TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3194-5p
miRNA Sequence: GGCCAGCCACCAGGAGGGCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5--1344 ----
NM_000069chr1--136 ----
NM_000070chr15----2543 464 --
NM_000081chr11366 ------
NM_000084chrX36240 5022 4307 2769 681 26299 2626 --
NM_000085chr12385 54 ------
NM_000090chr21639 ------
NM_000138chr1522515 955 12174 1277 --
NM_000141chr1011047 ------
NM_000142chr4157 11165 ----
NM_000163chr531709 956 653 ------
NM_000170chr91183 ------
NM_000176chr52680 367 1981 13261 --
NM_000208chr1934162 3901 361 24581 1313 11075 --
NM_000214chr201132 1541 1164 --
NM_000217chr1211739 ------
NM_000232chr422490 2325 ------
NM_000259chr1511044 34300 4293 309 ----
NM_000260chr112114 22 --1120 --
NM_000264chr951233 1009 757 726 89 --1767 12197
NM_000278chr1051558 849 681 482 372 --12155 --
NM_000286chr17160 ------
NM_000314chr101446 ------
NM_000333chr331162 944 350 ------
NM_000335chr352055 1968 1938 1641 183 --32037 1603 817 --
NM_000347chr14132 ------
NM_000353chr16147 --1934 --
NM_000368chr933629 3153 482 41208 758 669 41 44289 1217 779 399 11714
NM_000378chr11--1850 ----
NM_000390chrX13268 ------
NM_000399chr101404 ------
NM_000408chr223066 764 ------
NM_000430chr1723407 2980 12690 --1240
NM_000434chr6----1397 --
NM_000439chr521738 1606 ------
NM_000445chr83943 684 202 --1188 --
NM_000451chrX31583 1469 399 11575 ----
NM_000452chr1311474 188 ----
NM_000480chr11----1413 --
NM_000484chr211749 ------
NM_000489chrX--1867 ----
NM_000533chrX1216 ------
NM_000555chrX56125 5124 4951 3103 2830 ----12234
NM_000615chr11----11141 --
NM_000618chr1235504 5496 5337 ------
NM_000618chr1235504 5496 5337 ------
NM_000633chr1885160 4346 1347 1288 1145 468 447 387 ------
NM_000678chr201163 --168 --
NM_000682chr221793 29 ------
NM_000684chr1021213 1024 ------
NM_000719chr1234738 2130 1778 11450 ----
NM_000721chr132151 1959 346 --1628 12450
NM_000723chr171394 1589 ----
NM_000725chr12144 ----194
NM_000767chr1931224 1076 265 --21233 432 --
NM_000801chr201920 ------
NM_000813chr525601 125 ------
NM_000814chr151616 --13473 --
NM_000818chr102193 184 ------
NM_000831chr175917 4986 4367 2230 1987 1383 37 25561 1225 35756 4149 1000 --
NM_000832chr92658 218 ------
NM_000839chr3180 ------
NM_000859chr521242 526 ------
NM_000868chrX1653 ------
NM_000875chr15106438 5972 5016 4770 4741 4271 2358 2146 693 668 --12028 14642
NM_000876chr621203 1101 --11349 --
NM_000891chr1721010 294 ------
NM_000899chr12------144
NM_000919chr51154 ------
NM_000926chr1149174 7954 7331 3343 --19387 18694
NM_000944chr411613 ------
NM_000945chr2----31885 373 264 --
NM_000960chr192510 158 1703 ----
NM_000961chr2063640 3258 762 413 142 89 13828 13425 --
NM_000964chr1741325 1295 508 425 --11025 --
NM_000966chr12134 ------
NM_001001323chr121688 ------
NM_001001331chr322566 377 ------
NM_001001342chr1021243 116 --21399 365 --
NM_001001349chr1771718 1655 1377 1172 603 556 545 ------
NM_001001481chr81174 ------
NM_001001522chr112396 284 ------
NM_001001523chr131309 287 42 --1146 1202
NM_001001557chr82489 97 1803 ----
NM_001001664chr21586 ------
NM_001001668chr1923983 3891 ------
NM_001001852chr221159 ------
NM_001001890chr2144041 432 212 23 ------
NM_001001933chr11153 ------
NM_001002031chr12----298 44 --
NM_001002032chr171660 --1483 --
NM_001002033chr171760 --1583 --
NM_001002258chr221704 792 125 ----
NM_001002295chr101867 ------
NM_001002762chr1022053 1069 2814 589 ----
NM_001002838chrX1628 ------
NM_001002843chr15--1504 ----
NM_001002860chr1421448 656 14698 --1258
NM_001002876chr223379 314 49 --1138 --
NM_001002909chr1731781 1465 1439 ------
NM_001003406chr2233249 2632 2183 13240 1959 --
NM_001003652chr1828456 6244 36972 6926 820 13043 --
NM_001003676chr11----2357 275 --
NM_001003681chr223774 306 47 ------
NM_001003682chr14399 384 289 109 ------
NM_001003688chr41853 ------
NM_001003698chr611379 ------
NM_001003699chr611379 ------
NM_001003792chr32843 69 ------
NM_001003793chr32843 69 ------
NM_001003794chr33994 919 707 ----12336
NM_001003800chr92937 618 23065 1454 ----
NM_001003940chr1543375 3366 2738 2527 22427 837 33483 2467 529 --
NM_001003942chr1543375 3366 2738 2527 22427 837 33483 2467 529 --
NM_001003943chr1543379 3370 2742 2531 22431 841 33487 2471 533 --
NM_001004065chr922453 1399 --1396 --
NM_001004105chr5----126 --
NM_001004127chr132745 684 --1207 --
NM_001004304chr1252710 2537 975 654 477 1332 ----
NM_001004317chr664142 3569 2976 2951 1721 1356 14545 ----
NM_001004342chr125254 432 25721 5675 15167 --
NM_001004360chr21228 ------
NM_001004419chr1222801 349 --1737 --
NM_001004439chr152174 109 ------
NM_001004722chr2193 ------
NM_001005271chr171222 ----1253
NM_001005273chr171222 ----1253
NM_001005290chr1----1103 --
NM_001005360chr196855 660 599 338 170 137 ------
NM_001005361chr196855 660 599 338 170 137 ------
NM_001005362chr196855 660 599 338 170 137 ------
NM_001005386chr2--12011 ----
NM_001005415chr192465 48 ------
NM_001005416chr192465 48 ------
NM_001005463chr1011931 ------
NM_001005473chr516437 --16166 21214 119
NM_001005505chr341671 1426 726 122 ----1740
NM_001005609chrX53372 2974 1006 591 435 12959 ----
NM_001005743chr1421278 450 ------
NM_001005744chr1421278 450 ------
NM_001005745chr1421278 450 ------
NM_001006115chr322216 1703 1641 1379 1656
NM_001006600chr52528 475 ------
NM_001006634chr162559 210 ------
NM_001006665chr14774 639 576 207 ----1698
NM_001006933chrX147 ------
NM_001007024chr1723991 675 13207 ----
NM_001007025chr1723991 675 13207 ----
NM_001007102chr6--11260 11032 --
NM_001007156chr15264 47 ------
NM_001007237chr152401 2221 911 186 27 --21091 904 --
NM_001007246chr21--11315 ----
NM_001007257chr111194 ------
NM_001007277chr1121113 933 ------
NM_001007466chr644957 3771 1669 272 --13803 --
NM_001007553chr11340 ------
NM_001007559chr1821821 1663 --11830 --
NM_001008220chr5103709 3590 3429 3211 1228 749 632 537 518 108 13515 12598 --
NM_001008225chr71507 ------
NM_001008408chr766106 5703 5113 4661 570 193 14649 14125 --
NM_001008495chr811756 ------
NM_001008528chr174712 485 328 233 ------
NM_001008540chr21433 ------
NM_001008541chr1022197 1606 ------
NM_001008541chr1022197 1606 ------
NM_001008564chr13----11873 --
NM_001008701chr1962615 2377 2302 2135 1987 1042 --42044 579 98 26 --
NM_001008711chr841468 1135 175 41 ------
NM_001008738chr511848 --12014 --
NM_001009880chr2274730 4358 3844 1472 1430 571 203 --24854 4273 1822
NM_001009881chr1126 ------
NM_001009882chr1126 ------
NM_001009899chr352313 2017 1912 1373 430 --24713 2187 --
NM_001009955chr1196 ------
NM_001009955chr1196 ------
NM_001009958chr71167 ------
NM_001009993chr294218 3398 3352 2913 1737 1243 646 187 62 21675 1393 13705 --
NM_001010867chr1125465 5183 2422 2183 2026 2018 1811 1646 1042 428 383 39 --15362 --
NM_001010891chr566781 5663 5126 4981 2543 223 --12712 --
NM_001010922chr161430 1410 1137 987 881 529 --11384 --
NM_001010938chr33748 650 152 --1546 --
NM_001010989chr16--1371 ----
NM_001010990chr16--1371 ----
NM_001011666chr711814 --11552 --
NM_001012329chr122204 1623 21674 920 1434 1163
NM_001012393chr1133835 3642 184 --23839 1390 --
NM_001012420chr1522916 333 ----1977
NM_001012423chr1522916 333 ----1977
NM_001012426chr653262 1101 1039 847 26 ------
NM_001012427chr653262 1101 1039 847 26 ------
NM_001012751chr102401 395 ------
NM_001012755chrX53446 1227 601 543 52 --11394 --
NM_001012756chr1922891 2538 --22674 2547 --
NM_001013415chr421201 125 ------
NM_001013438chr31406 ------
NM_001013439chr31252 ------
NM_001013615chr1----1437 1778
NM_001013620chr1248096 3393 2869 265 --25963 3037 --
NM_001013622chr47449 388 326 264 202 141 79 ------
NM_001013690chr1262388 2356 1871 1816 450 98 ----2284 90
NM_001013693chr162360 1127 1063 909 579 543 21988 470 1728 --
NM_001013693chr162360 1127 1063 909 579 543 21988 470 1728 --
NM_001013739chr72227 221 ------
NM_001013839chr1751656 780 734 540 82 ------
NM_001014283chr1311770 --21781 1596 11401
NM_001014797chr1058122 7125 6957 6428 2685 38056 7643 6799 --15102
NM_001014839chr13795 708 261 ----1354
NM_001014841chr13795 708 261 ----1354
NM_001015053chr1711103 --21504 596 --
NM_001015877chrX----12020 --
NM_001015881chrX1120 ------
NM_001015887chr3----11279 --
NM_001017368chr1732253 2159 1131 --167 1186
NM_001017371chr221221 368 ------
NM_001017395chr352885 2876 1239 877 543 ------
NM_001017424chr1--173 ----
NM_001017425chr1--173 ----
NM_001017440chr757716 6263 6100 1976 1210 --36035 3099 2288 16358
NM_001017916chr1721595 730 11801 ----
NM_001017917chr1721595 730 11801 ----
NM_001017926chr811424 ------
NM_001017930chrX1984 ------
NM_001017970chr1452583 1754 672 581 460 1844 ----
NM_001017995chr553762 1852 1090 43 33 13688 ----
NM_001018009chr31312 1944 1180 --
NM_001018050chr2272898 2413 2286 2121 1379 1058 597 ------
NM_001018052chr2272898 2413 2286 2121 1379 1058 597 ------
NM_001018056chr92437 103 ------
NM_001018074chr52680 367 1981 13261 --
NM_001018075chr52680 367 1981 13261 --
NM_001018076chr52680 367 1981 13261 --
NM_001018077chr52680 367 1981 13261 --
NM_001018100chr151323 ------
NM_001018108chr1552314 1746 625 543 317 ------
NM_001023567chr1542308 980 856 333 ----1985
NM_001024094chr52680 367 1981 13261 --
NM_001024226chr11383 ------
NM_001024227chr11383 ------
NM_001024228chr11383 ------
NM_001024401chr1672570 2283 2275 2245 1020 599 544 --1162 --
NM_001024463chr1531161 378 208 ------
NM_001024666chrX------1205
NM_001024808chr1252306 2150 968 944 713 12596 ----
NM_001024809chr1741325 1295 508 425 --11025 --
NM_001024959chr32582 109 --1209 --
NM_001024960chr32582 109 --1209 --
NM_001025076chr1024217 974 15747 15132 --
NM_001025077chr1025575 2332 17105 16490 --
NM_001025079chr322770 546 ------
NM_001025081chr182576 375 31268 1173 968 ----
NM_001025090chr182576 375 31268 1173 968 ----
NM_001025092chr182576 375 31268 1173 968 ----
NM_001025101chr182576 375 31268 1173 968 ----
NM_001025108chr222727 1634 --12936 --
NM_001025109chr131102 827 24 ------
NM_001025202chr72227 221 ------
NM_001025389chr11----1413 --
NM_001025390chr11----1413 --
NM_001025580chrX1717 23808 1337 ----
NM_001025595chr411477 ------
NM_001025616chr4----185 --
NM_001025778chr191258 ------
NM_001025780chr9--11045 11125 --
NM_001029861chr193316 217 127 ------
NM_001029882chr1--1628 ----
NM_001029882chr1--1628 ----
NM_001030006chr1732665 2495 1969 12448 1282 --
NM_001030007chr161321 174 1203 --
NM_001030055chr14126 24239 1539 ----
NM_001031680chr142445 2033 652 139 1583 --12242
NM_001031684chr221412 1243 --1974 --
NM_001031690chr722437 513 12352 1799 --
NM_001031694chr11867 --2278 212 --
NM_001031694chr11867 --2278 212 --
NM_001031695chr2245379 4288 4192 532 1667 1523 14293
NM_001031702chr33825 797 358 --1186 2665 162
NM_001031710chr71189 ------
NM_001031717chr3170 ------
NM_001031738chr21334 --121 --
NM_001031804chr16--13941 13964 --
NM_001032280chr6--11302 ----
NM_001032289chrX1132 ------
NM_001032296chr1332445 2354 889 --22769 2632 12599
NM_001032380chr10--1640 11949 --
NM_001032999chr20114969 3971 3776 1933 1780 1565 1407 1023 813 681 362 13538 13941 --
NM_001033026chr192218 35 ------
NM_001033044chr141369 1231 485 161 ------
NM_001033056chr141369 1231 485 161 ------
NM_001033057chr31251 ------
NM_001033059chr621626 392 ------
NM_001033081chr121708 1427 ------
NM_001033082chr121708 1427 ------
NM_001033087chr2032444 1078 364 12703 ----
NM_001033117chr364880 4751 4173 3783 963 157 --44670 4140 1190 865 --
NM_001033503chr5197 ------
NM_001033557chr211177 ------
NM_001033677chr121284 ------
NM_001033925chr1011589 ------
NM_001034025chr123671 132 115 1899 1707 --
NM_001034845chr41234 --1110 --
NM_001035260chr10------1408
NM_001035511chr141616 326 290 278 ------
NM_001035512chr141723 433 397 385 --11406 --
NM_001035513chr141723 433 397 385 --11406 --
NM_001037132chr71885 ------
NM_001037133chr71885 ------
NM_001037174chr222288 2003 ------
NM_001037290chr11----1762 --
NM_001037332chr521972 189 ------
NM_001037333chr521972 189 ------
NM_001037582chr43553 408 248 ------
NM_001038493chr2258 34 1592 ----
NM_001038707chr142036 846 415 156 --1498 --
NM_001038707chr142036 846 415 156 --1498 --
NM_001039457chr1147 ------
NM_001039459chr7--1171 ----
NM_001039465chr141130 ------
NM_001039479chr14124 --1785 --
NM_001039538chr213003 --13624 --
NM_001039547chr347300 2816 2658 36 1794 27428 2825 --
NM_001039583chr223527 405 104 ------
NM_001039584chr223527 405 104 ------
