TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-32-3p
miRNA Sequence: CAAUUUAGUGUGUGUGAUAUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr542025 1454 819 798 1839 1699 1362
NM_000051chr11143514 3349 3018 2915 2875 2495 2474 2351 2254 964 926 765 746 590 23178 3044 13554 --
NM_000052chrX73456 2949 2927 2775 1361 1321 704 --31306 981 201 1851
NM_000084chrX106805 6269 5211 4797 4775 4765 1570 1231 791 638 45002 2408 1146 709 15432 --
NM_000089chr75787 754 216 125 90 ------
NM_000092chr2104546 4456 4412 4397 4264 3484 3047 1217 511 220 34138 4009 3732 11443 --
NM_000108chr741848 701 338 181 --2520 301 1109
NM_000109chrX72238 1751 1629 765 327 230 214 ------
NM_000112chr5155572 5247 4899 4625 4496 4192 4016 3780 3730 2115 1939 1283 1070 916 117 --21622 1560 --
NM_000127chr81262 ------
NM_000138chr1561930 1655 978 702 430 114 32646 1000 582 1443 --
NM_000139chr1172794 2659 2489 1966 832 570 119 1641 22620 2098 1750
NM_000163chr562388 2246 2080 1994 1931 423 --1793 --
NM_000167chrX61851 1784 1490 1174 1166 506 ----1533
NM_000176chr5113840 3736 3580 3546 3125 2653 2435 2382 1319 1125 131 12463 ----
NM_000202chrX123833 3822 3428 3068 3045 2987 1372 1208 1197 1051 959 266 --1428 1968
NM_000216chrX113760 3620 3306 2826 2664 2565 1520 903 553 515 187 2628 295 43279 1602 321 256 1424
NM_000217chr12125272 4644 4391 4132 3848 3830 3565 941 857 730 609 110 21146 703 14557 1698
NM_000232chr453250 2962 2024 652 327 --23008 169 --
NM_000252chrX41348 1264 1108 268 41418 1280 1251 82 ----
NM_000259chr15216396 6255 5866 5770 5758 5394 5340 5203 4908 2468 2354 2083 1950 1734 1592 1550 1482 687 631 586 324 26203 5182 16315 35385 5366 1713
NM_000264chr992918 2461 1275 1248 1221 452 363 336 163 12767 --13311
NM_000267chr1793507 3264 2718 2541 1082 1045 849 723 315 --1174 1705
NM_000282chr131244 ------
NM_000313chr371084 839 714 381 321 242 235 --1289 --
NM_000314chr1082918 2295 1276 1238 1213 1066 886 436 12013 ----
NM_000332chr697144 7036 5891 5694 5302 5061 2611 2057 1085 11335 11231 --
NM_000337chr5146583 6461 6025 5645 5561 4507 4407 2628 2535 2334 2219 1639 656 386 12585 14967 --
NM_000346chr1751854 515 441 354 260 11254 11346 --
NM_000362chr2293562 3401 2642 2581 2500 1081 943 894 866 12286 13519 --
NM_000382chr1771988 322 279 236 221 81 55 11858 --141
NM_000390chrX143442 3416 3396 3259 2685 2498 2265 2249 1153 1045 794 481 404 209 23315 624 ----
NM_000393chr2132046 1992 1970 1878 1830 1816 1537 701 680 662 623 610 209 ------
NM_000397chrX41745 741 728 719 1165 --12150
NM_000401chr1151121 1113 1069 282 26 ------
NM_000408chr2113194 3049 2943 2783 2678 2530 2152 1312 1246 1077 316 --1960 --
NM_000430chr17113800 3414 3290 3240 3116 3021 303 191 139 126 86 1111 ----
NM_000439chr592145 2032 1962 1776 1018 1004 609 508 92 12360 ----
NM_000448chr1192510 2430 2086 1255 988 974 754 718 516 22150 652 22037 1108 --
NM_000449chr151542 1119 438 312 273 11483 ----
NM_000452chr1362114 2088 2031 1752 1644 725 22055 405 1334 --
NM_000454chr211242 ------
NM_000461chr384643 4470 3747 1843 1787 1649 1579 1175 24163 3483 33554 2804 1732 --
NM_000462chr1571880 1852 1627 1186 328 308 89 ------
NM_000463chr24738 728 154 79 2721 118 1639 1280
NM_000489chrX133463 3029 2185 1326 1296 1194 1176 1142 788 599 350 153 112 --32806 2250 301 --
NM_000495chrX51141 1055 1048 728 230 11012 ----
NM_000510chr1121420 1206 ------
NM_000516chr201351 ------
NM_000549chr1129 ------
NM_000555chrX147200 6682 6657 6376 6256 6024 2874 2523 2215 1628 1600 1248 695 218 36527 5729 2975 22969 1468 --
NM_000586chr45269 244 226 59 51 ------
NM_000600chr71156 ------
NM_000602chr741508 1485 1475 1128 ------
NM_000618chr12165064 4545 4443 4144 4059 2484 2395 1610 1468 840 615 408 396 355 215 101 36427 4510 2190 1344 26339 5806
NM_000618chr12165064 4545 4443 4144 4059 2484 2395 1610 1468 840 615 408 396 355 215 101 36427 4510 2190 1344 26339 5806
NM_000619chr124577 40 34 28 ------
NM_000627chr25939 861 794 339 326 ------
NM_000633chr18114970 4916 4818 4367 4261 4202 4042 3540 1392 701 368 13987 14426 --
NM_000681chr1011371 ------
NM_000686chrX51523 1372 1196 270 112 3593 512 458 1438 11231
NM_000700chr9171 ------
NM_000719chr12106736 5447 5026 4874 4753 2624 1656 1582 1305 772 11662 11627 --
NM_000780chr851105 1062 1045 905 30 11199 ----
NM_000788chr431365 1249 82 51402 1371 1234 516 440 ----
NM_000791chr562432 2368 866 492 183 26 ----12491
NM_000793chr14124727 3967 3925 3360 3230 1867 1738 1436 1147 933 346 68 --21973 1807 --
NM_000794chr54982 949 900 705 ------
NM_000806chr561915 1853 1660 1522 1414 697 21977 420 11887 --
NM_000809chr4199295 9178 8321 7974 7662 7034 6742 5884 3688 3523 3458 2947 1985 1494 1488 1197 661 68 58 88128 7363 6948 6485 2435 1964 1081 478 58668 2536 1523 1220 371 16653
NM_000811chr53801 265 33 2607 589 2669 24 --
NM_000813chr5145552 5250 4489 4153 4047 3982 3907 3871 3442 2161 1707 1682 996 171 11549 45289 1953 1690 34 --
NM_000814chr1564214 4103 3305 3259 2788 351 23794 421 13884 11635
NM_000826chr482569 2390 1892 1039 1018 592 304 283 --11802 --
NM_000845chr7148 ------
NM_000859chr521554 641 3506 402 70 31692 491 484 --
NM_000868chrX72642 2633 2426 2366 2301 2189 793 --11607 1405
NM_000872chr1031518 1161 1040 ------
NM_000895chr12143 ------
NM_000899chr12164405 4364 4266 4236 4189 4124 4039 3913 3500 3335 2794 1709 1238 922 431 356 21158 974 --2696 204
NM_000901chr462074 1761 1585 1557 634 34 1728 12350 12484
NM_000917chr102991 830 ------
NM_000926chr11339440 9379 9309 9302 8993 8777 8455 8239 8165 8082 7888 7268 6978 6663 6421 6117 3324 2696 2642 2527 1968 1931 1924 1626 1552 1526 1423 1319 996 649 558 131 30 66163 6045 5721 2976 2249 1806 47533 6264 5885 1540 --
NM_000937chr171413 ------
NM_000941chr71337 ------
NM_000944chr452184 2089 1908 728 341 ----2825 536
NM_000950chrX63650 3354 3246 2507 438 353 43577 2513 2257 1043 23222 2773 --
NM_000959chr163615 2950 2741 2673 1031 75 1681 ----
NM_000963chr1102162 2038 1934 1883 1667 767 649 473 266 197 1487 1557 --
NM_000990chr11103905 3818 2937 2836 2793 2663 1435 929 400 27 23790 1018 21265 272 --
NM_001001323chr12102473 2337 1224 1148 1056 923 909 664 424 299 --1883 --
NM_001001330chr1091226 1175 1148 476 401 211 136 104 41 ------
NM_001001396chr1143832 3652 3586 3580 3420 3369 3351 2842 2807 2782 1760 1081 925 286 12897 53959 666 623 150 72 --
NM_001001419chr5114909 4893 4655 4140 4001 3921 3859 1250 585 381 308 24467 976 --14234
NM_001001420chr5114909 4893 4655 4140 4001 3921 3859 1250 585 381 308 24467 976 --14234
NM_001001433chr2063094 968 947 785 773 669 1677 1767 --
NM_001001481chr8113471 3280 3194 3167 2440 2407 1287 1060 1046 817 606 3878 702 554 11367 --
NM_001001556chr1531558 1042 577 31249 332 76 21549 368 11171
NM_001001567chr211196 ------
NM_001001568chr211196 ------
NM_001001571chr211196 ------
NM_001001572chr211196 ------
NM_001001573chr211196 ------
NM_001001574chr211196 ------
NM_001001575chr211196 ------
NM_001001576chr211196 ------
NM_001001577chr211196 ------
NM_001001579chr211196 ------
NM_001001580chr211196 ------
NM_001001581chr211196 ------
NM_001001582chr211196 ------
NM_001001584chr211196 ------
NM_001001585chr211196 ------
NM_001001661chr72697 608 ------
NM_001001664chr2183883 3836 3703 3336 3322 3274 3077 3039 3015 2884 1618 1352 1340 1044 1012 871 426 388 43481 520 215 183 4661 593 479 346 --
NM_001001668chr19113941 3929 3896 3743 3678 3036 1470 1235 1127 1021 285 44074 2943 2833 939 33953 3251 1228 --
NM_001001787chr11408 ------
NM_001001890chr21104102 3734 3620 3527 1600 1312 888 820 638 578 ------
NM_001001928chr22148258 7149 7091 6751 6644 5925 5711 5183 2930 2871 2210 1635 525 454 ------
NM_001002026chr392485 2469 2405 2018 750 712 441 255 174 1210 31757 1647 78 --
NM_001002233chr861926 1665 508 413 213 141 --11685 --
NM_001002257chr273422 3103 2640 2609 720 689 185 13597 --11003
NM_001002258chr232010 1779 1528 41980 1820 1696 182 41868 708 699 175 --
NM_001002837chr221266 ------
NM_001002843chr1551249 1233 1218 306 242 --11072 --
NM_001002860chr1474560 3965 3825 3611 3313 3299 1580 11806 23702 1342 --
NM_001003652chr18198357 8113 7865 6780 6550 6303 6283 6210 6094 5905 5286 3276 2876 2851 1716 1558 1280 1251 692 35605 2895 1341 27874 5558 15488
NM_001003656chr101582 ------
NM_001003674chr18147002 6284 6141 5200 5001 4364 2801 2698 2556 1559 1064 1007 859 387 12772 ----
NM_001003675chr18147002 6284 6141 5200 5001 4364 2801 2698 2556 1559 1064 1007 859 387 12772 ----
NM_001003679chr1112169 2036 1920 1701 1609 1413 803 501 348 200 181 --12001 --
NM_001003681chr2252061 1628 1432 555 105 ------
NM_001003712chr12124071 3821 3794 3776 3372 3340 3283 3260 2519 1336 1063 626 22624 1493 ----
NM_001003760chr6123696 3269 3253 3024 2875 2745 2302 1061 763 449 308 154 13508 1638 --
NM_001004023chr11211 ------
NM_001004304chr1233250 3160 3107 ------
NM_001004317chr683968 3805 1752 1585 1457 753 416 127 64278 4257 3686 3639 3217 1082 ----
NM_001004360chr261906 1806 1268 697 624 543 1735 --11536
NM_001004720chr21986 ------
NM_001004722chr211155 ------
NM_001005335chr191127 ------
NM_001005375chrY31731 1642 81 --1174 11420
NM_001005386chr292234 2109 1761 1722 1708 1673 1585 256 160 12268 --12464
NM_001005407chr162689 678 ------
NM_001005463chr10102644 2526 2518 2246 2100 951 929 853 648 425 --12350 --
NM_001005473chr5176587 6579 6265 5792 5389 5265 4869 4630 4309 4138 2592 2502 2412 2140 1740 1309 762 --46212 4322 4234 1142 --
NM_001005474chr381634 1581 1488 1402 621 476 354 101 --21389 237 --
NM_001005502chr1275218 4475 4406 4152 3214 1599 530 --15209 13268
NM_001006600chr582483 2418 2024 1830 906 498 279 198 12436 ----
NM_001006623chr262506 2451 2272 2212 884 85 --41749 1646 566 173 --
NM_001006657chr2103242 3181 1260 1171 1135 907 480 393 300 129 --42489 742 557 330 --
NM_001007023chr14124727 3967 3925 3360 3230 1867 1738 1436 1147 933 346 68 --21973 1807 --
NM_001007024chr1784434 4368 4298 3086 3074 3057 2983 1589 14423 ----
NM_001007025chr1784434 4368 4298 3086 3074 3057 2983 1589 14423 ----
NM_001007067chr811087 ------
NM_001007068chr811087 ------
NM_001007069chr811087 ------
NM_001007070chr811087 ------
NM_001007097chr984815 4434 1946 1921 1695 1538 801 447 2808 256 55085 4620 4466 1896 510 13662
NM_001007102chr6111581 1418 1386 1249 1228 577 520 503 353 159 85 11305 31406 451 237 --
NM_001007189chr51106 ------
NM_001007246chr2181827 1752 1639 1507 558 337 224 144 11342 1408 --
NM_001007256chr11105 ------
NM_001007466chr675053 4744 4043 3998 3300 2085 1022 --23489 3396 --
NM_001007468chr221304 ------
NM_001008408chr784550 4498 4463 4456 837 371 338 208 21468 503 ----
NM_001008495chr8102270 2249 1641 1533 1460 852 759 609 397 126 ------
NM_001008539chr8135407 5269 4938 4368 4279 3980 3889 3472 1648 1322 1225 569 396 31486 837 167 13880 --
NM_001008541chr1032287 1482 71 11959 --12248
NM_001008541chr1032287 1482 71 11959 --12248
NM_001008661chr12352 111 ------
NM_001008662chr12352 111 ------
NM_001008738chr552657 2512 970 204 109 ----12846
NM_001008756chr382600 2335 1611 863 852 826 490 395 12258 ----
NM_001008925chr4143546 3532 3397 3310 3302 3267 2887 2722 1254 1000 675 668 625 597 43388 3154 2938 2394 ----
NM_001009554chr494692 4541 3549 3283 3070 2892 1617 1452 839 34445 3570 876 ----
NM_001009554chr494692 4541 3549 3283 3070 2892 1617 1452 839 34445 3570 876 ----
NM_001009570chr21128 ------
NM_001009814chr133180 155 31 ------
NM_001009894chr1291723 1207 1097 643 599 466 339 310 128 --21171 483 --
NM_001009899chr3136468 5814 5194 5136 1229 1110 1051 922 903 372 262 234 135 22553 604 25515 612 1587
NM_001009909chr11183487 3350 3081 3042 3006 2928 2854 2700 1542 1535 1295 1109 657 542 471 248 234 192 --23868 641 23308 2833
NM_001009955chr11397 ------
NM_001009955chr11397 ------
NM_001009959chr262610 2478 648 593 199 158 ----1676
NM_001009993chr254348 4304 1434 460 274 --1802 1876
NM_001010000chr1873241 2887 2873 2468 2415 1315 1299 --1543 --
NM_001010853chr6103070 2880 2733 2542 2369 2248 2047 881 847 356 ------
NM_001010861chr152199 900 787 778 283 1936 --12034
NM_001010888chrX124293 3714 3028 3010 1858 1770 1759 1730 1448 341 269 242 23831 807 12834 --
NM_001010891chr5146039 5018 4941 4573 1990 1893 1638 1594 1452 1425 491 406 337 211 36477 4468 1927 15969 --
NM_001010895chr992055 1781 1748 1728 1554 540 327 255 35 31693 1681 156 ----
NM_001010923chr671671 1556 1249 1161 582 305 216 11629 ----
NM_001010980chr153577 3389 3237 2352 2290 22336 860 --1592
NM_001010986chrX61956 823 467 405 333 289 1177 --1643
NM_001011513chr4143991 3960 3900 3183 3144 3038 2970 2947 1549 1085 397 269 128 76 33077 1542 287 ----
NM_001011515chr45927 426 311 237 87 1814 1986 --
NM_001011516chr45927 426 311 237 87 1814 1986 --
NM_001011537chr362177 1978 1663 1579 110 48 --11481 12071
NM_001011657chrX51057 827 787 151 31 2874 158 ----
NM_001011666chr7136280 6017 5853 5814 5799 5479 5071 4596 2335 2315 2286 2073 378 15805 26008 2294 11638
NM_001011713chr1431077 561 468 --1994 1182
NM_001011885chr1571714 1565 1421 1399 479 358 232 --1674 --
NM_001012420chr15112950 2847 2830 2533 2459 2453 2190 2170 2144 628 144 32943 2715 1072 ----
NM_001012423chr15122950 2847 2830 2533 2459 2453 2190 2170 2144 1030 628 144 32943 2715 1072 ----
NM_001012507chr61101 ------
NM_001012514chr211077 ------
NM_001012516chr211077 ------
NM_001012751chr1091965 1779 560 421 389 266 183 131 26 --21636 632 --
NM_001012754chr1372073 1997 1626 831 638 341 55 12116 ----
NM_001012755chrX145105 5003 4723 4663 4196 4079 3847 3715 3611 3412 1151 842 252 39 --13593 1556
NM_001012756chr1983228 3015 2820 2555 608 453 379 133 --12151 --
NM_001012968chrX112798 2611 2526 1893 1861 1803 1744 1006 595 220 118 32259 281 48 12181 --
NM_001012989chrX1140 ------
NM_001013031chr1083373 3239 2777 2728 2631 1200 911 835 13541 33496 882 346 22589 490
NM_001013620chr12278489 8066 7991 7056 7003 6959 6767 6450 6369 6358 6065 5744 5729 5718 3398 3359 2611 2162 1964 1749 1350 1140 963 537 303 211 69 38340 2116 1623 16967 17355
NM_001013659chr19195455 5374 5366 5132 5096 4898 4878 4181 4037 3914 3371 2077 1591 1564 1438 1215 1039 847 385 11858 ----
NM_001014380chr13155891 5804 5184 4930 4770 4645 4604 4045 4026 4007 2179 1672 1601 476 150 25190 4627 44826 2000 1402 853 15367
NM_001014434chr12590 29 ------
NM_001014764chr171173 ------
NM_001014797chr10136382 5712 5357 5282 5256 3211 3103 2601 2571 2558 1756 464 212 56763 5687 1360 572 381 --15652
NM_001014812chr152454 328 ------
NM_001017395chr373608 3093 3048 2340 925 680 178 --2469 311 --
NM_001017396chr272175 1976 1966 1942 1848 1421 629 1543 21460 775 12015
NM_001017420chr861383 1087 316 251 185 41 11271 1468 --
NM_001017424chr181913 1735 1642 1582 1489 1358 385 86 ------
NM_001017425chr181913 1735 1642 1582 1489 1358 385 86 ------
NM_001017440chr7127625 7229 7031 6794 6676 5188 2390 2205 1412 1374 1354 1297 48090 7188 5073 1036 27466 7373 --
NM_001017926chr871785 1563 1278 1206 293 246 65 ------
NM_001017930chrX81500 1487 1448 1112 962 926 37 26 31509 1494 448 ----
NM_001017962chr102991 830 ------
NM_001017969chr92522 29 ------
NM_001017999chr132334 2065 739 12175 --1838
NM_001017999chr132334 2065 739 12175 --1838
NM_001018000chr132334 2065 739 12175 --1838
NM_001018000chr132334 2065 739 12175 --1838
NM_001018001chr132334 2065 739 12175 --1838
NM_001018064chr921721 255 ------
NM_001018065chr995833 5281 4111 4075 2364 1513 691 669 57 1641 45124 5113 4544 4380 11213
NM_001018066chr995833 5281 4111 4075 2364 1513 691 669 57 1641 45124 5113 4544 4380 11213
NM_001018067chr1185379 5046 4811 4727 4572 3725 3659 3635 3521 3389 3243 2055 1818 1213 894 741 609 413 11336 45213 1192 1183 138 --
NM_001018068chr1185379 5046 4811 4727 4572 3725 3659 3635 3521 3389 3243 2055 1818 1213 894 741 609 413 11336 45213 1192 1183 138 --
NM_001018069chr1185379 5046 4811 4727 4572 3725 3659 3635 3521 3389 3243 2055 1818 1213 894 741 609 413 11336 45213 1192 1183 138 --
NM_001018074chr5113840 3736 3580 3546 3125 2653 2435 2382 1319 1125 131 12463 ----
NM_001018075chr5113840 3736 3580 3546 3125 2653 2435 2382 1319 1125 131 12463 ----
NM_001018076chr5113840 3736 3580 3546 3125 2653 2435 2382 1319 1125 131 12463 ----
NM_001018077chr5113840 3736 3580 3546 3125 2653 2435 2382 1319 1125 131 12463 ----
NM_001018080chr1121420 1206 ------
NM_001018091chr15102790 2709 2581 2411 2387 2163 1039 867 126 106 ------
NM_001020658chr181651 1253 1137 1114 620 509 499 176 ------
NM_001020658chr181651 1253 1137 1114 620 509 499 176 ------
NM_001020818chr1921916 1818 ------
NM_001020819chr1921916 1818 ------
NM_001020820chr1921916 1818 ------
NM_001020821chr1921916 1818 ------
NM_001020825chr551315 1211 1055 1021 128 ------
NM_001024094chr5113840 3736 3580 3546 3125 2653 2435 2382 1319 1125 131 12463 ----
NM_001024401chr1612865 ------
NM_001024647chr12146940 6583 6512 5971 4896 4734 4681 2058 1653 1264 1048 341 276 54 32856 2042 1913 25668 1286 15823
NM_001024649chr592722 2671 2250 2068 1954 1939 606 570 419 12732 12297 --
NM_001024948chr1143391 3375 3364 2896 2806 2736 2186 1150 996 971 644 587 442 367 ------
NM_001024956chr11195786 5578 4902 4853 4816 4668 4550 4398 4301 4272 4249 4216 3842 3685 3609 1406 846 659 295 45684 4512 4255 313 34328 2088 1302 --
NM_001025068chr351568 1503 1210 423 49 31676 342 39 2685 76 --
NM_001025069chr351568 1503 1210 423 49 31676 342 39 2685 76 --
NM_001025076chr10116248 6089 5561 4752 2052 1971 1912 1902 1764 964 229 45345 4522 800 618 11549 --
NM_001025077chr10137606 7447 6919 6110 5091 5043 4639 2322 1587 1365 836 774 575 56703 5880 4600 2158 1976 12907 --
NM_001025079chr3144189 4127 4073 3859 3690 3615 3557 3496 3087 2950 2782 1380 344 162 22753 523 11661 --
NM_001025108chr2104206 4049 3917 3300 1595 1389 1293 1029 988 670 --43562 1372 1006 602 --
NM_001025248chr1531277 1271 387 ------
NM_001025249chr1531277 1271 387 ------
NM_001025252chr8113172 3107 2752 2203 2156 1267 1119 776 438 429 85 13036 ----
NM_001025253chr8113172 3107 2752 2203 2156 1267 1119 776 438 429 85 13036 ----
NM_001025580chrX114202 3613 3544 3509 2993 2971 2862 2620 1624 1252 1077 33574 2748 1575 11728 13909
NM_001025603chr151542 1119 438 312 273 11483 ----
NM_001025616chr42307 300 ------
NM_001028chr11147 ------
NM_001029858chr663312 2629 2518 2406 2158 2144 ----12455
NM_001029860chr82284 225 ------
NM_001029863chr6113077 2984 2919 2717 2520 2292 937 798 626 563 383 2732 672 21107 752 13151
NM_001029875chr592965 2484 2261 2152 2139 1929 863 320 152 1302 12920 --
NM_001029955chr453473 2694 618 524 287 1337 1886 --
NM_001030001chr141454 ------
NM_001030055chr14134499 4481 4199 4108 3677 3654 3323 3278 1492 1303 959 334 136 64515 4394 3398 3197 3124 1580 --11266
NM_001030272chr111478 ------
NM_001030273chr111478 ------
NM_001031679chr1263515 3440 3393 3321 566 183 --13047 --
NM_001031684chr261498 582 479 222 160 136 1503 1242 11405
NM_001031695chr2265452 4735 4704 3777 426 195 25362 3712 14527 11775
NM_001031723chr45421 381 163 112 57 ------
NM_001031732chr4143708 3697 3678 3652 3620 3140 3109 2926 2373 1250 762 607 214 81 33660 2314 1163 ----
NM_001031804chr16104426 4196 4088 3549 3202 2886 1702 1695 1581 1550 --34127 3436 1606 --
NM_001032394chr6112831 2712 2585 2061 2016 1902 864 784 769 706 474 --12399 --
NM_001032395chr6112698 2579 2452 1928 1883 1769 731 651 636 573 341 --12266 --
NM_001033045chr274289 3965 3910 3805 3521 3434 1700 64397 3396 2851 1691 1070 1024 13469 --
NM_001033059chr682026 1958 1805 1506 426 154 127 66 --11484 --
NM_001033085chr22329 303 ------
NM_001033087chr2083211 3193 3153 2512 2479 2277 1033 428 12850 22249 609 --
NM_001033518chr752516 758 563 213 199 ------
NM_001033519chr752516 758 563 213 199 ------
NM_001033520chr752516 758 563 213 199 ------
NM_001033557chr251128 1006 175 157 77 3997 979 140 ----
NM_001033566chr178972 894 772 744 682 322 66 56 1367 1218 --
NM_001033568chr178972 894 772 744 682 322 66 56 1367 1218 --
NM_001033723chr862813 2732 2455 2146 1750 90 ----1370
NM_001033925chr1082124 1714 1539 1387 778 423 413 183 22093 1975 ----
NM_001035260chr1051355 1217 1041 505 142 --11133 --
NM_001035267chr121306 ------
NM_001035511chr141733 1639 1554 852 ----1634
NM_001037132chr792119 1990 1874 1674 1538 1469 791 560 409 ------
NM_001037133chr792119 1990 1874 1674 1538 1469 791 560 409 ------
NM_001037163chr74803 197 151 141 129 --1883
NM_001037165chr7108893 8787 8098 7720 7700 7596 6905 5475 3297 1793 --16567 17639
NM_001037174chr262225 1619 1519 866 303 26 31746 872 208 --1860
NM_001037317chr152199 900 787 778 283 1936 --12034
NM_001038640chr152698 219 ------
NM_001038702chr522268 2253 22557 1817 1175 11034
NM_001039199chr20174987 4509 3871 3285 3093 3082 1987 1974 1821 1687 1170 963 935 927 676 567 481 12006 24199 3819 --
NM_001039348chr251079 871 860 723 247 1205 1790 --
NM_001039349chr251079 871 860 723 247 1205 1790 --
NM_001039395chr962222 2122 2017 1745 674 587 22316 1945 --12266
NM_001039465chr141195 --1417 --
NM_001039538chr293281 3262 3176 3032 2696 2552 1446 1327 473 42311 576 523 424 22402 714 --
NM_001039547chr3248055 7199 7167 7136 7045 7028 6965 6941 6763 6642 6578 6550 6289 6208 6050 5996 5954 5913 5283 5053 1553 1510 1455 110 26900 5223 11960 --
