TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3200-5p
miRNA Sequence: AAUCUGAGAAGGCGCACAAGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541476 1420 831 555 ----11788
NM_000044chrX148 ------
NM_000045chr61103 ------
NM_000051chr1152874 2285 860 822 777 ------
NM_000067chr82698 639 1677 ----
NM_000084chrX65436 2540 2398 1929 1222 1018 24761 2421 14858 --
NM_000092chr284012 3777 3600 3514 3370 952 717 283 ------
NM_000104chr282795 2498 2342 2225 1118 563 444 140 --12692 --
NM_000125chr653321 1371 1350 1119 668 130 --22767 314
NM_000138chr1552649 2628 2426 476 195 ------
NM_000165chr661675 1321 1240 1227 594 129 --1250 --
NM_000168chr783307 3222 3196 3112 2552 2448 2389 2312 1886 12187 --
NM_000176chr523095 3088 11547 ----
NM_000183chr21428 1468 ----
NM_000192chr1211182 ------
NM_000208chr1984626 4133 4109 4029 3595 1447 115 79 21305 1274 21639 825 --
NM_000216chrX42663 1646 686 100 13722 --13023
NM_000217chr12115248 4732 4663 4402 3847 1278 1064 802 469 388 370 13767 23604 2035 14497
NM_000237chr821266 1215 ------
NM_000259chr15105652 5185 5105 5083 4849 1746 1663 1377 1109 721 15370 32478 1949 1472 --
NM_000266chrX2620 237 ----1681
NM_000280chr111702 ----1822
NM_000314chr1053215 2583 951 522 101 13110 ----
NM_000321chr1351662 1411 694 561 432 11700 ----
NM_000332chr6186688 6602 6335 5896 5804 5525 5310 2570 2444 2410 1874 1776 1754 1084 1058 892 565 486 24503 2706 ----
NM_000337chr5106291 5851 4912 2600 2292 2051 1850 1593 919 344 12184 12333 --
NM_000340chr311054 ------
NM_000368chr974816 4732 4486 3417 1853 1735 654 1388 ----
NM_000390chrX93422 2952 2787 2626 2486 2301 370 261 53 13358 ----
NM_000411chr2162827 2354 1048 966 890 763 1326 ----
NM_000430chr1763725 3020 2457 2367 503 484 --12707 --
NM_000441chr72200 75 --12344 --
NM_000448chr1183132 3013 2476 2241 1113 1065 674 247 13145 22699 2540 --
NM_000489chrX103401 3323 3312 3086 2993 2176 1175 1151 885 415 ------
NM_000495chrX1162 ------
NM_000522chr751267 973 805 351 46 1283 --1456
NM_000523chr231149 331 31 ------
NM_000555chrX77325 7251 5971 5389 2033 1844 904 --11824 --
NM_000574chr12980 60 ------
NM_000594chr64792 566 133 69 ------
NM_000601chr7161 ------
NM_000615chr1162852 2089 2061 658 410 346 --22328 935 --
NM_000618chr1296219 5846 5206 4663 2222 2203 2039 1356 1080 ------
NM_000618chr1296219 5846 5206 4663 2222 2203 2039 1356 1080 ------
NM_000633chr1874549 4201 4087 3938 3407 1105 638 ------
NM_000676chr171365 ------
NM_000684chr102878 307 ------
NM_000726chr22590 187 1928 11437 --
NM_000793chr1454318 3966 3833 3192 2059 ------
NM_000807chr42677 466 ------
NM_000810chr151172 1612 ----
NM_000813chr572237 2091 1057 990 570 315 287 ----1983
NM_000814chr1553304 2678 1462 1170 424 13101 1913 --
NM_000818chr101219 ------
NM_000829chr1151863 1675 1551 355 181 --1196 --
NM_000838chr682499 2437 2083 2050 603 552 420 213 ------
NM_000855chr111279 ------
NM_000859chr551303 1178 696 566 150 --2186 162 --
NM_000872chr1041447 986 617 604 11537 ----
NM_000879chr51115 ------
NM_000880chr8179 ------
