 360 1579 ----
NM_175861chr1245596 4066 3725 84 23846 1596 1382 --
NM_175866chr111364 1219 ----
NM_175902chr171277 ------
NM_175913chr2021074 940 2913 799 11029 --
NM_176081chr1075730 4892 3959 2012 1782 1241 305 ------
NM_176083chr1075730 4892 3959 2012 1782 1241 305 ------
NM_176823chr133914 2928 455 33115 3044 2743 1217 --
NM_176871chr8103328 3244 3210 2993 2943 2740 2508 441 357 145 11062 23077 2313 --
NM_177398chr131784 750 661 11218 --1599
NM_177399chr131784 750 661 11218 --1599
NM_177414chr131166 298 214 --1416 --
NM_177438chr1443391 2602 1586 1530 ------
NM_177452chr141581 --2790 238 --
NM_177556chrX171 ------
NM_177559chr202946 33 --11089 --
NM_177560chr202946 33 --11089 --
NM_177972chr1194235 3714 3707 3260 1725 1356 1093 728 182 --32726 366 44 --
NM_177996chr2042845 2666 1364 1300 ----22303 227
NM_177999chr973160 3092 2671 1208 909 820 151 43652 3177 2901 867 23693 704 --
NM_178010chr12------11647
NM_178011chr1023038 451 23127 229 ----
NM_178026chr20153 1146 ----
NM_178037chr1243607 2935 2366 691 21191 334 12910 --
NM_178038chr1243607 2935 2366 691 21191 334 12910 --
NM_178123chr2--1962 ----
NM_178126chr1762071 1863 1630 784 697 394 --11755 --
NM_178136chr2231789 681 35 --11259 --
NM_178151chrX86448 5103 3154 2466 1151 350 85 22 130 ----
NM_178152chrX86448 5103 3154 2466 1151 350 85 22 130 ----
NM_178153chrX86448 5103 3154 2466 1151 350 85 22 130 ----
NM_178190chr1--150 --143
NM_178191chr1--11391 --11384
NM_178554chr3102997 2228 1205 1071 1032 875 449 346 210 76 22962 828 22579 767 12303
NM_178578chr2062076 1833 1650 938 497 157 31757 1035 767 ----
NM_178585chr453229 2187 812 331 163 ------
NM_178812chr8190 ------
NM_178818chr1632440 1618 284 --11644 --
NM_178832chr103487 115 83 11140 ----
NM_180989chr1322186 1545 ----1118
NM_181077chr1542158 922 540 104 1890 11455 --
NM_181349chr782761 2240 2090 1077 817 473 87 23 ------
NM_181351chr1111118 22092 61 22737 2719 --
NM_181358chr153424 3370 1511 566 126 11484 --14252
NM_181361chr31276 ----1130
NM_181453chr231472 576 502 ------
NM_181491chr9142978 2732 2538 2202 1978 1251 934 720 577 517 479 365 179 141 31205 427 124 53048 825 128 60 22 --
NM_181504chr542804 392 311 134 11035 ----
NM_181521chr1677221 6399 6259 5065 4602 522 485 --16425 --
NM_181523chr542804 392 311 134 11035 ----
NM_181524chr542804 392 311 134 11035 ----
NM_181645chr111215 ------
NM_181659chr2033192 2077 1051 ----1872
NM_181659chr2033192 2077 1051 ----1872
NM_181715chr14378 279 273 79 --1299 --
NM_181782chr631521 270 177 1137 ----
NM_181787chr853130 2965 2810 2659 145 22932 87 12881 --
NM_181828chr2273774 3692 3644 1165 595 384 250 1776 124 1677
NM_181829chr2273774 3692 3644 1165 595 384 250 1776 124 1677
NM_181830chr2273774 3692 3644 1165 595 384 250 1776 124 1677
NM_181832chr2273789 3707 3659 1180 610 399 265 1791 139 1692
NM_182515chr1996038 5836 5211 5050 4757 1320 1196 55 23 36681 2165 1050 ----