NM_001039577chr1104513 3713 1528 1094 1070 1044 998 530 487 229 1435 ----
NM_001039585chr173872 3207 2998 2930 2570 1288 332 1938 ----
NM_001039590chrX94052 3766 3311 3074 2972 2918 2839 2554 1401 1538 33478 1441 583 --
NM_001039591chrX94052 3766 3311 3074 2972 2918 2839 2554 1401 1538 33478 1441 583 --
NM_001039618chr11275822 5342 5296 5286 5204 5134 4994 4805 4672 4577 4291 4168 3928 3823 3776 2327 2181 1948 1918 1620 1244 1175 1152 1023 979 779 198 45596 5190 1532 1250 35604 2298 1642 11818
NM_001039693chr243745 3697 3618 2598 31440 1373 58 33902 3708 1410 --
NM_001039711chr11382 ------
NM_001039712chr11382 ------
NM_001039762chr1082391 2373 1987 1875 1778 1592 1473 391 22354 2149 1770 --
NM_001039840chrX165911 5503 5464 5262 5140 5041 4820 4744 4730 3731 2116 1239 652 407 213 62 ------
NM_001039937chr1394160 3835 3674 3205 2583 1399 1280 1054 455 34020 3828 2882 11668 1755
NM_001040020chr791459 1375 1333 1231 1188 1148 1110 300 270 21515 436 ----
NM_001040142chr2122424 2275 2095 1670 1505 771 658 642 553 411 318 305 --1966 --
NM_001040143chr2122424 2275 2095 1670 1505 771 658 642 553 411 318 305 --1966 --
NM_001040152chr7114956 4556 4538 4325 4063 3855 3792 3440 1632 1430 426 34919 4882 3980 54352 4126 3759 1229 907 11495
NM_001040153chr133680 269 173 ------
NM_001040157chr462840 2722 1802 479 311 134 21137 443 --12607
NM_001040202chr4122598 2423 2031 1956 1939 923 862 689 618 461 252 25 42292 2273 1906 1768 3849 789 482 --
NM_001040284chr16155884 5806 4963 4293 4206 3589 2292 2054 1877 1560 1382 1235 1163 584 467 --1631 --
NM_001040402chr4102950 2556 2039 933 847 644 270 226 145 65 12520 22770 2464 12736
NM_001040429chr1383524 3441 2853 2630 1403 973 818 674 22340 1100 ----
NM_001040440chr55268 235 144 129 85 1241 --149
NM_001040441chr1135377 4974 4251 3876 3718 3623 3570 3471 2016 1539 1500 1443 350 24819 1949 14023 11978
NM_001040450chr153934 902 392 1432 ----
NM_001040453chr153934 902 392 1432 ----
NM_001040653chr382680 2457 2210 1760 900 609 223 186 --1653 --
NM_001040665chr7165041 4969 4117 3967 3910 3622 3551 3475 3206 3119 1904 1776 1190 945 191 116 ----44701 4187 4110 3519
NM_001040666chr72743 671 ------
NM_001040708chr841158 903 241 222 ------
NM_001040875chr872683 2417 2367 2155 1920 1772 476 2987 631 ----
NM_001040876chr451540 1458 1411 578 348 --1159 --
NM_001042355chr16155343 5163 4646 4353 4015 3729 1733 1472 1197 966 937 851 790 585 237 21383 267 13679 --
NM_001042404chr182001 1556 1464 1297 593 368 343 266 --11603 --
NM_001042412chr16155343 5163 4646 4353 4015 3729 1733 1472 1197 966 937 851 790 585 237 21383 267 13679 --
NM_001042413chr993296 3159 2953 2942 2559 1404 1354 1304 152 13707 --13107
NM_001042453chrX51775 1635 1595 1502 507 2383 281 11167 --
NM_001042473chr1021585 440 2385 281 11815 22191 407
NM_001042475chr6142 ------
NM_001042490chr52315 282 ------
NM_001042492chr1793507 3264 2718 2541 1082 1045 849 723 315 --1174 1705
NM_001042493chr671460 1445 722 327 309 277 150 1343 11881 --
NM_001042533chr3143198 3191 3181 2954 2632 2381 2250 1093 914 877 839 487 478 84 12960 22821 2347 --
NM_001042548chr27889 814 808 651 618 217 195 1247 138 1357
NM_001042550chr942093 1727 716 41 1324 ----
NM_001042555chr12114793 4535 4503 4045 3926 3852 1571 788 414 322 121 21739 1424 11101 --
NM_001042599chr297133 6898 6656 6583 5968 2608 1773 1437 1374 35904 4742 2186 ----
NM_001042601chr3113269 3230 2994 2890 2690 2633 2552 568 540 475 307 43278 3159 1254 251 52713 1063 811 362 193 --
NM_001042603chr1284422 4013 3561 2135 2073 1722 1158 670 23844 1192 1688 --
NM_001042604chr3154862 4772 4681 4309 4200 3907 3250 1690 1531 1497 1411 1373 947 450 114 53672 1229 355 138 23 33188 687 613 1253
NM_001042669chr42307 300 ------
NM_001042749chrX5528 374 343 170 43 11239 21704 487 --
NM_001042750chrX5528 374 343 170 43 11239 21704 487 --
NM_001042751chrX5528 374 343 170 43 11239 21704 487 --
NM_001044385chr2123951 3776 3119 2858 2639 1227 1066 423 367 330 100 59 --33078 1134 576 --
NM_001046chr562906 2710 2313 2069 1112 1011 --12601 --
NM_001071775chr1381528 1465 1358 1350 1245 509 497 421 11750 ----
NM_001072chr24738 728 154 79 2721 118 1639 1280
NM_001076chr4174 ----1175
NM_001076chr4174 ----1175
NM_001083620chr482567 2388 1890 1038 1017 591 303 282 --11800 --
NM_001099678chr3206446 6178 6003 5881 5856 5167 5119 4712 4614 4573 4487 4044 2404 2051 1928 1395 1360 1236 1010 856 36396 4061 191 25950 4388 1513
NM_001100108chr1178362 7946 7235 7184 7090 6373 6302 5980 5278 5114 3187 3095 3002 1902 1387 585 418 33253 2799 204 11832 --
NM_001106chr3178975 8702 8679 7840 7720 7610 7578 7551 7094 6580 6021 3879 3151 1957 1541 1400 1302 16871 59642 8882 8533 7917 1330 29282 6478
NM_001113490chrX63637 1008 334 318 308 247 ------
NM_001117chr1832521 2082 132 ------
NM_001121chr1071944 1921 1743 1564 201 67 53 ----1283
NM_001126chr161040 1017 821 355 108 59 21026 994 ----
NM_001160chr1282819 2121 1921 1043 476 444 45 36 22695 1848 ----
NM_001167chrX196531 6388 5699 4922 4656 4532 4501 4428 2313 2287 2189 2169 1568 1227 759 439 303 164 89 46735 6441 5244 315 12437 --
NM_001173chr14134499 4481 4199 4108 3677 3654 3323 3278 1492 1303 959 334 136 64515 4394 3398 3197 3124 1580 --11266
NM_001177chr1272133 2038 949 895 851 192 85 22051 399 ----
NM_001178chr111478 ------
NM_001179chr41245 ------
NM_001186chr21123286 3275 2973 2914 2813 2717 2647 2253 2154 2127 686 541 ------
NM_001187chr211458 ------
NM_001201chr4193926 3673 3515 3496 3250 3176 3020 2822 2698 2649 2441 2419 1582 1070 1016 524 473 446 193 22643 410 1891 --
NM_001204chr2267681 7530 7296 6760 6270 6171 5886 5739 5233 4806 3057 2947 2879 2862 2570 2515 2509 2394 2124 1519 1048 789 642 203 188 138 22831 2193 37050 6868 1793 --
NM_001206chr972959 2930 2510 2463 2275 2038 737 1826 22669 697 13061
NM_001211chr151365 ------
NM_001233chr792407 2258 1981 1689 955 907 548 244 229 32119 1850 422 ----
NM_001249chr143338 325 317 ------
NM_001253chr61130 ------
NM_001259chr7145789 5671 5512 5241 4803 4262 2423 2361 2258 1863 1340 1233 868 637 35835 1782 1409 21873 746 25356 4170
NM_001271chr1553220 2516 2494 2469 1227 ----11267
NM_001281chr191145 ------
NM_001289chrX81678 1526 1442 1225 644 625 277 236 ------
NM_001304chr17153742 3045 2965 2833 2420 1429 869 715 666 598 519 478 363 147 121 13448 2934 130 12819
NM_001310chr12103094 3074 3050 2634 2601 2584 1967 1073 626 459 32951 2786 2171 1923 22686 2077
NM_001316chr202328 134 ------
NM_001343chr581722 1636 1597 1581 1293 381 213 199 1219 ----
NM_001357chr11257 ------
NM_001364chr1184397 3839 1290 1098 802 727 426 121 --23938 3893 --
NM_001386chr872199 2148 1866 1715 720 490 381 11528 2704 498 --
NM_001391chr184476 261 143 129 4857 852 847 842 --11214
NM_001396chr2152766 2574 2515 1839 1799 --11781 --
NM_001412chrX103663 3636 2855 2319 1491 1440 1027 903 633 409 12575 12685 1173
NM_001419chr1963795 1340 1190 251 205 119 34353 4176 215 14481 13971
NM_001429chr2221102 1075 1346 ----
NM_001432chr4123661 3606 3576 3352 3170 3055 2731 2497 2480 908 694 246 --43775 3280 896 840 --
NM_001438chr193578 3206 2701 2498 2456 2247 1216 808 730 --1396 --
NM_001453chr691554 1240 1182 596 579 496 322 237 24 1701 ----
NM_001497chr962778 884 853 709 682 195 1362 1328 --
NM_001498chr671361 1252 1061 1042 472 362 265 11156 ----
NM_001533chr191127 ------
NM_001539chr91136 ------
NM_001557chr231316 1193 935 --11171 --
NM_001570chr321439 1344 ------
NM_001584chr1181183 995 942 908 251 206 169 114 ------
NM_001609chr1083488 3091 2725 1683 1139 817 743 674 --1755 14519
NM_001616chr283532 3483 2987 2809 2791 889 386 362 ----1615
NM_001621chr793005 2785 2555 1136 1074 1011 887 661 545 52299 621 342 319 40 12939 12468
NM_001621chr793005 2785 2555 1136 1074 1011 887 661 545 52299 621 342 319 40 12939 12468
NM_001624chr651862 1768 521 425 132 1326 1121 --
NM_001627chr341628 1474 883 312 1763 ----
NM_001634chr682026 1958 1805 1506 426 154 127 66 --11484 --
NM_001642chr1141158 468 224 177 1275 ----
NM_001650chr1854003 3863 3405 3244 190 44108 2661 1138 91 23744 2937 --
NM_001656chr571941 1274 1259 438 268 207 185 21529 213 31923 776 728 --
NM_001660chr31280 ------
NM_001663chr1492637 2619 2497 2210 2203 939 721 271 106 ------
NM_001668chr161692 1448 1392 901 725 678 ----11429
NM_001681chr123661 573 187 ------
NM_001682chr1292187 2051 938 862 770 637 623 378 138 --1597 --
NM_001684chr1113549 3369 3303 3297 3137 3086 3068 2559 1477 798 642 12614 33676 383 340 --
NM_001689chr232010 1779 1528 41980 1820 1696 182 41868 708 699 175 --
NM_001695chr8103897 3568 3046 2657 1626 846 585 419 128 61 --13819 --
NM_001699chr1941281 1273 1251 1229 --31547 1322 293 11361
NM_001701chr941533 1191 1118 263 2632 550 --1415
NM_001704chr62462 425 ------
NM_001718chr651059 1005 986 432 379 ----150
NM_001721chrX1357 ------
NM_001730chr1331329 1131 1019 11364 --11080
NM_001730chr1331329 1131 1019 11364 --11080
NM_001742chr781534 1497 1428 1329 1284 1242 448 127 21792 400 ----
NM_001743chr2125 ------
NM_001744chr51228 ------
NM_001746chr592722 2671 2250 2068 1954 1939 606 570 419 12732 12297 --
NM_001748chr151091 957 316 257 210 ------
NM_001753chr751648 1315 627 218 103 1109 1200 --
NM_001754chr21104102 3734 3620 3527 1600 1312 888 820 638 578 ------
NM_001755chr16111998 1916 1906 1757 1687 1528 1465 1419 831 666 456 12142 32215 1438 861 --
NM_001777chr3144189 4127 4073 3859 3690 3615 3557 3496 3087 2950 2782 1380 344 162 22753 523 11661 --
NM_001797chr16185 ------
NM_001801chr54681 471 274 100 ------
NM_001806chr19112940 2580 2447 2273 2037 1988 1120 735 459 321 196 1674 1387 1446
NM_001830chrX114019 4012 3545 3362 3210 2789 1376 1182 1082 516 464 23708 3624 11072 --
NM_001839chr12514 202 ------
NM_001843chr121201 ------
NM_001854chr181151 1035 1010 994 543 375 269 198 11361 31288 1047 446 --
NM_001858chr6194968 4925 4780 4756 4714 4635 4619 4511 4375 4326 4278 3741 3485 3181 2003 1987 1938 1343 420 34092 1686 1612 1382 --
NM_001859chr983925 2873 1384 1057 915 859 378 356 22765 1132 12813 --
NM_001873chr47685 459 444 274 121 74 27 ------
NM_001874chr1275218 4475 4406 4152 3214 1599 530 --15209 13268
NM_001875chr251102 1060 442 157 31 ----1199
NM_001881chr102497 34 ------
NM_001893chr171405 ------
NM_001901chr61101 ------
NM_001902chr13384 364 63 ------
NM_001903chr57873 227 165 143 81 73 43 1884 1100 --
NM_001918chr1189208 9070 8819 8388 6699 6570 6561 6445 6308 6225 3730 3546 2951 2801 2636 2345 1029 950 49057 7988 7962 3091 ----
NM_001924chr13513 467 445 ----1478
NM_001938chr1111589 1579 1539 1452 1413 1354 604 392 342 225 141 21700 400 1478 --
NM_001942chr1891926 1610 1572 1366 1360 686 565 495 367 21803 1694 ----
NM_001948chr1531277 1271 387 ------
NM_001966chr371498 1441 341 272 208 188 70 21294 1278 155 --
NM_001977chr4121524 1457 1185 1104 639 533 506 401 306 285 221 153 31538 1225 556 11262 --
NM_001981chr1102151 2127 1929 1849 1811 1762 1629 654 499 48 --12227 --
NM_001995chr42503 309 --11243 1272
NM_001999chr581436 1170 968 609 481 473 291 262 ------
NM_002006chr4205670 5345 5141 4658 4641 4529 4436 4383 4049 3820 3649 2324 2294 2261 1340 1219 1148 1044 1020 432 --25579 781 --
NM_002009chr15142800 2485 2305 2095 2015 2007 1738 1083 957 924 799 492 348 321 1295 --12197
NM_002010chr131593 ------
NM_002015chr13103358 3286 2753 2651 995 855 722 648 513 385 23277 456 --1610
NM_002025chrX158978 8812 7829 7182 5997 5952 3364 3328 2774 2742 2207 2161 1268 975 161 49294 7012 6007 2513 37030 5747 3355 11187
NM_002035chr18124011 3789 3676 2903 2859 2542 1532 1296 803 573 309 59 11030 --13609
NM_002040chr2193059 2682 2615 2434 2124 934 629 512 154 4974 703 676 527 179 --
NM_002044chr1531558 1042 577 31249 332 76 21549 368 11171
NM_002056chr24851 840 736 698 1904 1560 --
NM_002061chr151644 1554 1187 551 150 1745 ----
NM_002069chr7111893 1779 1671 1656 1342 727 715 588 456 393 180 ----1507
NM_002072chr91270 ------
NM_002076chr1272577 2395 1203 978 972 632 502 13274 33149 2258 325 --
NM_002092chr4154915 4091 4005 3215 1527 1402 1217 1056 945 895 859 843 521 398 284 34853 3895 3156 14759 --
NM_002110chr201305 ------
NM_002126chr1784176 3905 3734 1408 1374 1162 601 540 51669 1219 1155 1114 477 1640 --
NM_002128chr13112601 2303 1946 1602 1023 950 638 442 432 372 240 1551 ----
NM_002137chr762199 1656 1643 546 343 334 32161 662 552 22320 816 --
NM_002139chrX4660 224 128 115 ------
NM_002151chr191265 ------
NM_002156chr21291 ------
NM_002158chr2183836 3555 3467 3440 3346 3146 3008 2996 2771 1428 1390 1218 1090 1054 1043 763 538 351 42372 1292 1018 797 12825 --
NM_002160chr92603 405 ------
NM_002188chr52712 705 ------
NM_002199chr421030 828 ------
NM_002210chr2133310 3206 3147 2789 2527 2256 2225 773 682 645 224 173 61 23349 1296 12807 --
NM_002214chr7135501 5491 5372 5130 4168 2158 2086 1021 988 834 794 687 492 55477 5397 4746 4737 3505 33731 3618 1724 25172 729
NM_002223chr12143461 3306 2987 2868 2718 2522 1592 1400 1365 1138 726 355 329 57 12918 23592 453 --
NM_002227chr141232 880 196 22 ------
NM_002232chr141215 1148 1011 547 ------
NM_002264chr3125027 4933 4516 3831 3345 3326 1681 1523 708 688 409 395 --13674 13216
NM_002268chr341507 1300 1217 143 11563 --11547
NM_002270chr5155524 5392 4794 4610 4562 4527 3668 3542 3527 2259 2059 1955 1516 821 487 85213 4725 4085 2224 1649 1450 1280 912 45560 5476 4105 3660 14297
NM_002271chr1332373 2337 401 11656 --1851
NM_002285chr2104206 4049 3917 3300 1595 1389 1293 1029 988 670 --43562 1372 1006 602 --
NM_002296chr181772 1724 1643 1298 1211 504 454 376 ------
NM_002310chr5216375 6014 6004 5943 5677 5667 5381 5207 5157 5149 4944 4812 4421 4339 4000 2642 2414 2343 1186 1104 461 25904 134 25726 1661 --
NM_002335chr11151 ------
NM_002336chr12184694 4672 4633 4462 4413 4189 3854 3581 3107 1897 1761 1475 1326 1174 811 711 269 53 14174 15053 23553 827
NM_002350chr82497 160 --21150 1036 1137
NM_002351chrX51741 1595 1552 54 43 11664 ----
NM_002374chr293281 3262 3176 3032 2696 2552 1446 1327 473 42311 576 523 424 22402 714 --
NM_002381chr251057 929 653 317 143 ----1235
NM_002384chr184988 864 800 224 ------
NM_002395chr661452 1016 590 504 324 153 31264 1159 102 1992 1224
NM_002397chr561535 1391 662 626 241 150 11529 ----
NM_002413chr4172 ------
NM_002451chr9133910 3317 3157 3101 2476 1150 980 884 630 586 391 287 170 33380 1216 609 ----
NM_002481chr1147822 7202 7158 6435 6003 5156 2783 2538 2502 1868 1234 1211 959 479 ----12526
NM_002500chr231121 1058 870 ----1435
NM_002515chr14101975 1899 1851 1521 1397 674 579 491 485 346 --21590 742 21457 358
NM_002519chr1191470 1243 1202 1158 992 474 459 307 136 1427 ----
NM_002568chr8173 ------
NM_002577chr3133363 3243 2933 2857 2797 2467 1303 1038 926 736 681 225 112 13424 ----
NM_002581chr975509 5339 4993 4932 1146 1119 1022 11596 14509 15389
NM_002606chr211196 ------
NM_002608chr2211594 ------
NM_002610chr2143154 3066 3000 2881 2501 2472 2237 2222 1038 840 647 575 362 47 22174 1944 22959 140 --
NM_002613chr16135374 5271 5160 5136 4862 4842 4481 4031 3816 3558 3537 3303 957 15152 24665 3737 --
NM_002635chr123419 388 27 ------
NM_002636chr61465 ------
NM_002645chr11102763 2456 2450 2252 849 818 797 517 202 140 22843 786 --1504
NM_002655chr8165297 5232 4772 4147 3999 2049 1866 1810 1473 1383 1268 458 438 402 192 53 23927 489 24059 1134 1711
NM_002670chr361403 1350 1042 476 289 131 21532 251 21327 1187 11575
NM_002687chr1431141 460 270 ------
NM_002689chr111337 ------
NM_002690chr8191 ------
NM_002703chr451850 1537 542 361 127 --11794 --
NM_002709chr2133569 3474 3434 3401 3289 3127 2956 2807 2201 1057 300 218 146 13048 13069 --
NM_002715chr531195 1156 1054 ------
NM_002718chr382710 2350 2334 2049 1747 876 699 41 --12618 --
NM_002721chr95533 517 396 349 134 1143 1151 --
NM_002726chr61359 ------
NM_002729chr105737 726 594 321 248 1331 ----
NM_002731chr152818 2119 1043 900 585 --22530 820 12318
NM_002734chr17162314 2267 2153 2065 1955 1942 1836 1818 1708 1578 1565 1550 724 705 195 177 1318 1823 --
NM_002737chr1766425 5414 1473 1409 1399 1246 36586 1519 1463 14843 --
NM_002740chr382833 2735 2433 2215 1730 546 491 383 32308 1768 515 ----
NM_002745chr2273907 3689 3135 1712 1018 684 331 23652 3632 ----
NM_002747chr1831710 1615 688 ------
NM_002752chr52571 385 ------
NM_002753chr42865 275 ------
NM_002788chr14296 31 ------
NM_002790chr12115 59 ------
NM_002819chr191151 ------
NM_002836chr201207 ------
NM_002837chr12124610 4365 4327 4307 3419 3353 2862 1731 1575 1053 739 576 --23624 440 --
NM_002838chr151018 980 887 805 101 ------
NM_002844chr631275 1037 908 1230 11371 1182
NM_002858chr131163 478 132 1989 11296 1266
NM_002886chr3194743 4698 4574 4540 4305 3912 3774 3744 3528 2022 1855 1651 1318 1279 1245 1193 922 476 63 ------
NM_002892chr14111469 1389 1299 1279 1248 1214 688 557 377 294 105 ----165
NM_002940chr451540 1458 1411 578 348 --1159 --
NM_002942chr351429 1293 1148 500 429 1375 1532 1925
NM_002948chr361139 1113 491 426 311 274 --11252 --
NM_002959chr1114386 3520 3052 2828 1224 1199 993 884 759 228 86 11281 11580 11272
NM_002971chr32821 170 ------
NM_002977chr273127 3014 2782 2517 2330 774 550 23408 2461 --23181 1210
NM_002996chr161310 ------
NM_003016chr1751481 1451 629 590 403 ------
NM_003030chr341952 1451 1436 589 11873 11710 --
NM_003043chr364267 1654 686 374 299 55 ----1271
NM_003046chr8135407 5269 4938 4368 4279 3980 3889 3472 1648 1322 1225 569 396 31486 837 167 13880 --
NM_003051chr151693 1398 548 289 24 31636 1431 719 31626 343 175 --
NM_003054chr101244 ------
NM_003069chrX4657 507 170 60 1756 ----
NM_003071chr372065 1805 780 677 510 197 44 21418 766 ----
NM_003073chr221304 ------
NM_003101chr151675 1482 1275 657 398 21268 1079 --1367
NM_003107chr632234 2152 1664 ------
NM_003112chr7193254 3153 3129 2657 2522 2504 2317 2126 2112 2105 2059 893 695 683 554 519 378 229 163 1546 23112 1147 --
NM_003118chr552046 1898 1739 1602 119 22082 1747 --11335
NM_003128chr292858 2259 2104 1103 1093 1074 765 745 656 21822 248 ----
NM_003137chr662190 1962 1755 554 203 112 21716 300 --11851
NM_003142chr22236 32 ------
NM_003155chr8102802 2597 2249 2123 825 770 495 436 417 404 12674 --12066
NM_003161chr17113617 3192 3177 3146 2997 1398 847 543 506 321 23 ------
NM_003188chr63819 782 111 ------
NM_003199chr18145679 5639 5587 5053 4937 4095 4077 3621 2228 2045 1889 1832 1458 1211 25262 510 23989 1016 --
NM_003201chr102983 680 ----1755
NM_003211chr1271706 1379 1156 352 317 163 28 31574 1463 215 ----
NM_003221chr684102 3975 3850 1265 777 437 153 36 --14119 --
NM_003234chr392386 2233 2179 1948 1931 1613 408 330 134 --22077 73 --
NM_003246chr1572036 1809 1687 1372 787 620 533 11753 11877 --
NM_003247chr642018 1734 1422 493 41852 499 457 397 ----
NM_003257chr1551416 1227 447 55 24 1990 11380 --
NM_003262chr3175286 5096 4722 4354 4039 3403 3232 3201 2076 1379 1357 1264 1001 800 284 102 23 55270 5236 4292 1948 1367 25064 5000 1577
NM_003274chr2172742 2603 2367 2241 1096 1025 749 22954 2352 ----
NM_003275chr911541 ------
NM_003298chr3156230 6181 5891 5344 4848 4661 4419 4043 3878 1621 1584 1491 1415 1349 1222 56257 6160 5350 5112 4837 56078 5057 1900 819 617 --
NM_003304chr351336 1142 578 412 235 11649 ----
NM_003309chr631695 1247 280 --21795 1687 --
NM_003337chr581452 1168 1084 566 351 344 335 211 ----1197
NM_003338chr10131685 1587 1399 1377 1355 745 701 585 566 443 322 130 71 2686 530 21837 1814 --
NM_003339chr541374 1132 564 291 11245 1544 --
NM_003359chr431070 1032 78 ------
NM_003407chr191691 ------
NM_003409chr1861354 1301 1231 1028 531 374 11021 ----
NM_003410chrX92889 2818 2544 2484 2457 1109 968 297 150 12862 1181 23066 859
NM_003411chrY51765 1687 1436 549 169 31725 1383 97 2732 254 --
NM_003412chr383003 2956 2863 1241 1007 688 546 399 1587 ----
NM_003423chr1982577 1865 1631 1617 826 815 747 507 41840 1641 959 865 ----
NM_003430chr1981638 1626 1550 1444 1240 1227 1186 652 21392 1180 21419 498 --
NM_003432chr53476 371 26 ------
NM_003463chr6103399 3258 3070 2542 2354 2083 1334 1257 1028 294 33311 3139 2234 13177 --
NM_003468chr294347 4075 3976 3853 3416 3108 1041 1003 817 22905 737 11676 --
NM_003470chr1641886 688 671 632 ------
NM_003471chr392045 2003 1970 1867 1685 1607 1600 1581 947 21952 455 1410 --
NM_003472chr6121536 1495 1464 1261 1248 1210 1183 285 176 157 94 37 --21268 510 --
NM_003473chr1021063 38 1410 1709 1977
NM_003478chr11153336 3075 2874 2726 2707 2532 2253 2081 2071 1255 1179 701 675 611 270 --23180 908 --
NM_003483chr1272973 2642 2325 1100 740 597 528 --1962 --
NM_003489chr2173454 3405 3199 2959 2424 2366 1035 2493 295 --1737
NM_003507chr252063 2054 1696 1546 1531 ------
NM_003558chr91468 ------
NM_003566chr12163472 3446 3410 3210 3139 2914 2664 2418 2265 1110 638 602 568 547 447 44 --53115 3074 3016 1192 367 --
NM_003574chr18165114 4945 4464 4439 3965 3588 2301 2018 1860 1512 1321 924 772 467 396 352 25744 973 15385 --
NM_003581chr21986 ------
NM_003582chr11211 ------
NM_003583chr12103897 3796 3315 2929 2830 2725 1557 1345 1185 194 43391 2775 2543 461 1746 --
NM_003586chr161530 ------
NM_003590chr2133754 3657 3211 2853 1435 1354 1317 964 826 731 409 76 68 1106 23906 1462 --
