TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3200-3p
miRNA Sequence: CACCUUGCGCUACUCAGGUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr5105674 4310 4253 2121 2020 1724 1696 1430 1332 519 ------
NM_000495chrX11165 ------
NM_000793chr1464948 4346 3879 3584 497 52 --14312 --
NM_000806chr511513 ------
NM_000813chr554016 1226 379 188 26 13592 ----
NM_000826chr42310 39 11832 11739 --
NM_000845chr71130 ------
NM_000899chr1263840 1763 1148 1055 994 679 ------
NM_000933chr201227 ------
NM_000935chr3----11143 --
NM_001001928chr2287892 7502 5619 5127 3268 3253 1988 655 18328 --11484
NM_001002843chr151108 ------
NM_001003674chr18116961 5142 4849 4577 4319 2788 2364 1173 544 454 256 1515 34987 2414 1080 --
NM_001003675chr18116961 5142 4849 4577 4319 2788 2364 1173 544 454 256 1515 34987 2414 1080 --
NM_001005375chrY1351 ----11766
NM_001005404chr1793987 3874 3315 1386 1300 869 774 631 304 12740 ----
NM_001005473chr514186 ----1799
NM_001007023chr1464948 4346 3879 3584 497 52 --14312 --
NM_001008408chr765122 4290 2158 1583 947 553 --34519 847 734 --
NM_001008801chr191275 11931 3616 263 106 --
NM_001009993chr274160 3623 3371 1555 1269 1154 756 --34206 1397 602 13364
NM_001010867chr1156612 6417 4772 2531 1401 1178 1109 1102 1019 700 683 482 417 289 69 --12378 --
NM_001013659chr1934786 3735 1599 ----14859
NM_001014434chr11261 ------
NM_001015508chr8180 ------
NM_001017440chr771885 1661 1040 916 466 189 144 --16162 15342
NM_001018089chr1583357 2894 2672 2454 1254 975 761 236 ------
NM_001025580chrX23247 3108 ----14251
NM_001031732chr413358 ------
NM_001031812chr51891 11487 --11838
NM_001032393chrX1591 ------
NM_001033057chr31373 ------
NM_001039590chrX33730 2686 520 --23873 1200 --
NM_001039591chrX33730 2686 520 --23873 1200 --
NM_001039762chr1032307 748 464 ----22294 177
NM_001042453chrX21331 194 ------
NM_001042473chr1011421 ------
NM_001042599chr247000 1361 1315 278 12775 16598 16617
NM_001042603chr1245075 5003 4081 723 24222 1577 43488 3430 3372 3314 12111
NM_001044722chr51891 11487 --11838
NM_001044723chr51891 11487 --11838
NM_001083620chr42309 39 11830 11738 --
NM_001100108chr1128336 7025 6451 5476 5064 2695 2413 2385 2280 328 233 217 11733 16737 --
NM_001106chr399118 8900 8217 8047 3697 2315 2223 1784 1394 --23333 1484 --
NM_001167chrX86233 5978 5668 5153 1695 1647 1188 996 1182 ----
NM_001289chrX11035 ------
NM_001300chr101408 ------
NM_001351chr331742 1695 255 ------
NM_001396chr2132282 754 530 --11005 1996
NM_001431chr6----1373 --
NM_001681chr12133 ------
NM_001704chr6--123 --1239
NM_001884chr51225 ------
NM_001932chr17----1643 --
NM_002336chr1234902 4710 1859 ------
NM_002481chr1107690 7173 7047 6613 5126 2577 2112 2096 1045 518 --15795 --
NM_002547chrX53244 2703 1316 878 593 13686 --11233
NM_002643chr2142 ------
NM_002656chr61358 ------
NM_002717chr81213 ------
NM_002868chr121525 ------
NM_003012chr882900 2513 1040 992 890 545 518 210 22721 188 ----
NM_003034chr1267297 5858 5245 3083 2780 1603 31443 339 34 --1973
NM_003091chr201217 ------
NM_003188chr61531 ------
NM_003221chr652732 1376 1284 1243 676 11065 --12739
NM_003320chr11113410 3019 2789 1725 1475 1093 1080 803 789 365 182 --14199 --
NM_003413chrX11357 ------
NM_003470chr1691806 1758 1692 1463 1309 699 310 251 28 11880 11358 --
NM_003489chr21------12606
NM_003583chr1263266 3233 1134 964 582 374 --11038 --
NM_003705chr21808 ------
NM_003797chr11176 ------
NM_003994chr1263840 1763 1148 1055 994 679 ------
NM_004081chrY1351 ----11766