NM_182517chr11689 ------
NM_182527chr22102084 1714 1684 1565 1451 900 814 651 453 120 2444 437 21920 850 --
NM_182557chr1161844 1472 1370 895 586 574 --1880 11576
NM_182643chr812298 --22358 2186 11510
NM_182647chr2031548 120 64 1507 61256 1228 1130 469 256 42 --
NM_182664chr151841 1610 1594 616 486 1119 11641 --
NM_182697chr741227 562 499 478 --11428 --
NM_182700chr73651 643 524 1554 31527 452 376 --
NM_182763chr132140 2117 1946 ------
NM_182767chr12--21321 557 ----
NM_182797chr2011418 1607 1253 --
NM_182830chr1442226 914 491 227 ------
NM_182898chr711354 --14367 --
NM_182899chr711354 --14367 --
NM_182918chr211331 ------
NM_182935chr371831 1029 947 681 530 254 106 1172 1195 --
NM_182948chr1----166 --
NM_182970chr20134068 3953 3665 3571 2855 1643 1395 1340 993 646 508 487 360 12862 --1289
NM_182972chr112372 1301 21885 834 --
NM_183004chr1453710 3306 3141 1264 1154 12960 11275 --
NM_183049chr41329 ------
NM_183353chrX----11159 --
NM_183393chr3133 --1941 --
NM_183394chr3133 --1941 --
NM_194278chr1483210 2795 2628 1226 1193 567 294 49 13813 --1346
NM_194282chr463050 2861 2804 2297 1125 54 ------
NM_194285chr1142969 2918 510 32 ------
NM_194314chr154850 4687 1616 1310 52 15019 ----
NM_194317chr242364 1785 1736 806 ------
NM_194434chr1834929 2000 319 --12007 --
NM_194449chr181932 ----1353
NM_197968chr131555 ------
NM_198040chr161177 773 331 194 106 32 --155 11075
NM_198081chr642925 2780 893 383 --12466 --
NM_198123chr811437 ------
NM_198124chr811437 ------
NM_198128chr1822323 1960 ------
NM_198181chr152931 89 ------
NM_198268chr153424 3370 1511 566 126 11484 --14252
NM_198269chr153424 3370 1511 566 126 11484 --14252
NM_198270chrX63384 3154 3062 2878 1115 321 11399 12672 --
NM_198273chr511077 ----12043
NM_198291chr2031900 725 502 1716 11284 --
NM_198321chr562103 1248 1221 952 272 230 22045 783 175 --
NM_198392chr651993 795 435 412 362 ------
NM_198440chr22112423 2381 2279 2254 2194 2129 1595 910 865 566 205 12141 52188 1872 888 513 485 --
NM_198446chr1----1209 --
NM_198490chr3133484 3347 3304 3174 3137 3131 2891 2232 2202 1126 712 446 77 1433 43478 3325 1256 440 --
NM_198560chr3103089 3033 2873 2833 2332 1521 1339 1011 654 612 --53633 2772 2728 1407 326 --
NM_198573chr93139 73 52 ------
NM_198679chr9102483 2465 1921 1762 852 656 460 343 110 43 1213 22234 1000 1505
NM_198793chr322978 2683 24161 843 14165 --
NM_198834chr1772026 1923 1662 846 642 438 51 1576 ----
NM_198836chr1772026 1923 1662 846 642 438 51 1576 ----
NM_198837chr1772026 1923 1662 846 642 438 51 1576 ----
NM_198838chr1772026 1923 1662 846 642 438 51 1576 ----
NM_198839chr1772026 1923 1662 846 642 438 51 1576 ----
NM_198901chr7------21273 841
NM_198903chr5--1240 ----
NM_198904chr5--1240 ----
NM_198956chr73651 643 524 1554 31527 452 376 --
NM_199003chr811164 ------
NM_199005chr92848 92 1932 ----
NM_199039chr41745 ------