NM_003591chr101357 ------
NM_003601chr41164 ------
NM_003607chr194067 3900 3811 3766 2825 1109 563 536 294 2499 220 11582 --
NM_003613chr153552 217 109 --1514 --
NM_003615chr3203881 3756 3740 3492 3455 3383 3285 3015 2754 2707 2658 2530 2471 1176 1112 1072 775 610 599 297 21536 1009 1707 --
NM_003620chr176332 301 249 221 200 57 2855 424 1938 --
NM_003622chr1262595 2167 1999 504 448 382 ----1691
NM_003642chr22329 303 ------
NM_003659chr261166 1109 1020 190 127 46 --1946 --
NM_003663chr383441 3268 3088 2795 2449 2231 1276 761 --11196 --
NM_003672chr171733 1245 775 454 417 367 250 21413 122 ----
NM_003688chrX1242 ------
NM_003713chr191769 1756 1649 1562 1316 1156 647 498 393 --1551 --
NM_003716chr34838 725 407 236 2857 781 ----
NM_003722chr362465 2017 869 579 407 363 --2959 946 --
NM_003743chr252179 877 843 757 29 ------
NM_003749chr1362257 2165 1869 918 700 310 --12010 --
NM_003750chr107843 807 763 663 274 157 36 1684 189 --
NM_003758chr1571638 1429 1405 1352 1252 1024 222 11483 31552 288 212 --
NM_003758chr1571638 1429 1405 1352 1252 1024 222 11483 31552 288 212 --
NM_003759chr444100 2971 2823 910 1837 22743 822 --
NM_003762chr151401 931 520 264 68 ----11366
NM_003763chr2063094 968 947 785 773 669 1677 1767 --
NM_003772chr1181199 1182 1165 1031 902 458 401 209 31321 519 221 184 --
NM_003774chr12133296 3232 3155 3089 2984 2932 2410 1113 630 478 470 365 273 32869 2219 791 32597 2321 2108 --
NM_003787chr1821664 1219 --21315 35 --
NM_003794chr371067 712 690 378 314 288 186 2906 109 1753 --
NM_003809chr171527 ------
NM_003845chr12194 ------
NM_003864chr41188 ----1174
NM_003873chr1062519 2455 2417 2229 1923 1642 22561 1759 ----
NM_003885chr17161 ------
NM_003909chr882973 2955 2945 2797 2708 695 633 599 32931 825 445 1809 12324
NM_003913chr6104346 4292 4019 3500 3252 3192 1266 821 785 214 1130 13165 14114
NM_003930chr742347 727 426 175 2215 196 22515 1992 --
NM_003932chr22111728 1628 1578 1438 1428 1397 1327 632 475 244 48 31245 1196 331 ----
NM_003934chr94942 910 450 441 2979 135 ----
NM_003939chr1043295 1327 1102 786 24169 2668 ----
NM_003941chr792489 2380 2323 2207 1893 1817 783 675 280 11605 21964 376 12153
NM_003948chr492610 2601 2514 2184 2178 2117 2110 1955 589 1336 1547 --
NM_003951chrX1299 ------
NM_003966chr5177773 7129 7001 6858 6533 5314 5169 4887 3141 3122 2922 2860 2627 2619 2423 2399 2157 11793 --1958
NM_003980chr651450 1212 1160 1119 916 ------
NM_003983chr1674478 4109 3957 3790 3640 3519 2771 --43307 3156 977 346 190
NM_003994chr12164405 4364 4266 4236 4189 4124 4039 3913 3500 3335 2794 1709 1238 922 431 356 21158 974 --2696 204
NM_004006chrX72238 1751 1629 765 327 230 214 ------
NM_004007chrX72238 1751 1629 765 327 230 214 ------
NM_004009chrX72238 1751 1629 765 327 230 214 ------
NM_004010chrX72238 1751 1629 765 327 230 214 ------
NM_004011chrX72238 1751 1629 765 327 230 214 ------
NM_004012chrX72238 1751 1629 765 327 230 214 ------
NM_004013chrX72238 1751 1629 765 327 230 214 ------
NM_004014chrX72238 1751 1629 765 327 230 214 ------
NM_004015chrX72238 1751 1629 765 327 230 214 ------
NM_004017chrX72238 1751 1629 765 327 230 214 ------
NM_004020chrX72238 1751 1629 765 327 230 214 ------
NM_004028chr1854003 3863 3405 3244 190 44108 2661 1138 91 23744 2937 --
NM_004035chr1794939 4759 2007 1698 1507 1142 1080 158 106 13982 34737 4630 687 --
NM_004040chr211274 --21248 1012 --
NM_004060chr561232 818 423 227 188 182 2870 432 1829 --
NM_004081chrY31731 1642 81 --1174 11420
NM_004094chr14142948 1867 1850 1139 1080 991 867 785 582 406 166 129 121 104 32956 2164 1161 ----
NM_004098chr1011041 ----1909
NM_004100chr6112430 2295 2216 2159 2109 1964 1865 1086 619 157 93 1491 32247 432 51 --
NM_004101chr552097 1755 1585 1448 543 ------
NM_004105chr251079 871 860 723 247 1205 1790 --
NM_004109chr1172398 2321 798 615 510 504 73 --1147 --
NM_004124chr14173583 3443 3206 2971 2833 2688 2620 2363 2326 2268 1353 1143 1111 779 597 508 329 --12668 --
NM_004133chr8112718 2639 2609 2251 2187 1907 1750 722 569 553 316 22657 435 1420 --
NM_004136chr1573194 3133 2783 1248 1101 992 177 43281 2111 925 781 12613 --
NM_004171chr11209637 9444 8991 8165 8134 7604 7440 7341 7298 7268 6848 5980 5968 3364 3157 2937 2901 2353 1714 811 --36544 5947 716 17045
NM_004187chrX11483 ------
NM_004215chr82581 445 ----1437
NM_004232chr18153890 3328 3307 3068 2779 2680 2617 2424 2378 1280 1012 648 537 413 364 33779 265 227 --1604
NM_004261chr12132 120 --1761 1325
NM_004274chr14103231 3099 2241 2018 1210 958 948 511 384 199 22251 674 42687 2530 2393 1248 --
NM_004290chr581376 1105 919 286 271 245 192 185 1931 1502 11016
NM_004301chr33372 241 130 ------
NM_004316chr121994 ------
NM_004329chr1061326 1292 1145 1138 904 223 1571 1319 --
NM_004337chr892320 2024 1944 1649 1430 851 545 375 81 1890 ----
NM_004338chr18147002 6284 6141 5200 5001 4364 2801 2698 2556 1559 1064 1007 859 387 12772 ----
NM_004342chr752102 2052 1829 1443 389 11905 197 1582
NM_004373chr121177 ------
NM_004380chr1671960 1952 1809 921 879 183 88 11054 22500 1982 --
NM_004397chr11113894 3709 3573 3510 3485 3300 3105 2820 2687 1715 1003 --23118 1145 --
NM_004412chr10195893 5655 5568 5533 5047 5030 4653 4482 4386 4371 4038 1874 1803 1628 1091 962 947 736 560 12066 15451 24815 104
NM_004438chr283291 3164 3092 3019 2902 2328 915 829 1399 ----
NM_004440chr681810 1637 1584 1330 1213 494 390 159 ------
NM_004457chr251732 1647 1353 458 259 ------
NM_004458chrX82653 2605 2533 2233 2152 1840 397 320 1978 1930 --
NM_004464chr493869 3295 3284 2674 1293 871 802 652 288 1519 23583 847 13103
NM_004481chr142665 2643 972 600 ------
NM_004482chr24817 663 591 101 1729 1855 --
NM_004496chr1441362 1293 1244 1220 1992 ----
NM_004501chr1124004 3695 3060 3043 2844 2778 1650 1244 1201 525 447 433 13868 13915 --
NM_004504chr2152545 2224 2144 2053 2040 1936 1188 940 930 817 710 694 680 492 196 32249 2153 249 1534 --
NM_004505chr1751997 1674 1492 278 95 21825 1796 21558 1505 --
NM_004528chr1277 39 ------
NM_004559chr12397 272 ------
NM_004571chr2172904 2600 2354 996 627 616 514 22263 300 52663 2652 2154 714 249 --
NM_004574chr17127 ------
NM_004580chr1561739 1704 1402 730 480 473 --21560 759 --
NM_004586chrX285305 5296 5229 5196 5079 4752 4689 4586 4500 4316 3972 2089 2052 2040 1913 1868 1293 1206 1181 1059 1029 571 561 350 297 247 189 169 14695 ----
NM_004593chr33950 878 309 --1250 --
NM_004598chr5113341 3235 3229 3134 2801 2703 2384 929 755 414 342 ------
NM_004602chr201958 --11357 --
NM_004612chr9124217 4208 4134 3746 3711 1810 1764 1532 1159 980 948 725 44332 3864 1127 884 --1357
NM_004621chr1121267 114 ------
NM_004663chr1591517 1123 1006 548 509 230 132 116 62 11361 ----
NM_004685chr13112851 2598 2206 1948 1880 1117 1072 882 519 492 271 11919 12589 --
NM_004689chr141334 ------
NM_004690chr62234 185 1224 --1141
NM_004713chr144733 705 514 222 ------
NM_004719chr1292902 2865 2730 546 533 478 442 339 151 52283 2045 1953 1134 326 --1697
NM_004726chrX165793 5060 4625 4363 4220 4099 3895 3873 3790 3491 2178 1726 1624 793 744 466 23703 3574 ----
NM_004727chr1562155 1753 1692 1435 1399 292 ------
NM_004736chr172218 2039 1616 1529 1493 832 420 --1903 --
NM_004742chr351530 1479 1401 579 559 ------
NM_004744chr4123918 3723 2684 1548 1532 1507 1198 947 843 735 392 183 43622 2864 1516 1444 1345 --
NM_004745chr8186848 6806 6557 6523 6303 6046 5873 5740 5555 5202 4728 1987 1975 1803 1306 1065 866 359 27030 5599 ----
NM_004748chr15114092 4030 3821 3643 3485 3396 3038 1231 782 636 104 53299 3008 1633 1415 1131 13981 --
NM_004755chr1451101 1094 852 461 269 --21161 285 --
NM_004773chr172412 395 ------
NM_004774chr1792972 2729 2698 2075 824 777 642 116 55 1148 22935 2215 --
NM_004775chr1871825 1766 1634 1530 900 809 643 1356 1470 --
NM_004779chr52368 295 --1199 --
NM_004788chr1162185 1973 755 557 540 299 ----1134
NM_004791chr132768 669 ----2687 132
NM_004815chr1194839 4797 4581 4411 4159 3924 3913 3181 3107 1802 1698 1398 1207 996 843 559 419 216 162 44946 1607 1271 1193 14705 1680
NM_004834chr283422 3297 3268 2841 2377 2214 721 335 12659 12635 --
NM_004850chr241495 1297 1183 1175 1166 ----
NM_004855chr152195 55 ------
NM_004857chr14134744 4565 4531 4307 3895 3256 3229 3168 3030 1384 1246 977 408 34779 2938 1159 --14718
NM_004859chr17102900 2677 2441 2226 1207 942 573 412 402 361 1900 ----
NM_004863chr1494399 4047 1824 1157 1125 1110 541 198 148 15331 23600 3573 14104
NM_004866chr5134737 4709 3738 2007 1670 1464 1389 1293 1115 1081 714 457 224 1266 --11354
NM_004869chr1861659 1621 1262 572 550 174 31476 1156 518 21738 1490 11638
NM_004871chr1784434 4368 4298 3086 3074 3057 2983 1589 14423 ----
NM_004896chr1051270 1132 956 420 57 --11048 --
NM_004904chr7136280 6017 5853 5814 5799 5479 5071 4596 2335 2315 2286 2073 378 15805 26008 2294 11638
NM_004927chr1111482 ------
NM_004938chr921073 1055 ------
NM_004949chr1892075 1952 1924 1626 1592 1510 850 806 150 21847 414 ----
NM_004955chr61594 ------
NM_004956chr7184610 4593 4340 3642 3591 3504 3263 1843 1634 1599 999 936 840 833 795 770 110 71 13554 11148 --
NM_004958chr12860 105 ------
NM_004966chr104784 760 702 282 --1259 --
NM_004969chr102214 199 1166 ----
NM_004985chr12144444 4052 3907 3888 3228 1699 1532 1438 1230 887 841 241 181 138 33636 1356 683 33846 3085 785 33984 3417 69
NM_004987chr22295 268 ------
NM_004999chr684361 4124 3822 3426 1779 761 738 145 11447 1822 --
NM_005006chr23975 925 205 2854 276 --1986
NM_005010chr792119 1990 1874 1674 1538 1469 791 560 409 ------
NM_005023chr541389 1370 955 224 11281 ----
NM_005036chr22148258 7149 7091 6751 6644 5925 5711 5183 2930 2871 2210 1635 525 454 ------
NM_005054chr261586 1217 1195 630 357 299 --1375 --
NM_005056chr1264666 4257 3805 1966 1402 914 24088 1436 1932 --
NM_005057chr151801 1647 1259 147 135 1161 ----
NM_005065chr14175352 5312 4475 4438 4271 4246 4175 4105 3544 3517 1742 1249 984 827 348 200 130 34934 3498 474 55380 5301 1546 1318 976 --
NM_005066chr14686 582 571 65 1839 1274 --
NM_005076chr144217 1421 204 115 ----12631
NM_005079chr8113172 3107 2752 2203 2156 1267 1119 776 438 429 85 13036 ----
NM_005102chr27889 814 808 651 618 217 195 1247 138 1357
NM_005121chr17203443 3405 3155 2875 2850 2789 2539 2427 1481 1285 1274 1032 992 776 642 471 462 455 358 315 53848 3141 2771 1193 69 --13283
NM_005139chr41294 ------
NM_005156chr9115248 4795 4508 4428 3877 3254 2158 1099 773 626 421 25197 291 --12127
NM_005160chr22186824 6806 6571 6556 5602 5464 5399 5294 5191 5092 4813 4741 2500 2187 2081 1858 962 276 24806 1558 12221 --
NM_005168chr251625 1424 388 313 76 11647 ----
NM_005171chr1271178 1088 1056 472 430 267 46 174 2323 259 1438
NM_005180chr1081511 1293 1274 1176 1102 643 131 78 --11616 --
NM_005188chr11138345 6661 6012 5872 5865 3217 2253 2094 1820 1696 1401 1098 913 21459 1152 12666 --
NM_005197chr14104926 4714 4647 4358 4343 4326 3781 747 720 333 35018 1371 765 22111 2097 --
NM_005233chr3112444 2387 2202 1979 1939 1753 1732 653 575 245 226 ------
NM_005235chr297133 6898 6656 6583 5968 2608 1773 1437 1374 35904 4742 2186 ----
NM_005238chr11103087 2584 2459 2331 1128 942 659 583 137 78 22182 1414 21294 71 --
NM_005243chr222337 67 ------
NM_005244chr201689 ------
NM_005259chr281482 1443 1311 1267 1231 1116 585 445 21525 316 ----
NM_005277chr431697 182 165 11620 1579 --
NM_005308chr103535 385 342 ------
NM_005337chr121401 ------
NM_005339chr4184301 4107 4072 3703 3186 3065 2845 1561 1464 1330 1195 890 768 659 518 439 193 84 11452 11214 22750 1381
NM_005358chr1371645 1481 1474 1441 1405 602 236 1139 --1441
NM_005359chr18185732 5624 5309 5094 4260 4233 4149 1919 1825 1738 1571 1401 1322 1301 1074 977 946 930 25283 524 36366 2558 966 14700
NM_005388chr971715 1401 1066 573 466 159 24 31177 421 143 11649 --
NM_005399chr194229 4121 3944 3862 3189 2934 2700 1694 1159 23667 1112 11365 --
NM_005412chr121556 ------
NM_005433chr18112816 2586 2478 2452 2434 2361 2304 1707 591 193 59 11925 12742 1493
NM_005445chr105314 258 239 83 72 ------
NM_005460chr52212 93 ------
NM_005465chr141873 629 454 372 ----11505
NM_005487chr2252061 1628 1432 555 105 ------
NM_005497chr17125968 5956 5885 5812 4617 1985 1339 1115 1066 715 272 60 ------
NM_005499chr191472 ------
NM_005502chr972737 2044 1165 1082 1063 779 235 1986 --13173
NM_005504chr12216191 6118 5894 5863 5677 5660 5447 5417 4688 4669 4547 4180 2409 1125 879 841 462 312 170 86 76 55537 5165 4459 4362 338 45962 5745 4415 2118 --
NM_005506chr452407 2306 1887 1120 982 22419 2374 22831 2143 1972
NM_005509chr5111887 1805 1522 1502 1443 1325 1290 1176 752 524 318 21690 185 ----
NM_005511chr941028 973 197 59 ------
NM_005539chr101243 ------
NM_005542chr771769 1484 1477 1341 1303 1256 527 --11908 --
NM_005561chr132802 201 ------
NM_005575chr53679 575 222 ------
NM_005578chr385075 5049 4399 1752 1721 1528 1440 1348 54876 1479 578 569 140 12052 --
NM_005593chr125531 466 415 403 120 ------
NM_005596chr996089 5384 4413 1591 1028 891 653 424 158 35828 4152 4017 24588 945 --
NM_005604chr662413 2273 2105 1763 521 350 1356 ----
NM_005611chr1641347 1174 886 824 ----21085 67
NM_005613chr152007 1382 405 258 160 22020 1678 1224 11567
NM_005618chr63655 501 262 ------
NM_005625chr811087 ------
NM_005650chr2251200 1185 471 383 176 ------
NM_005657chr15167 ------
NM_005665chr184257 3725 3434 1931 1352 949 346 264 34520 3771 1542 34676 1918 1296 --
NM_005668chr5133553 3434 3403 2953 2850 1709 1582 1553 1440 1350 1237 500 184 14630 24214 4078 --
NM_005669chr5102361 2197 2006 1945 1938 1748 1574 1451 595 144 21985 1716 ----
NM_005685chr71146 ------
NM_005711chr55885 767 738 431 88 1241 --1267
NM_005722chr292234 2109 1761 1722 1708 1673 1585 256 160 12268 --12464
NM_005725chr162463 2395 2336 2119 1984 602 --1507 22419 1928
NM_005746chr7152533 2439 2377 2330 2320 2087 1769 1710 1106 1070 1036 1024 1009 978 944 2950 483 1909 --
NM_005748chr12143297 2906 2261 1231 1006 981 526 507 478 373 343 313 292 155 22372 239 32984 2271 1302 1591
NM_005756chrX21539 1158 --1409 1321
NM_005759chr2114799 4409 4295 4266 4099 3981 3837 1920 1793 549 486 ------
NM_005776chr145816 698 299 207 142 1225 --1665
NM_005777chr3197 ------
NM_005786chr1841254 1089 1023 897 ------
NM_005795chr2143044 2721 2652 2484 2393 2378 2370 2257 2084 1958 1059 807 335 93 1559 22566 1869 12019
NM_005797chr1171695 1345 646 596 512 233 130 11503 2570 499 --
NM_005801chr171800 ------
NM_005802chr94820 282 263 127 ------
NM_005813chr272208 1951 804 761 655 177 78 --11688 1411
NM_005822chr682347 2298 1954 1923 807 692 386 86 --11892 1561
NM_005840chrX87635 7028 5994 3082 2975 2702 2092 1044 17512 11656 12527
NM_005841chr43989 432 416 ------
NM_005857chr161159 514 475 395 184 126 ------
NM_005868chr7122445 2336 2041 964 957 910 900 776 671 584 430 284 --22315 128 --
NM_005870chr13101476 1283 1098 946 571 310 245 139 97 24 ------
NM_005871chr1031089 825 326 2269 79 --1806
NM_005875chr31287 ------
NM_005880chr1681443 1393 1374 1365 1015 334 313 267 21490 647 ----
NM_005886chr161287 ------
NM_005888chr123419 388 27 ------
NM_005898chr11103139 2995 2889 2376 2281 2091 2069 1979 1057 489 13051 43033 2013 1290 889 23228 411
NM_005899chr1741376 1365 1199 185 ------
NM_005901chr18198357 8113 7865 6780 6550 6303 6283 6210 6094 5905 5286 3276 2876 2851 1716 1558 1280 1251 692 35605 2895 1341 27874 5558 15488
NM_005902chr1564504 4137 3308 1539 989 963 ----11392
NM_005903chr5114909 4893 4655 4140 4001 3921 3859 1250 585 381 308 24467 976 --14234
NM_005905chr131447 ------
NM_005907chr661294 1262 1111 290 120 113 11704 1171 --
NM_005909chr574103 3204 3124 3086 2611 1316 796 --23575 157 --
NM_005924chr751070 1055 450 297 115 --1831 --
NM_005930chr145836 643 365 286 154 2371 175 ----
NM_005932chr13125 ------
NM_005935chr4165270 4916 4872 4712 4526 4255 4170 3846 3798 3500 3471 3447 1965 1795 372 268 11285 21246 877 --
NM_005941chr8114018 3991 3970 3807 3757 3431 3093 2967 2702 1307 1165 33985 1417 1076 11338 13903
NM_005955chr1105563 5551 5529 5397 4296 3693 3514 1257 807 319 11231 15151 1225
NM_005962chr1032287 1482 71 11959 --12248
NM_005962chr1032287 1482 71 11959 --12248
NM_005966chr292206 2193 2040 2028 1938 1665 1571 850 342 2871 856 1726 --
NM_005994chr17197 ------
NM_005999chr1111507 1493 1236 1202 1189 1180 1158 438 371 232 132 --11453 21267 1024
NM_006007chr994432 4311 3352 3100 2861 2728 852 836 561 --1829 --
NM_006016chr682009 1891 471 449 351 237 173 113 1486 1919 --
NM_006024chr75801 714 624 277 188 ----1344
NM_006036chr242579 2192 959 504 21994 105 1139 12278
NM_006037chr293651 1637 1620 1584 1565 1543 1520 1298 1114 --21655 1375 --
NM_006038chr2062121 1598 1579 841 775 608 21381 823 11766 --
NM_006047chr20103390 3194 2729 2671 2560 2362 2275 2183 1070 638 12281 1298 --
NM_006080chr763010 2449 2183 2104 654 510 42980 1943 874 151 22321 2087 1949
NM_006089chrX6753 671 427 382 286 21 31553 681 567 ----
NM_006094chr872431 1877 1794 911 594 484 285 --12336 --
NM_006095chr4164105 3271 3216 3098 3063 2988 2973 2950 2825 2819 1392 881 851 422 381 223 44017 3869 3613 3032 23994 1628 12901
NM_006106chr11173408 3284 3010 2928 2800 2765 2469 2095 1378 1208 1083 899 672 485 348 324 27 22190 2104 121 --
NM_006108chr1191690 1682 1545 1476 958 804 672 161 85 1654 2867 36 --
NM_006141chr1651923 847 834 478 385 1872 22651 2480 --
NM_006154chr15112743 2447 2342 2158 1084 906 877 858 312 304 179 --1556 --
NM_006157chr111303 ------
NM_006166chr1282576 2493 2335 1821 1811 1780 751 445 12343 2706 489 --
NM_006180chr921721 255 ------
NM_006183chr125575 400 181 161 54 1153 1560 --
NM_006190chr23978 423 121 3890 303 96 1329 1765
NM_006197chr871955 1570 789 616 338 288 68 31732 1615 99 2835 170 --
NM_006203chr594452 4317 3425 1806 1326 1149 741 607 520 44952 4710 4640 1388 ----
NM_006206chr491873 1837 906 790 751 688 605 389 151 1833 12366 --
NM_006207chr81292 ------
NM_006212chr1125260 4626 4550 4077 3859 3747 3393 1937 1212 1035 778 615 --35058 3527 1875 12048
NM_006216chr22438 88 ------
NM_006226chr251215 1007 197 87 75 2538 527 1949 1171
NM_006238chr622093 2078 ------
NM_006241chr392219 2195 2170 1981 1761 966 792 453 136 1632 11734 --
NM_006247chr191476 ------
NM_006251chr5123270 3094 2527 2476 2377 2248 2172 2045 1249 1106 854 361 43070 2429 239 181 12079 --
NM_006252chr1247410 7059 6698 6665 6446 6354 6064 5791 5764 5717 4652 2951 2425 1873 1649 1576 1344 1172 884 851 668 483 214 57 26185 113 66165 5189 2614 2197 1535 390 37467 5323 5218
NM_006264chr41404 ------
NM_006275chr2072516 2328 1534 567 532 522 472 3741 612 375 ----
NM_006282chr20104755 4672 4476 4069 3758 3669 3590 526 398 50 1388 ----
NM_006283chr8114984 4870 4643 4178 3961 3236 1948 1904 1535 1364 335 31910 1577 500 13325 --
NM_006287chr292699 2555 2200 1932 700 685 177 110 36 ------
NM_006306chrX135050 4999 4226 3997 2360 2133 1740 1643 1481 1456 1108 707 688 --22294 426 --
NM_006310chr1731143 1137 166 ------
NM_006313chr1281720 1407 1290 1255 1138 333 266 230 21457 1401 1663 --
NM_006315chr4124315 3923 3454 3445 3341 3323 2854 1484 1387 1141 367 108 13469 22882 344 1426
NM_006324chr161195 ------
NM_006333chr25638 438 142 118 94 ------
NM_006339chr192536 145 ------
NM_006343chr21359 ------
NM_006371chr3115310 5300 5127 4663 4415 4321 1974 1800 1504 1280 693 --21704 812 --
NM_006375chrX61769 1450 668 437 249 106 ----11780
NM_006380chr1794339 4235 4056 3922 1691 1591 1505 977 324 34395 2720 770 ----
NM_006386chr2262432 2022 687 530 518 453 1714 1418 1985
NM_006415chr94520 480 282 259 ------
NM_006416chr61710 ------
NM_006429chr21128 ------
NM_006451chr541093 781 440 313 ----11064
NM_006457chr4143991 3960 3900 3183 3144 3038 2970 2947 1549 1085 397 269 128 76 33077 1542 287 ----
NM_006460chr17101712 1604 1195 1154 1137 720 476 363 342 144 --11274 --
NM_006467chr592306 2241 1891 1651 1542 1501 787 661 594 21606 687 ----
NM_006482chr12103897 3796 3315 2929 2830 2725 1557 1345 1185 194 43391 2775 2543 461 1746 --
NM_006489chr14101975 1899 1851 1521 1397 674 579 491 485 346 --21590 742 21457 358
NM_006496chr131487 599 260 --1399 --
NM_006504chr1092971 2655 992 560 416 299 262 161 154 --22754 1076 11153
NM_006517chrX32322 2276 198 --1177 --
NM_006520chrX91354 1205 1064 651 441 236 204 138 94 21152 621 1639 --
NM_006526chr2072204 2118 1908 1382 874 273 64 11461 21632 423 --
NM_006527chr43508 216 199 1542 --1132
NM_006529chr461352 1170 1069 607 545 366 --1585 11123
NM_006534chr20103293 3258 2732 2466 2372 1225 1065 961 930 348 12292 1503 --
NM_006538chr274107 3816 2804 2655 1210 777 683 21639 565 11563 --
NM_006544chr14245997 5683 5669 5284 5266 5154 5104 4907 4650 4577 4530 4130 4077 3884 3850 3836 1657 1410 1382 1151 997 856 714 223 24931 1439 35048 2070 1453 11229
NM_006547chr7102134 1931 1619 1603 789 668 521 438 392 382 11778 21488 369 --
NM_006549chr1242886 1060 576 446 ------
NM_006559chr191183 1158 1069 981 877 393 267 209 109 21105 225 1815 --
NM_006561chr10116248 6089 5561 4752 2052 1971 1912 1902 1764 964 229 45345 4522 800 618 11549 --
NM_006572chr17153530 3450 3108 2832 2703 2609 2603 2542 2510 2394 2304 1185 844 577 355 22256 298 1319 --
NM_006575chr1441052 545 401 345 ------