NM_001039590chrX11107 ----1526
NM_001039591chrX11107 ----1526
NM_001039690chr1632357 802 608 --1263 --
NM_001039709chr20114969 3971 3776 1933 1780 1565 1407 1023 813 681 362 13538 13941 --
NM_001039711chr11943 11033 ----
NM_001039712chr11943 11033 ----
NM_001039802chr1133 ------
NM_001039847chr19124 ------
NM_001039877chr19135 ------
NM_001039916chr12----1387 --
NM_001039917chr12----1387 --
NM_001039918chr12----1387 --
NM_001039919chr12----1387 --
NM_001039920chr12----1387 --
NM_001040057chr72600 493 11451 ----
NM_001040144chr1632357 802 608 --1263 --
NM_001040146chr1632357 802 608 --1263 --
NM_001040152chr71366 ------
NM_001040153chr13166 ------
NM_001040157chr42730 588 1300 1896 --
NM_001040158chr5--1199 ----
NM_001040202chr4--1232 ----
NM_001040260chr4--11018 ----
NM_001040261chr4--11018 ----
NM_001040272chr922317 2171 22203 2182 ----
NM_001040284chr1624917 1057 ------
NM_001040424chr2122951 1061 ------
NM_001040427chr16166 ------
NM_001040429chr13--12886 ----
NM_001040440chr51207 ------
NM_001040441chr155262 2181 1634 780 225 21334 27 1660 --
NM_001040446chr521884 88 ------
NM_001040455chr1131275 833 236 --11023 --
NM_001040715chr16------1880
NM_001042353chr202491 147 ------
NM_001042368chr9----126 131
NM_001042371chr1662012 1956 1649 1556 1542 233 --21527 1337 1259
NM_001042388chr181675 ------
NM_001042410chr2--1165 ----
NM_001042425chr6--11302 ----
NM_001042476chr1641853 798 537 521 11877 --1686
NM_001042486chr202990 256 --11397 --
NM_001042537chrX2774 555 11626 ----
NM_001042555chr121273 --1332 --
NM_001042599chr237368 6493 235 17110 16724 --
NM_001042601chr31784 ------
NM_001042632chr2051976 1936 923 843 397 2960 503 1403 --
NM_001042633chr2051976 1936 923 843 397 2960 503 1403 --
NM_001042663chr151309 1150 1085 378 270 --1964 --
NM_001042664chr151309 1150 1085 378 270 --1964 --
NM_001042665chr151309 1150 1085 378 270 --1964 --
NM_001042669chr4----185 --
NM_001042681chr121614 23 ------
NM_001042682chr121614 23 ------
NM_001042682chr121614 23 ------
NM_001042728chr12134 ------
NM_001042749chrX1256 ------
NM_001042750chrX1256 ------
NM_001042751chrX1256 ------
NM_001043318chr1452650 1215 1111 218 177 23138 2880 42825 477 116 41 --
NM_001043351chr121598 1440 --11607 --
NM_001044305chr631580 1376 1301 ------
NM_001045478chr12370 318 ----137
NM_001077628chr11521 ------
NM_001079874chr1--2840 175 ----
NM_001096chr17--176 ----
NM_001100108chr187791 7674 6885 6053 2162 1063 609 236 16615 ----
NM_001106chr386942 6630 6503 2912 2689 2104 1544 838 --47635 6636 2293 1668 --
NM_001113490chrX32308 1440 934 ----13525
NM_001117chr181614 ------
NM_001121chr1011503 11462 ----
NM_001128chr161321 174 1203 --
NM_001130chr19125 ------
NM_001167chrX75682 5156 4696 2057 1897 482 452 1148 15816 12067
NM_001173chr14126 24239 1539 ----
NM_001174chrX2230 161 ------
NM_001177chr1221926 1793 --1714 --
NM_001191chr2051361 1304 1274 280 129 ----1257
NM_001219chr72661 280 --12154 --
NM_001222chr1021719 1589 ----1308
NM_001241chr21949 --1377 --
NM_001241chr21949 --1377 --
NM_001249chr14--1179 ----
NM_001256chr1722356 93 --12065 --
NM_001258chr172363 189 ------
NM_001259chr736295 1957 1678 22531 1103 ----
NM_001273chr123410 231 212 1444 ----
NM_001282chr1732665 2495 1969 12448 1282 --
NM_001331chr111770 ----1992
NM_001343chr51333 --147 --
NM_001351chr3138 ------
NM_001356chrX1353 12010 ----
NM_001364chr1164541 4136 3851 3817 1741 1335 --12959 --
NM_001386chr842126 1815 1612 443 ----1592
NM_001390chr1832968 2937 1158 12355 ----
NM_001396chr2112326 ----11715
NM_001397chr182615 2462 2395 2111 1070 914 522 156 --22585 253 --
NM_001399chrX53372 2974 1006 591 435 12959 ----
NM_001402chr6--12014 11399 --
NM_001406chr17----21564 1413 1353
NM_001407chr351416 672 534 527 294 ------
NM_001419chr1923860 2997 --11373 --
NM_001420chr1942657 2450 543 240 --1885 --
NM_001421chrX--11752 ----
NM_001427chr731721 1651 462 ------
NM_001429chr22----1216 --
NM_001430chr211351 11804 ----
NM_001431chr6--21088 369 ----
NM_001438chr11960 ------
NM_001440chr842577 444 302 95 --11079 --
NM_001447chr551012 979 418 354 93 ------
NM_001451chr16--11040 --1179
NM_001453chr611323 ------
NM_001458chr72266 180 --2759 282 --
NM_001482chr15----127 --
NM_001493chrX1157 ------
NM_001495chr831192 786 211 --2471 373 1438
NM_001497chr942574 2494 2401 1823 1969 178 --
NM_001530chr1411116 ------
NM_001542chr152401 2221 911 186 27 --21091 904 --
NM_001543chr5113950 3120 1671 1558 1508 1414 1353 1063 844 508 142 --24425 4399 14156
NM_001552chr1711080 --1700 1705
NM_001554chr11174 ------
NM_001567chr112537 473 ------
NM_001610chr114768 690 104 47 ------
NM_001616chr21770 ------
NM_001634chr621626 392 ------
NM_001656chr5--1445 ----
NM_001658chr11383 ------
NM_001659chr1232717 2325 765 ------
NM_001660chr31594 ------
NM_001662chr71324 ------
NM_001668chr121828 236 11847 --1910
NM_001670chr223716 645 322 --1336 1118
NM_001677chr11854 ------
NM_001678chr17--1648 11302 --
NM_001681chr12--1733 ----
NM_001682chr121402 11083 ----
NM_001683chr322566 377 ------
NM_001689chr221704 792 125 ----
NM_001701chr911350 ------
NM_001706chr31135 ------
NM_001707chr72240 129 1323 1138 --
NM_001718chr621322 406 ------
NM_001722chr8----1562 --
NM_001723chr6----144 --
NM_001730chr13--1364 ----
NM_001730chr13--1364 ----
NM_001743chr21467 ------
NM_001754chr2144041 432 212 23 ------
NM_001755chr1621764 898 32080 301 105 1738 --
NM_001759chr1264840 4613 4265 4143 1454 1293 ------
NM_001777chr322770 546 ------
NM_001791chr1133 ------
NM_001802chr161808 --1234 --
NM_001825chr5--141 ----
NM_001826chr1--1144 ----
NM_001842chr91187 ------
NM_001858chr634842 4346 1625 --24350 366 --
NM_001880chr21304 ------
NM_001895chr201408 1816 ----
NM_001904chr3187 ----1387
NM_001915chr1721595 730 11801 ----
NM_001927chr2--1240 1661 --
NM_001933chr141113 1328 ----
NM_001938chr121712 447 ------
NM_001939chrX73782 3687 3095 2622 1502 1095 347 ----13156
NM_001945chr531283 1026 29 ------
NM_001950chr16128 1169 ----
NM_001954chr63696 249 146 ------
NM_001955chr63920 107 79 ------
NM_001957chr411709 12296 ----
NM_001962chr53414 405 166 ------
NM_001964chr5--1358 ----
NM_001965chr22339 24 ------
NM_001969chr1433584 3170 2649 --11584 --
NM_001987chr122463 197 1725 ----
NM_002006chr434431 4305 593 15467 ----
NM_002010chr13----1458 --
NM_002014chr123192 161 123 ------
NM_002015chr1333054 2084 1041 ------
NM_002017chr1111031 ------
NM_002025chrX59242 9058 3477 2946 2037 46278 3572 1539 723 ----
NM_002048chr93394 110 23 ------
NM_002051chr101867 ------
NM_002052chr811484 --1965 --
NM_002065chr141369 1231 485 161 ------
NM_002076chr1232802 2644 1255 --2642 116 --
NM_002080chr161826 --1196 --
NM_002081chr231779 1541 1428 ------
NM_002086chr1731894 634 145 ----1368
NM_002092chr424353 4194 --24362 1075 --
NM_002104chr51178 ------
NM_002126chr1713140 --122 --
NM_002136chr12--1588 ----
NM_002137chr71620 --11707 --
NM_002139chrX2554 413 ------
NM_002140chr91219 ------
NM_002141chr73232 212 175 --1216 --
NM_002156chr2----1114 --
NM_002167chr12339 40 ------
NM_002181chr23604 213 72 ----1261
NM_002193chr21378 ------
NM_002203chr5----1264 --
NM_002204chr171457 21282 165 --1292
NM_002222chr321289 435 1192 ----
NM_002226chr141655 ----1633
NM_002228chr121004 431 ------
NM_002233chr11--1375 ----
NM_002241chr14683 562 382 323 ----11197
NM_002247chr10------11594
NM_002264chr333834 3746 1453 1815 ----
NM_002267chr131658 ------
NM_002270chr533924 1829 736 24997 1324 ----
NM_002285chr222727 1634 --12936 --
NM_002309chr2292844 2610 2127 877 760 433 263 163 81 1121 12277 --
NM_002315chr11----194 --
NM_002356chr61751 ------
NM_002359chr1784089 3520 3189 1314 1296 1202 625 417 12693 ----
NM_002374chr213003 --13624 --
NM_002376chr141155 ------
NM_002384chr182684 202 ------
NM_002385chr182576 375 31268 1173 968 ----
NM_002387chr533815 1867 717 --11876 1110
NM_002390chr1732022 1692 613 21602 1307 ----
NM_002395chr6167 ------
NM_002397chr511402 ------
NM_002398chr2--11303 ----
NM_002399chr151294 ------
NM_002401chr1762323 2102 1928 1632 448 259 --1540 --
NM_002405chr223787 300 26 ----1129
NM_002409chr2263171 2719 2264 2246 2153 644 11198 22957 981 --
NM_002419chr111473 ------
NM_002430chr2232481 1770 144 ------
NM_002442chr12----11240 --
NM_002479chr12640 45 ------
NM_002499chr1531893 810 803 --2535 150 --
NM_002500chr2--11213 ----
NM_002515chr1421423 645 ------
NM_002522chr1762831 2653 1155 860 467 348 ----13250
NM_002537chr151389 --2894 351 --
NM_002545chr1133835 3642 184 --23839 1390 --
NM_002553chr72126 75 ------
NM_002556chr111604 --1175 --
NM_002569chr1521510 1461 --31441 622 402 --
NM_002581chr915602 ------
NM_002582chr162114 29 ----159
NM_002586chr641520 1266 1124 1083 ------
NM_002588chr521173 405 --11498 --
NM_002609chr531643 594 496 --1167 11701
NM_002613chr16125109 5099 4490 4115 4024 2083 1250 822 761 671 573 391 34853 4813 636 24290 3990 14086
NM_002628chr31404 ------
NM_002636chr62351 121 ------
NM_002646chr181994 1799 1594 1436 879 620 610 206 --136 --
NM_002648chr621244 383 ------
NM_002655chr82895 702 --14029 --
NM_002657chr2033374 2926 1100 22574 701 ----
NM_002670chr31162 ------
NM_002687chr1421037 852 ------
NM_002705chr162860 39 ------
NM_002706chr21460 ------
NM_002709chr211067 12772 ----
NM_002710chr121156 ------
NM_002714chr641030 712 334 254 ------
NM_002716chr1123185 3055 ----12329
NM_002717chr81638 ------
NM_002725chr173816 2934 1229 1085 696 543 46 --44221 4170 3300 1069 --
NM_002730chr192336 73 ------
NM_002736chr71509 1601 ----
NM_002745chr2223358 923 --14422 --
NM_002747chr1811842 ----2110 63
NM_002763chr1--1132 1368 --
NM_002779chr102407 150 ------
NM_002787chr71583 ------
NM_002806chr14141 ------
NM_002819chr191592 --11446 --
NM_002822chr12--11737 ----
NM_002824chr122432 25 ------
NM_002833chr15128 ----11450
NM_002834chr1232774 2591 965 ----11035
NM_002840chr131505 427 311 --11146 --
NM_002842chr19188 ----1129
NM_002843chr1163056 2853 2662 2655 2564 800 22806 778 --11015
NM_002845chr18--1270 ----
NM_002851chr71617 ------
NM_002868chr122790 556 ------
NM_002880chr32321 210 ------
NM_002885chr12873 253 1219 ----
NM_002886chr323701 3575 --1134 1952
NM_002890chr51155 ------
NM_002895chr201730 ------
NM_002897chr21691 ------
NM_002906chr1121846 601 ------
NM_002918chr193729 388 175 ------
NM_002920chr12--1360 ----
NM_002953chr14774 639 576 207 ----1698
NM_002955chr611379 ------
NM_002961chr1121 ------
NM_002971chr311130 ------
NM_002972chr221273 ------
NM_002994chr411386 ------
NM_002996chr1651771 1530 1342 663 253 --21439 257 --
NM_003001chr141723 433 397 385 --11406 --
NM_003010chr171207 ------
NM_003016chr1711630 ------
NM_003027chr151452 ------
NM_003029chr11570 ------
NM_003034chr1267655 6401 6005 2553 242 162 --16567 28071 1785
NM_003039chr13242 208 28 ------
NM_003043chr323900 1467 2564 437 --1844
NM_003045chr1354848 4636 4264 3833 660 13725 33460 971 239 --
NM_003060chr5----1916 --
NM_003072chr19--1286 ----
NM_003075chr12----1266 --
NM_003101chr121021 219 ------
NM_003107chr61865 --21820 135 --
NM_003108chr255662 2911 2655 2177 1921 ------
NM_003110chr171723 ------
NM_003111chr221221 368 ------
NM_003112chr71333 --173 --
NM_003128chr221984 992 ------
NM_003131chr661806 1604 854 627 445 355 ------
NM_003155chr81464 ------
NM_003156chr11----21290 115 --
NM_003161chr1721440 602 --12236 --
NM_003164chr111508 ------
NM_003178chr311461 11606 1643 --
NM_003183chr22800 115 ------
NM_003185chr201856 1430 ----
NM_003186chr112396 284 ------
NM_003189chr162365 1232 888 852 410 289 --22539 166 --
NM_003192chr6--1381 ----
NM_003199chr1845566 3749 3581 3428 ------
NM_003200chr1932314 1617 1454 --11793 --
NM_003203chr23838 627 72 --1262 12157
NM_003204chr172487 56 --2458 171 --
NM_003215chr411120 --11471 --
NM_003216chr2253290 2734 2298 1059 604 13149 11280 --
NM_003220chr6--11302 ----
NM_003221chr61404 --1571 --
NM_003246chr151743 146 ----
NM_003253chr21----1582 --
NM_003262chr354612 4452 3623 58 43 ------
NM_003274chr2142217 331 223 146 ------
NM_003286chr201721 ------
NM_003291chr13--1225 ----
NM_003336chrX127 --1400 --
NM_003342chr1752780 2036 1139 879 128 1116 ----
NM_003344chr711666 ------
NM_003345chr162380 116 ------
NM_003350chr8--1111 ----
NM_003375chr101166 ------
NM_003383chr92437 103 ------
NM_003387chr241955 1177 1088 237 12782 1761 --
NM_003392chr344165 3034 2755 1070 --1833 --
NM_003404chr20--1164 ----
NM_003410chrX21948 590 ------
NM_003411chrY132 ------
NM_003412chr332802 1168 424 11924 ----