NM_000885chr262141 1773 1753 1743 616 336 --141 11830
NM_000899chr1264153 3709 3135 2894 317 162 1389 ----
NM_000901chr462198 2010 1910 1818 1556 232 ------
NM_000912chr883364 3003 2827 2258 1344 925 389 147 1693 171 --
NM_000919chr55645 609 580 49 21 ------
NM_000945chr221672 398 ------
NM_000962chr942745 1191 282 212 ------
NM_000984chr171472 ------
NM_001001342chr1031129 275 198 ------
NM_001001395chr1242397 2156 1968 180 ------
NM_001001396chr163557 1797 1405 677 514 23 --1939 --
NM_001001419chr574783 3834 3644 2098 1794 242 198 14026 24061 916 --
NM_001001420chr574783 3834 3644 2098 1794 242 198 14026 24061 916 --
NM_001001481chr843385 3221 3193 2680 --22801 2439 --
NM_001001661chr71613 --1751 --
NM_001001664chr283454 3054 2753 1580 1185 1174 952 148 --23588 3286 --
NM_001001669chr5102638 2196 1993 1985 1866 902 756 662 133 48 --21755 962 --
NM_001001890chr2132919 2610 785 ------
NM_001002243chr22664 371 ------
NM_001002257chr2103382 3326 2470 2409 2399 2196 1409 843 647 434 13389 22900 71 --
NM_001002258chr23623 227 180 --11978 --
NM_001002838chrX51422 1280 430 272 39 --11412 --
NM_001002860chr1484408 4319 4035 3369 3111 1651 895 543 14168 ----
NM_001003406chr2283018 2952 2686 2459 2277 691 487 59 --12227 1994
NM_001003652chr18107343 7219 6607 5904 5672 3458 3275 3156 1284 176 11931 15293 15825
NM_001003674chr18117028 6953 6524 6194 5736 5698 2539 2389 2223 1006 534 12630 ----
NM_001003675chr18117028 6953 6524 6194 5736 5698 2539 2389 2223 1006 534 12630 ----
NM_001003681chr2222016 1645 ------
NM_001003688chr43414 249 136 ------
NM_001003712chr1253282 2993 2971 1318 542 ------
NM_001003722chr93398 312 91 ------
NM_001003792chr32492 324 ------
NM_001003793chr32492 324 ------
NM_001003810chr42779 229 ------
NM_001003895chrY126 ------
NM_001003945chr941886 1231 611 56 ------
NM_001004127chr131896 ------
NM_001004317chr684276 2921 979 941 778 522 515 196 --21718 1353 11578
NM_001004330chr1241784 1552 253 125 31537 477 310 --1573
NM_001004419chr1254572 4121 3966 3172 730 33111 460 62 ----
NM_001005207chr172100 54 ------
NM_001005386chr262505 2167 1743 1699 546 268 ------
NM_001005404chr17114375 3992 3407 2924 1805 1723 1689 1588 1509 1126 1060 --24002 3193 1916
NM_001005417chr11159 ------
NM_001005463chr1032066 1618 960 22580 2019 1424 --
NM_001005473chr5115989 5878 5814 5482 4170 4018 2616 1767 1530 701 397 15273 --11775
NM_001005476chr22208 48 ------
NM_001005746chr22590 187 1928 11437 --
NM_001005747chr22590 187 1928 11437 --
NM_001005782chr21405 ------
NM_001005845chr841806 327 143 113 11759 ----
NM_001007023chr1454318 3966 3833 3192 2059 ------
NM_001007027chr11------1272
NM_001007067chr82973 172 ------
NM_001007068chr82973 172 ------
NM_001007069chr82973 172 ------
NM_001007070chr82973 172 ------
NM_001007094chr1073537 3403 3294 3193 1761 1052 1038 1622 14344 --
NM_001007097chr9104568 4204 3699 3341 3218 1377 1189 826 514 220 13235 11945 --
NM_001007099chr12694 267 ------
NM_001007100chr12694 267 ------
NM_001007102chr631624 392 124 ------