NM_006577chr261137 1117 1093 1020 477 471 ------
NM_006590chr21455 ------
NM_006595chr1192059 2027 1786 1769 1387 815 621 105 57 ------
NM_006597chr111217 --161 --
NM_006599chr16218206 7897 7119 6623 6610 6442 6249 5875 5351 5297 5015 3146 3059 2768 2537 2093 1176 1103 788 311 127 44998 2758 1811 757 25256 2982 --
NM_006602chr202844 612 ------
NM_006603chrX5528 374 343 170 43 11239 21704 487 --
NM_006609chr282963 2945 2864 2815 2694 2522 1869 147 --1175 --
NM_006614chr383480 3327 3108 2470 2393 639 526 272 13374 3828 716 514 --
NM_006620chr6134884 4598 4592 4376 4243 4203 3847 3140 1334 1029 769 610 301 64573 4052 4003 3998 3939 899 1182 --
NM_006624chr1082120 1430 714 570 518 370 222 152 ----11573
NM_006628chr15124440 4063 3753 3307 3124 3100 1864 1450 1076 700 471 32 21560 1529 34632 4340 1518 --
NM_006629chr1882501 2412 2177 1023 974 960 877 609 ----1831
NM_006646chr13113061 2972 2775 2530 2513 2407 2351 2195 1159 578 472 33041 2501 2303 ----
NM_006654chr12114793 4535 4503 4045 3926 3852 1571 788 414 322 121 21739 1424 11101 --
NM_006682chr772889 2664 2264 2041 1859 1830 249 22629 2355 ----
NM_006690chr2032373 2362 688 ------
NM_006699chr182555 2430 2364 1893 1885 1016 900 644 32439 1835 1022 32076 998 565 --
NM_006726chr461209 1186 1047 473 91 80 2990 489 11238 --
NM_006729chrX85233 5134 4664 3863 1261 1155 861 345 11267 15256 --
NM_006731chr9225698 5667 5601 4981 4649 4457 4213 4104 4022 3812 3805 3680 3541 1819 1524 1423 1116 1050 958 708 643 218 1564 64596 4370 4098 3761 1834 900 --
NM_006750chr16177431 6991 6622 6548 6062 5719 5646 5627 5408 5133 5008 2253 1954 1095 804 655 539 37390 2971 1843 ----
NM_006763chr1193 ------
NM_006766chr882571 2398 1676 1641 1062 408 111 31 22709 344 ----
NM_006772chr61578 ------
NM_006777chrX152889 2776 2618 2277 2214 2140 2134 2089 1096 980 923 599 454 297 276 --1383 12481
NM_006832chr1451083 817 792 229 201 ----1865
NM_006851chr1292888 2872 2286 2215 1014 655 514 368 256 12590 --22583 1855
NM_006873chr283231 2821 2444 1026 896 789 782 99 33171 2467 535 22852 1295 --
NM_006884chr341952 1451 1436 589 11873 11710 --
NM_006885chr16144183 3789 3776 3754 3290 3023 2840 1544 1010 900 863 804 428 33 23763 3401 ----
NM_006915chrX72451 2392 2380 2284 555 315 134 32438 672 186 12108 11669
NM_006918chr11195786 5578 4902 4853 4816 4668 4550 4398 4301 4272 4249 4216 3842 3685 3609 1406 846 659 295 45684 4512 4255 313 34328 2088 1302 --
NM_006920chr272028 1845 1598 1564 1394 825 627 31634 1614 721 21836 1751 --
NM_006922chr292579 2405 2133 1995 1850 1640 988 901 585 12610 1728 --
NM_006924chr17174470 4264 4251 4024 3167 3153 3132 3089 2995 1234 1071 1050 857 821 216 179 118 34277 1497 1116 44050 3985 3961 3544 --
NM_006925chr141195 --1417 --
NM_006930chr551603 1585 1566 1291 435 21547 404 1412 --
NM_006947chr471627 1455 1365 563 547 510 445 1401 ----
NM_006948chr2172397 1980 1868 1764 1520 941 626 --1370 --
NM_006955chr1093027 2908 2841 2724 2559 1116 900 255 91 1940 ----
NM_007006chr16113512 3312 2781 2548 2353 2178 1225 998 499 426 169 22648 2379 1121 13250
NM_007007chr12144181 3932 3919 3717 3699 3610 3510 3214 3059 2978 1491 1059 727 140 44158 4153 1601 599 ----
NM_007010chr1771751 1575 1458 1195 719 545 334 --11900 --
NM_007011chr15126743 6309 5096 4773 2584 2562 2432 2119 1313 1016 768 323 --12758 --
NM_007013chr86836 801 665 223 101 39 ----11042
NM_007017chr54905 841 776 637 --2820 747 --
NM_007023chr241108 851 698 394 ------
NM_007036chr54935 233 225 206 ----182
NM_007038chr21126123 5687 5590 5198 4090 3949 1976 1832 1390 1272 1252 689 11884 32382 2358 1502 --
NM_007054chr5113980 3923 3339 2951 2636 2589 1082 938 767 718 687 43730 3650 1591 1576 21006 851 --
NM_007068chr2241001 986 193 137 ------
NM_007084chr1351571 1439 1343 1090 207 11523 1989 --
NM_007106chr1382715 2664 2502 2187 1926 1890 935 534 12062 12559 1124
NM_007114chr393295 2916 972 780 716 518 503 78 32 32494 2191 171 ----
NM_007115chr22338 106 ------
NM_007120chr24738 728 154 79 2721 118 1639 1280
NM_007124chr682018 1886 1755 725 586 578 527 81 1240 ----
NM_007125chrY91393 1383 1293 1190 1079 968 526 401 22 1310 ----
NM_007146chr1762809 2714 1091 1012 891 421 ------
NM_007157chrX122995 2920 2568 2226 2103 1175 852 748 253 234 146 73 ------
NM_007159chr361671 1311 1271 1167 320 264 2245 147 21466 343 --
NM_007170chr11756 ------
NM_007172chr22103258 3223 3203 2739 2499 1203 936 547 275 159 12653 ----
NM_007175chr893537 3504 3115 2627 2514 2306 1060 1043 139 ------
NM_007195chr1873574 3488 3335 3314 409 279 151 22977 693 22528 879 --
NM_007212chr182034 1739 1704 1670 1447 729 677 390 21724 1650 22117 1748 --
NM_007218chr83748 634 205 ------
NM_007222chr871785 1563 1278 1206 293 246 65 ------
NM_007231chrX52166 1961 847 207 85 1937 --11543
NM_007249chr13239378 9359 9297 9214 9028 8937 8894 7228 7179 6784 3661 3318 3220 3013 2725 2542 2525 2377 1825 1301 584 380 70 27717 2637 --17397
NM_007292chr1794939 4759 2007 1698 1507 1142 1080 158 106 13982 34737 4630 687 --
NM_007373chr1081712 1418 1374 1143 465 287 193 168 11546 1207 --
NM_012081chr5103433 2930 2872 2667 2569 2547 2425 599 551 463 21324 1294 175 --
NM_012082chr85873 846 812 713 625 186 ----
NM_012095chr1093535 2757 2327 1148 1104 1031 999 932 363 --12395 --
NM_012096chr393532 3475 3275 2905 1158 1029 971 489 427 1798 ----
NM_012097chr262225 1619 1519 866 303 26 31746 872 208 --1860
NM_012104chr1153779 3319 854 816 315 1538 22544 555 --
NM_012104chr1153779 3319 854 816 315 1538 22544 555 --
NM_012115chr62434 73 ------
NM_012120chr662598 2222 781 267 156 89 --22529 2344 --
NM_012124chr116938 903 800 729 721 105 1587 ----
NM_012129chr7102370 2007 1755 1748 1653 674 618 194 186 179 --12425 --
NM_012137chr182778 2566 2463 2372 2087 1897 881 208 2246 214 3747 459 138 12291
NM_012141chr1394160 3835 3674 3205 2583 1399 1280 1054 455 34020 3828 2882 11668 1755
NM_012164chr9137458 6559 5615 4753 4668 2330 2137 1970 1242 1092 947 573 320 17522 ----
NM_012176chr51275 ------
NM_012193chr1195387 5304 4989 4507 3638 3343 979 692 412 --55317 5023 3646 863 302 13714
NM_012198chr28826 814 747 634 325 297 264 38 ------
NM_012210chr941410 1075 1026 337 --1191 --
NM_012214chr2136425 6235 6193 5965 5495 4804 1982 1960 794 542 493 304 36 45303 1253 919 394 24436 4248 12090
NM_012224chr481219 1171 1135 465 242 216 204 47 ------
NM_012234chr383740 3719 3591 3406 3177 941 424 259 53153 2785 2474 2383 871 ----
NM_012238chr1051579 1094 292 230 137 21600 379 11499 11338
NM_012243chr18961 862 833 706 647 363 349 108 1807 1611 --
NM_012247chr102816 37 ------
NM_012249chr2103073 3045 2935 2843 2722 1183 933 727 581 417 32983 2372 1078 23363 3343 --
NM_012252chr7155379 4992 4874 4425 4181 4011 3858 3673 3566 3433 2075 1844 1197 1032 241 31237 523 183 15005 --
NM_012257chr72790 338 --11036 --
NM_012262chr1103561 1987 1810 1774 1512 1350 759 606 577 298 23743 365 33232 428 183 --
NM_012272chr121455 ------
NM_012281chr732449 1690 726 ------
NM_012287chr394031 3360 3173 1766 1713 1677 1627 1017 668 43007 2809 1079 152 43856 3243 1132 257 --
NM_012290chr291700 1425 1159 1050 670 503 339 58 34 --11204 --
NM_012300chr582461 2454 2370 2339 2124 2024 505 284 12251 --22139 1831
NM_012307chr181724 ------
NM_012309chr1195011 4257 3382 3237 3124 1860 1693 371 72 44994 3520 3091 3020 --13482
NM_012329chr1751502 558 500 476 237 21455 198 --1317
NM_012334chr543292 2896 1288 1127 21031 981 34584 4443 4052 --
NM_012338chr761140 1010 772 464 395 53 1470 ----
NM_012342chr103391 184 174 ------
NM_012347chr662936 596 266 255 198 167 139 12153 170
NM_012382chr5144451 4434 4287 4067 3877 3221 3112 3032 2964 1722 976 925 762 258 44030 3150 1464 186 23999 3617 --
NM_012412chr75764 590 341 332 98 1541 ----
NM_012425chr1072761 2715 2621 1916 630 348 158 22657 2134 --1695
NM_012434chr671696 1645 1627 1143 1114 341 119 --11374 --
NM_012443chr105912 226 85 72 62 --2137 97 1348
NM_012464chr492812 2376 2342 2146 1876 1843 848 728 684 42897 2884 2555 2390 ----
NM_012474chr11198 ------
NM_013229chr1282819 2121 1921 1043 476 444 45 36 22695 1848 ----
NM_013238chr1341307 512 443 195 11841 1269 11608
NM_013250chr1151502 1001 479 124 62 ------
NM_013255chr7228519 8127 7767 7679 7522 7490 7440 6822 6623 5895 5793 5689 3476 2827 2428 2187 2067 2007 1912 1867 1807 238 46556 6416 2556 2418 22029 1882 23275 200
NM_013261chr463744 2764 2743 2553 2441 1094 22667 535 33522 2611 1191 --
NM_013281chr2081473 1408 1380 1011 515 460 452 338 --11206 --
NM_013283chr54824 693 263 34 1251 ----
NM_013309chr15102463 2427 2062 1875 1863 1617 730 697 527 76 --1392 --
NM_013322chr761428 1366 678 331 310 119 ------
NM_013354chr82205 145 1989 --1331
NM_013372chr1593224 3006 2951 2936 2726 2631 2566 2197 502 13407 12136 1552
NM_013374chr363045 2296 2221 2011 377 115 2568 471 --12888
NM_013377chr123639 432 120 1677 ----
NM_013381chr1282359 2194 1915 1884 1763 1757 1569 866 22021 1623 41964 1723 1681 848 --
NM_013386chr181786 1666 1301 534 426 417 381 266 1676 --1161
NM_013390chr921667 1610 11728 --11780
NM_013437chr871305 1286 1167 925 420 336 146 ------
NM_013444chrX3847 110 57 ------
NM_013943chr1103031 2815 2759 2549 2445 2186 1228 1010 770 610 ----11159
NM_013986chr222337 67 ------
NM_013989chr14124727 3967 3925 3360 3230 1867 1738 1436 1147 933 346 68 --21973 1807 --
NM_013995chrX82231 2055 1938 958 831 719 536 249 1270 12442 --
NM_014011chr2122619 2559 2532 2462 2370 2354 2082 1859 1844 761 687 610 --42584 1625 1041 976 --
NM_014016chr361529 1275 1182 1138 268 202 --21691 244 --
NM_014021chr193450 2552 2463 1375 902 751 467 396 160 23504 3479 53295 2904 2816 2405 56 --
NM_014028chr693138 3117 3055 2947 2830 2399 833 802 136 2769 759 13260 23223 1058
NM_014031chr53343 257 229 ------
NM_014033chr1282335 2315 1995 1985 1749 759 72 26 --11679 12023
NM_014035chr571438 1351 1316 1268 1201 506 361 21048 538 ----
NM_014038chr72275 171 ------
NM_014043chr381475 1110 607 578 476 340 322 308 1639 ----
NM_014044chr21177 ------
NM_014048chr1681865 1602 1395 756 642 383 358 187 22057 1534 ----
NM_014057chr961649 1609 1042 528 428 180 ------
NM_014071chr202503 80 ------
NM_014112chr8124215 4043 3770 3599 1269 1254 1143 1113 1020 728 426 26 --1438 --
NM_014153chr162635 514 ------
NM_014155chr11177179 6506 6351 6268 5874 5537 5384 4898 2844 2800 2093 2049 1929 1891 1569 1308 337 56841 6836 4787 4678 2148 22022 1558 16989
NM_014170chr34427 369 95 65 ------
NM_014175chr81154 ------
NM_014182chr121634 ------
NM_014217chr181913 1735 1642 1582 1489 1358 385 86 ------
NM_014223chr12700 275 ------
NM_014250chr2252061 1628 1432 555 105 ------
NM_014263chr1061241 1218 1106 924 424 278 11112 1320 --
NM_014264chr47636 629 600 572 558 185 27 1530 ----
NM_014296chr361641 1017 493 362 187 107 21174 1062 --1389
NM_014300chr151455 ------
NM_014309chr2265442 4725 4694 3767 416 185 25352 3702 14517 11765
NM_014329chr161336 ------
NM_014331chr4237837 7825 7722 7684 7527 7072 6916 6579 6508 6165 5948 5682 5470 5087 4825 2853 2498 2419 2311 2081 1020 991 799 35966 5439 3082 26762 5105 15834
NM_014345chr61834 ------
NM_014372chr1102103 1730 1707 1664 1623 832 825 545 357 309 21691 713 22096 1900 --
NM_014382chr371798 1685 1354 630 410 360 208 --21540 1093 --
NM_014394chr1051164 836 464 130 68 ------
NM_014405chr1712378 ------
NM_014415chr331517 1152 513 21097 284 41645 1376 1082 310 11124
NM_014421chr472131 1700 1674 1575 827 795 163 1169 11527 --
NM_014423chr5195652 5344 4476 4012 3932 3695 3623 1941 1544 1439 1426 1129 621 398 371 324 293 215 205 45125 4262 3730 905 25632 5409 --
NM_014445chr3102221 2048 1942 1775 1763 1724 926 567 283 39 1387 31636 1534 348 --
NM_014454chr651082 1044 919 701 316 1717 ----
NM_014495chr17654 619 601 442 221 108 80 ----1265
NM_014496chrX146 ----196
NM_014500chrX1245 ------
NM_014547chr151734 ------
NM_014547chr151734 ------
NM_014585chr23315 228 151 --2463 256 135
NM_014587chr161635 ------
NM_014606chr471561 1408 1317 1215 1083 121 103 --11454 --
NM_014607chr252151 1748 1388 728 500 --1521 --
NM_014616chr373327 2475 1010 960 860 611 394 31253 780 410 32732 1332 1079 --
NM_014630chr1522956 1573 11588 33804 1047 206 13168
NM_014635chr271755 1558 1180 1158 594 321 263 --1339 1701
NM_014636chr9114382 4341 4109 4069 3979 3720 3528 3491 3219 2960 702 1603 21430 645 --
NM_014637chr8101446 1297 1245 1218 1145 1049 555 493 327 280 1920 1160 --
NM_014647chr1632107 2030 1459 1875 ----
NM_014671chr751601 1358 1280 1169 154 11347 ----
NM_014674chr383726 3335 3235 3038 2986 2938 1035 323 23919 1109 11560 --
NM_014676chr181651 1253 1137 1114 620 509 499 176 ------
NM_014679chr1191418 1404 1139 1046 944 918 408 349 186 11285 ----
NM_014682chr862193 1955 942 701 574 413 1756 12152 --
NM_014686chr1911014 ------
NM_014701chr15173406 3392 3333 3312 2940 2895 2759 2720 2639 2580 2364 2325 1256 468 446 279 179 32621 2381 624 ----
NM_014702chr6173435 3140 2721 2435 2359 2341 1261 915 897 886 864 828 820 765 663 580 230 12133 12499 11037
NM_014705chr7132142 2128 2037 2026 1935 1871 1661 754 637 626 363 190 138 --1206 1719
NM_014707chr772144 2095 2079 1460 617 585 247 21655 626 ----
NM_014711chr1672058 1524 1414 390 359 345 238 ------
NM_014713chr22550 384 ------
NM_014720chr1071688 1565 1423 1132 514 351 340 --2639 386 --
NM_014721chr6177195 7073 6720 6632 6198 6170 5985 5759 5696 5667 5326 5233 5135 2063 766 670 645 1361 37258 6082 1162 12349
NM_014729chr852005 1795 1778 523 380 --1471 1845
NM_014733chr571795 1599 1409 730 644 284 173 --11937 --
NM_014751chr861917 1330 670 498 470 309 12049 --12203
NM_014754chr81957 ------
NM_014755chr284241 3916 3656 3595 3027 363 329 313 23628 3057 ----
NM_014764chr12----11158 1904
NM_014765chr192558 2516 2119 1992 1835 810 660 626 579 1979 2905 872 --
NM_014766chr763814 3645 2584 976 966 759 12947 --153
NM_014774chr173278 3139 2715 2380 1284 453 366 1379 31319 948 857 12566
NM_014781chr871232 1112 1075 831 361 332 175 21217 449 11289 1198
NM_014787chr162787 2107 1995 994 805 763 31129 136 125 1412 12270
NM_014797chr6133237 2986 2968 2862 2316 2213 1329 1271 1005 754 711 477 313 11292 4908 799 792 687 12459
NM_014803chr10102769 2647 2388 1942 1830 1143 669 596 499 385 22950 2465 1772 --
NM_014812chr182001 1556 1464 1297 593 368 343 266 --11603 --
NM_014819chr562427 2015 1785 592 335 193 12165 2155 60 1727
NM_014820chr352078 1827 484 431 245 31778 663 405 11442 --
NM_014826chr194067 3900 3811 3766 2825 1109 563 536 294 2499 220 11582 --
NM_014828chr1472488 2268 2101 1928 1646 1548 801 12550 22345 178 --
NM_014829chr581778 1755 961 865 748 254 123 98 --12385 --
NM_014873chr1123557 3527 3424 3414 3366 3090 1834 1803 1722 989 945 707 --13290 14118
NM_014877chr17197439 6643 6314 5885 5820 4863 2911 2510 2348 2106 1243 1210 1197 844 504 470 460 240 113 26463 2244 --17203
NM_014888chr791459 1375 1333 1231 1188 1148 1110 300 270 21515 436 ----
NM_014893chrY72330 2230 1972 1853 1773 1543 1519 ------
NM_014897chr1762774 2177 1280 789 258 134 --22627 2074 13087
NM_014899chr562944 2669 2292 2145 1229 1219 22233 311 13128 --
NM_014903chr1231751 865 149 --21972 172 12457
NM_014904chr10113108 2977 2576 1464 1301 926 832 338 206 198 189 22997 843 11405 12597
NM_014906chr1753997 3634 2946 279 127 43850 3545 3100 2649 11535 23417 429
NM_014909chr1412732 ------
NM_014910chr196843 750 706 675 663 194 --3630 618 544 --
NM_014923chr1362096 1681 1628 765 734 617 ------
NM_014934chr13183954 3707 3660 3484 3437 3118 3024 2954 1399 1162 1151 843 750 685 651 510 453 327 23395 362 1870 --
NM_014939chr1861571 1525 1464 1457 430 292 --1395 --
NM_014946chr293023 2825 2605 2590 1931 1245 537 506 480 13078 21050 94 42710 2575 2117 246
NM_014950chr1461602 1587 1579 1353 1267 445 11635 ----
NM_014951chr1062425 2313 2282 2211 649 240 12624 12154 --
NM_014962chr2072907 2770 2716 1052 731 723 336 11987 1560 --
NM_014978chr1011682 ------
NM_014982chr14195433 4845 4481 4401 3813 3759 3588 3460 3437 3406 3318 1356 1327 1262 1196 1160 640 511 311 1219 22066 1934 24597 3507
NM_014988chr472316 1899 934 633 460 331 251 1612 22236 711 1874
NM_014990chr146925 880 454 440 319 309 21260 351 --11067
NM_014991chr4103256 3191 3060 2846 2779 2531 2099 1096 570 453 12785 ----
NM_014997chr782628 2465 2120 884 844 495 335 147 --12049 --
NM_015000chr12123096 3043 2756 2695 2687 2549 2439 2390 2361 917 853 439 22506 2489 22917 2077 --
NM_015002chr1282217 2131 2063 2005 1673 805 632 574 1212 1147 --
NM_015008chr373608 3093 3048 2340 925 680 178 --2469 311 --
NM_015017chr121109 200 ------
NM_015025chr262713 2658 2258 348 323 102 1769 --12489
NM_015026chr12154505 4400 4111 4047 3761 3171 1771 1696 1474 1351 697 572 547 189 127 73984 3411 3401 3250 1636 985 218 11643 13281
NM_015027chr1641422 1338 692 323 21288 96 --1235
NM_015032chr13102905 2748 2282 2205 2045 1804 1161 1133 506 80 22846 2705 2782 577 --
NM_015045chr1082132 1894 1408 864 843 535 256 174 11663 ----
NM_015049chr2113332 2334 2254 2196 2187 2151 1281 824 784 696 296 32924 1067 518 --12771
NM_015051chr953243 2335 768 720 244 33065 711 460 1967 --
NM_015056chr2172300 2088 1808 983 323 108 98 22350 56 22177 424 --
NM_015068chr793808 3408 3390 3177 2915 2707 2644 484 282 33771 3734 2832 43204 2978 2611 81 1347
NM_015071chr586238 5972 4763 2374 2232 2049 1637 282 46538 1748 1648 970 ----
NM_015076chr694082 3734 2956 1494 1464 1229 782 734 631 34507 4095 1343 ----
NM_015087chr1362354 1843 1058 137 104 59 1639 ----
NM_015092chr16124463 4355 4090 3870 3515 3090 2932 1809 1380 1358 1280 550 31198 1108 699 11419 13201
NM_015093chr631565 1191 138 11858 1340 --
NM_015097chr372192 1744 1735 1450 476 336 327 12065 ----
NM_015110chr972307 1793 669 400 125 70 42 11815 --11606
NM_015115chr4102950 2556 2039 933 847 644 270 226 145 65 12520 22770 2464 12736
NM_015124chr2222511 2325 12495 ----
NM_015130chr4101382 1207 1131 1091 1032 931 447 392 355 245 194 ----
NM_015132chr741307 775 372 203 1122 --1569
NM_015134chr171655 ------
NM_015137chr8122602 2430 2362 2287 2222 929 807 629 435 354 242 196 22066 1823 ----
NM_015144chr1673999 3900 3503 1304 731 356 57 --21255 188 --
NM_015155chr1073302 2907 1292 1195 1112 704 323 22755 1120 --1355
NM_015156chr14134025 3753 3696 3502 3231 3199 2712 2630 1002 839 622 608 485 12638 ----
NM_015170chr862130 2111 1919 1712 1684 416 12049 ----
NM_015176chr161662 1442 1396 408 357 208 21595 284 --11373
NM_015199chr352972 2959 2358 913 563 21082 498 31981 381 350 --
NM_015200chr462505 2099 2054 1666 499 324 --12498 22031 468
NM_015206chr15113228 3213 3145 3107 2957 2936 1491 1451 1308 1228 1194 1354 13008 --
NM_015208chr18123729 3413 3250 2968 2794 2571 1534 1068 1050 701 467 319 31523 1382 1331 12531 --
NM_015209chr132334 2065 739 12175 --1838
NM_015215chr1103165 3134 3042 3022 2553 2260 1141 1079 970 475 13192 22792 2424 --
NM_015216chr581474 1411 1301 1196 1187 1008 569 99 1470 1392 --
NM_015225chr993099 2921 2517 2128 1032 911 838 639 521 23116 366 1124 --
NM_015230chr471513 1431 1209 549 474 355 174 21525 416 31758 1326 1201 --
NM_015235chr1062150 1556 1357 873 808 320 31903 1768 217 ----
NM_015245chr621994 1032 --12437 32772 2627 967
NM_015247chr16155343 5163 4646 4353 4015 3729 1733 1472 1197 966 937 851 790 585 237 21383 267 13679 --
NM_015251chr1662327 2283 1812 1768 1681 1450 --21647 209 12221
NM_015271chr4124077 4020 3799 3727 3624 3180 2687 1472 1193 508 214 137 23792 516 23120 3091 --
NM_015275chr1272016 1859 1821 1710 827 670 86 41815 1689 1420 789 ----
NM_015278chr663474 3238 2639 2565 2335 1224 1197 ----
NM_015285chr1862568 2541 2272 1857 1643 702 22478 476 --144
NM_015310chr8128330 8283 8092 7601 5683 5438 3147 2030 1952 1650 895 410 46350 1613 1124 261 32943 2584 1869 12004
NM_015313chr11124386 3940 3502 3139 3094 1798 1529 1414 1057 866 758 314 23838 3214 11745 --
NM_015317chr2132873 2743 2617 2359 2102 1891 1042 947 762 723 531 308 147 42809 197 190 65 ----
NM_015335chr1282610 2392 2164 2105 2035 1882 1870 976 32685 2677 2045 12426 12200
NM_015336chr1272159 1930 987 921 445 387 127 42662 2643 2439 795 1369 --
NM_015347chr1282897 2872 2757 2635 967 787 740 166 --2627 208 --
NM_015349chr6112868 2777 2663 2587 2426 2398 2376 1985 789 723 572 12788 ----
NM_015358chr2181169 883 525 497 454 441 377 193 ------
NM_015359chr862878 2395 2009 1174 591 258 12523 --12088
NM_015365chrX114202 3613 3544 3509 2993 2971 2862 2620 1624 1252 1077 33574 2748 1575 11728 13909
NM_015378chr1102587 2450 2169 1168 1117 810 697 429 276 233 2720 201 ----
NM_015384chr5139 ------
NM_015387chr282061 1892 1749 1686 1300 569 535 208 31719 676 162 --11711
NM_015431chr193503 2558 2325 1380 1244 1226 680 373 230 --176 --
NM_015436chr4153365 3351 3216 3129 3121 3086 2706 2541 1339 1073 819 494 487 444 416 43207 2973 2757 2213 ----
NM_015439chr62513 465 ------
NM_015446chr191645 1623 1417 1404 673 312 247 108 65 2510 99 ----
NM_015455chr5164147 4133 3861 3754 3604 3183 3094 3072 2911 2567 1393 1219 850 812 743 665 23104 1332 3951 539 440 --
NM_015458chr8125355 5334 5304 5200 4744 4428 3523 3439 3294 2073 748 662 34722 3786 606 --13852
NM_015464chr73881 749 229 ------
NM_015507chrX3451 409 172 ------
NM_015523chr111263 ------