NM_003418chr3------184
NM_003442chr111814 --1751 --
NM_003453chr132633 477 ------
NM_003467chr21433 ------
NM_003468chr213168 --31201 827 333 --
NM_003470chr1621829 116 --11837 --
NM_003474chr1012357 ------
NM_003478chr1133031 709 488 22351 1248 ----
NM_003482chr1272595 2438 2354 2342 1035 146 106 ----1223
NM_003489chr21----22318 2314 --
NM_003507chr222006 1390 ------
NM_003557chr111526 1414 ----
NM_003559chr1723009 755 13152 --12717
NM_003567chr11272 --1276 --
NM_003569chr61142 ------
NM_003576chr1332445 2354 889 --22769 2632 12599
NM_003583chr1212575 123 ----
NM_003592chr71143 1337 ----
NM_003597chr222102 133 ------
NM_003598chr192192 175 ------
NM_003603chr4----1192 --
NM_003607chr121137 817 ----1113
NM_003612chr151449 --2458 77 --
NM_003618chr21985 1433 ----
NM_003622chr1252639 2284 1010 850 622 ------
NM_003632chr17197 ------
NM_003633chr532132 843 489 --22319 498 --
NM_003637chr12456 161 1199 ----
NM_003644chr1795747 5230 4783 1815 1073 363 278 126 46 --24790 2082 --
NM_003651chr121437 ------
NM_003655chr17----1119 --
NM_003663chr312613 12908 ----
NM_003666chr12411 177 ------
NM_003671chr942871 1394 342 290 --1294 --
NM_003673chr17281 43 ------
NM_003680chr12587 219 ----1494
NM_003692chr91122 ------
NM_003701chr132794 306 ------
NM_003704chr42119 76 ------
NM_003711chr5130 ------
NM_003713chr11307 ------
NM_003714chr552033 1942 1918 649 441 ------
NM_003732chr52260 95 ------
NM_003735chr521173 405 --11498 --
NM_003736chr521173 405 --11498 --
NM_003743chr21539 ------
NM_003744chr1421278 450 ------
NM_003745chr163326 147 100 ------
NM_003750chr101186 ------
NM_003758chr151124 ------
NM_003758chr151124 ------
NM_003759chr433635 3172 1221 --11317 13983
NM_003768chr1129 --11393 --
NM_003773chr32230 32 ------
NM_003787chr1811286 ----11690
NM_003791chr16155 --184 --
NM_003793chr111145 196 ----
NM_003796chr191484 ------
NM_003800chr612082 ------
NM_003806chr12292 61 ------
NM_003818chr20171 ------
NM_003829chr92837 313 ------
NM_003861chr1442774 2725 1918 184 ------
NM_003872chr222547 51 12262 22555 1872 --
NM_003873chr1041780 810 241 91 1361 1673 11700
NM_003883chr5152 ------
NM_003884chr3--11615 ----
NM_003885chr1741835 929 697 382 11670 ----
NM_003893chr101186 1431 ----
NM_003907chr33321 130 57 ------
NM_003908chr203991 128 47 11011 ----
NM_003913chr623452 3367 11332 ----
NM_003939chr1024008 3730 ------
NM_003941chr711772 1982 ----
NM_003947chr311089 --1114 --
NM_003955chr1741357 1181 1162 414 --1476 --
NM_003972chr101134 --11203 --
NM_003987chr1051558 849 681 482 372 --12155 --
NM_003988chr1051635 926 758 559 449 --12232 --
NM_003989chr1051494 785 617 418 308 --12091 --
NM_003990chr1051494 785 617 418 308 --12091 --
NM_003994chr12------144
NM_004035chr1755131 4509 3712 3472 3242 --14518 --
NM_004037chr12800 241 --1329 --
NM_004047chr1147 ------
NM_004050chr1451845 735 489 248 34 ------
NM_004055chr1121415 486 --12030 --
NM_004089chrX1120 ------
NM_004093chr1322510 733 1609 1746 --
NM_004094chr14--13017 ----
NM_004097chr2148 --1179 --
NM_004098chr102988 843 ------
NM_004100chr622206 2073 1252 22348 1737 --
NM_004134chr51470 ------
NM_004136chr1522972 1197 ------
NM_004152chr191233 ------
NM_004161chr22287 225 11422 ----
NM_004165chr16145 --154 --
NM_004200chr112647 485 ------
NM_004202chrY------1194
NM_004205chr111530 ------
NM_004209chr164944 899 791 321 ------
NM_004227chr752669 778 688 262 170 --12036 --
NM_004229chrX12186 ------
NM_004242chr6--1112 ----
NM_004274chr1422733 211 --194 --
NM_004276chr121284 ------
NM_004290chr511137 ------
NM_004295chr172533 216 ------
NM_004296chr1442981 1533 951 203 24025 1498 --22919 966
NM_004302chr1232535 891 715 ------
NM_004311chr1052846 2518 2401 892 460 11068 ----
NM_004319chr1165 ------
NM_004321chr232506 2235 244 --22751 1207 --
NM_004342chr71625 ----11664
NM_004343chr19256 22 --1112 --
NM_004350chr142445 2033 652 139 1583 --12242
NM_004380chr161305 --11868 --
NM_004389chr21358 1853 ----
NM_004392chr1312277 ------
NM_004393chr31756 --32256 2148 276 11766
NM_004395chr54620 323 315 130 ------
NM_004397chr1133936 3168 244 11722 13155 --
NM_004414chr21----171 --
NM_004416chr122332 95 --2800 181 --
NM_004417chr5----198 --
NM_004418chr23582 504 167 139 1209 --
NM_004421chr13561 121 43 ------
NM_004422chr172379 21 ------
NM_004426chr121165 ----1585
NM_004429chrX41245 1134 1100 266 ------
NM_004430chr831091 681 195 ------
NM_004432chr93882 795 542 ----12297
NM_004436chr13461 126 68 ------
NM_004450chr14127 ------
NM_004451chr11168 1108 ----
NM_004454chr321883 174 11492 ----
NM_004459chr172657 359 ------
NM_004481chr142710 2681 2464 1794 ------
NM_004483chr161481 ------
NM_004486chr951118 1074 330 177 41 11082 ----
NM_004491chr19154127 3421 3105 2819 2681 1617 1414 1258 1144 1138 1102 980 558 210 167 --33713 1666 494 1406
NM_004496chr14--142 ----
NM_004497chr193553 520 34 --2644 288 --
NM_004501chr133347 1309 757 ------
NM_004514chr1731993 138 98 ------
NM_004529chr911278 ------
NM_004535chr2041641 659 362 146 ------
NM_004575chr411220 ------
NM_004578chr11836 ------
NM_004583chr171500 ------
NM_004586chrX34415 4273 4049 1112 ----
NM_004588chr1193944 3931 3665 3477 3158 2873 879 666 492 --13282 13484
NM_004599chr22--1669 1624 --
NM_004602chr2041399 380 277 179 ------
NM_004603chr72433 72 ------
NM_004612chr924784 288 ------
NM_004615chrX1361 ------
NM_004622chr211887 ------
NM_004626chr11----1266 1714
NM_004630chr112463 147 ------
NM_004635chr341165 968 340 225 --2896 266 --
NM_004637chr311214 1328 1479 --
NM_004654chrY----1496 --
NM_004656chr3--21177 923 ----
NM_004660chrY3930 544 351 12304 ----
NM_004673chr11984 ------
NM_004687chr171600 ------
NM_004689chr14----1440 --
NM_004694chr17134 ------
NM_004709chrX31409 396 191 ------
NM_004725chr101403 ------
NM_004726chrX55177 2032 1874 1717 436 ------
NM_004733chr3--1448 ----
NM_004739chr111142 1508 ----
NM_004747chr10133 ------
NM_004756chr1921374 1031 11402 1283 1247
NM_004760chr711985 1241 ----
NM_004774chr1742662 2454 1947 400 ------
NM_004776chr2041293 1176 845 665 12617 --1714
NM_004779chr5--11282 ----
NM_004781chr11528 11582 ----
NM_004781chr11528 11582 ----
NM_004783chr161557 --1158 1646
NM_004784chr4--1136 ----
NM_004796chr1421894 832 11606 1894 --
NM_004799chr11166 ------
NM_004801chr22546 519 ------
NM_004807chr231032 876 161 12214 1827 --
NM_004822chr1793939 3424 3335 3202 2591 1247 1160 990 336 --1800 --
NM_004834chr242524 2179 1262 232 ------
NM_004836chr23913 787 248 ------
NM_004840chrX2425 216 --1404 --
NM_004844chr31312 1944 1180 --
NM_004846chr2266 39 ------
NM_004849chr611183 --21620 167 --
NM_004861chr22275 69 ------
NM_004871chr1723991 675 13207 ----
NM_004879chr112991 811 ------
NM_004893chr5--1199 ----
NM_004896chr10------1323
NM_004904chr711814 --11552 --
NM_004921chr11248 ------
NM_004924chr192202 142 --1177 --
NM_004926chr1411755 ------
NM_004945chr196855 660 599 338 170 137 ------
NM_004958chr1--1647 ----
NM_004959chr931178 186 79 ------
NM_004969chr101530 ------
NM_004973chr611233 ------
NM_004975chr202754 194 ------
NM_004976chr1164171 4033 3797 1426 1282 205 --11656 --
NM_004979chrX31148 837 402 ------
NM_004991chr32296 30 ------
NM_004992chrX98189 8161 7606 7584 6459 6031 5661 3219 2920 17645 1816 --
NM_004992chrX98189 8161 7606 7584 6459 6031 5661 3219 2920 17645 1816 --
NM_004993chr141387 ------
NM_004995chr1421250 970 21474 344 21187 143 --
NM_004998chr155637 628 621 614 159 --1675 --
NM_005000chr7--11042 ----
NM_005006chr21288 ------
NM_005010chr71885 ------
NM_005022chr171192 ------
NM_005060chr131309 287 42 --1146 1202
NM_005065chr1454904 3935 2094 862 591 13861 ----
NM_005066chr11564 ------
NM_005067chr31882 --1190 --
NM_005087chr31252 ------
NM_005093chr20114969 3971 3776 1933 1780 1565 1407 1023 813 681 362 13538 13941 --
NM_005096chrX2874 335 --1220 --
NM_005099chr121120 975 --2984 155 --
NM_005103chr111228 ------
NM_005104chr61134 ------
NM_005109chr332144 2028 664 ------
NM_005116chr2044106 1582 783 235 13573 21701 336 --
NM_005119chr11961 --2186 58 --
NM_005124chr6141 ------
NM_005134chr181675 ------
NM_005153chr161516 ------
NM_005154chr152573 91 ------
NM_005168chr221604 1349 ------
NM_005173chr171277 1307 ----
NM_005176chr12----298 44 --
NM_005178chr192396 285 ------
NM_005197chr1434394 4053 3915 --15845 --
NM_005201chr32395 317 ------
NM_005207chr2243473 1201 907 618 --1784 --
NM_005220chr1711341 --11081 --
NM_005225chr20----1490 --
NM_005229chrX21180 1150 ------
NM_005234chr19----1308 --
NM_005235chr237368 6493 235 17110 16724 --
NM_005238chr11161 13501 ----
NM_005243chr22194 ------
NM_005249chr14--1597 ----
NM_005252chr14155 1259 ----
NM_005257chr1811065 ------
NM_005259chr2------1170
NM_005273chr71238 --2292 78 --
NM_005281chr12174 109 ------
NM_005284chr6--1173 ----
NM_005296chrX2340 227 ------
NM_005312chr941797 1770 772 624 --1122 --
NM_005324chr171852 ----11915
NM_005326chr16166 ------
NM_005329chr1631886 1834 1805 ------
NM_005336chr231833 776 85 ------
NM_005337chr121371 ------
NM_005339chr414211 22936 2767 ----
NM_005342chrX1519 1633 ----
NM_005359chr1876319 6053 6034 5942 5157 2281 793 26187 1283 12290 --
NM_005376chr131155 338 168 --1141 --
NM_005388chr92667 42 ------
NM_005392chr92648 399 ----2567 411
NM_005399chr124147 2994 12889 ----
NM_005400chr21562 --32498 2479 1925 --
NM_005407chr1431324 581 434 11071 --1377
NM_005418chr11--1479 ----
NM_005424chr1133 ------
NM_005431chr731584 425 88 --1434 --
NM_005433chr18--32556 2081 1109 ----
NM_005436chr1024000 250 ------
NM_005438chr112204 75 ------
NM_005458chr921507 788 --2926 115 --
NM_005465chr121719 548 11956 ----
NM_005474chr1711103 --21504 596 --
NM_005477chr1542223 1580 326 299 12056 12006 --
NM_005477chr1542223 1580 326 299 12056 12006 --
NM_005479chr1021239 1079 --2426 82 --
NM_005487chr223774 306 47 ------
NM_005494chr7--2590 521 ----
NM_005497chr1775776 5469 4826 2337 1656 155 116 --11831 --
NM_005502chr9--1477 ----
NM_005506chr432181 2023 630 2285 126 1178 --
NM_005507chr11195 --1435 --
NM_005509chr5------11434
NM_005512chr1141882 1509 1460 454 ------
NM_005522chr731164 511 46 11196 ----
NM_005523chr741547 1523 508 284 ------
NM_005529chr15989 837 265 209 136 --2396 193 --
NM_005544chr22839 295 ------
NM_005550chr161573 ----1517
NM_005557chr172120 42 ------
NM_005563chr1------1543
NM_005581chr191345 --1310 --
NM_005595chr11199 ------
NM_005596chr916247 14692 ----
NM_005603chr181148 ------
NM_005604chr6--1427 ----
NM_005611chr1611013 ------
NM_005631chr711039 --1404 1266
NM_005637chr1821821 1663 --11830 --
NM_005647chrX42574 1258 1183 575 12758 ----
NM_005650chr22--1999 ----
NM_005654chr51226 ------
NM_005656chr21--11399 31260 230 53 --
NM_005663chr4122 ------
NM_005669chr51581 11998 ----
NM_005688chr321157 492 --1870 11211
NM_005692chr7143 --164 --
NM_005704chr11966 --2896 310 --
NM_005717chr11311 147 1315 --
NM_005718chr32582 109 --1209 --
NM_005720chr71246 ------
NM_005721chr2----181 --
NM_005722chr2--12011 ----
NM_005724chr152606 75 ------
NM_005730chr1241018 992 986 663 13306 ----
NM_005731chr22402 43 ----131
NM_005735chr21219 ------
NM_005737chr252733 2091 688 680 68 --12200 --
NM_005742chr21663 ------
NM_005779chr522488 417 13171 ----
NM_005781chr33748 650 152 --1546 --
NM_005782chr17275 61 ------
NM_005786chr181102 ------
NM_005789chr1721848 95 1276 ----
NM_005822chr612134 ------
NM_005832chr31209 ------
NM_005839chr11849 1282 ----
NM_005840chrX35971 5395 2801 --47352 7154 5006 5002 --
NM_005852chr171222 ----1253
NM_005859chr511437 ------
NM_005860chr1931602 1356 351 1367 21336 191 --
NM_005871chr10----1124 --
NM_005880chr161638 --11181 --
NM_005896chr21742 ------
NM_005898chr11----1556 --
NM_005899chr1721293 1039 ------
NM_005900chr41853 ------
NM_005901chr1828456 6244 36972 6926 820 13043 --
NM_005902chr1524109 3014 13123 14197 11029
NM_005904chr183530 524 131 ------
NM_005911chr231311 1006 33 --31345 1320 1284 --
NM_005916chr7145 ------
NM_005920chr173565 2762 954 906 709 667 257 ------
NM_005922chr6--1426 1191 --
NM_005933chr113540 428 311 --1372 --
NM_005934chr1962277 1961 711 685 387 204 --22182 259 --
NM_005937chr1763265 2551 1430 573 438 334 --33168 3164 3160 --
NM_005941chr823120 148 ------
NM_005943chr631386 473 178 ------
NM_005955chr135131 1891 778 --12054 --
NM_005962chr1022197 1606 ------
NM_005962chr1022197 1606 ------
NM_005964chr1721098 569 ------
NM_005967chr122650 621 ------
NM_005968chr19177 ------
NM_005969chr111940 --11065 --