NM_199169chr2083334 3145 2741 2594 751 725 710 580 --21130 805 --
NM_199170chr2083334 3145 2741 2594 751 725 710 580 --21130 805 --
NM_199171chr2083334 3145 2741 2594 751 725 710 580 --21130 805 --
NM_199185chr5----192 --
NM_199189chr51241 ------
NM_199320chr442797 1179 929 146 12332 1622 --
NM_199320chr442797 1179 929 146 12332 1622 --
NM_199436chr221987 1222 1251 12694 --
NM_199437chr11----176 --
NM_199438chr11----176 --
NM_199439chr11----176 --
NM_199440chr21409 ------
NM_199454chr1104666 4091 3461 3039 3018 1269 946 272 189 33 --43684 1036 770 466 --
NM_199462chr1124460 4071 3647 3350 1998 1947 1631 955 904 763 564 147 --13862 24381 3408
NM_201269chr111403 1140 --1521
NM_201412chr161148 ------
NM_201436chr72781 746 --1631 --
NM_201516chr72837 802 --1687 --
NM_201517chr72781 746 --1631 --
NM_201524chr1661379 526 516 510 481 35 1498 ----
NM_201525chr1661379 526 516 510 481 35 1498 ----
NM_201542chr1----142 --
NM_201591chr421918 1830 ------
NM_201592chr421918 1830 ------
NM_201599chrX--1273 2987 370 --
NM_201624chr12403 245 ------
NM_201629chr9----1508 --
NM_203305chr962429 1975 1678 1037 904 367 11597 1451 --
NM_203327chr2074550 2814 1815 1182 436 332 117 --11257 11640
NM_203342chr132878 2758 494 11084 1602 --
NM_203343chr132878 2758 494 11084 1602 --
NM_203349chr15--21919 97 11923 11951
NM_203350chr12448 105 ------
NM_203351chr1772320 1968 1001 654 505 161 48 21918 436 ----
NM_203382chr531394 443 73 11382 189 --
NM_203446chr2151829 954 858 495 344 --1449 12833
NM_203459chr112072 12529 ----
NM_203463chr234051 1801 1490 23300 418 1721 11006
NM_203504chr4--12367 --12230
NM_203505chr4--12367 --12230
NM_203506chr1751965 1723 1469 890 572 --22018 468 --
NM_205836chr5164 1611 ----
NM_205861chr131949 1827 47 --11706 1703
NM_206594chr122693 2473 ----13663
NM_206595chr122693 2473 ----13663
NM_206814chr641404 940 388 189 21456 1104 --1335
NM_206839chr151248 ------
NM_206853chr663907 3025 2944 1417 485 292 12551 --13810
NM_206854chr655168 4286 4205 1746 1553 13812 1634 15071
NM_206855chr646133 5251 5170 2518 14777 11599 16036
NM_206866chr2122121 478 --1508 --
NM_206909chr897615 7531 7113 7104 5861 3245 1411 1369 591 15335 26654 3038 16881
NM_207015chr331624 820 371 2905 648 1936 --
NM_207042chr11653 --1533 --
NM_207045chr11653 --1533 --
NM_207046chr11653 --1533 --
NM_207119chr1062324 2077 1965 1769 1612 36 --31841 793 523 1621
NM_207303chr1054060 1040 702 657 109 1712 ----
NM_207306chr164325 4159 3912 3767 3629 2928 14262 13806 --
NM_207371chr1041301 1262 1050 406 11400 1276 --
NM_207387chr1731776 1666 342 21660 1653 1124 --
NM_207396chr131758 577 273 2519 38 11166 11637
NM_207406chr456466 6264 5807 5674 324 16009 --11289
NM_207517chr152744 348 1627 ----
NM_213589chr255217 4074 3950 3723 86 11511 ----
NM_213594chr12------1256
NM_213609chr3----1810 --
NM_213618chr11--2685 273 239 22 --
NM_213654chr3----153 --