NM_015525chr6111003 983 961 823 410 394 257 238 172 141 102 1108 ----
NM_015550chr782395 2382 1280 1239 985 730 485 332 12480 ----
NM_015554chr1552735 2462 2385 2361 959 32306 1100 604 1890 --
NM_015560chr382923 2592 2112 2097 1034 960 907 458 ------
NM_015564chr583359 831 711 602 186 162 116 63 ----23209 2175
NM_015565chr2192276 2089 2014 1765 717 698 636 178 108 2489 467 --1301
NM_015569chr1114399 4095 4019 3754 3646 3532 3514 1937 1832 1719 703 44862 3624 2984 39 11267 --
NM_015571chr672601 2466 1023 850 740 460 41 32275 1871 961 --12509
NM_015576chr382927 2235 2019 1009 518 393 340 57 1502 1789 --
NM_015578chr1961976 1928 1331 215 93 32 --1337 --
NM_015599chr61314 ------
NM_015602chr171810 1698 1447 1407 1283 398 354 --1366 --
NM_015610chr752516 758 563 213 199 ------
NM_015640chr1185379 5046 4811 4727 4572 3725 3659 3635 3521 3389 3243 2055 1818 1213 894 741 609 413 11336 45213 1192 1183 138 --
NM_015670chr171128 ------
NM_015677chr25653 640 400 180 89 ------
NM_015695chr621874 1380 ----11641
NM_015704chr221123 ------
NM_015725chr191512 ------
NM_015844chr184988 864 800 224 ------
NM_015845chr183766 642 578 ------
NM_015846chr184988 864 800 224 ------
NM_015847chr184988 864 800 224 ------
NM_015852chr753320 3103 2675 1420 1259 32863 2788 2387 ----
NM_015855chr111640 ------
NM_015878chr882184 2150 1610 1550 678 561 462 315 ----12064
NM_015879chr18238628 8613 8117 7730 7703 7090 6869 6849 6783 6431 5938 5828 3038 2920 2570 2292 2274 2229 2133 2053 1777 1461 566 18111 21562 892 --
NM_015886chr8145524 5381 5239 5106 4631 4024 4010 3941 3839 2233 1842 1760 1646 655 65009 4304 4135 3824 2307 140 44875 4077 2152 2133 35307 4601 221
NM_015888chr1123337 3207 3063 3055 2660 2301 2285 2103 1166 1118 1103 307 22873 2243 12320 --
NM_015891chr682070 1985 1710 1658 728 425 144 69 11895 ----
NM_015902chr84935 864 581 52 ------
NM_015906chr1174615 4459 4207 4154 3795 3534 3301 3250 3182 3145 3104 3077 2924 846 574 380 156 44845 4792 4105 1226 14289 --
NM_015907chr4137 ------
NM_015942chr8171 ------
NM_015948chr61390 ------
NM_015976chr14330 301 288 261 ------
NM_016003chr752516 758 563 213 199 ------
NM_016004chr201209 ------
NM_016006chr32246 231 ------
NM_016009chr1124548 4095 4039 3829 888 868 670 620 606 480 350 63 11854 14556 --
NM_016018chr8142755 2548 2528 2357 2343 2204 2060 1955 1903 1040 775 749 424 75 22461 2288 32336 2130 1125 --
NM_016021chr6102615 2406 2202 1195 868 776 718 345 286 133 ----12010
NM_016023chr892107 1946 1627 1573 1342 663 628 208 80 12219 ----
NM_016037chr131101 385 158 --1116 --
NM_016040chr182767 2038 1881 1712 811 794 301 233 1419 12334 12319
NM_016045chr20121750 1689 1639 1551 1536 1465 1417 1220 534 302 172 124 31824 1597 1399 ----
NM_016048chr55945 931 730 619 336 ------
NM_016072chr12112335 2039 1893 1517 1476 909 841 724 601 563 449 2945 83 1667 1657
NM_016073chr1541080 791 453 362 1370 --11132
NM_016075chr13143123 2983 2973 2838 2812 2542 2344 2270 2089 2068 994 924 213 147 1364 --12802
NM_016083chr6153795 3530 3409 3296 3247 3106 3081 2757 2746 2737 2603 2466 2435 1580 984 23816 2482 11307 13975
NM_016098chr63500 186 103 ------
NM_016100chr203356 150 35 ------
NM_016120chrX41205 343 232 93 --1113 1396
NM_016125chr175612 523 493 480 155 ------
NM_016131chr252373 2164 2149 905 233 11957 ----
NM_016132chr15122762 2386 2118 1235 1210 1036 488 454 447 343 219 44 43448 3086 747 438 11023 --
NM_016138chr1641868 1705 1339 107 31750 1209 121 11184 11517
NM_016147chr111744 ------
NM_016157chrX181 ------
NM_016179chr13175 ------
NM_016206chr3248848 8443 8315 8199 8191 8147 7905 6913 6842 6389 5993 5876 5461 5447 5438 3185 3141 2051 1963 1404 1347 1299 1226 26 36581 1417 713 45595 2942 2332 281 --
NM_016221chr562263 861 631 525 462 383 12055 41480 1458 951 549 12188
NM_016248chr1374024 3268 3190 3073 2459 924 474 22999 1582 12637 --
NM_016255chr6133101 3040 2880 2597 2165 1339 1289 1050 936 812 771 758 191 1727 --142
NM_016257chr163388 3249 3038 3008 978 882 ------
NM_016260chr2177536 7291 7159 6613 5596 5352 5284 5249 5225 5047 5010 2345 2031 1898 1765 1197 859 --26454 2416 16553
NM_016262chr61581 ------
NM_016263chr191157 ------
NM_016271chr1862176 2007 727 486 458 291 1177 22263 782 --
NM_016275chr3142656 2120 2112 1838 1107 1061 1048 815 753 726 692 646 579 383 12260 ----
NM_016277chr661306 462 425 321 292 132 129 ----
NM_016304chr155586 248 185 168 98 ----169
NM_016306chr31366 ------
NM_016308chr1102074 1697 1488 1447 1344 515 408 389 187 144 12016 1807 11834
NM_016315chr291912 1321 719 654 574 387 243 140 34 21277 1272 11479 --
NM_016322chr9103161 2630 2251 2067 1274 1185 721 496 424 171 12103 --12098
NM_016328chr71146 ------
NM_016338chr521247 379 ------
NM_016353chr8122480 2440 2300 2143 2118 1936 903 871 749 549 223 133 32061 1000 837 ----
NM_016356chr6112672 2325 2107 2042 1126 639 347 325 231 165 86 1856 11151 --
NM_016357chr126954 455 415 210 187 28 ------
NM_016396chr1562926 2791 2596 2436 670 382 1506 ----
NM_016422chr11133041 2956 2886 2736 2721 2663 2285 2204 2163 2104 2013 753 268 22300 931 22903 821 1837
NM_016442chr572129 2005 1490 680 443 353 34 1459 --11855
NM_016448chr161886 1811 1508 613 239 224 21388 284 ----
NM_016472chr1441482 1103 583 395 1555 1335 --
NM_016485chr692184 1963 1478 871 863 848 679 546 518 1771 1197 1434
NM_016488chr1271792 1619 1340 1260 619 388 265 31971 1857 1589 ----
NM_016507chr1793212 3162 2696 2501 2316 2101 1987 426 64 1636 ----
NM_016519chr42537 420 ------
NM_016530chr15144082 3783 3622 3353 3286 3192 3117 2865 2699 1484 1057 1002 643 509 ------
NM_016531chr4123780 3698 3531 3258 3113 2950 2765 2721 1563 1489 568 120 --32892 1535 129 --
NM_016532chr171197 ------
NM_016536chr192321 23 ----1312
NM_016542chrX51775 1635 1595 1502 507 2383 281 11167 --
NM_016562chrX61688 1535 1422 1039 307 58 11611 ----
NM_016603chr582267 1925 1897 1888 1633 903 706 83 --1401 --
NM_016604chr511221 ------
NM_016613chr462774 2166 1083 890 752 62 22252 1032 1294 --
NM_016618chr2132 ------
NM_016620chr171474 1192 1047 536 473 45 34 2124 78 1451 --
NM_016640chr53260 89 39 ------
NM_016824chr1071944 1921 1743 1564 201 67 53 ----1283
NM_016831chr172289 2091 1697 852 696 232 80 1306 22340 2322 --
NM_016931chr111354 ------
NM_016952chr1174030 3424 3301 2668 2545 1090 186 1944 ----
NM_017412chr841230 1150 470 305 ------
NM_017420chr14153848 3187 3169 3090 2967 1488 1271 1124 1115 1099 959 681 223 211 135 21203 327 ----
NM_017423chr4112173 2096 2058 1893 1887 1650 1596 1569 652 526 44 21828 1460 ----
NM_017447chr2193904 3390 1648 1520 1404 1218 1163 257 108 33240 3195 1701 11282 12717
NM_017452chr201958 --11357 --
NM_017453chr201958 --11357 --
NM_017454chr201958 --11357 --
NM_017514chrX1942 ------
NM_017563chr3106394 6074 5300 5248 4296 2134 1241 917 567 532 14509 --14556
NM_017577chr351668 1595 1375 1254 224 11608 31618 298 262 --
NM_017593chr42507 486 ------
NM_017594chr9143097 3026 2939 2860 2718 2593 2433 2180 2136 1117 1106 909 844 339 12704 ----
NM_017599chr1251722 1483 479 89 32 21447 295 11407 --
NM_017610chr1551366 793 623 537 383 --2815 207 --
NM_017628chr4164822 4813 4780 4610 4089 3546 3408 3343 3223 1975 1465 1371 1055 676 315 130 11346 55104 5044 4972 4427 1038 24759 4387
NM_017633chr693903 3378 2662 1536 1479 1223 1135 1092 141 21199 1029 ----
NM_017634chr881998 1646 509 432 413 406 313 233 11550 11346 21637 612
NM_017637chr9199299 9214 8130 7688 7397 7297 7039 6845 6412 5768 3161 2645 2485 2444 2376 2221 2075 1753 197 48382 6747 2880 1163 ----
NM_017641chr1281175 1064 989 951 870 859 411 30 1301 2258 126 --
NM_017643chr1752773 953 947 571 368 --13115 11994
NM_017644chr3195218 5129 5091 4923 4762 4593 4527 4491 4369 4153 3580 3540 3532 3401 3394 3287 3257 3140 1397 1278 24472 1346 --
NM_017645chr993170 2744 2609 2539 2081 941 377 80 38 2795 70 23122 1239 --
NM_017650chr7146040 6016 5683 5547 5174 4991 4954 2255 2046 1449 1265 733 374 94 55460 2391 2386 2147 638 35903 5865 1645 12007
NM_017658chr14194662 4486 4356 4269 3788 3678 3267 3241 2936 1774 1274 1221 1180 1129 708 600 572 557 247 13286 11334 --
NM_017661chr1551249 1233 1218 306 242 --11072 --
NM_017672chr1561372 1349 1266 491 424 115 --11110 --
NM_017694chr282087 1872 1861 1303 805 712 325 122 21608 1315 ----
NM_017700chr4160 ------
NM_017704chr114412 318 138 31 --124 --
NM_017709chr1124324 3998 3892 3845 3608 3252 2940 2907 1439 1328 838 77 --34135 891 535 --
NM_017714chr204868 694 638 306 1952 ----
NM_017719chr351613 1564 814 677 255 42266 964 920 709 1362 --
NM_017737chr192100 2084 2073 1605 1515 1445 895 498 201 --1477 --
NM_017742chr1851672 1395 317 290 253 21976 1717 21219 108 --
NM_017752chrX31778 1502 311 52121 1716 1541 547 388 1680 11901
NM_017754chr6135062 4835 4678 4493 4447 3936 3669 1547 1448 1157 975 750 89 13961 ----
NM_017761chr1111548 1477 1310 1142 1018 556 480 452 309 233 21 ------
NM_017769chr14112824 2800 2793 2742 2463 2406 2389 2334 1018 447 426 53047 2198 586 547 345 ----
NM_017770chr673007 2629 2561 1024 635 405 173 --3946 598 69 --
NM_017778chr831295 306 224 --11423 --
NM_017779chr1142691 2683 2602 2259 2231 2204 1098 1006 627 574 414 284 176 110 32627 2426 383 11013 --
NM_017785chr52546 527 ------
NM_017786chr84701 596 549 529 ------
NM_017801chr382626 2569 2427 2405 2302 562 268 203 42389 447 413 183 ----
NM_017813chr8175841 5833 5371 5098 4769 4572 4193 4023 3973 3783 2308 2247 1682 1548 932 572 522 34528 4199 269 35701 5589 1397 15477
NM_017824chr1062740 2421 2341 1736 636 443 31678 482 477 ----
NM_017831chr1893837 3424 3375 1564 1356 1309 1265 1153 178 23303 3128 136 34428 4207 4190
NM_017847chr1102277 2205 1847 1811 1803 761 654 319 299 227 ------
NM_017890chr851912 1869 1850 1179 581 21761 1724 ----
NM_017905chr132608 550 ------
NM_017915chr1231192 434 318 188 ----
NM_017918chr41109 ------
NM_017919chr9165846 5153 5125 4959 4936 4826 4592 4540 4088 4023 1874 1652 1602 782 631 379 34359 1811 387 25788 360 14321
NM_017925chr9101765 1746 1598 1523 1418 1338 783 731 365 47 1140 ----
NM_017933chr241389 1223 146 126 ------
NM_017943chr1461081 1062 873 780 271 56 --1154 --
NM_017944chr1173132 2925 2885 1230 1196 1097 409 1699 --13110
NM_017952chr2124248 4069 3972 3854 3072 2974 1508 1458 1393 1354 165 120 11213 13520 --
NM_017964chr24965 238 206 99 --1869 1893
NM_017974chr211033 ------
NM_017987chr10132233 2220 1892 1838 1830 1755 1650 1605 1554 1545 1535 1385 731 1612 1316 --
NM_017998chr94526 255 146 52 11111 --11038
NM_018015chrX51026 912 831 722 415 21161 926 ----
NM_018017chr1062871 2795 2487 743 661 507 21784 700 12029 11956
NM_018027chr1032966 2157 779 ------
NM_018030chr1881109 974 834 792 756 691 314 63 ------
NM_018036chr14114443 4290 3423 3168 2744 1764 1738 1337 1186 489 131 1630 24340 1356 --
NM_018048chr1291954 1432 1344 803 685 664 528 418 202 --22019 1986 --
NM_018051chr71289 --1311 1389
NM_018060chr11369 ------
NM_018061chr191768 1684 1295 1199 1159 1095 315 196 48 ------
NM_018063chr101139 ------
NM_018067chr11561 ------
NM_018070chr11397 ------
NM_018078chr43831 329 196 --1716 1824
NM_018084chr2123292 3095 3025 2825 2785 2564 2442 2122 1094 411 380 280 42805 2424 921 718 --1459
NM_018085chr1178218 7857 6978 6425 6419 5906 5503 5198 5112 3154 2854 2432 1912 1557 910 847 740 18143 37518 7158 7117 16934
NM_018092chr1691667 1619 1587 1571 1543 1388 1359 1191 25 --1422 --
NM_018098chr391122 1084 930 466 420 374 315 265 70 123 ----
NM_018112chr961066 887 749 400 346 282 ------
NM_018121chr1051041 1007 765 754 739 22861 312 1906 --
NM_018126chr471165 1110 1013 397 370 164 75 1976 ----
NM_018133chr362200 2116 745 672 549 337 ----1134
NM_018139chr142329 26 ------
NM_018155chr3163450 3322 3101 3092 2868 2719 2700 2563 1235 1196 1170 627 542 487 379 122 43401 2756 934 799 ----
NM_018156chr1102587 2450 2169 1168 1117 810 697 429 276 233 2720 201 ----
NM_018178chr1111936 1880 1781 1769 1746 1624 1600 686 474 442 312 11630 ----
NM_018191chr13122068 2004 1936 1865 1776 1434 1363 1317 816 583 238 221 41859 1569 748 433 ----
NM_018195chr1182166 2070 1621 1476 856 834 710 338 --22151 1356 --
NM_018211chr171936 1748 1562 1443 772 432 97 --11481 --
NM_018227chr4102815 2795 2702 2520 2509 2221 1288 937 525 383 12180 ----
NM_018237chr10135 ------
NM_018243chr4103711 2754 2524 2472 1272 636 491 387 262 152 --12543 --
NM_018247chr672439 2321 2173 2046 1124 465 316 52637 2235 1216 1170 1138 32739 2560 1998 --
NM_018252chr14576 540 533 219 2643 229 ----
NM_018254chr181833 1793 1700 1572 850 814 405 98 1415 11718 --
NM_018257chr2092368 2282 1754 1019 931 656 592 584 479 --21863 526 --
NM_018263chr292540 2499 2454 2197 967 567 315 218 198 1497 --12428
NM_018287chr1051217 1032 1019 232 217 11150 21185 255 11306
NM_018293chr372981 2611 2446 2439 2414 2129 959 12874 22491 836 --
NM_018299chr8113471 3280 3194 3167 2440 2407 1287 1060 1046 817 606 3878 702 554 11367 --
NM_018302chr462200 1776 926 798 745 674 ------
NM_018307chr178972 894 772 744 682 322 66 56 1367 1218 --
NM_018313chr3142323 2305 2260 2090 1673 1662 1643 1058 1019 877 856 516 437 188 21855 1819 ----
NM_018325chr951657 1596 1529 1443 455 21614 129 1203 11131
NM_018339chr971869 1859 1836 1713 1652 1172 544 31384 166 116 ----
NM_018342chr491745 1649 1604 1536 1297 1190 1089 504 448 11722 ----
NM_018351chr1274759 4507 4163 3087 1753 1642 1111 21261 569 31247 658 246 14312
NM_018361chr873199 1642 1440 725 609 475 227 12561 43506 2569 919 84 --
NM_018362chr11154062 3753 3734 3106 2935 2467 1625 1617 1081 1010 996 846 825 653 282 24013 3521 ----
NM_018364chr1124049 4040 3985 3780 2726 2690 2518 1511 1467 1437 1103 39 53342 2528 495 319 78 13992 --
NM_018373chr1486044 5992 5636 4684 4442 2270 1965 945 24254 4246 11824 --
NM_018374chr7195095 4483 4284 4199 3805 3798 3654 3399 3371 3354 1999 1680 1424 1323 1078 901 451 372 91 34839 3850 1213 34977 4402 216 --
NM_018398chr32331 53 ------
NM_018403chr374090 3852 3203 2695 1644 1616 1173 44054 1478 1437 261 1798 --
NM_018409chr4123196 2361 2304 920 551 472 445 425 403 347 162 146 ------
NM_018420chr182893 2853 2140 1862 996 925 346 233 12282 12128 --
NM_018425chr1042274 915 836 377 --22686 435 --
NM_018429chr5112869 2506 2326 2267 2018 1974 1112 1041 545 458 334 22910 32 ----
NM_018444chr862250 2152 1735 1534 1499 443 12372 1545 --
NM_018445chr151561 ------
NM_018452chr6_random153863 3502 3417 3296 3253 2818 2373 1484 1468 1376 1170 1049 878 601 526 ------
NM_018456chr31121 ------
NM_018461chr101582 ------
NM_018469chr1731414 1283 546 ------
NM_018482chr842602 2470 1755 544 ------
NM_018490chr1171721 1512 1396 1328 1291 562 186 21886 1414 11352 1180
NM_018509chr1731735 1561 333 ----11207
NM_018555chr1952117 1655 1539 411 93 1602 ----
NM_018557chr291745 1710 1641 1418 1262 666 546 422 259 ------
NM_018566chr1135124 5116 4741 4731 4502 4124 3257 2000 1297 1115 558 543 533 44604 4403 4275 1983 11968 21425 552
NM_018638chr12265631 5434 5406 5276 5172 5146 5069 4920 4683 4351 4055 3859 3614 1615 1607 1113 1078 865 759 739 642 593 386 377 223 165 54748 4177 1176 289 124 24909 2226 14254
NM_018650chr172110 1525 1479 714 645 502 321 22280 1780 21838 308 --
NM_018652chr152698 219 ------
NM_018662chr184226 4119 2910 1750 1296 329 226 91 --23489 215 --
NM_018682chr73682 289 28 ------
NM_018685chr731009 772 227 --11073 11035
NM_018695chr582483 2418 2024 1830 906 498 279 198 12436 ----
NM_018700chr541697 1638 487 414 11421 11183 --
NM_018710chr851213 1176 899 344 303 31252 309 76 ----
NM_018837chr201374 ------
NM_018840chr201327 ------
NM_018898chr572355 2017 1903 1641 901 568 188 ------
NM_018899chr572355 2017 1903 1641 901 568 188 ------
NM_018900chr572355 2017 1903 1641 901 568 188 ------
NM_018901chr572355 2017 1903 1641 901 568 188 ------
NM_018902chr572355 2017 1903 1641 901 568 188 ------
NM_018903chr572355 2017 1903 1641 901 568 188 ------
NM_018904chr572355 2017 1903 1641 901 568 188 ------
NM_018905chr572355 2017 1903 1641 901 568 188 ------
NM_018906chr572355 2017 1903 1641 901 568 188 ------
NM_018907chr572355 2017 1903 1641 901 568 188 ------
NM_018908chr572355 2017 1903 1641 901 568 188 ------
NM_018909chr572355 2017 1903 1641 901 568 188 ------
NM_018910chr572355 2017 1903 1641 901 568 188 ------
NM_018911chr572355 2017 1903 1641 901 568 188 ------
NM_018945chr693696 3676 3366 3310 2452 1207 1087 1008 352 23233 2431 ----
NM_018947chr7194918 4904 4890 4807 3961 3794 3714 3697 3655 3307 3204 967 946 685 670 364 333 188 166 13845 11005 21174 697
NM_018958chr15114052 3714 3648 3465 3220 3169 3063 1634 1154 984 506 11523 33869 2864 2824 --
NM_018959chr191173 ------
NM_018963chr2161433 1225 1199 1185 1130 201 ----11476
NM_018970chr7103014 2889 2809 738 627 548 299 286 263 169 41990 1197 512 366 1239 13084
NM_018972chr872683 2417 2367 2155 1920 1772 476 2987 631 ----
NM_018993chr2041452 1245 1153 339 ------
NM_018999chr10214901 4793 4648 4610 4573 4558 4450 4068 3994 3962 3938 3649 3615 3609 3486 3465 3081 1809 1479 1283 395 1847 24155 3074 --
NM_019001chr3154862 4772 4681 4309 4200 3907 3250 1690 1531 1497 1411 1373 947 450 114 53672 1229 355 138 23 33188 687 613 1253
NM_019002chr21275 ------
NM_019004chr771956 1922 736 509 333 272 24 31840 793 30 ----
NM_019015chr71108 ------
NM_019022chr18103174 3081 2990 2773 2524 2412 625 325 281 63 22823 1229 11257 --
NM_019027chr432645 2413 1921 22147 1770 11711 1135
NM_019035chr481935 1816 1793 1658 1545 832 774 138 31907 1551 351 ----
NM_019040chr112230 189 ------
NM_019049chr13200 171 99 1497 --1691
NM_019072chr5124254 4044 3762 3651 3511 3233 2694 1326 1104 1088 924 753 53969 3410 3181 2734 1139 --1910
NM_019075chr24738 728 154 79 2721 118 1639 1280
NM_019076chr24738 728 154 79 2721 118 1639 1280
NM_019077chr24738 728 154 79 2721 118 1639 1280
NM_019078chr24738 728 154 79 2721 118 1639 1280
NM_019084chr10102480 2426 676 644 514 488 372 360 140 98 11882 1500 --
NM_019093chr24738 728 154 79 2721 118 1639 1280
NM_019094chr1263460 2653 2460 1096 918 850 --42810 2596 594 103 --
NM_019095chr201205 ------
NM_019114chr941793 1668 1023 814 ----1886
NM_019116chr1673703 3509 3259 2984 2484 1192 777 11314 1265 13589
NM_019117chrX133242 3230 3192 3024 2410 1342 1320 1238 1083 684 652 255 36 63486 3379 2359 865 199 188 22863 1376 --
NM_019590chr1051233 1144 147 131 120 11328 ----
NM_019593chr20113200 3019 2896 2528 2486 2009 1169 1082 985 895 250 32557 2445 169 11015 --
NM_019610chr161930 1904 803 669 230 120 ------
NM_019852chr14197 ------
NM_019859chr1031549 1192 1071 ------
NM_019860chr1031597 1240 1119 ------
NM_019891chr181353 1236 1185 901 886 330 127 114 31050 216 161 --11333
NM_019903chr1071944 1921 1743 1564 201 67 53 ----1283
NM_020064chr91705 ------
NM_020116chr4101632 1602 1514 1489 627 519 283 153 139 67 21312 254 ----
NM_020122chr2135939 5841 5807 5396 4181 2325 1848 1340 1301 846 820 531 428 15993 --1883
NM_020133chr6106279 5993 5981 5733 5427 4377 2361 2342 2180 1217 36263 5542 1553 25466 2235 1426
NM_020139chr472070 2064 1968 1911 1455 1437 1387 11400 --11301
NM_020140chr122177 37 ------
NM_020141chr171723 1595 1544 1478 955 848 828 1262 1813 --
NM_020152chr213874 180 73 ------
NM_020156chr73244 160 105 ------
NM_020159chr451465 1162 1150 380 257 1478 3632 546 162 --
NM_020177chr5103390 3331 2889 2588 2554 2284 2248 2143 952 344 42673 2096 1204 208 33038 2715 780 --
NM_020184chr21289 ------
NM_020192chr71160 ------
NM_020199chr56895 853 820 258 139 95 --1324 --
NM_020204chr12590 29 ------
NM_020205chr1103237 3027 2628 2322 2212 945 817 740 596 516 32835 2709 490 22464 2177 --
NM_020228chr1192487 2270 2099 1876 1843 1750 1641 500 237 --21936 568 --
NM_020240chr522268 2253 22557 1817 1175 11034
NM_020245chr674959 4650 3949 3904 3206 1991 928 --23395 3302 --
NM_020336chr2073870 3633 2567 2401 854 832 810 ------
NM_020337chr4123150 3130 2936 2634 2575 2486 996 948 909 895 644 156 53119 2284 2065 954 313 ----
NM_020341chr20101776 1754 1620 1494 1356 1327 1261 785 610 32 ------
NM_020342chr2132523 2457 2420 2408 2315 1933 936 930 877 546 420 378 126 --32192 2093 1857 11746
NM_020347chr372318 2306 1986 1792 529 512 343 --11526 --
NM_020348chr1032790 2773 2031 ------
NM_020390chr3174921 4841 4374 3949 3636 3500 3427 3190 1852 1289 1236 726 717 383 338 198 38 21392 1340 44642 3963 3680 67 11490
NM_020420chrY31731 1642 81 --1174 11420
NM_020425chr671460 1445 722 327 309 277 150 1343 11881 --
NM_020443chr1146864 6518 6234 4931 4716 4509 2642 2072 1991 1968 1639 1313 544 365 16661 15006 --
NM_020455chr6112831 2712 2585 2061 2016 1902 864 784 769 706 474 --12399 --
NM_020456chr1352072 716 527 381 229 --1843 --
NM_020466chr694468 4410 3917 3807 1839 1757 1304 1115 1101 13418 --24901 3338
NM_020474chr1872035 1944 1750 1320 1304 596 435 11839 ----
NM_020630chr101739 ------
NM_020647chr861795 1507 1464 891 665 83 1917 ----
NM_020651chr251824 1625 578 46 34 31528 1343 596 31702 1478 213 --
NM_020654chr351370 1215 1034 618 217 1225 11056 11607
NM_020673chr20137741 7682 7533 6087 5747 3025 1661 1631 1529 1249 947 683 287 35919 927 589 47129 1541 954 739 11833
NM_020698chr12103124 2823 2622 2582 2560 2190 1203 862 628 339 ----11216