NM_005990chr56880 749 722 509 413 187 1827 --21063 25
NM_006007chr944425 4035 3672 3439 ------
NM_006010chr31191 ------
NM_006022chr131917 ------
NM_006030chr341671 1426 726 122 ----1740
NM_006038chr201449 --1137 --
NM_006039chr173718 183 93 --1156 --
NM_006047chr2031261 1061 392 ------
NM_006062chr231034 285 206 ----1479
NM_006079chr61597 ------
NM_006080chr71432 ------
NM_006089chrX11302 --11443 --
NM_006094chr81479 --1709 --
NM_006106chr1141091 762 272 201 ------
NM_006108chr1121853 56 1530 ----
NM_006113chr1--2840 175 ----
NM_006133chr1162057 986 745 472 363 192 ------
NM_006145chr19------1359
NM_006156chr141181 ------
NM_006164chr2--1449 ----
NM_006190chr2----1881 1174
NM_006194chr1421123 121 ------
NM_006201chrX41174 979 374 34 ------
NM_006202chr1951804 1798 1595 529 206 ------
NM_006224chr1722424 2116 11683 2954 883 --
NM_006237chr1311569 --1825 --
NM_006239chr41159 --1517 --
NM_006245chr611002 ------
NM_006251chr522881 538 --2706 108 --
NM_006252chr146886 5566 4862 2278 15424 11101 --
NM_006266chr9----126 131
NM_006268chr11--11005 ----
NM_006275chr201438 1336 ----
NM_006285chr9----1276 --
NM_006293chr15157 1266 ----
NM_006306chrX12203 --25093 3878 --
NM_006310chr1721328 119 1469 ----
NM_006313chr1221561 42 ------
NM_006317chr51696 ------
NM_006322chr13----1218 --
NM_006335chr12840 374 ------
NM_006359chrX2774 555 11626 ----
NM_006364chr141226 ------
NM_006371chr3125046 5024 4990 4354 3607 3421 3270 1892 1850 1466 413 256 --33875 953 422 --
NM_006378chr93325 313 24 --1910 --
NM_006380chr1733484 1708 88 ------
NM_006386chr2222328 2126 ------
NM_006389chr1151329 1084 103 87 75 --11054 --
NM_006401chr9145 ------
NM_006411chr631008 968 825 ------
NM_006421chr81175 125 ----
NM_006459chr10----11922 --
NM_006469chr131489 1016 590 ------
NM_006482chr1212575 123 ----
NM_006489chr1421423 645 ------
NM_006496chr121858 1645 ------
NM_006509chr191363 ------
NM_006517chrX21763 557 --11715 --
NM_006520chrX21574 1246 ------
NM_006526chr2021791 355 21543 666 ----
NM_006527chr4----158 --
NM_006544chr14--13765 ----
NM_006546chr1786565 6084 5389 5083 4788 4328 2129 2035 --45233 5093 2580 1051 --
NM_006547chr721925 1813 1531 1724 --
NM_006548chr311251 ------
NM_006561chr1024217 974 15747 15132 --
NM_006589chr1150 ----191
NM_006599chr1632692 488 321 27345 256 16876 1837
NM_006603chrX1256 ------
NM_006608chr1------135
NM_006618chr11584 11123 ----
NM_006622chr52470 146 1577 ----
NM_006624chr101449 ------
NM_006625chr1--1470 ----
NM_006625chr1--1470 ----
NM_006625chr1--1470 ----
NM_006628chr1534391 3637 3479 14618 13646 --
NM_006650chr5103709 3590 3429 3211 1228 749 632 537 518 108 13515 12598 --
NM_006654chr121273 --1332 --
NM_006677chr3131 ------
NM_006690chr2052019 1461 452 357 113 1547 11893 --
NM_006698chr20--11240 1252 --
NM_006703chr61207 ------
NM_006706chr51656 ------
NM_006724chr6--1426 1191 --
NM_006729chrX21980 86 --11492 14771
NM_006734chr611183 ------
NM_006738chr1574380 3927 1532 1339 1133 1058 237 --22970 243 --
NM_006742chr1641477 1397 1288 685 ------
NM_006743chrX1726 ------
NM_006749chr8149 ------
NM_006751chr21707 ------
NM_006761chr17--1580 ----
NM_006763chr111395 ------
NM_006766chr811938 ------
NM_006771chr171208 --126 --
NM_006772chr611519 --1701 --
NM_006775chr632434 2249 952 ------
NM_006788chr1851933 1855 1730 1324 749 11502 ----
NM_006805chr51378 ------
NM_006807chr17--11024 ----
NM_006816chr5----1230 --
NM_006833chr72161 127 ------
NM_006841chr31631 --1575 1768
NM_006848chr112212 187 1162 ----
NM_006851chr1222070 947 ------
NM_006861chr1232004 1783 1539 --11720 1804
NM_006874chr42811 350 ------
NM_006885chr1633804 3457 1246 ------
NM_006888chr1432213 440 180 13184 1303 --
NM_006898chr2----1638 --
NM_006922chr2--12061 ----
NM_006924chr1722926 1397 11173 14183 --
NM_006925chr141130 ------
NM_006943chr2022976 721 --22290 569 190
NM_006988chr213996 383 75 --153 --
NM_006999chr511442 --1635 --
NM_007030chr574579 3165 1812 1674 1589 327 123 14363 --14194
NM_007042chr332210 885 588 ------
NM_007054chr533852 2848 2685 --12857 --
NM_007067chr1721399 172 ------
NM_007084chr1341380 1213 352 279 ----1498
NM_007111chr131697 ------
NM_007114chr3--13011 ----
NM_007124chr621515 1506 ------
NM_007125chrY1372 ------
NM_007126chr9130 ------
NM_007137chrX34598 1946 1330 11340 --14875
NM_007144chr1711202 ------
NM_007146chr171152 1258 --12151
NM_007158chr11340 ------
NM_007159chr3--146 ----
NM_007162chr62133 47 ------
NM_007170chr13862 800 679 1315 1692 --
NM_007174chr122562 386 11489 ----
NM_007182chr32730 524 ------
NM_007191chr12--1276 ----
NM_007200chr1574380 3927 1532 1339 1133 1058 237 --22970 243 --
NM_007203chr922453 1399 --1396 --
NM_007214chr6--1544 ----
NM_007221chr12376 304 ------
NM_007222chr811424 ------
NM_007238chr2043910 3710 3688 372 --14568 --
NM_007249chr1337424 3056 2261 28870 2342 11667 --
NM_007260chr13637 583 521 ------
NM_007275chr34201 168 122 93 --1881 --
NM_007280chr151334 ------
NM_007283chr33994 919 707 ----12336
NM_007292chr1755131 4509 3712 3472 3242 --14518 --
NM_007294chr173381 344 334 ------
NM_007295chr173381 344 334 ------
NM_007296chr173381 344 334 ------
NM_007297chr173381 344 334 ------
NM_007298chr173381 344 334 ------
NM_007299chr173381 344 334 ------
NM_007300chr173381 344 334 ------
NM_007302chr173381 344 334 ------
NM_007303chr173381 344 334 ------
NM_007304chr173381 344 334 ------
NM_007305chr173381 344 334 ------
NM_007324chr11166 ------
NM_007327chr91973 1859 3818 166 158 --
NM_007345chr181576 --1700 --
NM_007349chr7----260 48 --
NM_007358chr1----11577 --
NM_007359chr1741524 1419 236 81 1619 ----
NM_007365chr11577 ------
NM_009588chr6132 --197 --
NM_012074chr143806 402 63 ------
NM_012081chr512886 ------
NM_012092chr22122 37 ------
NM_012095chr1012690 12748 ----
NM_012096chr332962 710 404 ------
NM_012097chr222288 2003 ------
NM_012098chr931309 105 61 ------
NM_012102chr121614 23 ------
NM_012104chr1153610 986 583 439 225 --11481 1161
NM_012104chr1153610 986 583 439 225 --11481 1161
NM_012154chr8------1668
NM_012156chr2032290 2284 233 1988 22154 1107 1222
NM_012164chr932779 2409 2251 11851 22418 625 11399
NM_012186chr11746 ------
NM_012193chr1165175 4940 4887 4128 3971 3409 --14137 --
NM_012199chr1104100 3817 3749 3263 3157 2988 1768 1589 763 381 13082 13773 --
NM_012215chr1031904 1799 174 11251 21803 1288 --
NM_012224chr4----11073 11078
NM_012234chr32537 358 ------
NM_012236chr11867 --2278 212 --
NM_012238chr101126 ------
NM_012244chr1411590 11725 11597 11301
NM_012250chr1121050 135 ------
NM_012252chr7148 14897 ----
NM_012261chr20------1507
NM_012262chr145138 3729 3528 1486 24704 3548 --1165
NM_012264chr22129 21425 94 ----
NM_012264chr22129 21425 94 ----
NM_012282chrX123 ------
NM_012285chr171108 --1117 --
NM_012288chr665622 5482 3617 1065 682 267 --2958 715 2472 299
NM_012293chr221724 131 ------
NM_012294chr7--11103 1258 --
NM_012296chr1183628 3163 3130 2587 2404 1037 340 47 12394 ----
NM_012297chr4--1930 1788 --
NM_012309chr1124413 163 --11746 --
NM_012329chr1711493 ------
NM_012330chr10--1121 --11412
NM_012333chr1----11471 --
NM_012334chr574086 3170 1679 1521 1355 925 913 --21688 62 --
NM_012384chr2042199 2009 1882 1588 --3543 89 40 --
NM_012399chr2211253 21828 441 ----
NM_012402chr113489 305 125 --11279 --
NM_012405chr152689 2682 2357 1183 1142 22387 2348 32858 746 71 --
NM_012407chr223527 405 104 ------
NM_012425chr10----123 1793
NM_012479chr721004 697 1202 ----
NM_012482chr12601 23 ------
NM_013262chr611146 ------
NM_013263chr161142 ------
NM_013267chr12146 ------
NM_013269chr121276 --1664 --
NM_013277chr122688 209 ------
NM_013281chr2011542 ------
NM_013283chr5--1783 ----
NM_013304chr16----147 --
NM_013330chr1131 ------
NM_013368chr19----1435 --
NM_013372chr15--12201 1620 --
NM_013374chr321069 322 13072 ----
NM_013390chr911192 --1221 1437
NM_013399chr1631532 549 98 ------
NM_013403chr19135 ------
NM_013436chr2--1655 ----
NM_013437chr821019 975 ------
NM_013444chrX1794 ------
NM_013448chr141498 ------
NM_013449chr1222208 2197 ------
NM_013943chr1--13293 ----
NM_013952chr232231 2216 685 --12359 --
NM_013953chr232231 2216 685 --12359 --
NM_013958chr81163 ------
NM_013959chr81163 ------
NM_013961chr81163 ------
NM_013962chr81163 ------
NM_013986chr22194 ------
NM_013992chr232231 2216 685 --12359 --
NM_013993chr63696 249 146 ------
NM_013994chr63696 249 146 ------
NM_014030chr1731089 965 902 --1939 --
NM_014043chr3--1651 ----
NM_014079chr341007 299 229 208 ------
NM_014089chr13----11873 --
NM_014106chr1532565 2325 772 --12869 --
NM_014112chr835342 4997 4002 ------
NM_014149chr71297 1606 ----
NM_014155chr1126582 1292 --11462 1167
NM_014157chr1632571 2437 1084 1956 32580 2446 1416 --
NM_014159chr3--1205 ----
NM_014212chr121257 --1123 --
NM_014213chr22589 161 ------
NM_014217chr1--173 ----
NM_014233chr1722006 163 --11622 --
NM_014240chr323303 1290 ------
NM_014243chr41143 ------
NM_014246chr2212020 --1306 1397
NM_014250chr223774 306 47 ------
NM_014253chrX32395 700 611 1372 ----
NM_014263chr10129 ------
NM_014279chr91307 ------
NM_014282chr921285 950 ------
NM_014284chr13795 708 261 ----1354
NM_014289chrX2403 306 ------
NM_014299chr1922093 1986 21939 1619 1884 --
NM_014309chr2245369 4278 4182 522 1657 1513 14283
NM_014316chr1641853 798 537 521 11877 --1686
NM_014319chr122593 496 ------
NM_014325chr1241647 1627 604 60 ------
NM_014338chr223389 248 113 ------
NM_014351chr2211181 ----11003
NM_014368chr9--22168 1523 ----
NM_014372chr1--1415 1571 --
NM_014376chr521972 189 ------
NM_014382chr311504 1159 ----
NM_014400chr191150 --196 --
NM_014405chr1732352 695 681 --1145 11725
NM_014409chr11179 1426 ----
NM_014415chr32387 215 ------
NM_014417chr191336 ------
NM_014423chr554937 4289 1305 1064 170 ------
NM_014445chr311871 ------
NM_014447chr411476 ------
NM_014454chr61729 1165 ----
NM_014456chr1041501 1433 570 413 ------
NM_014462chr8123 ------
NM_014470chr122681 299 1728 ----
NM_014489chr111162 1243 ----
NM_014515chr121853 ------
NM_014516chr19----1282 --
NM_014552chr221426 137 ------
NM_014562chr21755 ------
NM_014574chr1411541 ------
NM_014577chr221244 ------
NM_014604chr173552 301 122 ------
NM_014606chr42191 110 ------
NM_014615chr1642270 986 727 481 ------
NM_014634chr2243269 2970 2923 1244 ----11465
NM_014637chr811179 2500 482 ----
NM_014646chr1862787 2111 460 224 124 64 22911 2841 ----
NM_014655chr121698 602 ------
NM_014659chr1531161 378 208 ------
NM_014661chr10103704 2968 2594 2481 1436 1052 990 861 726 26 138 23451 1372 --
NM_014663chr12849 291 1369 ----
NM_014665chr873006 2847 2700 783 508 497 231 ----13573
NM_014667chr332170 842 785 1950 ----
NM_014671chr731403 450 328 ------
NM_014678chr22--2544 134 ----
NM_014682chr81733 1844 ----
NM_014685chr16--1371 ----
NM_014686chr1932467 915 550 ----1156
NM_014690chr722437 513 12352 1799 --
NM_014701chr1512494 13343 12448 --
NM_014705chr7----11414 --
NM_014712chr162569 124 ------
NM_014726chr172315 252 ------
NM_014729chr821728 1413 ------
NM_014730chr1245184 3757 3609 1599 24518 4484 25153 223 14408
NM_014730chr1245184 3757 3609 1599 24518 4484 25153 223 14408
NM_014739chr623986 870 --14054 --
NM_014742chr2021427 411 --11243 --
NM_014743chr411031 12215 ----
NM_014746chr254398 3315 1555 993 133 ------
NM_014747chr1135276 5042 4798 4624 4241 4222 4150 3868 1318 710 532 120 51 24370 143 15014 11791
NM_014751chr821480 325 ------
NM_014754chr81876 ------
NM_014755chr232955 2604 950 ------
NM_014757chr532253 1859 926 1220 21783 201 --
NM_014765chr122400 2159 --11809 --
NM_014770chr1221072 856 --1407 --
NM_014772chr1853486 3392 3078 1401 1343 --13466 --
NM_014774chr132887 2812 904 ------
NM_014800chr7--1171 ----
NM_014806chr9--1130 ----
NM_014807chr112222 146 1536 ----
NM_014819chr522438 2009 ----12089
NM_014820chr311925 ----1326
NM_014824chr111454 --1495 --
NM_014826chr121137 817 ----1113
NM_014827chr111259 ------
NM_014832chr13283 73 ------
NM_014836chr10--1640 11949 --
NM_014839chr11566 --11895 --
NM_014840chr1252453 2134 2113 522 88 22472 457 173 --
NM_014841chr611196 ------
NM_014849chr121123 405 ------
NM_014850chr364880 4751 4173 3783 963 157 --44670 4140 1190 865 --
NM_014871chr12180 ------
NM_014873chr154869 4172 4145 1404 448 11622 24750 1413 1453
NM_014876chr2232215 1472 616 --22045 781 --
NM_014877chr1746107 5948 1591 1411 1687 ----
NM_014892chr61237 ------
NM_014897chr1722507 474 --12674 --
NM_014899chr552689 2630 2402 1164 1072 --1632 1966