NM_004130chr32587 271 ------
NM_004171chr1178366 7807 5874 2576 1889 1883 1481 48675 7416 3290 2876 13065 --
NM_004338chr18116961 5142 4849 4577 4319 2788 2364 1173 544 454 256 1515 34987 2414 1080 --
NM_004384chr51891 11487 --11838
NM_004458chrX41968 995 812 453 12465 --21633 97
NM_004499chr5------1460
NM_004520chr5169 ------
NM_004569chr14----1203 --
NM_004705chr11----158 --
NM_004772chr511070 --11137 21617 594
NM_004788chr1112026 ------
NM_004956chr743317 3304 1624 22 ----24431 1541
NM_005036chr2287892 7502 5619 5127 3268 3253 1988 655 18328 --11484
NM_005056chr1255319 5247 4325 967 159 24466 1821 43732 3674 3616 3558 --
NM_005080chr221675 ------
NM_005156chr911163 --1952 --
NM_005159chr1561775 1629 1546 847 389 276 12232 1832 --
NM_005188chr1167769 7740 5038 2435 1118 445 --16755 16064
NM_005222chr71379 ------
NM_005235chr247000 1361 1315 278 12775 16598 16617
NM_005329chr1682201 1617 623 552 216 208 74 41 --11678 --
NM_005336chr282127 2046 1718 516 510 226 135 126 --1708 --
NM_005455chr1----11708 11253
NM_005520chr51584 ------
NM_005665chr164397 3501 3004 1376 431 245 --11839 --
NM_005840chrX87315 6995 6978 6516 5750 2984 2253 1895 14965 11977 --
NM_005863chr10174 ------
NM_005941chr853959 3799 3485 3454 2634 13645 ----
NM_006145chr191737 ------
NM_006252chr166672 5935 5892 1741 1135 325 ----25756 1291
NM_006306chrX75391 5367 4732 4677 4546 4240 649 25544 4256 ----
NM_006371chr364554 1787 1567 1441 1416 1238 11198 23267 1653 --
NM_006416chr61305 ------
NM_006454chr492699 2460 2091 2047 732 547 425 220 212 --12927 --
NM_006482chr1263266 3233 1134 964 582 374 --11038 --
NM_006546chr1775327 4963 2597 2587 1309 1065 242 11644 --1848
NM_006717chr91186 ------
NM_006718chr61358 ------
NM_006805chr51407 ------
NM_006828chr6----1439 --
NM_006982chr12----1237 --
NM_007007chr122788 105 --24582 1297 --
NM_007050chr20167683 7374 6908 6266 5853 5819 5798 3096 3027 2835 2487 2212 1063 791 736 273 16464 12511 --
NM_007107chr341752 766 645 78 1598 169 11523
NM_007249chr1387784 7683 7293 6113 2494 1459 1243 64 1917 ----
NM_012137chr161879 727 533 272 181 45 ----12695
NM_012160chr61381 ------
NM_012290chr211376 ------
NM_012294chr794010 3776 3118 2729 1378 1143 978 718 603 ----1694
NM_012428chr151152 ------
NM_012482chr12538 477 ------
NM_013231chr1464031 2859 1552 1317 654 268 23064 411 24163 3881 --
NM_013283chr51830 ------
NM_013989chr1464948 4346 3879 3584 497 52 --14312 --
NM_014007chr941133 1021 367 245 ----11232
NM_014016chr3191 11651 --11159
NM_014048chr1674748 4532 4379 1085 1021 848 831 --23597 3273 --
NM_014155chr1177533 7487 6820 6719 5275 5234 899 16014 ----
NM_014181chr252349 2287 2082 440 290 1412 22413 2342 --
NM_014612chr9142 ------
NM_014674chr393681 3586 3513 3424 2855 2492 958 437 413 --11382 --
NM_014682chr8----1585 --
NM_014711chr1611878 ------
NM_014730chr1294876 4741 4272 3985 3700 3666 1013 369 26 11945 --14721
NM_014730chr1294876 4741 4272 3985 3700 3666 1013 369 26 11945 --14721
NM_014747chr1135207 4857 4641 4184 3931 3642 2204 1899 1648 1117 965 756 742 ------
NM_014909chr14143669 3552 3305 3237 3010 2851 2628 2491 2446 1468 1418 1076 1057 104 1246 --1515
NM_014912chr102579 526 ------
NM_014917chr11875 ------
NM_014953chr1344265 3209 1351 405 13568 13559 --
NM_014988chr412040 ------
NM_015026chr1222963 205 34733 4379 1675 21603 735 --
NM_015035chr20156565 6126 5851 4765 4501 4403 4315 4256 4061 2495 1656 1581 1162 1036 496 15069 ----
NM_015042chr1572908 2763 1439 1007 713 706 586 12816 1423 --