NM_020704chr792390 1808 1798 1690 825 756 464 452 149 11866 ----
NM_020711chr262610 2478 648 593 199 158 ----1676
NM_020718chr16146618 6416 6182 5819 4905 4783 4584 4341 4120 2177 1609 1479 1424 1390 25144 1576 35553 1464 911 --
NM_020727chr21144044 4013 3592 3431 3373 3283 3271 2681 2494 1524 616 594 398 133 1509 2804 53 11018
NM_020728chr792499 2414 1928 960 637 542 441 386 178 ------
NM_020734chr1262553 2526 2167 1021 967 257 22242 433 22775 2735 --
NM_020739chr15114092 4030 3821 3643 3485 3396 3038 1231 782 636 104 53299 3008 1633 1415 1131 13981 --
NM_020742chrX52462 2299 2040 1920 1839 11089 ----
NM_020747chr52983 942 1133 ----
NM_020748chr1751932 1828 853 787 82 12084 ----
NM_020760chr221585 409 1666 --1465
NM_020762chr123958 876 195 ----1161
NM_020766chrX104571 4078 3876 2894 1718 1036 941 742 293 122 44493 3807 1418 330 --11056
NM_020768chr5113081 2902 2825 2194 2078 1015 896 554 409 197 186 13240 --1934
NM_020771chr661562 1240 1166 460 216 90 ----11184
NM_020772chr17218462 7783 7610 7168 6954 6151 5956 5928 5479 3382 3278 2983 2613 2396 2307 2141 1727 1327 944 260 83 48580 5807 5676 1005 37624 7030 2451 18100
NM_020774chr18246162 5903 5820 5810 5562 5279 5108 4535 4475 4295 4206 4138 3907 3857 3794 3778 2307 2233 2094 1898 1685 1457 318 201 55008 4283 3918 3872 465 56249 4928 1504 629 564 11362
NM_020779chr2103242 3181 1260 1171 1135 907 480 393 300 129 --42489 742 557 330 --
NM_020782chr12114440 4369 4310 3937 3263 3068 1841 1806 1019 820 286 2221 206 ----
NM_020792chr362787 2705 776 444 204 174 32583 1049 384 --11933
NM_020794chr191492 1432 1354 1192 1059 1044 338 274 58 21530 963 ----
NM_020801chr562564 2492 2428 2288 1990 1809 12509 ----
NM_020802chr1193413 3227 2682 2629 1363 368 345 260 53 12068 23363 1039 --
NM_020803chr461487 633 484 187 139 114 --12071 --
NM_020810chr1463452 3382 2514 1310 1237 837 31284 1046 1030 --23364 192
NM_020819chr681051 1041 884 868 838 416 254 89 --1757 --
NM_020841chr12124071 3821 3794 3776 3372 3340 3283 3260 2519 1336 1063 626 22624 1493 ----
NM_020843chr152417 48 ------
NM_020844chr8207602 7413 6979 6912 6660 6504 6450 5615 3072 3019 2842 1562 1492 1471 1414 1222 609 446 354 214 67726 7652 7458 4951 2420 1971 36803 6039 75 25497 583
NM_020859chr4124045 4024 4006 3993 3779 3735 3512 3301 2530 1251 939 604 --1829 --
NM_020865chr32499 61 1451 ----
NM_020868chr261906 1806 1268 697 624 543 1735 --11536
NM_020871chrX132557 2187 2169 1620 772 713 681 638 567 515 240 163 23 32227 1862 1598 22468 288 --
NM_020888chr122071 1970 ------
NM_020918chr1093214 2620 2492 1427 1400 1391 1294 542 368 1272 ----
NM_020935chr264086 4020 3768 3290 1411 659 24630 1811 11795 13386
NM_020937chr144820 223 110 48 2882 144 --2624 199
NM_020940chr1072688 2315 2210 1034 998 791 605 22711 526 22071 2012 --
NM_020948chr1163524 3230 2737 2671 2639 2392 1421 1147 1080 997 941 841 302 219 114 35 12806 11411 --
NM_020949chr31215 ------
NM_020951chr1952432 1971 974 533 478 --12260 --
NM_020960chr9104997 4758 4014 1796 1586 1229 1143 1021 1012 771 --11192 --
NM_020981chr26807 741 627 565 549 133 ------
NM_021003chr144687 546 335 191 --1835 --
NM_021007chr2122424 2275 2095 1670 1505 771 658 642 553 411 318 305 --1966 --
NM_021027chr24738 728 154 79 2721 118 1639 1280
NM_021072chr552654 2188 823 480 246 32382 2345 2124 3508 452 184 --
NM_021083chrX83327 3295 3037 2875 2753 2340 662 307 23647 2616 32818 2632 612 1995
NM_021088chr272175 1976 1966 1942 1848 1421 629 1543 21460 775 12015
NM_021097chr282808 2658 2608 2169 2095 2083 448 24 12003 1723 --
NM_021098chr162689 678 ------
NM_021104chr121306 ------
NM_021109chrX1113 ------
NM_021109chrX1113 ------
NM_021116chr7149018 8949 8870 8708 8337 7960 7946 7922 7227 7157 6813 5757 5530 1150 ----27269 3511
NM_021129chr103212 121 92 ------
NM_021145chr731105 735 108 21033 804 1466 --
NM_021148chr742039 1944 1700 445 22488 1656 22251 1860 --
NM_021163chr7103649 3616 3478 3300 2433 1297 492 456 423 34 13355 13282 --
NM_021167chr772860 2818 2799 2694 2314 2228 189 1965 12065 --
NM_021183chrX152516 2307 2270 2167 2048 2002 1873 1789 1781 1725 1608 1001 951 767 354 22298 863 2805 269 --
NM_021215chr2082376 2182 2123 1909 1790 1723 1602 721 21659 690 ----
NM_021229chr123869 473 168 ------
NM_021238chr1271512 1372 1301 841 672 471 295 11803 147 --
NM_021242chrX21003 876 --1950 --
NM_021252chr1061780 1726 1712 1483 548 343 --11672 1365
NM_021255chr1474123 3996 3937 1460 1189 1052 333 13220 21081 68 1869
NM_021627chr32843 320 ----2985 425
NM_021629chr3195092 4818 4629 4547 4275 4203 4150 3942 3618 3559 3122 1494 1352 1175 1149 1062 782 470 249 34967 4289 115 54134 3994 1518 1036 822 --
NM_021645chr1362332 2280 2060 1740 1721 214 11930 ----
NM_021647chr494692 4541 3549 3283 3070 2892 1617 1452 839 34445 3570 876 ----
NM_021649chr571868 1472 1225 691 473 143 91 --1353 --
NM_021728chr143948 688 38 1906 1318 --
NM_021813chr6115802 5739 5620 4710 3656 2112 2104 1159 1028 892 362 14599 15820 --
NM_021815chr2143025 2904 2598 2501 2390 2381 2268 2071 1234 1155 754 648 531 228 43112 863 851 461 1948 --
NM_021818chr1471529 1346 1184 1150 428 294 24 ------
NM_021911chr5145552 5250 4489 4153 4047 3982 3907 3871 3442 2161 1707 1682 996 171 11549 45289 1953 1690 34 --
NM_021912chr1564214 4103 3305 3259 2788 351 23794 421 13884 11635
NM_021913chr1941281 1273 1251 1229 --31547 1322 293 11361
NM_021914chr1482173 2108 1780 1724 778 679 554 524 --12144 --
NM_021943chr622062 2045 --12114 --
NM_021954chr1393722 3347 3162 2926 2824 2315 865 769 480 --13182 --
NM_021958chr11323 ------
NM_021961chr11147189 7170 7003 6840 6793 6762 6309 6245 4948 1657 1486 567 461 148 36576 1373 475 1961 1557
NM_021964chr3266554 5930 5889 5682 5618 5491 5464 5152 5115 5084 4917 4878 4513 4346 4207 4193 2337 2062 1953 1861 1526 1306 1266 1111 976 469 65896 4687 1822 1694 825 475 45997 5396 4810 373 --
NM_022041chr16112724 2717 2434 2391 2302 2018 822 654 592 513 223 12543 12057 --
NM_022051chr11481 ------
NM_022073chr1441099 661 271 61 --152 11482
NM_022075chr14941 885 871 752 ------
NM_022082chr2011070 ------
NM_022091chr6122788 2280 2149 1825 1709 1093 1027 961 862 358 282 45 22655 175 ----
NM_022130chr561420 1396 1295 1085 908 497 1997 ----
NM_022133chr861699 1584 514 446 342 266 31900 281 153 1733 --
NM_022166chr1676267 6072 5743 5558 4699 4240 1360 ----15801
NM_022170chr721767 1676 ------
NM_022351chr8183810 3727 3627 3476 3445 3408 3010 2898 1409 1273 1266 1150 1053 635 415 222 172 125 1705 12741 --
NM_022361chr61463 ------
NM_022444chr781642 1251 631 622 516 350 99 77 11783 11928 --
NM_022456chr12146940 6583 6512 5971 4896 4734 4681 2058 1653 1264 1048 341 276 54 32856 2042 1913 25668 1286 15823
NM_022458chr7123165 2726 2670 2619 2562 2539 2059 1121 1075 430 369 179 12545 1622 --
NM_022459chr13176374 5780 5482 5288 5261 4989 4835 4762 4646 4565 3867 1964 1229 1114 366 233 227 45908 5677 5240 1940 36236 5363 52 11610
NM_022473chr1574207 3323 3176 1030 591 199 180 23677 168 24184 3868 --
NM_022474chr1452257 573 407 392 238 32001 723 143 1737 --
NM_022484chr741445 1236 1205 383 21342 324 11161 --
NM_022488chr31134 ------
NM_022491chr12103497 3207 3145 3027 3017 2451 1375 696 516 141 12179 ----
NM_022497chr353885 3389 2858 1258 189 ------
NM_022575chr201141 ------
NM_022716chr162403 2263 2177 1205 1014 696 63130 3050 2481 1211 776 101 ----
NM_022726chr641576 1217 551 483 2389 376 21130 343 --
NM_022753chr1102520 2332 2207 2060 1879 1823 1804 500 265 169 1457 --11997
NM_022763chr393131 3073 2977 2363 2169 1010 691 564 273 32011 675 27 21190 1092 --
NM_022776chr381442 1160 1080 642 292 247 127 53 11511 ----
NM_022781chr9143277 3264 3210 3160 2919 2878 2745 2405 2345 2318 1003 962 841 758 ------
NM_022810chrX1299 ------
NM_022822chr111900 ------
NM_022826chr251129 798 454 284 62 170 --1178
NM_022828chr591783 1665 1506 1226 630 363 344 170 54 31522 1305 665 11633 1307
NM_022841chr15102773 2202 2067 1953 1942 999 683 590 568 221 2829 302 11994 --
NM_022843chr1371519 1474 1167 1107 969 437 150 21553 481 ----
NM_022845chr16111952 1870 1860 1711 1641 1482 1419 1373 785 620 410 12096 32169 1392 815 --
NM_022893chr2113104 2791 2772 2170 1955 1071 1031 666 630 608 394 12256 ----
NM_022898chr1494841 4472 4374 3714 3494 1365 1335 1063 297 31407 934 411 --34320 1915 1845
NM_022902chr52155 46 ------
NM_022917chr951205 1193 1074 1042 132 ------
NM_022918chr1171920 1902 1606 1412 488 458 31 21819 1773 ----
NM_022977chrX82653 2605 2533 2233 2152 1840 397 320 1978 1930 --
NM_023000chr14111469 1389 1299 1279 1248 1214 688 557 377 294 105 ----165
NM_023001chr14111469 1389 1299 1279 1248 1214 688 557 377 294 105 ----165
NM_023010chrX2790 539 ------
NM_023011chr134873 830 717 182 ------
NM_023015chr11785 ------
NM_023016chr2112855 2433 2305 2212 2149 2049 987 964 855 446 48 2611 295 1272 2937 97
NM_023034chr81214 ------
NM_023076chr1672945 2408 543 533 493 420 246 ------
NM_023929chr882823 2595 2228 2214 2169 2038 1956 689 12193 12151 --
NM_023931chr1611427 ------
NM_024007chr593107 3010 2994 2855 1993 1099 980 767 505 12900 12540 --
NM_024052chr1733000 2868 2255 --1676 22361 1001
NM_024063chr151185 ------
NM_024095chr122332 114 --1304 11378
NM_024112chr91297 ------
NM_024165chr61241 ------
NM_024293chr21203 ------
NM_024312chr1221655 521 ----2561 450
NM_024334chr391874 1755 1710 1699 1475 1383 1306 1285 691 --11323 11883
NM_024345chr9266038 5996 5952 5945 5902 5891 5856 5839 5822 5792 5256 5200 4982 4653 4342 2235 2170 2133 2043 1526 1112 886 716 608 482 97 25472 840 13987 --
NM_024416chr961649 1609 1042 528 428 180 ------
NM_024423chr1874219 3570 3356 1486 1239 935 163 41601 1012 654 331 --2649 532
NM_024503chr11411 ------
NM_024511chr4102604 2585 2437 1402 1290 941 658 618 321 120 12469 32448 846 79 --
NM_024524chr3133038 2436 2406 2351 2112 1267 1118 1057 873 818 758 708 419 43005 2270 942 189 22294 2257 --
NM_024539chrX81250 1172 1053 958 906 146 86 77 2812 506 ----
NM_024548chr351765 1278 602 351 154 1461 21266 258 --
NM_024561chr1351397 1346 1081 294 116 11414 2260 42 1968
NM_024574chr45482 448 416 404 51 1393 --1298
NM_024584chr281301 1269 1192 1043 836 205 164 24 2965 953 1347 --
NM_024586chr11593 ------
NM_024594chr581939 1603 1427 598 355 215 207 122 --11520 --
NM_024613chr851563 1459 1429 227 105 --41437 1257 1233 649 --
NM_024624chr271595 1513 1311 1266 1187 242 231 --11431 --
NM_024632chr52271 87 ------
NM_024645chr83372 325 230 1206 1344 1268
NM_024646chr173137 2851 1485 1103 1095 974 403 23833 3481 12672 --
NM_024665chr3174285 4171 3958 3850 3575 3399 3198 3155 3037 1731 1372 1257 1095 815 680 336 199 33888 3694 496 23275 3145 1944
NM_024704chr2071133 1111 1086 1017 785 727 387 1887 ----
NM_024713chr1581604 1485 1462 1309 1196 1065 647 443 11520 ----
NM_024731chr161161 ------
NM_024744chr2112704 2587 2456 2106 1881 1770 1712 1658 532 423 410 1704 2965 260 22559 1947
NM_024751chr452130 1985 1585 819 552 2831 792 11515 --
NM_024761chr9135307 5279 4458 4231 4093 3856 1822 1714 1453 1260 987 845 439 ------
NM_024770chr2136540 6096 5467 5154 4956 4748 4606 4323 2579 2245 1876 1301 227 1284 45162 4236 2603 2343 --
NM_024803chr101399 ----1143
NM_024814chr73387 254 148 ------
NM_024818chr351504 1470 1060 988 510 1999 1119 11174
NM_024824chr1471620 1611 1546 1403 1098 526 170 11684 1245 --
NM_024828chr971368 1214 1002 451 321 206 22 21033 407 --1136
NM_024837chr15101738 1597 1401 1335 750 741 341 273 263 125 ------
NM_024913chr791553 1534 1384 1340 1120 541 189 158 22 11406 ----
NM_024920chr481432 1419 1392 421 381 163 112 57 41541 1214 1167 1020 ----
NM_024941chr5101497 1304 1287 1254 1229 1074 1038 350 139 106 ------
NM_024945chr941203 1177 907 844 2860 179 --11014
NM_024947chr3329612 9397 9385 9348 9342 8737 8627 8608 8451 8152 7845 7806 7560 7010 6904 6796 6756 6731 6325 6271 6113 6025 6003 5982 5917 3566 3514 2883 2708 2456 1001 285 69429 8836 7681 7101 6365 2201 39187 8672 2820 --
NM_024949chr494857 4478 3425 3284 1982 1696 1611 1396 853 --21150 798 --
NM_024953chr12102838 2484 2188 2064 1822 1009 479 369 154 138 1174 --12453
NM_024989chr2218216 8201 7951 7583 7149 6443 6216 5438 5181 5163 4951 3021 1864 1615 1356 1285 1051 736 490 447 410 56979 6581 2940 2834 1826 36383 1997 878 --
NM_024993chr271582 1263 1174 1061 476 223 186 1145 11467 --
NM_025040chr1982266 2242 1843 1766 1757 1602 399 328 22258 1573 ----
NM_025054chr8153976 3741 3711 3412 3154 3142 3082 2642 2568 1506 1474 1211 898 442 326 53797 3659 3559 3435 209 53477 1622 625 458 198 --
NM_025073chr1124524 4360 4319 3339 2978 2882 1860 1183 1154 753 465 397 24775 4409 24251 200 --
NM_025138chr1371471 1346 1235 1011 339 267 203 --1553 --
NM_025146chr382677 2198 2079 2071 2001 906 633 193 --22686 2150 --
NM_025151chr861926 1665 508 413 213 141 --11685 --
NM_025160chr194321 3663 3137 2826 2677 1424 1210 953 362 2683 227 34234 4074 1560 --
NM_025181chr22820 645 ------
NM_025184chrX2802 111 ------
NM_025191chr162899 2847 2551 1336 496 487 23067 860 11419 --
NM_025214chr18102607 2004 1101 1063 952 911 788 507 280 106 22306 259 1903 1554
NM_025235chr1041769 862 380 187 21644 1530 --1255
NM_025238chr1571511 1362 1218 1196 276 155 29 --1471 --
NM_025244chr22109 92 ------
NM_025246chr31174 ------
NM_030621chr14124014 3939 3697 3051 2796 1357 1116 462 403 255 106 65 --11321 --
NM_030623chr261524 1325 1220 1105 321 70 152 ----
NM_030625chr1072644 2128 1997 1840 1772 601 231 1297 --1442
NM_030627chr5154129 4083 3984 3941 3559 3371 3263 2694 2569 1501 1433 1231 1126 774 166 34014 2737 352 23883 2627 --
NM_030629chr161535 ------
NM_030647chr7166105 5419 5342 5205 4605 4185 3870 1825 1658 1397 1177 966 957 526 372 268 55571 2253 2223 583 457 36338 4960 2449 12388
NM_030648chr4195565 5011 4843 4124 3628 3603 3517 2192 2125 1985 1871 1859 1307 1007 981 935 785 457 275 55412 4136 3878 3556 806 13957 --
NM_030674chr12155730 5469 5416 4776 4506 2362 2268 1624 1606 1515 1491 1121 717 553 435 14704 24234 2347 14694
NM_030751chr1071862 1657 1585 570 456 43 26 11836 ----
NM_030751chr1071862 1657 1585 570 456 43 26 11836 ----
NM_030755chr1473115 3109 2974 1034 614 207 126 12723 1116 --
NM_030773chr2031848 1820 1530 --11563 --
NM_030777chr2052361 1593 1584 956 371 11611 ----
NM_030780chr871718 1458 1221 1117 450 312 145 21590 436 ----
NM_030786chr151828 1737 1177 482 64 ------
NM_030790chr16188 ------
NM_030791chr1481855 1722 1149 656 495 348 129 112 11219 21616 728 --
NM_030799chr541503 308 211 64 21999 842 ----
NM_030803chr211033 ------
NM_030806chr1109449 8938 8800 8628 7208 6621 5961 5864 1706 1396 28151 144 ----
NM_030816chr173561 2749 2309 1463 1286 1103 715 33090 1226 392 --12912
NM_030817chr12133800 3731 3679 3618 3400 3352 3159 2809 2720 2695 1455 896 677 12816 ----
NM_030881chr2262432 2022 687 530 518 453 1714 1418 1985
NM_030885chr3102343 2239 1652 778 650 607 600 580 358 252 --12273 11767
NM_030918chr1115457 3621 3561 3493 1909 1469 1258 951 632 365 177 --34819 4758 975 --
NM_030920chr192056 1697 1557 1494 1447 1371 670 413 258 1356 ----
NM_030926chr211077 ------
NM_030934chr181712 1579 1350 1176 662 625 576 438 21662 736 ----
NM_030938chr176860 739 397 347 338 53 1418 1426 --
NM_030939chr661127 1075 967 874 299 155 ------
NM_030959chr64898 858 842 832 --1882 --
NM_031243chr762199 1656 1643 546 343 334 32161 662 552 22320 816 --
NM_031268chr16135374 5271 5160 5136 4862 4842 4481 4031 3816 3558 3537 3303 957 15152 24665 3737 --
NM_031271chr841675 1567 647 531 --1276 --
NM_031275chr113405 162 135 ------
NM_031286chr11379 ------
NM_031289chr121798 ------
NM_031291chr41153 ------
NM_031298chr171173 ------
NM_031305chr42307 300 ------
NM_031411chr572355 2017 1903 1641 901 568 188 ------
NM_031419chr381634 1581 1488 1402 621 476 354 101 --21389 237 --
NM_031427chr14165990 5954 5605 5306 4612 4118 3955 3839 2137 1993 1508 1249 838 826 59 36 25925 4702 35599 4786 2183 21465 983
NM_031431chr1391866 1757 1741 1476 1342 644 516 243 28 21443 327 ----
NM_031435chr12113473 3357 3301 3164 3142 2630 1240 690 376 364 233 2498 436 23153 121 12760
NM_031442chrX123072 3041 2732 2719 2327 2125 1251 1234 1198 955 847 753 --12375 --
NM_031461chr882291 2238 1672 1559 1419 859 533 226 12020 157 --
NM_031468chr7127625 7229 7031 6794 6676 5188 2390 2205 1412 1374 1354 1297 48090 7188 5073 1036 27466 7373 --
NM_031469chr6103853 3251 3127 2987 2737 2694 1510 1357 1321 848 13781 23345 2675 1653
NM_031483chr20113228 3139 2859 2582 2547 2515 1359 1353 931 601 143 21198 126 ----
NM_031844chr1124004 3695 3060 3043 2844 2778 1650 1244 1201 525 447 433 13868 13915 --
NM_031845chr293281 3262 3176 3032 2696 2552 1446 1327 473 42311 576 523 424 22402 714 --
NM_031847chr293281 3262 3176 3032 2696 2552 1446 1327 473 42311 576 523 424 22402 714 --
NM_031849chr572355 2017 1903 1641 901 568 188 ------
NM_031857chr572355 2017 1903 1641 901 568 188 ------
NM_031858chr1741376 1365 1199 185 ------
NM_031860chr572355 2017 1903 1641 901 568 188 ------
NM_031862chr1741376 1365 1199 185 ------
NM_031903chr7190 ------
NM_031911chr4102745 2664 2539 1767 958 568 325 279 211 182 --32712 1853 1821 --
NM_031990chr191151 ------
NM_031991chr191151 ------
NM_031992chr721767 1676 ------
NM_032012chr9104423 4270 3286 2007 1995 1846 1219 952 936 824 23456 862 24769 2082 --
NM_032042chr5122725 2255 1957 1929 1071 918 905 672 564 162 139 96 --12043 12067
NM_032047chr3112377 2359 2088 2035 1735 1533 971 850 824 85 66 --1189 --
NM_032048chr181608 ------
NM_032105chr1147955 7335 7291 6568 6136 5289 2916 2671 2635 2001 1367 1344 1092 612 ----12659
NM_032116chr13155891 5804 5184 4930 4770 4645 4604 4045 4026 4007 2179 1672 1601 476 150 25190 4627 44826 2000 1402 853 15367
NM_032145chr681946 1732 1613 1508 1221 1195 292 83 11241 2429 101 --
NM_032153chr362712 2298 2256 1766 985 284 32600 2465 131 ----
NM_032160chr18184228 4219 4177 4107 3968 3734 3476 3154 3123 3112 3059 3018 3000 2741 1603 1434 1356 305 1706 ----
NM_032165chr122270 230 ------
NM_032175chr581852 1734 1609 1595 1510 581 60 46 31659 1624 199 1613 --
NM_032182chr1041668 1551 308 259 ----11342
NM_032186chr171474 1192 1047 536 473 45 34 2124 78 1451 --
NM_032189chr1365046 4908 4319 3151 2020 1989 14820 --15026
NM_032195chr212410 395 ------
NM_032199chr1093209 3127 2947 2914 2718 2679 1189 655 524 ------
NM_032221chr2051969 1850 1584 515 39 11543 ----
NM_032228chr11113534 2637 2630 2395 1354 1103 1053 902 667 361 48 33386 527 129 --12291
NM_032230chr122120 100 ------
NM_032231chr151330 ------
NM_032287chr2274208 4053 3836 3778 3736 3549 770 --12583 --
NM_032288chr362177 1978 1663 1579 110 48 --11481 12071
NM_032289chr561981 1639 1560 1544 1470 1389 21887 1395 ----
NM_032291chr1101761 1530 1479 1435 565 530 408 380 335 243 41615 1545 1454 762 11830 --
NM_032312chr24857 341 208 38 ------
NM_032315chr11173 ----1247
NM_032373chr10265937 5857 5770 5453 5348 5185 5110 5080 4981 4793 4670 4639 3703 2314 2083 2060 1913 1679 1593 1306 1128 947 895 701 403 291 31982 1284 1018 31828 1529 142 --
NM_032379chr116944 908 824 249 217 180 1893 ----
NM_032431chr1121068 843 ------
NM_032435chr142106 1634 1491 689 31757 697 627 --1121
NM_032438chr6111581 1418 1386 1249 1228 577 520 503 353 159 85 11305 31406 451 237 --
NM_032439chr1061688 1567 1297 435 353 251 11255 --1220
NM_032440chr1092956 2774 2644 2424 1047 935 618 176 160 32855 630 343 ----
NM_032441chrX51057 827 787 151 31 2874 158 ----
NM_032445chr1572560 2067 1712 807 630 281 39 --12460 --
NM_032446chr593491 3450 3313 2565 1297 1143 905 899 615 33879 3561 2921 13707 --
NM_032457chr493901 3449 3213 3158 3102 2895 2845 2573 2564 23139 1254 1651 --
NM_032466chr851705 1607 1596 1534 677 31452 655 145 1303 11623
NM_032468chr851705 1607 1596 1534 677 31452 655 145 1303 11623
NM_032505chr372209 2082 1123 763 753 521 379 22237 613 --12153
NM_032510chr1862302 1989 1930 1688 819 375 --11609 12222
NM_032521chr20133174 3068 3056 2999 2976 2956 2886 2824 2398 2113 812 302 191 12799 ----
NM_032557chr45973 909 879 305 286 ------
NM_032560chr1431075 1002 916 ------
NM_032582chr1751682 1515 1440 1181 95 21837 1808 21581 1528 --
NM_032594chr143912 745 239 ------
NM_032604chr2149 ------
NM_032765chr53628 287 266 1824 --1874
NM_032778chr3143198 3191 3181 2954 2632 2381 2250 1093 914 877 839 487 478 84 12960 22821 2347 --
NM_032801chr1161762 1731 892 832 687 599 --1754 --
NM_032802chr153204 76 63 ------
NM_032810chr10101481 1311 1248 1152 1077 1066 1007 587 479 400 21263 1142 1131 1139
NM_032826chr744897 2110 1927 176 --1292 12016
NM_032833chr142678 2613 624 254 --22587 1041 1380
NM_032842chr771628 1604 1470 1433 1072 306 128 ------
NM_032859chr13143993 3943 3425 3359 3039 2901 2701 2495 2470 1236 963 616 439 322 83795 3105 2940 2725 2461 2453 896 472 12880 --
NM_032869chr892035 1835 1806 1599 1478 493 396 101 87 11608 21644 1284 --
NM_032870chr62204 130 --150 --
NM_032873chr11124547 3942 3704 3585 3562 3313 3074 3062 3048 841 248 91 ------
NM_032901chr121223 ------
NM_032943chr116944 908 824 249 217 180 1893 ----
NM_032968chrX133324 3219 3160 3042 2974 2906 2747 1696 1640 1590 1068 978 671 --1394 --
NM_032969chrX133324 3219 3160 3042 2974 2906 2747 1696 1640 1590 1068 978 671 --1394 --