NM_014901chr551902 615 539 528 130 1299 ----
NM_014902chr202990 256 --11397 --
NM_014903chr121450 ------
NM_014904chr10--1267 1370 --
NM_014905chr2--1741 ----
NM_014906chr172440 216 ------
NM_014912chr10--13113 ----
NM_014917chr1--2893 214 ----
NM_014921chr1962615 2377 2302 2135 1987 1042 --42044 579 98 26 --
NM_014923chr13------21434 165
NM_014924chr1442066 402 354 248 12826 12075 --
NM_014927chrX--138 ----
NM_014934chr131756 --12903 --
NM_014935chr151521 710 663 329 151 --23435 2389 --
NM_014952chr1541344 781 285 112 11893 --11689
NM_014961chr41166 --12168 --
NM_014962chr2012202 ----22560 2300
NM_014964chr1711942 1749 22395 1984 --
NM_014970chr1155 ------
NM_014974chr10------21168 593
NM_014978chr1031155 627 438 --21618 325 --
NM_014989chr61220 ------
NM_014990chr1411108 ------
NM_014991chr412386 ------
NM_015000chr1222833 185 --11006 1173
NM_015002chr1231784 381 131 ------
NM_015008chr352885 2876 1239 877 543 ------
NM_015017chr13424 267 183 ------
NM_015018chr61189 ------
NM_015020chr1643402 310 151 44 --2480 319 --
NM_015023chr131605 169 39 1371 ----
NM_015024chr81197 ------
NM_015039chr131375 1209 211 --12670 14176
NM_015042chr1574116 3599 3361 3338 3154 1560 762 1217 ----
NM_015051chr953396 2655 2626 1136 500 12206 ----
NM_015060chr71200 ------
NM_015061chr92623 41 194 ----
NM_015071chr5106489 5040 4981 4089 1385 1372 1331 589 424 393 25874 4643 ----
NM_015075chrX51936 1548 1435 696 528 ------
NM_015076chr6----12948 --
NM_015077chr17134400 4253 3654 3291 3192 2995 2975 1601 1571 1347 1080 814 695 14667 13518 12906
NM_015080chr112330 313 ------
NM_015092chr1633608 1511 504 ------
NM_015094chr22104357 4003 3730 3073 2936 2893 1759 389 347 275 23013 725 --11766
NM_015100chr121807 215 ------
NM_015101chr132705 2257 2168 ------
NM_015107chrX42185 2112 845 742 ------
NM_015113chr1721583 173 ------
NM_015144chr1613566 --1234 --
NM_015149chr12623 569 ----12218
NM_015150chr3166 --2756 78 --
NM_015155chr1063188 3116 866 488 216 87 --1989 --
NM_015156chr1461257 1031 1025 616 439 184 12920 ----
NM_015161chr1631096 397 210 ------
NM_015163chr1421851 128 197 ----
NM_015172chr1--21514 73 ----
NM_015184chr31213 ------
NM_015185chrX32858 2460 239 ----12252
NM_015187chr4--153 ----
NM_015193chr851238 1202 1075 950 500 ----11374
NM_015198chr7--1265 ----
NM_015199chr31999 ------
NM_015200chr411630 ------
NM_015206chr1523853 464 ------
NM_015208chr1813710 1254 ----
NM_015213chr111254 1610 1233 --
NM_015215chr112976 ------
NM_015219chr1751656 780 734 540 82 ------
NM_015225chr911079 ------
NM_015229chr173804 260 187 ------
NM_015250chr9--11367 ----
NM_015254chr872101 1261 1160 1137 1123 870 252 --32216 1143 142 --
NM_015263chr151154 ------
NM_015264chr2274730 4358 3844 1472 1430 571 203 --24854 4273 1822
NM_015265chr211683 ------
NM_015269chr1126 ------
NM_015270chr1221463 823 ----11608
NM_015272chr16----11769 --
NM_015277chr1811184 11422 --11720
NM_015282chr222877 2464 12839 ----
NM_015284chr121446 1337 ----11638
NM_015288chr543342 3316 1040 184 13880 22431 2427 --
NM_015292chr123650 557 234 ------
NM_015293chr6--133 ----
NM_015299chr1423572 300 1962 23380 1442 13636
NM_015310chr857926 6627 2974 1131 28 ------
NM_015316chr141306 --11003 --
NM_015317chr2--32621 2393 240 ----
NM_015321chr1974680 4384 4365 3526 1507 1152 220 13114 54755 3618 3363 1680 1144 --
NM_015326chr132451 931 717 --22769 366 --
NM_015327chr141240 1136 397 167 11319 11003 --
NM_015328chr71176 22048 1197 12518 --
NM_015329chr1932842 2721 2467 ------
NM_015339chr202234 107 ------
NM_015347chr121461 22709 1972 ----
NM_015358chr2111266 1200 ----
NM_015365chrX1717 23808 1337 ----
NM_015374chr2231382 1069 316 --1330 11084
NM_015401chr121217 --1430 --
NM_015404chr9291 66 ------
NM_015419chrX169 ------
NM_015435chr821149 53 ------
NM_015443chr1731152 471 254 2558 224 ----
NM_015470chr21788 ----132
NM_015477chr15----1147 --
NM_015497chr152930 142 1737 ----
NM_015503chr163470 180 162 ------
NM_015511chr2021107 425 ------
NM_015520chr341967 1852 1804 949 ------
NM_015525chr61841 ------
NM_015545chr72275 70 ------
NM_015550chr71510 ----12666
NM_015553chr655209 4079 3834 3633 1555 13458 24230 3533 --
NM_015559chr182362 256 --1301 --
NM_015570chr711175 ------
NM_015575chr272899 2889 2672 1419 1320 1145 600 --23353 2447 --
NM_015576chr32693 467 1542 ----
NM_015578chr19----11440 --
NM_015584chr1731421 1072 511 --2470 193 --
NM_015589chr14129 ------
NM_015609chr122898 272 --22051 2047 12740
NM_015630chr21995 ------
NM_015642chr31275 ------
NM_015651chr931773 620 83 --11507 --
NM_015678chr131551 ------
NM_015686chrX51914 1672 548 295 61 ------
NM_015691chrX32249 2051 297 --1457 --
NM_015726chr171794 1728 1479 688 483 351 28 --11187 --
NM_015844chr182684 202 ------
NM_015846chr182684 202 ------
NM_015847chr182684 202 ------
NM_015850chr852102 1895 737 576 197 1106 ----
NM_015866chr111194 ------
NM_015878chr811495 ------
NM_015892chr1031529 408 288 ------
NM_015898chr1942324 1984 451 383 ------
NM_015904chr21563 ------
NM_015906chr114682 ------
NM_015981chr573020 2309 1947 897 358 237 71 --1342 --
NM_016022chr12913 752 ------
NM_016037chr12417 259 --1426 --
NM_016061chr21499 ------
NM_016103chr5197 ------
NM_016107chr5151 ------
NM_016131chr212051 ------
NM_016132chr151428 13050 ----
NM_016185chr171760 --1583 --
NM_016231chr1711657 ------
NM_016235chr163377 355 304 ------
NM_016240chr841395 636 527 497 --11073 --
NM_016248chr13--13053 ----
NM_016250chr142696 562 ------
NM_016257chr131380 1081 268 --2650 74 12929
NM_016260chr225824 4809 12332 ----
NM_016263chr19103102 2762 2719 2624 2539 1227 1221 910 795 112 12965 22256 1320 --
NM_016272chr2271922 944 932 799 600 581 230 --2604 459 --
NM_016289chr23360 265 155 --12331 --
NM_016300chr31166 1123 ----
NM_016308chr12623 117 11881 ----
NM_016320chr112977 791 --199 --
NM_016322chr922712 1079 21268 865 ----
NM_016338chr511103 ------
NM_016340chr511093 ------
NM_016353chr82677 115 ------
NM_016374chr1------11287
NM_016374chr1------11287
NM_016376chr1753620 2836 433 417 93 ------
NM_016396chr15------11017
NM_016418chr22103242 2874 2811 2629 2579 888 743 688 660 155 13641 23040 2583 1654
NM_016423chr14----1164 --
NM_016427chr182150 67 ------
NM_016440chr191258 ------
NM_016447chr71174 ------
NM_016467chr22548 228 --1130 --
NM_016496chr192465 48 ------
NM_016507chr17--1185 ----
NM_016531chr41114 11362 ----
NM_016538chr17162 128 ----
NM_016545chr11846 ------
NM_016559chr3--1565 ----
NM_016577chr323259 159 23275 814 --14241
NM_016596chr121217 --1430 --
NM_016603chr51608 22105 770 --176
NM_016605chr53789 199 78 --22528 2477 --
NM_016609chr14----132 --
NM_016613chr422059 549 ------
NM_016621chr1133513 3203 546 13582 21823 1667 --
NM_016626chr18--11103 --1640
NM_016639chr16----2448 431 --
NM_016824chr1011503 11462 ----
NM_016836chr21691 ------
NM_016839chr21691 ------
NM_017409chr12----1258 --
NM_017413chrX31024 1018 503 ------
NM_017420chr1412895 ------
NM_017423chr42744 382 ------
NM_017424chr2231543 535 377 --21552 140 1545
NM_017450chr1731127 138 88 ----11220
NM_017452chr2041399 380 277 179 ------
NM_017453chr2041399 380 277 179 ------
NM_017454chr2041399 380 277 179 ------
NM_017544chrX1857 --1861 --
NM_017563chr344707 852 681 130 11494 1890 --
NM_017582chr121748 464 ------
NM_017590chr2262400 1696 899 553 490 344 --1926 --
NM_017595chr1771718 1655 1377 1172 603 556 545 ------
NM_017610chr151119 ------
NM_017628chr434938 1291 783 14197 ----
NM_017629chr121693 597 ------
NM_017633chr643713 2696 2498 592 ------
NM_017635chr113561 512 351 ------
NM_017637chr978832 7136 7015 3496 1709 1063 647 1753 18790 --
NM_017643chr1722268 761 1548 ----
NM_017661chr15--1504 ----
NM_017670chr112539 151 ------
NM_017672chr151501 1198 ----
NM_017712chr19126308 5491 5439 5141 5108 4163 4128 2251 1809 1390 939 326 45025 4909 2137 1398 41976 501 497 493 --
NM_017719chr312491 1899 ----
NM_017730chr32595 253 ------
NM_017736chr1642388 966 615 253 ------
NM_017739chr13380 101 28 193 2406 51 --
NM_017749chr112779 95 --1673 --
NM_017753chr911012 ------
NM_017758chr171323 1234 11078 --
NM_017769chr1412274 ------
NM_017784chr3--183 ----
NM_017787chr1072822 2267 2049 881 828 571 339 --32672 674 663 --
NM_017811chr942811 2662 2327 578 --12434 --
NM_017813chr845643 4517 1985 1977 1598 25052 2154 --
NM_017831chr1864179 3725 3004 2957 1706 685 --33525 2966 1870 --
NM_017848chrX33830 3156 1364 ------
NM_017849chr232480 2318 629 --22489 1018 --
NM_017873chr972133 2003 1990 1125 694 548 364 21212 620 ----
NM_017893chr1031118 509 55 --1144 --
NM_017895chr20----172 --
NM_017902chr1065022 4424 4344 4124 2056 1107 1168 ----
NM_017921chr1731732 1475 416 --1124 1196
NM_017933chr21440 1563 ----
NM_017938chrX21738 1427 ------
NM_017944chr11194 ------
NM_017945chr31876 ------
NM_017953chr1173 --1491 1414
NM_017964chr21656 --1665 --
NM_017974chr221265 1101 ------
NM_017982chr121304 1007 --11050 --
NM_017993chr13186 ------
NM_018000chr221399 591 ----11404
NM_018024chr8193 ------
NM_018028chr192930 830 --197 11331
NM_018043chr1121494 423 ----1252
NM_018045chr132356 992 679 ------
NM_018046chr521514 691 ------
NM_018054chr162559 210 ------
NM_018064chr6--1291 ----
NM_018070chr1196 ------
NM_018089chr2--1165 ----
NM_018092chr161283 ------
NM_018110chr1641334 479 199 150 11005 31338 169 55 1465
NM_018116chr12546 500 1514 ----
NM_018121chr10--1147 ----
NM_018124chr16135 --11798 --
NM_018126chr4--153 ----
NM_018133chr3--12157 --12046
NM_018157chr1221144 935 1421 12758 --
NM_018171chr121814 ------
NM_018176chr431447 1260 564 11236 ----
NM_018178chr1136 --140 --
NM_018181chr18--11890 1770 --
NM_018189chr351188 667 515 507 350 ------
NM_018193chr15--199 1185 --
NM_018221chr21159 ------
NM_018244chr203453 194 34 ------
NM_018245chr101155 ------
NM_018246chr812053 22733 1762 ----
NM_018270chr201636 --162 --
NM_018275chr72439 189 --1234 --
NM_018293chr31174 --1384 --
NM_018297chr3--128 ----
NM_018299chr81174 ------
NM_018302chr4132 --1699 --
NM_018315chr421201 125 ------
NM_018320chr1111273 1982 ----
NM_018325chr921170 359 147 11567 --
NM_018327chr201652 ------
NM_018340chr1654041 3803 3399 1676 1189 --23972 1344 --
NM_018367chr111313 ------
NM_018375chr1421720 1216 ------
NM_018424chr921595 470 ------
NM_018427chr1621563 565 21480 600 ----
NM_018440chr887674 7170 5788 5568 3321 2643 1994 122 ------
NM_018448chr12--1471 ----
NM_018482chr81307 ------
NM_018486chrX2484 156 ------
NM_018489chr11448 ------
NM_018584chr1--1416 ----
NM_018602chr15--21726 58 ----
NM_018638chr1211430 ----15467
NM_018644chr1122155 274 12099 11831 --
NM_018650chr1--21847 629 ----
NM_018652chr15----1401 11052
NM_018660chr821147 128 11883 ----
NM_018674chr21219 --2473 203 --
NM_018682chr71709 ------
NM_018684chrX31208 1022 468 ------
NM_018689chr1552586 996 912 217 78 --1386 --
NM_018695chr52528 475 ------
NM_018708chr1921663 601 ------
NM_018711chr1221016 24 21545 628 11025 155
NM_018715chr112117 ------
NM_018717chr471837 781 770 737 494 464 128 ------
NM_018718chr722096 886 ------
NM_018841chr113513 ------
NM_018846chr71189 ------
NM_018897chr2139 --143 --
NM_018898chr52655 307 11716 ----
NM_018899chr52655 307 11716 ----
NM_018900chr52655 307 11716 ----
NM_018901chr52655 307 11716 ----
NM_018902chr52655 307 11716 ----
NM_018903chr52655 307 11716 ----
NM_018904chr52655 307 11716 ----
NM_018905chr52655 307 11716 ----
NM_018906chr52655 307 11716 ----
NM_018907chr52655 307 11716 ----
NM_018908chr52655 307 11716 ----
NM_018909chr52655 307 11716 ----
NM_018910chr52655 307 11716 ----
NM_018911chr52655 307 11716 ----
NM_018912chr521173 405 --11498 --
NM_018913chr521173 405 --11498 --
NM_018914chr521173 405 --11498 --
NM_018915chr521173 405 --11498 --
NM_018916chr521173 405 --11498 --
NM_018917chr521173 405 --11498 --
NM_018918chr521173 405 --11498 --
NM_018919chr521173 405 --11498 --
NM_018920chr521173 405 --11498 --
NM_018921chr521173 405 --11498 --
NM_018922chr521173 405 --11498 --
NM_018923chr521173 405 --11498 --
NM_018924chr521173 405 --11498 --
NM_018925chr521173 405 --11498 --
NM_018926chr521173 405 --11498 --
NM_018927chr521173 405 --11498 --
NM_018928chr521173 405 --11498 --
NM_018929chr521173 405 --11498 --
NM_018931chr52347 181 1268 1660 --
NM_018951chr75400 346 289 197 44 --1155 --
NM_018957chr22------1333
NM_018959chr191499 ------
NM_018970chr713106 ------
NM_018976chr121123 12846 ----
NM_018999chr1033046 1948 1056 24941 1564 ----
NM_019027chr42933 856 1561 ----