NM_015076chr674443 4399 3393 3061 1438 1020 877 13373 14368 13378
NM_015090chr1126117 5496 5479 4150 4102 3974 2361 2056 2036 1941 1432 683 25058 2046 15062 --
NM_015094chr22184229 3929 3808 3469 3188 2845 1710 1699 1478 1269 1138 759 531 498 454 359 263 83 --168 --
NM_015161chr161154 ------
NM_015206chr1543705 3190 1435 477 23162 698 43655 2433 1244 763 --
NM_015271chr452902 2873 1063 533 126 13190 13554 --
NM_015293chr61264 ------
NM_015310chr8107195 6879 6832 6646 6453 1343 839 678 591 352 --15862 17275
NM_015365chrX23247 3108 ----14251
NM_015836chr131341 297 25 ------
NM_015879chr18117328 6939 6565 6549 6380 6313 6021 3264 1676 875 611 ------
NM_015976chr11341 ------
NM_015987chr12164 ------
NM_016040chr112690 --11728 11929
NM_016061chr21293 ------
NM_016218chr51318 ------
NM_016542chrX21331 194 ------
NM_016577chr384285 3964 2803 1786 1720 1569 804 642 ------
NM_016623chr81538 ------
NM_017455chr151152 ------
NM_017628chr435052 1882 615 24278 333 --11759
NM_017637chr968365 7810 7347 7231 483 252 19292 17918 --
NM_017661chr151108 ------
NM_017768chr1----1211 --
NM_017779chr131871 246 127 2788 101 ----
NM_017848chrX74307 3645 2901 1663 1491 333 296 13441 --1591
NM_017902chr1085696 4974 4249 4240 2095 998 489 154 --15073 12243
NM_017919chr995726 5634 5256 4633 4297 4109 1860 1481 938 12144 ----
NM_018027chr1082754 2459 2080 1153 1020 917 764 477 --11081 --
NM_018098chr3----1161 --
NM_018126chr4------11035
NM_018133chr31343 ------
NM_018200chr1531008 789 628 12468 1520 --
NM_018247chr6----12953 --
NM_018293chr3----22468 929 --
NM_018657chr3----159 --
NM_018947chr734536 625 450 21248 469 ----
NM_018957chr221327 ------
NM_019083chr111305 ----11505
NM_019597chrX1591 ------
NM_020193chr1111109 ------
NM_020198chr1711175 ------
NM_020204chr11261 ------
NM_020420chrY1351 ----11766
NM_020457chr16----1691 --
NM_020697chr831048 441 91 --1968 --
NM_020717chrX84747 4625 4017 3175 1927 1653 1626 504 11332 31775 1151 219 --
NM_020796chr523008 41 --268 47 --
NM_020865chr3------1112
NM_020956chr19164716 4449 3983 3926 3911 3759 3501 3439 3350 3238 1623 1512 1506 1362 1344 861 24123 1336 --13226
NM_021090chr22114830 4402 4331 3359 3303 1685 1427 948 670 541 403 --34874 1531 1455 14787
NM_021140chrX191 ----1405
NM_021144chr9------1215
NM_021202chr2092653 2164 1028 979 942 756 749 560 551 ------
NM_021631chr8139 ------
NM_021911chr554016 1226 379 188 26 13592 ----
NM_021914chr1411902 ------
NM_021935chr31209 ------
NM_021945chr693159 2738 2504 2273 1365 1134 589 539 30 13264 12685 1566
NM_022776chr3------11040
NM_022843chr131612 ----1306
NM_022977chrX41968 995 812 453 12465 --21633 97
NM_023016chr22347 68 42710 731 715 499 --11051
NM_024491chr33429 260 195 ----1203
NM_024556chr11142 ------
NM_024611chr1583357 2894 2672 2454 1254 975 761 236 ------
NM_024617chr91652 ------
NM_024749chr111704 1595 12186 1373
NM_024947chr347900 3186 1609 874 26540 2295 15971 25996 61
NM_024989chr287659 7415 7207 6871 6271 2707 1208 587 1955 ----
NM_025027chr1921083 862 ------
NM_025191chr11754 ------
NM_030647chr766064 5354 4619 2083 764 667 11361 --12407
NM_030918chr185120 3939 2143 2017 1847 1591 1568 599 --2790 48 --
NM_030920chr111976 ------
NM_031216chr1811422 ------
NM_031266chr5------1460
NM_031412chr12198 ----1894
NM_031468chr771885 1661 1040 916 466 189 144 --16162 15342
NM_032229chr131416 ------
NM_032291chr12597 263 ----11254
NM_032505chr332337 2171 185 ----1140
NM_032858chr11124 ------