NM_032973chrY113319 3214 3155 3037 2969 2901 2742 1589 1068 978 671 --1394 --
NM_032978chr184476 261 143 129 4857 852 847 842 --11214
NM_032979chr184476 261 143 129 4857 852 847 842 --11214
NM_032981chr184476 261 143 129 4857 852 847 842 --11214
NM_032998chr11382 ------
NM_033014chr961649 1609 1042 528 428 180 ------
NM_033016chr2211594 ------
NM_033020chr1174615 4459 4207 4154 3795 3534 3301 3250 3182 3145 3104 3077 2924 846 574 380 156 44845 4792 4105 1226 14289 --
NM_033058chr88987 912 896 868 843 757 680 106 ------
NM_033083chr393436 2826 1028 1007 916 816 804 766 468 ----22746 305
NM_033138chr752102 2052 1829 1443 389 11905 197 1582
NM_033139chr752102 2052 1829 1443 389 11905 197 1582
NM_033140chr752102 2052 1829 1443 389 11905 197 1582
NM_033143chr4104200 3626 3615 3005 1624 1202 1133 983 619 103 1850 23914 1178 13434
NM_033157chr752102 2052 1829 1443 389 11905 197 1582
NM_033181chr6153795 3530 3409 3296 3247 3106 3081 2757 2746 2737 2603 2466 2435 1580 984 23816 2482 11307 13975
NM_033211chr592103 1626 829 772 689 600 501 488 114 --31569 1289 466 --
NM_033224chr7137488 7364 6234 5640 5371 2603 2319 2287 2231 2043 1592 1497 923 57322 5842 1935 1906 995 36902 2513 2075 --
NM_033225chr873228 3213 2952 2451 898 814 223 1701 22230 1974 12278
NM_033272chr22259 71 --1140 --
NM_033281chr52911 238 ------
NM_033285chr873875 3691 3337 1596 1288 845 272 23343 722 14294 11743
NM_033326chr113939 240 150 1347 --2429 22
NM_033360chr12144565 4173 4028 4009 3349 1820 1653 1559 1351 1008 962 362 302 259 33757 1477 804 33967 3206 906 34105 3538 190
NM_033380chrX51141 1055 1048 728 230 11012 ----
NM_033381chrX51141 1055 1048 728 230 11012 ----
NM_033389chr1774885 4829 4795 3190 1355 1059 1038 11049 ----
NM_033427chr77866 740 709 630 572 552 81 1112 ----
NM_033430chr473980 3809 3654 1580 1056 1020 335 11308 11550 1361
NM_033437chr473980 3809 3654 1580 1056 1020 335 11308 11550 1361
NM_033480chr662936 596 266 255 198 167 139 12153 170
NM_033481chr662936 596 266 255 198 167 139 12153 170
NM_033505chr2156774 6263 5769 5666 4915 4863 4742 4591 1489 1427 1398 1364 1264 852 706 26480 5328 25535 4870 --
NM_033515chr671402 1343 1296 1128 1000 937 152 --11417 --
NM_033540chr35861 134 114 95 88 2972 229 1748 --
NM_033624chr1282217 2131 2063 2005 1673 805 632 574 1212 1147 --
NM_033644chr582461 2454 2370 2339 2124 2024 505 284 12251 --22139 1831
NM_033645chr582461 2454 2370 2339 2124 2024 505 284 12251 --22139 1831
NM_033656chr21215956 5883 5107 4813 4798 4637 4512 4433 4408 4344 4185 4163 4048 3891 2390 1106 1030 883 749 659 140 44066 1362 935 679 45213 4217 3782 355 35324 4761 3949
NM_052834chr1862568 2541 2272 1857 1643 702 22478 476 --144
NM_052879chr12143977 3919 3821 3639 3320 3153 2553 1577 1381 1139 982 613 595 187 23491 1550 33054 2978 992 --
NM_052885chr12114328 4279 3965 3789 3636 3204 3088 3053 1735 1568 1245 34888 3213 1876 1499 14620
NM_052900chr871795 1590 1502 1162 1115 536 492 11246 ----
NM_052905chr231455 1321 694 ------
NM_052907chr1294030 3539 3431 2784 1673 1385 1098 435 177 --14114 --
NM_052917chr2123256 3223 3176 2681 2075 1255 1231 621 594 550 491 483 23189 474 186 --
NM_052918chr1083572 3438 2976 2927 2830 1399 1110 1034 13740 33695 1081 545 22788 689
NM_052923chr61248 ------
NM_052927chr542216 1400 277 66 2253 220 1892 1384
NM_052936chrX4940 906 674 659 1930 ----
NM_052937chr8112737 2707 2557 2257 2112 2057 1847 981 344 322 201 21812 676 1376 --
NM_052971chr51146 ------
NM_052978chr1491832 1794 1725 1354 744 694 415 242 203 11665 --1345
NM_053016chr9127294 7006 6388 5624 2833 2618 2521 2029 1952 1675 849 126 36308 1510 1480 36990 5163 1888 17858
NM_053023chr1153196 2723 2246 1236 393 22473 932 22737 2109 11209
NM_053025chr351777 1180 1099 320 30 1111 1227 --
NM_053026chr351777 1180 1099 320 30 1111 1227 --
NM_053027chr351777 1180 1099 320 30 1111 1227 --
NM_053028chr351777 1180 1099 320 30 1111 1227 --
NM_053031chr351777 1180 1099 320 30 1111 1227 --
NM_053032chr351777 1180 1099 320 30 1111 1227 --
NM_053043chr784550 4498 4463 4456 837 371 338 208 21468 503 ----
NM_053053chr131030 961 691 1929 ----
NM_053281chrX1303 ------
NM_057749chr861094 1017 555 468 416 385 21145 1105 21157 927 --
NM_058170chr141649 1478 542 329 11105 21098 198 --
NM_078470chr1062338 1985 968 368 206 192 --22175 2011 11075
NM_078487chr993379 3366 3283 3269 3170 2893 2811 2795 1338 ------
NM_080413chr201141 ------
NM_080414chr201141 ------
NM_080416chr17127 ------
NM_080425chr201351 ------
NM_080426chr201351 ------
NM_080597chr1881109 974 834 792 756 691 314 63 ------
NM_080617chr2051070 1009 976 733 233 --21031 272 1296
NM_080626chr121328 ------
NM_080629chr181151 1035 1010 994 543 375 269 198 11361 31288 1047 446 --
NM_080630chr181151 1035 1010 994 543 375 269 198 11361 31288 1047 446 --
NM_080632chrX2790 539 ------
NM_080676chr2083211 3193 3153 2512 2479 2277 1033 428 12850 22249 609 --
NM_080683chr41404 ------
NM_080684chr41404 ------
NM_080685chr41404 ------
NM_080794chr21291 64 ------
NM_080821chr2072294 2105 1905 1658 1625 393 188 ----2513 46
NM_080840chr201207 ------
NM_080841chr201207 ------
NM_080867chr14185084 5070 5060 5035 4892 4653 4403 4283 3120 2025 1919 1231 1023 1002 733 608 502 192 24864 4308 53245 3206 1470 636 127 --
NM_080872chr873990 3571 3175 3014 1220 1115 56 33028 2929 1374 32780 402 146 --
NM_080874chr461716 1556 1300 1292 547 21 11398 ----
NM_080921chr151018 980 887 805 101 ------
NM_080923chr17806 614 599 561 533 193 99 1309 ----
NM_080927chr3113363 3288 2857 2702 2658 2643 2622 2490 2433 752 206 1984 ----
NM_130434chr152782 450 ------
NM_130435chr1092971 2655 992 560 416 299 262 161 154 --22754 1076 11153
NM_130436chr2152766 2574 2515 1839 1799 --11781 --
NM_130438chr2173343 3151 3092 2416 2376 2106 2065 --12358 --
NM_130439chr1032287 1482 71 11959 --12248
NM_130439chr1032287 1482 71 11959 --12248
NM_130766chr171197 ------
NM_130809chr582841 2697 2524 2159 1120 747 92 78 13037 --12914
NM_130831chr382923 2592 2112 2097 1034 960 907 458 ------
NM_130832chr382923 2592 2112 2097 1034 960 907 458 ------
NM_130833chr382923 2592 2112 2097 1034 960 907 458 ------
NM_130834chr382923 2592 2112 2097 1034 960 907 458 ------
NM_130835chr382923 2592 2112 2097 1034 960 907 458 ------
NM_130836chr382923 2592 2112 2097 1034 960 907 458 ------
NM_130837chr382923 2592 2112 2097 1034 960 907 458 ------
NM_130838chr1571880 1852 1627 1186 328 308 89 ------
NM_130839chr1571880 1852 1627 1186 328 308 89 ------
NM_133265chrX63637 1008 334 318 308 247 ------
NM_133334chr4134876 4843 2421 2379 2210 2049 2029 1632 1479 1068 570 560 249 --12296 --
NM_133370chr4143708 3697 3678 3652 3620 3140 3109 2926 2373 1250 762 607 214 81 33660 2314 1163 ----
NM_133372chr552657 2512 970 204 109 ----12846
NM_133473chr1941869 1857 542 30 1669 11946 --
NM_133477chr4153199 3128 3115 2952 2922 2847 2544 2485 2299 2083 1018 869 360 90 84 23205 2002 22332 134 --
NM_133484chr22108 98 ------
NM_133496chr164244 4065 4039 3826 549 121 33225 1514 1191 11269 --
NM_133646chr295431 5268 5013 4888 4794 4593 4266 1132 776 21348 1161 14238 11409
NM_138270chrX133463 3029 2185 1326 1296 1194 1176 1142 788 599 350 153 112 --32806 2250 301 --
NM_138288chr1441964 823 657 94 1873 ----
NM_138292chr11143514 3349 3018 2915 2875 2495 2474 2351 2254 964 926 765 746 590 23178 3044 13554 --
NM_138340chr186691 677 495 210 194 181 1583 ----
NM_138348chr5136647 6553 6380 5916 5799 5127 4719 2049 1974 1690 1649 1528 901 --21390 1306 16513
NM_138363chr171149 ------
NM_138370chr21770 ------
NM_138373chr1921916 1818 ------
NM_138376chr142475 108 ------
NM_138390chr282197 2099 1652 1366 876 471 465 332 182 --21804 1587
NM_138423chr1532258 1514 1434 12338 --12277
NM_138426chr772520 2378 2309 2225 2150 568 336 21989 1832 ----
NM_138444chr13144691 4660 4580 4445 4366 4359 4323 3941 3896 3868 3771 1682 1562 366 34566 3167 1864 14029 13824
NM_138453chr51189 ------
NM_138455chr85371 112 95 73 61 ------
NM_138459chr6113264 3061 3007 2885 2735 2379 2279 1478 1409 1187 842 13679 ----
NM_138468chr2156337 5956 5396 4815 4154 4021 1981 1257 1158 924 661 447 418 356 78 14580 12118 11674
NM_138473chr12115034 4963 4768 4391 4380 4213 4118 3518 3223 1908 1582 13308 11174 12000
NM_138485chr34427 369 95 65 ------
NM_138554chr972235 2201 1062 804 434 132 77 11979 --12735
NM_138563chr191612 ------
NM_138576chr1494841 4472 4374 3714 3494 1365 1335 1063 297 31407 934 411 --34320 1915 1845
NM_138621chr274107 3816 2804 2655 1210 777 683 21639 565 11563 --
NM_138638chr1482173 2108 1780 1724 778 679 554 524 --12144 --
NM_138690chr191109 ------
NM_138694chr683604 3046 2727 2429 1288 942 570 123 --22655 1282 11305
NM_138713chr16218206 7897 7119 6623 6610 6442 6249 5875 5351 5297 5015 3146 3059 2768 2537 2093 1176 1103 788 311 127 44998 2758 1811 757 25256 2982 --
NM_138714chr16218206 7897 7119 6623 6610 6442 6249 5875 5351 5297 5015 3146 3059 2768 2537 2093 1176 1103 788 311 127 44998 2758 1811 757 25256 2982 --
NM_138731chr14134141 3795 3719 3201 3126 2611 1418 1197 729 694 565 545 364 44007 3982 3103 1089 1742 11237
NM_138782chr5122387 2380 2173 1871 1823 1684 1577 844 725 445 412 138 2713 280 21765 452 11837
NM_138785chr6177 ------
NM_138959chr1106043 5246 5087 4473 4424 2735 2689 2560 2231 997 12138 --16071
NM_138962chr171314 ------
NM_138966chr184561 461 230 70 --2594 96 --
NM_138971chr1153779 3319 854 816 315 1538 22544 555 --
NM_138971chr1153779 3319 854 816 315 1538 22544 555 --
NM_138972chr1153779 3319 854 816 315 1538 22544 555 --
NM_138972chr1153779 3319 854 816 315 1538 22544 555 --
NM_138973chr1153779 3319 854 816 315 1538 22544 555 --
NM_138973chr1153779 3319 854 816 315 1538 22544 555 --
NM_138980chr42734 144 ------
NM_138981chr42865 275 ------
NM_138982chr42734 144 ------
NM_139035chrX4657 507 170 60 1756 ----
NM_139058chrX1413 ------
NM_139062chr171487 ------
NM_139068chr52702 516 ------
NM_139069chr52702 516 ------
NM_139070chr52571 385 ------
NM_139167chr81520 ------
NM_139168chr562006 1566 756 613 532 299 1699 1385 --
NM_139169chr1072059 2043 2025 1916 1854 1393 447 --1284 --
NM_139182chr471513 1431 1209 549 474 355 174 21525 416 31758 1326 1201 --
NM_139279chr273554 3200 3106 2698 788 210 200 --12962 --
NM_139312chr1061241 1218 1106 924 424 278 11112 1320 --
NM_139321chr2093737 3532 2905 1659 881 806 791 602 433 --33875 2975 841 --
NM_144563chr24834 238 175 147 ------
NM_144563chr24834 238 175 147 ------
NM_144567chr172624 2563 2219 538 445 284 255 12836 1213 --
NM_144570chr1662620 1021 906 770 739 465 12406 11015 12897
NM_144571chr4216955 6838 6702 6439 6340 4445 4392 4340 4263 2421 2370 1891 1648 1588 1369 939 822 508 447 415 233 76496 6200 1697 1571 1171 1010 284 ----
NM_144578chr14145472 4999 4721 3866 2214 1701 1693 1490 1412 1398 1330 1281 831 402 34670 1883 706 23962 1302 --
NM_144595chr133680 269 173 ------
NM_144597chr156945 938 849 837 830 368 1724 1716 --
NM_144599chr15115489 4174 4045 3504 2052 1924 1583 1364 981 896 510 51786 1340 720 678 378 14540 --
NM_144600chr1661417 1389 1269 1061 662 49 --11454 --
NM_144607chr1762655 2428 2058 1802 1762 508 21795 201 32568 2261 1738 --
NM_144608chr171208 ------
NM_144641chr311201 ------
NM_144642chr321381 1003 ----21106 475
NM_144664chr11182575 2472 2312 2226 2187 2136 1793 972 926 869 664 538 516 486 162 112 72 40 22459 2248 11861 --
NM_144721chr482627 1095 1042 790 713 411 400 77 22007 972 12062 --
NM_144778chr1372637 2447 1755 996 684 188 115 22035 2005 1811 21041 675
NM_144949chr2122619 2559 2532 2462 2370 2354 2082 1859 1844 761 687 610 --42584 1625 1041 976 --
NM_144963chr882157 2119 2075 1899 1810 955 510 257 22457 531 ----
NM_144973chr1285329 4976 4704 4053 3725 819 806 278 45167 3657 3579 538 25160 4730 13452
NM_144974chr132367 151 ------
NM_145011chr1071985 1769 1677 1449 732 548 203 11540 22260 2187 131
NM_145036chr172119 111 ------
NM_145044chr371607 1504 1229 688 619 596 465 --2644 62 --
NM_145176chr692968 2944 2821 2735 2389 2372 2305 628 206 33338 2490 1206 --1505
NM_145259chr2217133 7016 6732 6368 6344 6242 6174 6160 5267 5023 4616 4341 2461 2387 2267 2166 2033 1889 1785 1309 312 26658 460 56095 5603 5478 5201 4797 --
NM_145261chr36910 221 163 148 115 26 1762 157 --
NM_145263chr462177 2011 1564 942 539 146 --12323 --
NM_145284chrX62226 2208 1737 487 468 230 ------
NM_145307chr10244697 4640 4577 4344 3615 3558 3267 3080 3032 3004 2963 2893 2833 1727 1664 1382 1261 1227 951 901 573 559 545 362 44189 3503 3430 3128 13395 21796 273
NM_145320chr782395 2382 1280 1239 985 730 485 332 12480 ----
NM_145321chr782395 2382 1280 1239 985 730 485 332 12480 ----
NM_145322chr782395 2382 1280 1239 985 730 485 332 12480 ----
NM_145331chr63819 782 111 ------
NM_145686chr283422 3297 3268 2841 2377 2214 721 335 12659 12635 --
NM_145687chr283422 3297 3268 2841 2377 2214 721 335 12659 12635 --
NM_145698chr1021585 440 2385 281 11815 22191 407
NM_145716chr11397 ------
NM_145808chr7113158 3123 3105 2927 2761 2482 2412 1968 698 336 102 --2754 601 --
NM_147156chr1071491 1436 618 459 451 320 239 31500 1106 988 11205 --
NM_147175chrX41684 506 227 203 32206 367 297 1838 --
NM_147233chr252179 877 843 757 29 ------
NM_148174chr882184 2150 1610 1550 678 561 462 315 ----12064
NM_148904chr11593 ------
NM_148905chr11593 ------
NM_148906chr11593 ------
NM_148907chr11593 ------
NM_148908chr11593 ------
NM_148909chr11593 ------
NM_148957chr1362604 2476 2441 2352 603 573 22650 452 12134 --
NM_152132chr14296 31 ------
NM_152238chr14330 301 288 261 ------
NM_152261chr12112566 2166 2151 1888 1876 1772 926 633 311 198 54 21003 390 12000 163
NM_152263chr185683 4764 4714 2061 927 884 470 447 33968 1304 801 36022 5198 1512 --
NM_152277chr572094 1695 1599 1580 1569 1556 1348 --31718 651 103 --
NM_152300chr1771751 1575 1458 1195 719 545 334 --11900 --
NM_152332chr14102765 2750 2189 1967 1105 800 790 491 260 171 2857 266 ----
NM_152344chr1791489 1471 1167 1065 613 576 480 447 380 1552 ----
NM_152365chr11392 ------
NM_152366chr11105 ------
NM_152373chr18680 509 450 113 94 57 47 36 ------
NM_152388chr2123951 3776 3119 2858 2639 1227 1066 423 367 330 100 59 --33078 1134 576 --
NM_152390chr21695 ------
NM_152391chr251030 1015 306 158 90 ----2908 74
NM_152407chr5122702 2574 2478 2419 1178 965 874 614 540 470 435 269 --23289 953 --
NM_152417chr891283 1150 1142 993 327 274 266 237 46 21292 399 21217 76 --
NM_152420chr91772 ------
NM_152423chrX61357 1343 1316 500 436 179 156 ----
NM_152437chr1272290 1921 764 745 588 565 522 22345 1795 22054 1499 --
NM_152440chr122411 281 2457 173 --21169 117
NM_152450chr1541626 683 631 144 2720 443 1225 1422
NM_152457chr161277 ------
NM_152475chr1962700 2424 2198 1719 899 386 22665 2152 11770 11075
NM_152510chr225891 843 639 144 39 1862 1112 1153
NM_152522chr231060 1010 745 --1729 1782
NM_152529chr274289 3965 3910 3805 3521 3434 1700 64397 3396 2851 1691 1070 1024 13469 --
NM_152546chr541072 1010 353 305 ------
NM_152549chr55268 235 144 129 85 1241 --149
NM_152556chr7102588 2469 2163 2140 2130 2018 1630 1569 408 382 ----11585
NM_152564chr851912 1869 1850 1179 581 21761 1724 ----
NM_152597chr155791 717 629 229 77 3555 69 52 ----
NM_152608chr192538 2498 2484 2334 2219 2208 1925 1765 184 12521 ----
NM_152621chr41380 ------
NM_152622chr5153273 3244 2870 2662 2467 2422 2327 2214 2207 2188 2139 1138 967 418 393 23361 1265 22907 1018 --
NM_152624chr5247429 7191 7180 6760 6703 6601 6295 6029 5655 5128 4632 2980 2661 2548 2470 2423 2253 2066 1769 1484 1129 421 231 49 --17060 16834
NM_152629chr993296 3159 2953 2942 2559 1404 1354 1304 152 13707 --13107
NM_152635chr102412 393 1422 ----
NM_152636chr11153136 3032 2954 2700 2132 2121 1950 1927 993 973 911 849 783 546 284 22935 477 1842 --
NM_152638chr1291288 1232 1160 1134 1126 915 507 430 308 --1814 --
NM_152641chr12122770 2561 2436 2348 2208 1902 1844 1078 1069 781 605 376 32276 1917 108 ----
NM_152653chr33658 452 112 ------
NM_152678chr3102611 2558 2501 2280 1861 1099 1089 1073 648 336 22311 1851 --12739
NM_152682chr441277 493 298 145 61556 1361 1288 576 475 180 --11791
NM_152686chr542429 2400 2328 2117 1229 --21495 224
NM_152687chr591330 1287 1257 1210 1198 1066 1046 225 84 ------
NM_152688chr65890 759 730 657 340 ------
NM_152699chr3113780 3586 3288 3147 3126 1361 865 761 350 311 81 13482 21313 770 23525 2522
NM_152701chr771815 1702 1687 1552 785 643 482 21821 1802 11436 --
NM_152716chr1151229 531 524 341 156 --21625 1009 11237
NM_152724chr1072761 2715 2621 1916 630 348 158 22657 2134 --1695
NM_152754chr7173829 3765 3629 3526 3312 3290 3231 3109 2866 2841 2794 2555 1521 1042 865 578 130 23195 1329 23168 2767 11005
NM_152756chr5154221 3767 2872 2837 2786 2738 2683 2664 1621 1152 1092 922 889 376 277 23465 608 ----
NM_152758chr8182951 2864 2834 2799 2426 2316 2277 2207 1198 1039 1027 910 490 414 333 325 295 24 ------
NM_152765chr842348 906 610 559 11644 ----
NM_152774chr732289 1759 993 11877 12020 22516 1980
NM_152785chr382600 2335 1611 863 852 826 490 395 12258 ----
NM_152787chrX93840 3812 3629 3477 3147 2915 2837 995 392 23355 767 --13726
NM_152788chr122177 37 ------
NM_152793chr7135054 4563 4490 4327 3507 3412 1648 882 827 476 340 291 255 35040 4239 1379 21931 194 11307
NM_152832chr111500 ------
NM_152835chr192941 2744 2615 2189 887 598 213 154 117 2752 488 ----
NM_152836chr861699 1584 514 446 342 266 31900 281 153 1733 --
NM_152837chr861699 1584 514 446 342 266 31900 281 153 1733 --
NM_152838chr20103390 3194 2729 2671 2560 2362 2275 2183 1070 638 12281 1298 --
NM_152890chr141311 1058 806 115 1981 ----
NM_152896chr92338 185 --1818 --
NM_152902chr181986 1812 1529 1334 789 717 548 224 --21429 610 21824 243
NM_152903chr1372792 2754 2434 2060 378 338 80 32842 2777 469 42541 2333 50 37 --
NM_152924chr15126743 6309 5096 4773 2584 2562 2432 2119 1313 1016 768 323 --12758 --
NM_152995chr43777 55 48 1852 1595 --
NM_152999chr7165041 4969 4117 3967 3910 3622 3551 3475 3206 3119 1904 1776 1190 945 191 116 ----44701 4187 4110 3519
NM_153020chr691446 1397 1336 1273 1229 1215 1121 170 26 21199 417 11507 --
NM_153181chr184561 461 230 70 --2594 96 --
NM_153182chr3143198 3191 3181 2954 2632 2381 2250 1093 914 877 839 487 478 84 12960 22821 2347 --
NM_153184chr351602 1566 1492 1338 40 21553 725 1219 --
NM_153188chr5155524 5392 4794 4610 4562 4527 3668 3542 3527 2259 2059 1955 1516 821 487 85213 4725 4085 2224 1649 1450 1280 912 45560 5476 4105 3660 14297
NM_153201chr111217 --161 --
NM_153207chr12103937 3838 3820 3686 3617 3313 3151 1167 921 125 14092 33952 3474 1542 --
NM_153208chr161834 ------
NM_153223chr591331 1310 1047 604 582 562 408 222 34 --2293 41 --
NM_153226chr1071241 1170 1050 908 897 810 115 --1776 --
NM_153256chr1071854 1734 1613 1569 1551 1419 1407 11467 ----
NM_153261chr1641579 1453 1378 1338 21356 1041 --1280
NM_153262chr1153233 3195 2779 2735 2702 2642 2565 2510 2216 1999 1082 1021 595 589 135 22392 1209 12918 --
NM_153332chr8123288 3122 2016 1312 1295 1199 1076 971 764 509 381 348 172 2250 180 --
NM_153361chr52109 99 ------
NM_153365chr472647 2545 2067 1993 561 336 91 42131 1850 842 113 12029 --
NM_153371chr1362374 2314 451 345 157 45 12348 --1171
NM_153377chr124362 334 98 85 ------
NM_153456chr1395572 4803 4759 4158 1779 1489 1068 897 540 56333 6167 4986 2181 829 ----
NM_153605chr371634 1592 1271 1156 1059 498 384 ------
NM_153606chr1193 ------
NM_153607chr5143149 2782 2705 2582 2517 2310 2212 1154 1057 953 703 388 136 62 12561 ----
NM_153610chr55586 544 476 236 40 ------
NM_153619chr1583459 3426 3282 2517 2465 677 282 170 13228 ----
NM_153634chr12121631 1591 1519 1237 1205 1026 451 444 401 244 211 148 --1468 11174
NM_153645chr22103258 3223 3203 2739 2499 1203 936 547 275 159 12653 ----
NM_153686chr4132425 2336 1984 1937 1892 1772 1516 869 838 574 568 239 117 1671 1255 --
NM_153689chr241734 1676 899 65 --31911 1873 1485 --
NM_153757chr441036 781 411 117 31206 148 143 --1239
NM_153810chr10105065 4657 3638 3437 2032 1994 1883 1709 1026 290 ----11661
NM_170606chr781815 1705 1536 1265 695 594 584 503 --11173 --
NM_170665chr12114496 4408 4306 4022 3758 3716 3637 1775 840 745 389 --2131 84 --
NM_170710chr4103231 2968 2599 2534 2499 1214 540 345 263 141 2649 250 23175 2322 --
NM_170711chr191349 ------
NM_170719chr1371471 1346 1235 1011 339 267 203 --1553 --
NM_171998chrX42424 2221 1924 304 11558 1194 12007
NM_171999chr182720 210 ------
NM_172020chr751743 1406 637 562 42 11480 11395 11335
NM_172037chr871510 1435 1362 1304 1003 920 119 1149 1451 --
NM_172069chr241840 852 432 156 --11980 11634
NM_172070chr262158 1956 1641 1626 1590 1411 31942 755 217 22185 592 --
NM_172071chr1207490 7188 5668 5209 4798 4789 4764 4621 2896 2603 2514 2069 1888 1857 1747 1663 1066 793 601 244 47499 6273 5262 1387 56856 6116 5491 2792 2431 11361
NM_172103chr6112430 2295 2216 2159 2109 1964 1865 1086 619 157 93 1491 32247 432 51 --
NM_172105chr6112430 2295 2216 2159 2109 1964 1865 1086 619 157 93 1491 32247 432 51 --
NM_172110chr201689 ------
NM_172111chr201689 ------
NM_172112chr201689 ------
NM_172113chr201689 ------
NM_172159chr392045 2003 1970 1867 1685 1607 1600 1581 947 21952 455 1410 --