NM_019057chr51269 ------
NM_019063chr212170 12129 ----
NM_019071chr7------1571
NM_019072chr533629 1537 431 ------
NM_019074chr152866 43 ------
NM_019084chr1022256 352 ------
NM_019088chr19----123 --
NM_019096chr631029 776 345 --1245 --
NM_019106chr2222110 521 --13236 --
NM_019114chr922505 435 ------
NM_019116chr1643524 3476 2642 822 --11159 --
NM_019555chr321747 120 ------
NM_019557chr12783 350 ------
NM_019592chr93743 599 29 ------
NM_019593chr2012989 ------
NM_019606chr71510 --1197 --
NM_019613chr172908 95 --159 --
NM_019843chr22175 ------
NM_019885chr252536 2158 2053 371 180 --12312 --
NM_019891chr1----1411 --
NM_019903chr1011503 11462 ----
NM_020116chr421328 122 ------
NM_020117chr52745 90 ------
NM_020123chr1011507 ------
NM_020142chr121469 --1449 --
NM_020150chr102533 209 1242 ----
NM_020152chr21152 ------
NM_020163chr351728 1427 325 165 35 1240 ----
NM_020177chr523089 2184 ------
NM_020182chr2043148 2694 1153 23 --11077 --
NM_020185chr6----149 --
NM_020198chr1711180 ------
NM_020211chr1531390 1062 61 ------
NM_020239chr142036 846 415 156 --1498 --
NM_020245chr644863 3677 1575 178 --13709 --
NM_020248chr122204 1623 21674 920 1434 1163
NM_020310chr1722407 2375 --1554 --
NM_020337chr431232 1057 965 ------
NM_020342chr2----2992 150 --
NM_020343chr20------1489
NM_020346chr1121392 416 ------
NM_020362chr12242 96 ------
NM_020372chr14----132 --
NM_020381chr631816 576 506 ------
NM_020390chr321451 963 1577 11132 1627
NM_020423chr11174 ------
NM_020429chr753092 2101 2044 1132 962 184 ----
NM_020443chr145937 2347 1331 503 144 15780 --
NM_020452chr171413 856 846 562 151 133 86 --150 1595
NM_020456chr13----11842 --
NM_020463chr21415 ------
NM_020465chr1621913 557 11499 ----
NM_020475chr822055 301 --11591 12226
NM_020476chr822055 301 --11591 12226
NM_020477chr822055 301 --11591 12226
NM_020480chr822055 301 --11591 12226
NM_020631chr151309 1150 1085 378 270 --1964 --
NM_020640chr322099 78 1367 ----
NM_020647chr811905 ------
NM_020651chr2------11135
NM_020673chr2067525 6634 6008 5932 234 65 --26178 5248 15085
NM_020690chr52285 120 ------
NM_020692chr141894 --151 --
NM_020699chr165099 4803 3946 1210 1191 656 ------
NM_020703chr1----184 --
NM_020706chr211113 ------
NM_020708chr2052432 1728 1699 1634 289 ----12008
NM_020713chr2082736 2697 2477 2404 1196 948 855 202 --1417 --
NM_020714chr19114653 4325 4261 4169 3700 2998 1264 1124 984 713 410 22853 1053 33955 1133 576 --
NM_020717chrX1447 --11916 --
NM_020724chr41693 --1872 12587
NM_020727chr2123139 108 ------
NM_020728chr732603 1092 380 ------
NM_020734chr1212935 --13251 --
NM_020752chr1022146 2012 ------
NM_020755chr621322 1211 ------
NM_020760chr2--11713 ----
NM_020765chr1139 ------
NM_020766chrX43671 3359 1138 86 13988 14097 --
NM_020772chr1727565 6418 ------
NM_020773chr42834 133 12310 ----
NM_020783chr181412 ------
NM_020794chr1--1452 ----
NM_020795chr1741901 1662 1425 361 11623 ----
NM_020796chr522737 1217 --11849 --
NM_020801chr5----1927 --
NM_020809chr111230 ------
NM_020814chr211038 1485 1157 --
NM_020815chr41350 ------
NM_020818chr14183 ------
NM_020820chr2041031 277 188 73 ------
NM_020824chr10--1288 1114 --
NM_020832chr12547 77 ------
NM_020850chr1682860 2683 2350 2153 1282 363 294 50 --2236 28 --
NM_020856chr191130 1360 ----
NM_020858chr151217 ------
NM_020859chr453479 3463 3399 3114 365 --11280 11164
NM_020868chr21228 ------
NM_020870chr41834 11855 ----
NM_020895chr19--172 ----
NM_020917chr192611 604 13050 12874 --
NM_020918chr10--122 --1706
NM_020920chr142307 254 ------
NM_020922chrX1628 ------
NM_020925chr11958 --1206 --
NM_020935chr254204 3527 2882 2864 461 ----122
NM_020939chr6284 27 ------
NM_020946chr941667 1610 515 103 ------
NM_020948chr1--11210 13189 --
NM_020956chr19103822 3510 3361 3355 3147 3060 2960 997 915 244 --23411 828 14713
NM_020962chr1532076 1898 467 ------
NM_020983chr1221463 823 ----11608
NM_020989chr2164 ------
NM_020993chr1252306 2150 968 944 713 12596 ----
NM_021003chr141801 1568 ----
NM_021005chr15--1992 ----
NM_021012chr1783005 2770 2200 2049 747 540 371 39 22125 987 1348 --
NM_021035chr2021036 106 ------
NM_021038chr313177 ------
NM_021047chr191280 --1447 --
NM_021061chr844147 1639 841 525 13514 21648 850 --
NM_021069chr4----1192 --
NM_021072chr511951 ------
NM_021096chr2233249 2632 2183 13240 1959 --
NM_021097chr222101 1956 12514 ----
NM_021109chrX2293 100 ------
NM_021109chrX2293 100 ------
NM_021120chrX21180 691 ------
NM_021132chr101977 1503 ----
NM_021140chrX2388 99 ------
NM_021141chr21234 ------
NM_021145chr72845 218 ------
NM_021148chr722397 878 ------
NM_021189chr11294 --1408 --
NM_021198chr221219 457 --11428 --
NM_021215chr2052422 2044 456 400 64 ------
NM_021224chr9----163 --
NM_021238chr1241777 621 279 122 --2642 288 --
NM_021249chr1431466 1398 1201 21503 1083 ----
NM_021253chr631434 226 174 ------
NM_021260chr141332 --1433 --
NM_021569chr91973 1859 3818 166 158 --
NM_021627chr3132 --1899 --
NM_021639chr1--1294 ----
NM_021643chr221832 417 1461 ----
NM_021648chr672140 2007 898 714 602 419 162 ------
NM_021649chr5----126 --
NM_021728chr142754 50 ------
NM_021809chr201322 1154 11592 12342
NM_021825chr11131 ------
NM_021911chr525601 125 ------
NM_021912chr151616 --13473 --
NM_021940chr631580 1376 1301 ------
NM_021943chr661943 1350 1344 835 526 371 --1190 --
NM_021946chrX11433 ------
NM_021961chr1137176 5675 1040 12346 35339 2008 1836 --
NM_021969chr1------143
NM_021998chrX11151 ------
NM_022047chr6160 ------
NM_022048chr1566217 5527 659 562 477 432 13921 21878 1404 1975
NM_022114chr153344 3213 2986 800 328 --14329 --
NM_022130chr5--1169 ----
NM_022138chr621278 180 1985 2978 468 --
NM_022143chr7----1120 --
NM_022144chrX--136 ----
NM_022166chr1634943 4560 602 25255 1548 15406 --
NM_022169chr1151160 962 946 448 434 11207 21025 141 --
NM_022340chr353525 3383 2272 1422 785 12300 ----
NM_022346chr421260 1193 ------
NM_022362chr10------1326
NM_022454chr8--1129 ----
NM_022458chr712746 ------
NM_022469chr142760 807 476 458 ------
NM_022483chr531798 1440 679 ------
NM_022497chr382609 1520 964 779 770 363 210 23 --11524 23595 445
NM_022552chr21187 ------
NM_022574chr742068 1722 1597 719 --1609 1765
NM_022648chr253965 3793 2949 1143 711 ------
NM_022650chr51155 ------
NM_022730chr2----1341 --
NM_022733chr11735 1263 ----
NM_022735chr12434 34 ------
NM_022744chr161949 ------
NM_022745chr121193 565 ------
NM_022748chr71724 22402 1918 ----
NM_022749chr821067 972 ------
NM_022758chr642935 1254 933 488 12037 ----
NM_022763chr332893 2298 1132 12870 ----
NM_022780chr221641 702 --1650 --
NM_022832chr421890 605 --1599 2892 610
NM_022841chr15--1380 ----
NM_022845chr1631718 907 852 32034 255 59 1692 --
NM_022897chr52883 80 --11109 --
NM_022898chr1433408 3297 1323 ------
NM_022901chr911174 195 11183 --
NM_022910chr1621913 557 11499 ----
NM_022912chr232747 1213 312 ------
NM_022913chr51222 ------
NM_022917chr91118 ------
NM_022918chr1121857 1648 ------
NM_022965chr4157 11165 ----
NM_022970chr1011047 ------
NM_023010chrX2331 116 ------
NM_023034chr81186 ------
NM_023071chr121231 ------
NM_023074chr192865 204 ------
NM_023076chr1662671 2587 2478 959 145 111 --12675 12462
NM_023079chr1731582 1474 1197 --11201 --
NM_023105chr852102 1895 737 576 197 1106 ----
NM_023106chr852102 1895 737 576 197 1106 ----
NM_023110chr852102 1895 737 576 197 1106 ----
NM_023111chr852102 1895 737 576 197 1106 ----
NM_023927chr521135 92 --2978 974 --
NM_023929chr81206 ------
NM_024007chr532558 2381 39 ------
NM_024056chr122601 521 1234 ----
NM_024061chr71167 ------
NM_024085chr22799 388 ------
NM_024092chr1121218 270 --1221 --
NM_024293chr21112 ------
NM_024294chr642935 1254 933 488 12037 ----
NM_024297chr171211 ------
NM_024306chr161953 --190 --
NM_024344chr15----2543 464 --
NM_024424chr11--1850 ----
NM_024425chr11--1850 ----
NM_024426chr11--1850 ----
NM_024430chr181459 11789 11511 --
NM_024496chr142253 225 ------
NM_024512chr352387 2354 2252 2206 868 --22258 441 --
NM_024519chr16----183 --
NM_024522chr111682 ----11601
NM_024524chr322906 2087 1736 ----
NM_024536chr22317 119 --197 --
NM_024541chr1071887 1796 1439 599 331 96 57 ------
NM_024545chr22716 477 --2298 294 --
NM_024546chr1331023 322 259 ------
NM_024551chr1232509 347 69 1886 22386 2304 --
NM_024551chr1232509 347 69 1886 22386 2304 --
NM_024554chr121527 624 --11089 --
NM_024563chr52724 706 ------
NM_024565chr521260 1130 ------
NM_024590chr421302 97 ------
NM_024612chr171280 ------
NM_024613chr81271 11782 ----
NM_024617chr9----1810 --
NM_024646chr121416 715 --1538 --
NM_024665chr313807 ------
NM_024671chr161179 ------
NM_024674chr132134 1095 933 2494 98 12296 --
NM_024698chr1151199 339 309 298 52 ------
NM_024700chr11976 ------
NM_024713chr1511240 ------
NM_024721chr811635 1154 ----
NM_024742chr1651645 1422 1400 703 141 --11522 --
NM_024769chr111292 ------
NM_024770chr255925 4903 2676 2248 1460 12419 --16345
NM_024798chr1592512 2324 2113 2036 2020 1863 662 505 73 11126 1671 --
NM_024828chr9--11386 ----
NM_024834chr101438 ------
NM_024871chr33152 78 44 ------
NM_024875chr1011522 ------
NM_024884chr1454389 1834 1126 570 347 13946 11135 --
NM_024885chrX1704 ------
NM_024887chr131736 149 122 ----11846
NM_024899chr181544 ------
NM_024900chr442109 1945 830 439 1852 --1133
NM_024900chr442109 1945 830 439 1852 --1133
NM_024989chr266874 2744 2643 2380 2222 889 --22875 2389 --
NM_025054chr82966 58 --1190 --
NM_025061chr191914 --3283 279 163 --
NM_025074chr442789 2085 1049 1017 --1259 --
NM_025076chr21641 ------
NM_025133chr21290 ------
NM_025146chr332312 1711 592 --2742 673 --
NM_025187chr165875 495 205 146 135 ------
NM_025222chr362663 2254 1001 741 636 103 ------
NM_025224chr2051749 1632 1513 859 438 --11520 --
NM_025248chr1782765 2667 2323 783 725 650 291 280 12368 --11236
NM_030594chr152520 95 144 ----
NM_030621chr14------1598
NM_030625chr1022597 585 ------
NM_030627chr513511 189 ----
NM_030640chr121846 ------
NM_030647chr745985 5771 5184 3981 14315 ----
NM_030648chr422096 1392 ------
NM_030660chr141387 ------
NM_030661chr721072 516 ------
NM_030674chr1234162 1563 690 35214 1682 629 ----
NM_030759chr10--1766 ----
NM_030761chr142605 2251 1893 246 12260 12103 --
NM_030786chr121269 178 ------
NM_030791chr14--11593 ----
NM_030802chr172698 353 1645 ----
NM_030803chr221265 1101 ------
NM_030881chr2222328 2126 ------
NM_030912chr102338 220 ------
NM_030913chr12655 246 ------
NM_030927chr1021129 159 --21169 1165 --
NM_030939chr631192 890 354 ------
NM_030945chr542550 2015 435 283 ------
NM_030948chr61204 169 ----
NM_030957chr192157 31 --1177 --
NM_030964chr532833 2795 1139 ------
NM_030965chr11625 ------
NM_031157chr12--1588 ----
NM_031203chr19177 ------
NM_031205chr121284 ------
NM_031243chr71620 --11707 --
NM_031262chr91162 ------
NM_031263chr91219 ------
NM_031268chr16125109 5099 4490 4115 4024 2083 1250 822 761 671 573 391 34853 4813 636 24290 3990 14086
NM_031283chr2------1126
NM_031305chr4----185 --
NM_031309chr821931 68 ------
NM_031371chr1------11287
NM_031371chr1------11287
NM_031372chr411503 ------
NM_031411chr52655 307 11716 ----
NM_031417chr1922655 103 1480 22750 753 12281
NM_031424chr202491 147 ------
NM_031433chr11------159
NM_031434chr7----1394 --
NM_031435chr12--1349 ----
NM_031438chr5--1446 ----
NM_031442chrX--1354 ----
NM_031445chr232913 974 545 1861 12328 --
NM_031450chr112192 50 ------
NM_031459chr11500 --1364 --
NM_031468chr757716 6263 6100 1976 1210 --36035 3099 2288 16358
NM_031476chr1652620 2254 675 612 532 --12263 --
NM_031478chr163537 78 72 ------
NM_031483chr2022759 2435 ------
NM_031844chr133347 1309 757 ------
NM_031845chr213003 --13624 --
NM_031847chr213003 --13624 --
NM_031849chr52655 307 11716 ----
NM_031857chr52655 307 11716 ----
NM_031858chr1721293 1039 ------
NM_031860chr52655 307 11716 ----
NM_031862chr1721293 1039 ------
NM_031890chr2232975 2331 2103 --12335 1259
NM_031938chr11----1762 --
NM_031990chr191592 --11446 --
NM_031991chr191592 --11446 --
NM_032028chr54519 474 464 457 ------
NM_032047chr322312 740 ------
NM_032088chr521173 405 --11498 --
NM_032092chr521173 405 --11498 --
NM_032102chr111611 ------
NM_032105chr147911 5340 5076 1240 ----17565
NM_032109chr531292 959 328 11212 ----
NM_032120chr71195 194 1365 --
NM_032121chrX1685 --1853 --
NM_032128chr41324 ------
NM_032144chr211151 --11166 --
NM_032153chr312274 ------
NM_032160chr1813655 --13822 23367 701
NM_032182chr1011444 ------
NM_032192chr17----1141 --