NM_032932chr17106456 6362 5827 5319 4387 4076 1889 1488 241 169 --25175 275 25235 2458
NM_033071chr61264 ------
NM_033224chr787874 7540 6433 5730 2914 2897 2557 103 --15384 --
NM_033272chr2--1103 --1155
NM_033285chr864121 3249 2973 1693 1365 400 --22856 1372 --
NM_033326chr1131602 738 726 12151 --1695
NM_033380chrX11165 ------
NM_033381chrX11165 ------
NM_033495chrX1990 ----1305
NM_033656chr2153988 2356 1441 1332 814 46009 5165 4549 4404 --1496
NM_052906chr22194569 4448 4097 4020 3710 3335 3271 3226 3201 3138 2033 1894 1829 1783 1046 860 557 427 298 ------
NM_052923chr6------127
NM_053043chr765122 4290 2158 1583 947 553 --34519 847 734 --
NM_080626chr12----1344 --
NM_130436chr2132282 754 530 --11005 1996
NM_133170chr20167683 7374 6908 6266 5853 5819 5798 3096 3027 2835 2487 2212 1063 791 736 273 16464 12511 --
NM_133334chr486044 5389 4386 4063 1732 1117 782 302 1167 26215 4421 --
NM_133370chr413358 ------
NM_133650chr61264 ------
NM_138638chr1411902 ------
NM_139136chr121381 ------
NM_144992chr2198 ------
NM_145014chr112264 113 ------
NM_145259chr225995 4739 --1758 --
NM_145307chr1032864 1819 1182 12910 --13148
NM_145331chr61531 ------
NM_145698chr1011421 ------
NM_145912chr22113901 3608 1859 1826 1704 1668 1512 913 536 417 91 24266 450 1526 13363
NM_152238chr11341 ------
NM_152358chr19121 ------
NM_152594chr1512085 ----1528
NM_152733chr6176287 6281 5844 5836 5564 5463 5421 4735 4518 4116 2574 2548 1721 1607 1567 294 72 --45864 5850 4352 1539 --
NM_152854chr201665 ------
NM_152914chr17124325 4272 4222 4097 4065 3293 2929 1544 1351 521 201 119 --12757 --
NM_153050chr22114830 4402 4331 3359 3303 1685 1427 948 670 541 403 --34874 1531 1455 14787
NM_153051chr22114830 4402 4331 3359 3303 1685 1427 948 670 541 403 --34874 1531 1455 14787
NM_153207chr1243382 3350 2867 422 ------
NM_153332chr823140 264 11030 --1519
NM_153449chr12----1344 --
NM_153456chr1375715 5378 5251 4969 4499 2529 1715 12269 ----
NM_153748chr121381 ------
NM_172071chr137456 5673 2657 16278 24833 1189 --
NM_173694chrX11930 --1847 --
NM_173832chr8183357 2832 2743 2624 2538 2516 1348 1323 1298 1273 1248 1223 1198 1173 1148 1123 173 97 --12544 --
NM_173848chr82696 290 ------
NM_175736chr12137223 7065 7037 6891 6734 2728 2036 1932 1422 717 589 466 212 ------
NM_175866chr121009 317 ----11262
NM_177972chr11113410 3019 2789 1725 1475 1093 1080 803 789 365 182 --14199 --
NM_181358chr172901 2621 2614 1526 1511 869 126 ------
NM_181481chr18116961 5142 4849 4577 4319 2788 2364 1173 544 454 256 1515 34987 2414 1080 --
NM_181482chr18116961 5142 4849 4577 4319 2788 2364 1173 544 454 256 1515 34987 2414 1080 --
NM_181483chr18116961 5142 4849 4577 4319 2788 2364 1173 544 454 256 1515 34987 2414 1080 --
NM_181489chr396459 6340 4556 2460 2450 2043 1156 1052 735 24869 4452 15928 --
NM_182796chr51830 ------
NM_182797chr201247 ------
NM_182943chr3----11143 --
NM_182961chr61264 ------
NM_198216chr20144 ------
NM_198268chr172901 2621 2614 1526 1511 869 126 ------
NM_198269chr172901 2621 2614 1526 1511 869 126 ------
NM_198859chr334825 3177 1118 --24739 143 --
NM_198900chr12137223 7065 7037 6891 6734 2728 2036 1932 1422 717 589 466 212 ------
NM_199132chr191275 11931 3616 263 106 --
NM_201263chr141790 746 474 126 ------
NM_203301chr1411669 ------
NM_203346chr282127 2046 1718 516 510 226 135 126 --1708 --
NM_203350chr1----11603 11148
NM_203413chr17----1145 --
NM_206909chr8107195 6879 6832 6646 6453 1343 839 678 591 352 --15862 17275
NM_207325chr19------11705
NM_207371chr1011504 ------