NM_172160chr392045 2003 1970 1867 1685 1607 1600 1581 947 21952 455 1410 --
NM_172216chr1242886 1060 576 446 ------
NM_172230chr1121068 843 ------
NM_172240chr1281360 1322 1281 1238 1020 923 872 288 1214 ----
NM_172242chr105919 233 92 79 69 --2144 104 1355
NM_172337chr143948 688 38 1906 1318 --
NM_172373chr13111377 1327 1304 941 875 865 467 344 312 183 83 21157 399 ----
NM_173039chr112256 227 ------
NM_173081chr102104 91 ------
NM_173084chr362254 1588 1502 538 524 25 --22421 1935 --
NM_173164chr16184 ------
NM_173177chr25638 438 142 118 94 ------
NM_173214chr16218206 7897 7119 6623 6610 6442 6249 5875 5351 5297 5015 3146 3059 2768 2537 2093 1176 1103 788 311 127 44998 2758 1811 757 25256 2982 --
NM_173355chr22217 113 2793 210 1685 1182
NM_173468chr4176030 5410 5289 5261 5242 4946 4603 4594 4297 4224 3804 2375 1841 1775 1622 338 217 45162 1588 1368 1082 24775 1340 15836
NM_173469chr15111542 1436 1416 1386 1295 1092 1057 1031 558 521 448 1159 ----
NM_173473chr1052543 870 528 485 325 --22678 106 --
NM_173490chr5163 ------
NM_173495chrX82604 2390 2303 2277 2262 2077 2010 74 --1633 --
NM_173510chr2241969 1130 565 295 1351 ----
NM_173511chr283693 3174 3130 3014 2868 2651 2635 518 --13651 13308
NM_173519chr862032 1959 1853 1323 1294 285 21693 1553 1305 21876 498
NM_173531chr19203855 3820 3771 3734 3642 3280 3095 2919 2844 2714 2542 2507 2381 1416 1366 1205 1006 878 268 111 42742 1312 1047 302 23475 3106 --
NM_173536chr4154956 4487 3803 3251 3232 1604 1368 1297 986 827 342 289 281 242 83 --34591 1225 43 --
NM_173552chr361979 1589 1004 617 514 477 12422 ----
NM_173576chr1031884 1841 1704 41979 1827 1653 166 21609 1489 --
NM_173582chr11135899 5758 5679 4900 4586 4280 3963 2258 2126 1955 1024 612 172 36126 1669 1006 1980 --
NM_173607chr14112108 2037 1937 1516 1397 1350 800 680 509 338 35 41791 384 295 109 1409 --
NM_173642chr199241 8848 7683 6830 6755 3197 1917 1797 422 26373 2632 37817 7395 671 --
NM_173654chr331695 872 66 --1443 --
NM_173665chr53236 195 81 ------
NM_173670chr541019 332 150 92 11025 ----
NM_173685chr81216 ------
NM_173694chrX72022 1597 889 533 471 399 355 1243 --1709
NM_173808chr1104331 4282 4037 3959 3861 3052 886 734 671 599 11442 21609 514 23340 1094
NM_173814chr151183 ------
NM_173822chr262055 2046 1838 1705 1346 645 11545 11633 --
NM_173825chr362865 2197 1214 1113 931 620 42998 2153 957 225 12972 --
NM_173826chr361719 1551 1408 1347 409 63 150 ----
NM_173829chr5246227 6173 6122 5597 5487 5169 4204 4076 2200 2078 2058 2027 1693 1572 1445 1422 1224 897 858 574 504 304 190 27 36105 5162 4849 45695 4814 4798 2379 --
NM_173851chr8113980 3804 3754 3578 3500 3049 3002 2878 2461 1173 339 43213 2945 1280 241 43458 2814 617 526 --
NM_174890chr102717 332 ------
NM_174911chr893893 3800 3734 3638 3083 1591 1311 1236 1048 23557 2989 ----
NM_174921chr42390 369 ------
NM_175038chr121201 ------
NM_175056chr391787 1764 1587 1453 1409 662 652 389 120 --22075 79 --
NM_175061chr781941 1914 1685 1591 567 311 126 113 12063 ----
NM_175610chr1551416 1227 447 55 24 1990 11380 --
NM_175623chr12146940 6583 6512 5971 4896 4734 4681 2058 1653 1264 1048 341 276 54 32856 2042 1913 25668 1286 15823
NM_175624chr12147035 6678 6607 6066 4991 4829 4776 2153 1748 1359 1143 436 371 149 32951 2137 2008 25763 1381 15918
NM_175625chr12147035 6678 6607 6066 4991 4829 4776 2153 1748 1359 1143 436 371 149 32951 2137 2008 25763 1381 15918
NM_175847chr191151 ------
NM_175854chr13102596 2174 2094 789 663 652 632 618 454 231 --11050 --
NM_175856chr52714 266 ------
NM_175861chr12145965 5545 4866 4700 4554 4352 3780 1734 1685 1347 1144 992 982 555 11759 35571 1331 1132 --
NM_175873chr561320 1027 941 554 454 378 ------
NM_175907chr1842445 2232 1968 522 12648 22092 292 --
NM_175920chr53679 575 222 ------
NM_175921chr5114069 3963 3914 3694 3667 3617 3050 2801 2681 369 92 33475 2662 360 13118 --
NM_176081chr10195893 5655 5568 5533 5047 5030 4653 4482 4386 4371 4038 1874 1803 1628 1091 962 947 736 560 12066 15451 24815 104
NM_176083chr10195893 5655 5568 5533 5047 5030 4653 4482 4386 4371 4038 1874 1803 1628 1091 962 947 736 560 12066 15451 24815 104
NM_176814chr761501 1465 1008 527 126 58 --1439 --
NM_177401chr1931642 1607 1439 ------
NM_177414chr191769 1756 1649 1562 1316 1156 647 498 393 --1551 --
NM_177438chr14124014 3939 3697 3051 2796 1357 1116 462 403 255 106 65 --11321 --
NM_177452chr1461986 1816 629 622 546 394 5913 805 614 322 45 32270 535 426 12284
NM_177531chr82301 177 1857 --2896 270
NM_177538chr2118611 8164 7732 6489 5762 3398 3386 2673 2185 134 30 18692 12374 23428 3326
NM_177556chrX181 ------
NM_177952chr144687 546 335 191 --1835 --
NM_177974chr1532258 1514 1434 12338 --12277
NM_177985chr262225 1619 1519 866 303 26 31746 872 208 --1860
NM_177989chr33372 241 130 ------
NM_177990chr20101776 1754 1620 1494 1356 1327 1261 785 610 32 ------
NM_178011chr1062541 2423 2414 2001 1146 167 43061 2959 725 421 21286 200 13250
NM_178033chr13377 174 47 ------
NM_178042chr33372 241 130 ------
NM_178140chr572577 2371 1972 997 960 866 770 1555 2971 938 --
NM_178151chrX147200 6682 6657 6376 6256 6024 2874 2523 2215 1628 1600 1248 695 218 36527 5729 2975 22969 1468 --
NM_178152chrX147200 6682 6657 6376 6256 6024 2874 2523 2215 1628 1600 1248 695 218 36527 5729 2975 22969 1468 --
NM_178153chrX147200 6682 6657 6376 6256 6024 2874 2523 2215 1628 1600 1248 695 218 36527 5729 2975 22969 1468 --
NM_178171chr172544 215 ------
NM_178270chrX4940 906 674 659 1930 ----
NM_178313chr231822 1675 278 --21815 653 --
NM_178426chr151792 1548 1492 825 778 ----11529
NM_178427chr161692 1448 1392 901 725 678 ----11429
NM_178450chr51660 ------
NM_178509chr17134087 3880 3732 3618 3394 3300 3198 3138 3072 3024 2729 1305 682 22928 1534 11231 --
NM_178526chr1912005 ------
NM_178566chr951588 493 451 346 195 21721 1236 1397 --
NM_178585chr4103256 3191 3060 2846 2779 2531 2099 1096 570 453 12785 ----
NM_178812chr851628 1278 1113 432 102 --11615 --
NM_178839chr21238 ------
NM_178868chr34339 270 261 124 ------
NM_180989chr13102457 2029 1868 1723 947 916 667 536 367 32 1864 ----
NM_181265chr4103231 2968 2599 2534 2499 1214 540 345 263 141 2649 250 23175 2322 --
NM_181291chr141278 ------
NM_181332chrX52462 2299 2040 1920 1839 11089 ----
NM_181358chr1134282 3924 3251 3194 3162 1503 1355 1261 970 843 792 777 219 1805 21711 1204 --
NM_181443chr2072907 2770 2716 1052 731 723 336 11987 1560 --
NM_181453chr271755 1558 1180 1158 594 321 263 --1339 1701
NM_181481chr18147002 6284 6141 5200 5001 4364 2801 2698 2556 1559 1064 1007 859 387 12772 ----
NM_181482chr18147002 6284 6141 5200 5001 4364 2801 2698 2556 1559 1064 1007 859 387 12772 ----
NM_181483chr18147002 6284 6141 5200 5001 4364 2801 2698 2556 1559 1064 1007 859 387 12772 ----
NM_181492chr2251138 1123 409 321 114 ------
NM_181521chr16137268 6803 6579 6100 5931 4834 2137 1877 1011 948 728 326 100 --1744 --
NM_181527chr203356 150 35 ------
NM_181532chrX1219 ------
NM_181575chr21131 ------
NM_181659chr20103293 3258 2732 2466 2372 1225 1065 961 930 348 12292 1503 --
NM_181659chr20103293 3258 2732 2466 2372 1225 1065 961 930 348 12292 1503 --
NM_181705chr5165782 5767 5521 5434 5340 4672 4331 3762 1327 1224 1124 983 791 427 386 139 44480 4358 396 117 11293 --
NM_181713chr22362 264 1301 ----
NM_181714chr6101970 1960 1944 1741 1543 1391 1246 360 246 126 21849 1764 11469 --
NM_181723chr872288 2262 1998 1655 1598 1528 483 52158 1965 1780 1768 1727 22040 154 --
NM_181746chr14941 885 871 752 ------
NM_181782chr662040 1946 1925 918 639 575 11729 1775 --
NM_181783chr1281963 1798 1612 1346 1233 615 430 324 11331 ----
NM_181787chr8143546 3519 3359 3327 1189 1063 864 851 799 759 663 480 319 190 21510 510 --22990 1295
NM_181809chr134054 3078 75 ------
NM_181836chr5102557 2501 2392 2199 2113 1718 675 360 223 99 32078 1843 893 ----
NM_181838chr541374 1132 564 291 11245 1544 --
NM_181861chr1282819 2121 1921 1043 476 444 45 36 22695 1848 ----
NM_181868chr1282819 2121 1921 1043 476 444 45 36 22695 1848 ----
NM_181869chr1282904 2206 2006 1128 561 529 130 121 22780 1933 ----
NM_181897chr382710 2350 2334 2049 1747 876 699 41 --12618 --
NM_182314chrX61769 1450 668 437 249 106 ----11780
NM_182485chr4103725 3641 3601 3589 3536 3095 2707 2306 1337 1282 33765 3337 949 11246 --
NM_182492chr221320 ------
NM_182493chr16145398 5182 4537 4479 3783 3674 3283 1544 899 884 668 603 309 80 25176 4565 ----
NM_182503chr6205432 4958 4730 4544 4441 4280 4078 3839 3791 3746 3651 3426 3403 2017 1702 1476 1413 1146 931 494 33671 1224 769 1483 14923
NM_182515chr19156434 6066 6030 5828 4976 4923 4443 4289 2525 2498 2307 2268 1449 1277 532 34880 2472 664 15429 --
NM_182524chr44667 586 101 52 ------
NM_182529chr7133 ------
NM_182551chr273422 3103 2640 2609 720 689 185 13597 --11003
NM_182643chr872431 1877 1794 911 594 484 285 --12336 --
NM_182646chr4103725 3641 3601 3589 3536 3095 2707 2306 1337 1282 33765 3337 949 11246 --
NM_182700chr781983 1945 1933 1835 1736 1570 1318 1219 ----11304
NM_182757chr6103366 2456 2449 2175 1391 1306 1127 1114 879 727 --22743 736 23488 2323
NM_182758chr1583392 3294 3109 1399 1191 1005 326 237 11452 128 23054 355
NM_182762chr7136193 6187 5860 5849 4858 4390 3791 1853 1676 1450 1417 375 366 23913 2375 ----
NM_182765chr1081979 1896 1784 1658 845 629 328 126 22194 2165 12007 --
NM_182789chr541093 781 440 313 ----11064
NM_182796chr54824 693 263 34 1251 ----
NM_182830chr1451498 842 802 643 499 42202 2158 1675 1549 ----
NM_182854chr161323 ------
NM_182896chr371780 1663 605 528 306 219 212 2618 372 21824 1409 --
NM_182898chr7136280 6017 5853 5814 5799 5479 5071 4596 2335 2315 2286 2073 378 15805 26008 2294 11638
NM_182899chr7136280 6017 5853 5814 5799 5479 5071 4596 2335 2315 2286 2073 378 15805 26008 2294 11638
NM_182911chr22109 92 ------
NM_182931chr73682 289 28 ------
NM_182948chr152818 2119 1043 900 585 --22530 820 12318
NM_182983chr191265 ------
NM_183049chr41113 ------
NM_183050chr662401 2195 2111 2013 933 905 12021 12217 --
NM_183227chr661306 462 425 321 292 132 129 ----
NM_183234chr1561739 1704 1402 730 480 473 --21560 759 --
NM_183235chr1561739 1704 1402 730 480 473 --21560 759 --
NM_183236chr1561739 1704 1402 730 480 473 --21560 759 --
NM_183238chr1283523 3465 3126 2794 884 526 301 121 --1800 11127
NM_183323chr541093 781 440 313 ----11064
NM_183353chrX41205 343 232 93 --1113 1396
NM_183376chr1571834 1752 1601 1034 990 922 695 22522 1025 ----
NM_183393chr34838 725 407 236 2857 781 ----
NM_183394chr34838 725 407 236 2857 781 ----
NM_183398chr581376 1105 919 286 271 245 192 185 1931 1502 11016
NM_183399chr581376 1105 919 286 271 245 192 185 1931 1502 11016
NM_183400chr581376 1105 919 286 271 245 192 185 1931 1502 11016
NM_183401chr581376 1105 919 286 271 245 192 185 1931 1502 11016
NM_184085chr87875 800 784 756 731 645 568 ------
NM_184086chr87875 800 784 756 731 645 568 ------
NM_184087chr87875 800 784 756 731 645 568 ------
NM_194071chr7135492 5436 5370 5342 5301 5295 4758 4681 4265 4184 3543 3357 3304 ------
NM_194247chr2124319 3850 3799 3462 3447 1549 1321 1079 912 692 511 337 24077 679 24112 1293 23727 3589
NM_194282chr4112543 2474 2281 2137 894 740 308 234 188 177 154 22461 1996 1210 --
NM_194283chr5114098 3750 3729 3219 3125 3054 2908 1603 660 484 189 --3349 209 38 --
NM_194285chr11103289 3230 3099 3056 2299 2169 956 815 573 92 --2996 692 --
NM_194291chr8133014 2899 2517 2487 2437 2402 1952 1114 1076 1029 1014 811 54 ------
NM_194301chr145753 282 268 147 137 21088 179 --1895
NM_194314chr1155558 4941 4304 4268 4086 3975 3579 2182 1041 959 790 773 501 258 68 1724 13958 --
NM_194317chr262592 1669 1038 940 471 414 11857 21711 780 --
NM_194318chr1352584 2414 2344 892 567 1846 11857 --
NM_194328chr9143277 3264 3210 3160 2919 2878 2745 2405 2345 2318 1003 962 841 758 ------
NM_194329chr9143277 3264 3210 3160 2919 2878 2745 2405 2345 2318 1003 962 841 758 ------
NM_194330chr9143277 3264 3210 3160 2919 2878 2745 2405 2345 2318 1003 962 841 758 ------
NM_194332chr9143277 3264 3210 3160 2919 2878 2745 2405 2345 2318 1003 962 841 758 ------
NM_194434chr18165114 4945 4464 4439 3965 3588 2301 2018 1860 1512 1321 924 772 467 396 352 25744 973 15385 --
NM_194442chr181772 1724 1643 1298 1211 504 454 376 ------
NM_194463chrX81250 1172 1053 958 906 146 86 77 2812 506 ----
NM_198066chr1462927 1886 994 608 402 183 51111 752 677 480 190 2883 820 --
NM_198120chr82581 445 ----1437
NM_198123chr871795 1590 1502 1162 1115 536 492 11246 ----
NM_198124chr871795 1590 1502 1162 1115 536 492 11246 ----
NM_198128chr1862176 2007 727 486 458 291 1177 22263 782 --
NM_198181chr15162714 2616 2399 2222 2211 1914 1888 1090 1047 641 262 242 212 182 154 124 ------
NM_198212chr792369 2220 1943 1651 917 869 510 206 191 32081 1812 384 ----
NM_198268chr1134282 3924 3251 3194 3162 1503 1355 1261 970 843 792 777 219 1805 21711 1204 --
NM_198269chr1134282 3924 3251 3194 3162 1503 1355 1261 970 843 792 777 219 1805 21711 1204 --
NM_198270chrX143309 3162 3058 2697 2573 2489 2466 917 727 658 614 487 136 129 1715 ----
NM_198273chr5103009 2896 2736 2368 2212 1222 982 337 293 231 62651 2272 2180 2125 2112 576 ----
NM_198281chr493500 3491 3369 2359 2313 1144 564 550 33 1588 32378 860 822 12659
NM_198320chr1275218 4475 4406 4152 3214 1599 530 --15209 13268
NM_198329chr351504 1470 1060 988 510 1999 1119 11174
NM_198336chr771681 1396 1389 1253 1215 1168 439 --11820 --
NM_198353chr42445 200 ------
NM_198390chr161535 ------
NM_198391chr2081473 1408 1380 1011 515 460 452 338 --11206 --
NM_198399chr351568 1503 1210 423 49 31676 342 39 2685 76 --
NM_198400chr15112743 2447 2342 2158 1084 906 877 858 312 304 179 --1556 --
NM_198447chr11277 ------
NM_198465chrX102768 2738 2034 1921 1061 848 751 256 111 77 1337 ----
NM_198468chr654539 4003 3719 3569 575 14456 11611 23095 254
NM_198484chr3135692 5122 5091 5013 4954 4062 2280 1826 1746 1417 1147 1091 931 56413 6353 6315 1321 1079 15886 24781 1488
NM_198503chr1102131 1958 1901 1844 911 800 393 248 215 82 ----1230
NM_198511chrX71490 1479 1394 1202 1185 574 535 --1154 --
NM_198513chr881956 1895 1705 1456 1324 1253 816 424 21815 1447 1561 --
NM_198549chr162572 1279 594 573 269 178 62215 2108 1095 1090 1081 729 ----
NM_198567chr52201 164 ------
NM_198569chr6112698 2579 2452 1928 1883 1769 731 651 636 573 341 --12266 --
NM_198578chr1291489 1283 1173 1076 540 506 459 354 146 ------
NM_198581chr2167480 7322 6735 6262 2990 2751 2396 1716 1593 1562 1387 1211 1205 939 911 285 67408 7339 5870 5807 2409 100 37549 3010 1093 12939
NM_198584chr8112687 2556 2463 2350 2140 2078 1941 1930 1900 1886 339 32153 977 773 --1651
NM_198715chr1246115 6092 5175 5110 4792 4485 4384 3822 2321 2115 1931 1702 1437 1418 1102 1004 862 806 612 574 331 242 129 67 35662 2482 1899 42498 2397 1670 1497 14016
NM_198723chr201153 ------
NM_198793chr3144185 4123 4069 3855 3686 3611 3553 3492 3083 2946 2778 1376 340 158 22749 519 11657 --
NM_198794chr1441052 545 401 345 ------
NM_198859chr374100 3988 2007 1948 776 299 73 --14710 1396
NM_198904chr5121901 1886 1670 1600 828 669 458 404 136 108 77 67 11521 1333 --
NM_198935chr2073228 2741 2602 1124 1113 901 81 --1884 --
NM_198947chr1141083 879 688 117 ------
NM_198956chr781983 1945 1933 1835 1736 1570 1318 1219 ----11304
NM_198965chr122432 377 ------
NM_198966chr122432 377 ------
NM_198968chr13183954 3707 3660 3484 3437 3118 3024 2954 1399 1162 1151 843 750 685 651 510 453 327 23395 362 1870 --
NM_198990chr7143281 3242 3222 3197 3145 2882 2869 2463 1064 1002 861 421 243 106 1943 ----
NM_198991chr182744 575 ------
NM_198992chr123991 470 325 ----11330
NM_198993chr1711738 ------
NM_199000chr772152 2054 759 510 371 174 168 --22299 1832 1437
NM_199040chr1263460 2653 2460 1096 918 850 --42810 2596 594 103 --
NM_199072chr7143238 3229 2784 2734 2697 2260 2148 2134 1147 1133 865 714 271 212 43105 2891 1278 1139 ----
NM_199188chr12143977 3919 3821 3639 3320 3153 2553 1577 1381 1139 982 613 595 187 23491 1550 33054 2978 992 --
NM_199190chr12143977 3919 3821 3639 3320 3153 2553 1577 1381 1139 982 613 595 187 23491 1550 33054 2978 992 --
NM_199246chr561232 818 423 227 188 182 2870 432 1829 --
NM_199320chr482618 1908 1097 365 314 300 215 157 ----12058
NM_199320chr482618 1908 1097 365 314 300 215 157 ----12058
NM_199324chr4133768 3695 3184 2362 2351 1493 890 680 424 343 335 307 260 12910 --11236
NM_199327chr43989 432 416 ------
NM_199421chr14185084 5070 5060 5035 4892 4653 4403 4283 3120 2025 1919 1231 1023 1002 733 608 502 192 24864 4308 53245 3206 1470 636 127 --
NM_199436chr293023 2825 2605 2590 1931 1245 537 506 480 13078 21050 94 42710 2575 2117 246
NM_199437chr1192487 2270 2099 1876 1843 1750 1641 500 237 --21936 568 --
NM_199438chr1192487 2270 2099 1876 1843 1750 1641 500 237 --21936 568 --
NM_199439chr1192487 2270 2099 1876 1843 1750 1641 500 237 --21936 568 --
NM_199440chr21291 ------
NM_199482chr282061 1892 1749 1686 1300 569 535 208 31719 676 162 --11711
NM_201269chr171474 1192 1047 536 473 45 34 2124 78 1451 --
NM_201436chr75764 590 341 332 98 1541 ----
NM_201517chr75764 590 341 332 98 1541 ----
NM_201521chr61402 ------
NM_201522chr61402 ------
NM_201523chr61402 ------
NM_201591chr431697 182 165 11620 1579 --
NM_201592chr431697 182 165 11620 1579 --
NM_201624chr121109 200 ------
NM_203281chrX1357 ------
NM_203282chr19101851 1759 1576 1550 1511 1374 1361 702 619 179 41524 1316 1309 1248 ----
NM_203290chr61142 ------
NM_203341chr13205 193 86 --1834 1398
NM_203354chr145836 643 365 286 154 2371 175 ----
NM_203355chr145836 643 365 286 154 2371 175 ----
NM_203356chr145836 643 365 286 154 2371 175 ----
NM_203372chr251732 1647 1353 458 259 ------
NM_203390chr841893 1850 1839 1704 191 ----
NM_203391chrX61851 1784 1490 1174 1166 506 ----1533
NM_203403chr931238 1031 394 --2980 340 --
NM_203406chr5102847 2652 2043 1007 860 628 621 597 198 163 1968 22161 511 --
NM_203451chr1392368 2083 1864 1826 1659 1504 891 530 486 ------
NM_203458chr1113682 3648 3521 3175 1261 1025 1018 712 650 551 136 23515 562 149 --
NM_203459chr1102309 2025 2001 1933 848 792 744 653 602 40 11774 31889 1864 289 --
NM_203463chr2113833 3707 3404 3362 3332 3318 1296 644 628 456 63 ------
NM_205852chr124829 803 466 350 1582 3741 505 177 --
NM_205862chr24738 728 154 79 2721 118 1639 1280
NM_206594chr193578 3206 2701 2498 2456 2247 1216 808 730 --1396 --
NM_206595chr193578 3206 2701 2498 2456 2247 1216 808 730 --1396 --
NM_206853chr6103930 3436 3306 3221 3175 1198 1104 1034 465 228 42620 1658 1413 1081 32848 950 44 --
NM_206854chr6115191 4697 4567 4482 4436 1726 1489 1060 1041 514 388 23881 1110 34109 1305 124 11051
NM_206855chr6166156 5662 5532 5447 5401 4109 4036 3931 2454 2025 2006 1479 1353 792 387 162 34846 3884 2075 65074 3943 2270 1089 812 106 12016
NM_206866chr21123286 3275 2973 2914 2813 2717 2647 2253 2154 2127 686 541 ------
NM_206876chr2133569 3474 3434 3401 3289 3127 2956 2807 2201 1057 300 218 146 13048 13069 --
NM_206907chr5123270 3094 2527 2476 2377 2248 2172 2045 1249 1106 854 361 43070 2429 239 181 12079 --
NM_206909chr8128330 8283 8092 7601 5683 5438 3147 2030 1952 1650 895 410 46350 1613 1124 261 32943 2584 1869 12004
NM_206927chr116944 908 824 249 217 180 1893 ----
NM_206928chr116944 908 824 249 217 180 1893 ----
NM_206929chr116944 908 824 249 217 180 1893 ----
NM_206930chr116944 908 824 249 217 180 1893 ----
NM_206943chr25939 861 794 339 326 ------
NM_207012chr1093535 2757 2327 1148 1104 1031 999 932 363 --12395 --
NM_207015chr382409 1645 1595 1473 656 548 205 145 12252 --22171 2036
NM_207122chr1151121 1113 1069 282 26 ------
NM_207303chr10204186 3903 3764 3650 3402 3324 3314 3134 3057 2796 2762 2663 2617 2538 1402 1385 872 520 451 363 1250 21586 935 11184
NM_207304chr1362524 2334 1642 883 571 75 21922 1892 1698 2928 562
NM_207325chr1961845 1775 1764 1459 228 122 21491 1319 --11513
NM_207361chr13186239 6020 5617 5357 5255 5123 4959 4525 2534 2523 2459 2248 1080 885 614 608 153 66 21979 670 15465 16161
NM_207396chr111872 ------
NM_207406chr4196363 5954 5730 4753 4250 4119 2371 2070 1971 1955 1452 1440 1300 1097 889 764 432 252 237 15613 1881 14905
NM_207413chr83461 434 291 1347 ----
NM_207445chr15101817 1670 1542 1330 842 629 600 434 255 188 1348 1428 --
NM_207481chr281469 1405 1238 1205 1032 998 548 63 131 ----
NM_207491chr441492 1108 610 47 --1309 --
NM_207517chr1542005 1838 1275 1267 11707 1106 --
NM_207647chr992608 2555 2249 1886 1806 1585 975 532 352 12427 22299 568 --
NM_207660chr1471620 1611 1546 1403 1098 526 170 11684 1245 --
NM_207661chr1471620 1611 1546 1403 1098 526 170 11684 1245 --
NM_207662chr1471620 1611 1546 1403 1098 526 170 11684 1245 --
NM_212471chr17162314 2267 2153 2065 1955 1942 1836 1818 1708 1578 1565 1550 724 705 195 177 1318 1823 --
NM_212472chr17162314 2267 2153 2065 1955 1942 1836 1818 1708 1578 1565 1550 724 705 195 177 1318 1823 --
NM_212558chr9113351 3266 3152 2942 2881 1578 848 817 707 413 273 33986 3530 1291 54302 3659 2976 1096 1079 --
NM_213589chr2125613 5007 4797 4654 4607 3888 2017 1986 1480 1430 592 72 35468 3943 3534 ----
NM_213611chr123419 388 27 ------
NM_213651chr181786 1666 1301 534 426 417 381 266 1676 --1161
NM_213662chr1732104 1902 306 1612 --11925