NM_032199chr1033480 1209 70 11174 1200 --
NM_032208chr213092 12234 1781 1127
NM_032217chr4----1290 --
NM_032268chr1622232 2082 --53136 3132 3128 2423 551 12931
NM_032281chr1942657 2450 543 240 --1885 --
NM_032283chr151793 587 544 422 29 --11498 --
NM_032294chr17199 1504 31357 1199 308 21772 313
NM_032317chr731770 1543 1321 11533 11152 --
NM_032352chr141986 ------
NM_032353chr171132 --1392 --
NM_032364chr12----1328 --
NM_032373chr1034497 3979 898 1724 12092 --
NM_032376chr17170 --1668 --
NM_032389chr1151040 827 766 384 65 ------
NM_032403chr521173 405 --11498 --
NM_032408chr7--11071 ----
NM_032420chr52627 149 ------
NM_032430chr191284 ------
NM_032438chr6--11260 11032 --
NM_032445chr151894 ------
NM_032446chr521080 268 ------
NM_032449chr14910 495 466 365 --21918 1834 --
NM_032457chr4--12519 1430 --
NM_032458chrX----12350 --
NM_032468chr8--1367 ----
NM_032491chr12--1319 ----
NM_032505chr3----1719 --
NM_032523chr21490 ------
NM_032552chr951847 1395 1268 626 612 ------
NM_032560chr14--1769 ----
NM_032575chr1621670 680 1772 1160 --
NM_032583chr16------130
NM_032590chr121442 ------
NM_032595chr1731379 603 363 11084 1275 --
NM_032596chr9--1105 ----
NM_032682chr322604 1227 ------
NM_032689chr1911074 ------
NM_032711chr1784089 3520 3189 1314 1296 1202 625 417 12693 ----
NM_032725chr112212 27 ------
NM_032741chr631008 968 825 ------
NM_032775chr223405 112 37 ------
NM_032777chr841427 1086 116 94 --132 1481
NM_032786chr123472 152 43 ------
NM_032808chr152803 756 --1622 --
NM_032837chr171110 11822 --11982
NM_032842chr71583 11164 1592 --
NM_032854chr174229 222 193 97 ------
NM_032918chr121145 ------
NM_032926chrX147 ------
NM_032975chr1832968 2937 1158 12355 ----
NM_032980chr1832968 2937 1158 12355 ----
NM_032983chr721036 678 128 ----
NM_032995chr261612 1235 584 507 197 57 ----1636
NM_032998chr11943 11033 ----
NM_033012chr132794 306 ------
NM_033018chrX41174 979 374 34 ------
NM_033020chr114682 ------
NM_033025chr191737 --1310 --
NM_033027chr31962 --199 --
NM_033036chr115633 519 502 243 207 ------
NM_033055chr1--1786 ----
NM_033071chr6--133 ----
NM_033083chr333220 828 381 --23045 2406 --
NM_033117chr9----1254 --
NM_033118chr202886 130 --1596 --
NM_033133chr17143296 2877 2869 2408 2321 1412 1393 1369 1306 831 803 656 422 255 --31473 1443 993 11031
NM_033138chr71625 ----11664
NM_033139chr71625 ----11664
NM_033140chr71625 ----11664
NM_033151chr16------130
NM_033157chr71625 ----11664
NM_033158chr32230 32 ------
NM_033211chr521592 1552 ------
NM_033224chr768013 7386 6797 6634 4960 2481 22803 1284 36806 6345 1028 --
NM_033225chr8--12817 ----
NM_033226chr161195 ------
NM_033240chr153458 408 207 ------
NM_033266chr163388 82 38 --166 --
NM_033285chr82522 23 --11035 --
NM_033326chr1112185 --12506 --
NM_033331chr942871 1394 342 290 --1294 --
NM_033348chr111309 171 ----
NM_033389chr1734771 4381 773 ------
NM_033394chr211067 ------
NM_033420chr192754 293 ------
NM_033449chr542020 725 374 275 1804 11385 --
NM_033503chr1543375 3366 2738 2527 22427 837 33483 2467 529 --
NM_033549chr52800 393 ------
NM_033624chr1231784 381 131 ------
NM_033631chr173886 3358 2999 2983 2653 800 113 1774 12693 12685
NM_033632chr421201 125 ------
NM_033637chr1024008 3730 ------
NM_052851chr1322048 1997 ------
NM_052876chr1951932 1740 1073 829 514 12679 1315 1752
NM_052879chr121511 ----13387
NM_052886chr822105 614 ------
NM_052905chr2--11791 ----
NM_052906chr2284826 4817 4733 3660 3517 1599 1330 42 --44418 4102 3804 311 --
NM_052910chr133432 330 74 11671 ----
NM_052961chr6--138 ----
NM_052968chr112542 530 ------
NM_052978chr1421378 468 ------
NM_053002chr31888 ------
NM_053016chr967813 6901 6271 5693 2319 467 15901 ----
NM_053023chr1121046 914 ----1493
NM_053025chr3--1201 ----
NM_053026chr3--1201 ----
NM_053027chr3--1201 ----
NM_053028chr3--1201 ----
NM_053031chr3--1201 ----
NM_053032chr3--1201 ----
NM_053043chr766106 5703 5113 4661 570 193 14649 14125 --
NM_053046chr192193 68 1373 ----
NM_053279chr8248 29 ----1580
NM_054025chr1122155 274 12099 11831 --
NM_054027chr511976 ------
NM_057178chr1732253 2159 1131 --167 1186
NM_058170chr111422 ------
NM_058172chr421685 1469 --11807 --
NM_058175chr213733 591 553 --1639 --
NM_058241chr21849 --1277 --
NM_058241chr21849 --1277 --
NM_078470chr1032550 648 452 21741 302 1816 --
NM_078487chr941031 205 176 37 ------
NM_078625chr6--1280 ----
NM_079834chr1931267 382 77 11434 --1295
NM_080392chr11505 ------
NM_080430chr221131 ------
NM_080491chr1183628 3163 3130 2587 2404 1037 340 47 12394 ----
NM_080546chr911563 ------
NM_080616chr202548 260 --1581 --
NM_080621chr2041386 198 171 73 1273 41107 945 454 122 --
NM_080632chrX2331 116 ------
NM_080664chr141500 ------
NM_080669chr1793844 3375 3351 3210 1791 1298 979 715 541 --14075 21657 362
NM_080676chr2032444 1078 364 12703 ----
NM_080679chr62770 627 ----1800
NM_080680chr62770 627 ----1800
NM_080681chr62770 627 ----1800
NM_080732chr192193 68 1373 ----
NM_080738chr121610 1594 1137 ----
NM_080742chr61186 ------
NM_080743chr622495 1786 ------
NM_080759chr1312277 ------
NM_080760chr1312277 ------
NM_080872chr823901 1527 ------
NM_080881chr54620 323 315 130 ------
NM_080927chr31113 ------
NM_130436chr2112326 ----11715
NM_130438chr2112903 --1232 12292
NM_130439chr1022197 1606 ------
NM_130439chr1022197 1606 ------
NM_130440chr131505 427 311 --11146 --
NM_130442chr7--1171 ----
NM_130459chr921046 409 ------
NM_130830chr363975 3191 2881 2742 2515 24 11552 22896 1287 13756
NM_133177chr11966 --2896 310 --
NM_133178chr11966 --2896 310 --
NM_133264chr1723487 1059 --12834 1425
NM_133265chrX32308 1440 934 ----13525
NM_133372chr511848 --12014 --
NM_133457chr741267 1217 258 236 ------
NM_133468chr7----22406 610 --
NM_133476chr12----1387 --
NM_133650chr6--133 ----
NM_134269chr22129 ------
NM_134424chr1221072 482 ------
NM_134447chr191484 ------
NM_138270chrX--1867 ----
NM_138288chr1411429 ------
NM_138316chr101328 ------
NM_138338chr2272898 2413 2286 2121 1379 1058 597 ------
NM_138385chr461362 1120 491 299 239 34 --1163 1314
NM_138395chr21392 --1325 --
NM_138396chr125896 813 786 667 650 1209 ----
NM_138415chr2231759 1159 242 ------
NM_138444chr1324234 548 ------
NM_138456chr111112 --2390 24 --
NM_138457chr653262 1101 1039 847 26 ------
NM_138473chr1223289 1742 --1469 --
NM_138479chr141709 1593 1575 291 --1582 --
NM_138492chr51326 1130 ----
NM_138569chr6153 ------
NM_138576chr1433408 3297 1323 ------
NM_138578chr2051361 1304 1274 280 129 ----1257
NM_138609chr5--1199 ----
NM_138610chr5--1199 ----
NM_138713chr1632692 488 321 27345 256 16876 1837
NM_138714chr1632692 488 321 27345 256 16876 1837
NM_138730chr6--1137 ----
NM_138732chr112330 313 ------
NM_138734chr112330 313 ------
NM_138735chr22546 519 ------
NM_138764chr19277 56 ------
NM_138766chr51154 ------
NM_138771chr7176 ------
NM_138775chr11154 ------
NM_138782chr512203 ------
NM_138795chr141560 1382 1355 1082 11101 --2630 523
NM_138799chr211827 ------
NM_138821chr51154 ------
NM_138822chr51154 ------
NM_138931chr31135 ------
NM_138966chr181204 ------
NM_138967chr15--12436 --11647
NM_138970chr1421894 832 11606 1894 --
NM_138971chr1153610 986 583 439 225 --11481 1161
NM_138971chr1153610 986 583 439 225 --11481 1161
NM_138972chr1153610 986 583 439 225 --11481 1161
NM_138972chr1153610 986 583 439 225 --11481 1161
NM_138973chr1153610 986 583 439 225 --11481 1161
NM_138973chr1153610 986 583 439 225 --11481 1161
NM_139015chr1221516 79 1634 --11490
NM_139057chr1512183 --22842 191 11114
NM_139067chr12----1266 --
NM_139068chr5173 ------
NM_139069chr5173 ------
NM_139132chr112977 791 --199 --
NM_139156chr12800 241 --1329 --
NM_139157chr11--1479 ----
NM_139168chr5----11842 11847
NM_139177chr1721517 1426 --156 --
NM_139244chr61871 ------
NM_139273chr111223 ------
NM_139283chr121933 173 ----
NM_139312chr10129 ------
NM_139323chr20--1164 ----
NM_144499chr31861 --1770 --
NM_144563chr2--1335 ----
NM_144563chr2--1335 ----
NM_144571chr446780 645 634 182 14891 11311 --
NM_144578chr14182 15349 ----
NM_144579chr272713 2696 2025 1822 1808 871 640 12051 42811 2532 914 449 2515 467
NM_144586chr231154 908 401 --1487 1276
NM_144595chr13166 ------
NM_144610chr172546 28 ------
NM_144631chr22239 66 ------
NM_144633chr32508 403 ------
NM_144635chr31179 --1479 --
NM_144641chr331060 301 45 139 ----
NM_144657chrX1583 ------
NM_144660chr101397 ------
NM_144767chr1574380 3927 1532 1339 1133 1058 237 --22970 243 --
NM_144963chr8--11787 ----
NM_144967chrX--1199 ----
NM_144973chr1223701 327 ------
NM_144982chr121186 ------
NM_145071chr34894 834 279 127 ------
NM_145113chr1411036 ------
NM_145159chr141655 ----1633
NM_145166chr392731 2574 2257 2055 1929 660 493 189 127 22155 879 21074 398 1174
NM_145173chr1962461 2302 1783 1776 177 118 22171 296 22214 1607 --
NM_145176chr6----1260 --
NM_145206chr1052742 2708 2474 2228 184 1734 ----
NM_145260chr21572 ------
NM_145279chr121861 303 --11596 159
NM_145296chr192275 40 ------
NM_145313chr1031274 537 96 --1531 --
NM_145320chr71510 ----12666
NM_145321chr71510 ----12666
NM_145322chr71510 ----12666
NM_145341chr1041501 1433 570 413 ------
NM_145350chr1721147 594 1338 --1603
NM_145351chr1742287 2025 1734 944 ----11743
NM_145686chr242524 2179 1262 232 ------
NM_145687chr242524 2179 1262 232 ------
NM_145716chr1196 ------
NM_145733chr22----11025 --
NM_145739chr21490 ------
NM_145798chr171145 ------
NM_145808chr732861 2022 524 1799 ----
NM_145861chr121610 1594 1137 ----
NM_145891chr162443 230 ------
NM_145892chr162443 230 ------
NM_145893chr162565 352 ------
NM_146388chr193918 495 121 ------
NM_147150chr922453 1399 --1396 --
NM_147164chr91187 ------
NM_147168chr9--1105 ----
NM_147175chrX1220 ------
NM_147233chr21539 ------
NM_148174chr811495 ------
NM_148921chr1711942 1749 22395 1984 --
NM_148977chr101328 ------
NM_148978chr101328 ------
NM_152233chr1431466 1398 1201 21503 1083 ----
NM_152237chr2231661 676 194 ------
NM_152253chr2253961 3370 1076 635 101 33263 2786 1308 ----
NM_152263chr175604 5545 4789 4394 2338 2180 1004 --22347 102 --
NM_152264chr112974 856 ------
NM_152265chr111149 124 ----
NM_152271chr82337 89 ------
NM_152335chr152235 191 ------
NM_152341chr1621013 551 --183 --
NM_152343chr17133 ------
NM_152344chr172107 50 ------
NM_152385chr2153 ------
NM_152414chr831566 1532 445 ------
NM_152424chrX84485 4353 4277 3268 1813 1465 1069 62 --11844 23613 1882
NM_152437chr1211728 --12018 --
NM_152451chr151323 ------
NM_152470chr1874110 3370 2826 2689 2582 242 173 ----12536
NM_152493chr111458 ------
NM_152538chr3----11279 --
NM_152545chr43624 617 531 --160 --
NM_152549chr51207 ------
NM_152556chr722446 2395 ----22187 1961
NM_152594chr1512115 ------
NM_152622chr512742 22258 1084 ----
NM_152641chr122919 436 12759 ----
NM_152665chr11971 ----1841
NM_152678chr31776 1316 11703 --
NM_152688chr61172 ------
NM_152722chr1141650 1149 123 69 ------
NM_152724chr10----123 1793
NM_152733chr666308 5897 5436 4678 4426 2460 --12017 --
NM_152734chr685145 4744 4527 3378 1261 963 865 99 13364 1321 --
NM_152737chr61160 11395 ----
NM_152739chr7----1176 --
NM_152749chr72970 238 ------
NM_152756chr512649 1494 ----
NM_152773chr3--122 ----
NM_152787chrX33096 2676 1122 ------
NM_152789chr72600 493 11451 ----
NM_152832chr111385 --1176 1181
NM_152835chr142703 780 523 164 1370 ----
NM_152838chr2031261 1061 392 ------
NM_152862chr22402 43 ----131
NM_152874chr101434 ------
NM_152890chr1135 ------
NM_152902chr121491 800 ------
NM_153029chr1653562 3214 2574 1345 536 --34026 3620 38 --
NM_153040chr15--1137 ----
NM_153042chr621825 304 ------
NM_153181chr181204 ------
NM_153188chr533924 1829 736 24997 1324 ----
NM_153209chr172378 77 ------
NM_153262chr112860 ------
NM_153273chr322216 1703 1641 1379 1656
NM_153335chr1721213 431 ------
NM_153342chr21334 --121 --
NM_153350chr1631307 1228 471 11198 ----
NM_153367chr1042914 1172 521 125 --21390 1026 --
NM_153371chr131511 1108 ----
NM_153464chr19----1226 --
NM_153499chr1222844 308 --32043 618 312 --
NM_153500chr1222844 308 --32043 618 312 --
NM_153607chr512243 --12715 --
NM_153616chr151217 ------
NM_153617chr151217 ------
NM_153618chr151217 ------
NM_153619chr1521455 322 ------
NM_153620chr721555 437 11587 ----
NM_153631chr721072 516 ------
NM_153632chr721072 516 ------
NM_153649chr121598 1440 --11607 --
NM_153715chr75400 346 289 197 44 --1155 --
NM_153756chr131775 602 329 11269 ----
NM_153759chr21187 ------
NM_153812chr152168 1737 672 600 536 --1588 --
NM_153819chr11----1149 --
NM_170606chr71451 11804 ----
NM_170665chr1233687 1507 1067 14568 1107 --
NM_170674chr151294 ------
NM_170677chr151294 ------
NM_170706chr131375 1209 211 --12670 14176
NM_170711chr191675 ------
NM_170712chr32730 524 ------
NM_170713chr32730 524 ------
NM_170714chr32730 524 ------
NM_170750chrX140 ------
NM_171825chr573020 2309 1947 897 358 237 71 --1342 --
NM_172016chr631434 226 174 ------
NM_172071chr156922 6109 2840 2239 877 --11690 --
NM_172103chr622206 2073 1252 22348 1737 --
NM_172105chr622206 2073 1252 22348 1737 --
NM_172127chr4--1267 ----
NM_172128chr4--1223 1831 --
NM_172169chr1021719 1589 ----1308
NM_172170chr1021719 1589 ----1308
NM_172171chr1021719 1589 ----1308
NM_172173chr1021719 1589 ----1308
NM_172206chr17199 1504 31357 1199 308 21772 313
NM_172226chr1222844 308 --32043 618 312 --
NM_172315chr151294 ------
NM_172316chr151294 ------
NM_172337chr142754 50 ------
NM_173065chr163447 3114 2954 1210 948 339 --23123 223 --
NM_173074chr2----181 --
NM_173087chr15----2543 464 --
NM_173088chr15----2543 464 --
NM_173089chr15----2543 464 --
NM_173090chr15----2543 464 --
NM_173156chr131675 762 576 ------
NM_173214chr1632692 488 321 27345 256 16876 1837
NM_173359chr31101 ------
NM_173460chr201171 ------
NM_173475chr1611588 --11109 --
NM_173476chr1642032 1919 510 350 12154 31831 1505 543 --
NM_173489chr5124 ------
NM_173495chrX11855 2970 363 ----
NM_173508chr11903 ------
NM_173511chr221446 1080 --23441 1177 --
NM_173515chr62354 200 ------
NM_173543chr34683 502 42 22 ------
NM_173576chr1022039 1898 ------
NM_173587chr114571 473 223 48 ------
NM_173595chr1275037 4668 3834 3386 2082 1787 1312 --1691 13494
NM_173602chr1223753 748 1713 1752 --
NM_173642chr177093 6777 6413 6331 6250 2450 2396 38798 8775 6052 28642 6101 1617
NM_173666chr531261 1215 1146 ------
NM_173683chr8----11309 --
NM_173809chr1021243 116 --21399 365 --
NM_173822chr211437 ------
NM_173825chr312391 --12724 --
NM_174911chr841159 703 512 345 --2953 552 --
NM_174921chr411064 ------
NM_174934chr1163334 1379 1325 1207 1153 455 1860 2646 270 13260
NM_174953chr171277 1307 ----
NM_174957chr171277 1307 ----
NM_175061chr711861 ----1352
NM_175629chr21187 ------
NM_175630chr21100 --1321 --
NM_175709chr223308 193 75 --3461 381 377 12064
NM_175733chr1111917 --12140 --
NM_175747chr61374 --1945 --
NM_175767chr5--21604 149 ----
NM_175847chr191592 --11446 --
NM_175854chr1332280 1948 866 ------
NM_175856chr5--1766 ----
NM_175857chr211331 ------
NM_175866chr1--1439 ----
NM_175873chr51298 ------
NM_175898chr1531218 1057 495 --11382 --
NM_176792chr104934 895 548 445 ----1939
NM_176863chr1721848 95 1276 ----
NM_176871chr872905 2760 1190 991 716 105 43 1884 23318 505 13073
NM_176895chr5130 ------
NM_177405chr2231543 535 377 --21552 140 1545
NM_177414chr11307 ------
NM_177438chr14------1598
NM_177549chr201356 1434 ----
NM_177559chr201408 1816 ----
NM_177560chr201408 1816 ----
NM_177952chr141801 1568 ----
NM_177969chr21460 ------
NM_177985chr222288 2003 ------
NM_177996chr2032290 2284 233 1988 22154 1107 1222
NM_178006chr1322048 1997 ------
NM_178007chr1322048 1997 ------
NM_178013chr1463027 2067 1182 1114 910 25 --11164 --
NM_178126chr173806 640 477 12158 1649 --
NM_178151chrX56125 5124 4951 3103 2830 ----12234
NM_178152chrX56125 5124 4951 3103 2830 ----12234
NM_178153chrX56125 5124 4951 3103 2830 ----12234
NM_178313chr2--22179 760 ----
NM_178426chr121928 336 11947 ----
NM_178427chr121828 236 11847 --1910
NM_178441chr141332 --1433 --
NM_178496chr321426 1312 ------
NM_178509chr171788 1508 ----
NM_178539chr121273 1608 ----
NM_178554chr353618 1254 1074 634 428 --1926 --
NM_178566chr911519 141 ----
NM_178568chr1731675 1145 438 ----1112
NM_178585chr412386 ------
NM_178815chr10----12018 --
NM_178830chr192651 192 ------
NM_178860chr172929 631 ------
NM_178863chr16193 ------
NM_180976chr611002 ------
NM_180977chr611002 ------
NM_180989chr1311878 11006 ----
NM_181054chr1411262 ------
NM_181093chr12341 174 ------
NM_181291chr141538 ------
NM_181349chr753092 2101 2044 1132 962 184 ----
NM_181351chr11----11141 --
NM_181356chr61824 --1117 --
NM_181361chr31209 ------
NM_181442chr202234 107 ------
NM_181443chr2012202 ----22560 2300
NM_181491chr992588 2549 2527 2481 2194 2152 756 382 90 ------
NM_181492chr22--1937 ----
NM_181504chr533456 3392 3285 ------
NM_181505chr17----1141 --
NM_181521chr1657066 5295 1584 834 525 --37025 6333 2080 15474
NM_181523chr533456 3392 3285 ------
NM_181524chr533456 3392 3285 ------
NM_181571chr10--169 1930 --
NM_181672chrX1520 ------
NM_181673chrX1520 ------
NM_181704chr211442 ----1303
NM_181706chr112957 826 --3966 835 469 12135
NM_181762chrX127 --1400 --
NM_181777chrX127 --1400 --
NM_181782chr6165 ------
NM_181828chr22103242 2874 2811 2629 2579 888 743 688 660 155 13641 23040 2583 1654
NM_181829chr22103242 2874 2811 2629 2579 888 743 688 660 155 13641 23040 2583 1654
NM_181830chr22103242 2874 2811 2629 2579 888 743 688 660 155 13641 23040 2583 1654
NM_181843chr11182 1230 ----
NM_181844chr1751640 1571 1475 251 193 21489 462 ----
NM_182484chr211442 ----1303
NM_182509chr1421237 615 11246 ----
NM_182526chr1472558 2541 978 541 528 255 65 --2855 414 --
NM_182557chr112605 213 1163 1549 --
NM_182580chr12836 276 --21989 115 --
NM_182603chr112164 91 ------
NM_182620chr1721520 545 --21687 104 --
NM_182641chr172657 359 ------
NM_182643chr81479 --1709 --
NM_182648chr141498 ------
NM_182663chr1--12178 21515 607 --
NM_182664chr1--12308 21645 737 --
NM_182665chr1--12178 21515 607 --
NM_182688chr2111705 190 ----
NM_182691chr71100 ------
NM_182692chr71100 ------
NM_182697chr711666 ------
NM_182700chr71472 11663 ----
NM_182717chr10--1474 11335 --
NM_182718chr10--169 1930 --
NM_182719chr10--169 1930 --
NM_182720chr10--1474 11335 --
NM_182721chr10--1474 11335 --
NM_182722chr10--1474 11335 --
NM_182723chr10--1474 11335 --
NM_182724chr10--169 1930 --
NM_182725chr10--169 1930 --
NM_182728chr1411590 11725 11597 11301
NM_182769chr10--169 1930 --
NM_182770chr10--169 1930 --
NM_182771chr10--169 1930 --
NM_182772chr10--169 1930 --
NM_182776chr7145 ------
NM_182779chr13561 121 43 ------
NM_182796chr5--1783 ----
NM_182830chr14--1459 1365 --
NM_182847chr21219 --2473 203 --
NM_182850chr10--169 1930 --
NM_182853chr10--1474 11335 --
NM_182898chr711814 --11552 --
NM_182899chr711814 --11552 --
NM_182904chr11123 ------
NM_182920chr3----11046 --
NM_182931chr71709 ------
NM_182961chr6--133 ----
NM_182970chr2074255 4155 2972 2605 1459 978 740 --23236 1228 --
NM_182972chr11425 ------
NM_182978chr182705 541 ------
NM_183004chr1433584 3170 2649 --11584 --
NM_183006chr202990 256 --11397 --
NM_183011chr10--1474 11335 --
NM_183012chr10--1474 11335 --
NM_183013chr10--1474 11335 --
NM_183049chr42289 100 ------
NM_183060chr10--169 1930 --
NM_183373chr6168 ------
NM_183398chr511137 ------
NM_183399chr511137 ------
NM_183400chr511137 ------
NM_183401chr511137 ------
NM_183419chr821149 53 ------
NM_183422chr131917 ------
NM_194248chr23979 937 119 ------
NM_194259chr162380 116 ------
NM_194260chr162380 116 ------
NM_194261chr162380 116 ------
NM_194278chr1452650 1215 1111 218 177 23138 2880 42825 477 116 41 --
NM_194282chr422232 985 ------
NM_194285chr1122959 720 ------
NM_194286chr1263916 1276 1270 1197 831 548 1877 22361 977 --
NM_194301chr141936 ------
NM_194313chr931481 113 63 ------
NM_194314chr134028 3952 3465 ------
NM_194322chr23979 937 119 ------
NM_194452chr1111273 1982 ----
NM_194453chr1111273 1982 ----
NM_197968chr132633 477 ------
NM_197972chr1131 ------
NM_198056chr352055 1968 1938 1641 183 --32037 1603 817 --
NM_198057chrX1120 ------
NM_198081chr632534 2038 259 1920 ----
NM_198097chr71202 ------
NM_198098chr731355 1139 100 ------
NM_198181chr151419 --1993 --
NM_198182chr221426 137 ------
NM_198225chr10--1640 11949 --
NM_198243chr152821 150 ------
NM_198264chr1150 ----191
NM_198270chrX13235 ------
NM_198273chr522618 615 ------
NM_198275chr11193 ------
NM_198334chr111871 --1847 --
NM_198335chr111871 --1847 --
NM_198391chr2011542 ------
NM_198404chr13----1814 --
NM_198503chr1--167 ----
NM_198504chr3------1193
NM_198563chr34540 509 209 47 ------
NM_198576chr131066 107 91 ------
NM_198581chr297096 6676 6613 6470 5669 5511 5341 4884 2970 11265 15678 11022
NM_198679chr941797 1770 772 624 --1122 --
NM_198681chr151309 1150 1085 378 270 --1964 --
NM_198686chr1442481 2040 456 138 171 ----
NM_198718chr1--1301 ----
NM_198793chr322766 542 ------
NM_198830chr17--176 ----
NM_198880chr32595 253 ------
NM_198889chr4----1290 --
NM_198902chr152606 75 ------
NM_198904chr5--11928 ----
NM_198935chr2012989 1931 164 --
NM_198956chr71472 11663 ----
NM_198963chr2----1100 --
NM_198968chr131756 --12903 --
NM_198969chr19125 ------
NM_198970chr19125 ------
NM_199050chr2153966 3393 1247 1082 502 --13524 --
NM_199129chr204921 463 119 86 --1335 --
NM_199169chr2043148 2694 1153 23 --11077 --
NM_199170chr2043148 2694 1153 23 --11077 --
NM_199171chr2043148 2694 1153 23 --11077 --
NM_199188chr121511 ----13387
NM_199190chr121511 ----13387
NM_199245chr1252273 1848 832 632 257 ------
NM_199262chr1762138 1948 1769 381 277 269 --3702 307 303 --
NM_199324chr422328 1026 12726 ----
NM_199334chr17134 ------
NM_199440chr2----1114 --
NM_199454chr153344 3213 2986 800 328 --14329 --
NM_199478chrX1216 ------
NM_199487chr203453 194 34 ------
NM_201266chr222547 51 12262 22555 1872 --
NM_201279chr222547 51 12262 22555 1872 --
NM_201280chr621081 563 ------
NM_201348chr173816 2934 1229 1085 696 543 46 --44221 4170 3300 1069 --
NM_201378chr83943 684 202 --1188 --
NM_201379chr83943 684 202 --1188 --
NM_201380chr83943 684 202 --1188 --
NM_201381chr83943 684 202 --1188 --
NM_201382chr83943 684 202 --1188 --
NM_201383chr83943 684 202 --1188 --
NM_201384chr83943 684 202 --1188 --
NM_201403chr121861 303 --11596 159
NM_201413chr211749 ------
NM_201414chr211749 ------
NM_201432chr1795747 5230 4783 1815 1073 363 278 126 46 --24790 2082 --
NM_201433chr1795747 5230 4783 1815 1073 363 278 126 46 --24790 2082 --
NM_201434chr171500 ------
NM_201521chr62310 291 --1318 --
NM_201522chr62310 291 --1318 --
NM_201523chr62310 291 --1318 --
NM_201535chr142696 562 ------
NM_201536chr142696 562 ------
NM_201537chr142696 562 ------
NM_201538chr142696 562 ------
NM_201539chr142696 562 ------
NM_201540chr142696 562 ------
NM_201541chr142696 562 ------
NM_201568chr131675 762 576 ------
NM_201569chr131675 762 576 ------
NM_201599chrX2874 335 --1220 --
NM_201624chr13424 267 183 ------
NM_201995chr112246 34 ------
NM_201998chr112311 99 ------
NM_201999chr42811 350 ------
NM_203301chr141270 ------
NM_203327chr2044106 1582 783 235 13573 21701 336 --
NM_203344chr19----1435 --
NM_203346chr231833 776 85 ------
NM_203349chr152640 211 ------
NM_203351chr1762323 2102 1928 1632 448 259 --1540 --
NM_203399chr1------1543
NM_203401chr1------1543
NM_203404chr12800 241 --1329 --
NM_203413chr172205 148 ------
NM_203417chr21----171 --
NM_203418chr21----171 --
NM_203451chr1322398 1793 ------
NM_203459chr1--1852 ----
NM_203504chr4--1930 1788 --
NM_203505chr4--1930 1788 --
NM_203506chr1731894 634 145 ----1368
NM_205842chr2--1655 ----
NM_205846chr51326 1130 ----
NM_205848chr122552 744 2632 368 ----
NM_205861chr131736 149 122 ----11846
NM_206594chr11960 ------
NM_206595chr11960 ------
NM_206832chr171267 ------
NM_206853chr634017 1182 982 ------
NM_206854chr625278 637 ------
NM_206855chr636243 1602 204 ------
NM_206876chr211067 12772 ----
NM_206907chr522881 538 --2706 108 --
NM_206909chr857926 6627 2974 1131 28 ------
NM_206914chr1231504 832 303 ------
NM_206967chr16----228 24 --
NM_207012chr1012690 12748 ----
NM_207042chr13461 126 68 ------
NM_207045chr13461 126 68 ------
NM_207046chr13461 126 68 ------
NM_207111chr762506 2123 1817 728 459 397 --32234 123 79 --
NM_207116chr762506 2123 1817 728 459 397 --32234 123 79 --
NM_207121chr202491 147 ------
NM_207171chr121807 215 ------
NM_207292chr313177 ------
NM_207293chr313177 ------
NM_207294chr313177 ------
NM_207295chr313177 ------
NM_207296chr313177 ------
NM_207297chr313202 ------
NM_207299chr911012 ------
NM_207371chr1021515 213 --11080 --
NM_207396chr13438 294 135 --2607 303 --
NM_207406chr454383 2115 1369 345 31 ------
NM_207429chr113925 589 431 ------
NM_207518chr192336 73 ------
NM_207577chr113816 796 242 --1683 --
NM_207645chr111975 ------
NM_212465chr15----2543 464 --
NM_212535chr16--199 ----
NM_213594chr12--1319 ----
NM_213606chr102939 677 1952 ----
NM_213618chr11--1479 ----
NM_213662chr1711915 --21759 1684 --