NM_001007237chr142877 2495 2111 978 --12266 1310
NM_001007246chr2131899 1351 552 ------
NM_001007278chr1354852 3227 1512 804 67 24668 2063 ----
NM_001007466chr645052 4430 428 407 12077 ----
NM_001007565chr3192 ------
NM_001007794chr11273 ------
NM_001008239chr1863635 2743 1297 1066 458 93 1722 13301 --
NM_001008392chr361248 1099 1069 376 357 53 ----1486
NM_001008393chr452316 1940 875 740 118 12092 ----
NM_001008408chr755584 4329 1693 1256 207 25358 1816 1337 14368
NM_001008541chr1042149 1900 899 214 21599 452 ----
NM_001008541chr1042149 1900 899 214 21599 452 ----
NM_001008738chr53526 371 163 --12853 1918
NM_001008744chr1451394 1209 1054 593 585 ------
NM_001008800chr1195 ------
NM_001008883chr1195 ------
NM_001008925chr432894 2808 2274 ------
NM_001009185chr52606 520 ------
NM_001009554chr454489 1117 941 552 254 43966 3939 3672 1643 34540 3037 1279 --
NM_001009554chr454489 1117 941 552 254 43966 3939 3672 1643 34540 3037 1279 --
NM_001009555chr42512 155 166 ----
NM_001009567chr10--1229 --1658
NM_001009881chr13543 403 139 1169 ----
NM_001009882chr13543 403 139 1169 ----
NM_001009899chr3105804 5568 5474 5135 4658 4462 2208 1984 692 155 1568 ----
NM_001009909chr1153635 3422 2612 1426 380 23560 2924 11294 13714
NM_001009958chr71155 ------
NM_001009959chr282304 2268 1692 1630 970 906 887 604 ----12203
NM_001009993chr254180 3916 1257 956 822 --24503 490 --
NM_001010854chr144653 550 40 33 ------
NM_001010861chr152692 2405 2310 2023 1873 --12216 --
NM_001010867chr1116596 4872 2325 1941 1903 1030 689 647 526 480 173 15028 25383 5236 15793
NM_001010895chr951747 1489 669 88 54 12063 ----
NM_001010932chr7161 ------
NM_001010984chr152107 1940 1612 522 37 12010 11688 --
NM_001011645chrX148 ------
NM_001011666chr756513 5852 5777 1072 86 --14231 --
NM_001011722chr12166 21 ------
NM_001011722chr12166 21 ------
NM_001012393chr1184851 4840 4496 4463 4449 4177 3650 1760 ------
NM_001012420chr1552823 2385 2129 1930 884 21916 399 ----
NM_001012423chr1552823 2385 2129 1930 884 21916 399 ----
NM_001012514chr241113 1102 424 394 ------
NM_001012516chr241113 1102 424 394 ------
NM_001012751chr1041903 420 312 108 ------
NM_001012755chrX94474 4314 3573 1714 1418 1109 889 578 234 --1449 --
NM_001012756chr1943097 2808 984 457 --22695 2568 --
NM_001012761chr562631 2469 2434 2317 1963 609 ------
NM_001012979chrX1246 ------
NM_001013031chr1043040 2456 2149 118 ----13332
NM_001013406chr711330 ------
NM_001013437chr18188 ------
NM_001014764chr171167 ------
NM_001014797chr10117619 7183 6790 6740 5450 5401 1710 1422 1403 1068 848 36135 5862 3243 17549 --
NM_001014972chr2194 ------
NM_001015887chr341810 1633 1203 25 --11408 --
NM_001017371chr2------177
NM_001017415chr13689 541 530 ------
NM_001017416chr13689 541 530 ------
NM_001017424chr141656 1460 664 301 --11520 1762
NM_001017425chr141656 1460 664 301 --11520 1762
NM_001017923chr1431163 575 116 ------
NM_001017926chr831416 421 299 ------
NM_001017930chrX3419 250 232 ------
NM_001018065chr996042 5918 4574 4148 3975 2336 2003 1264 1241 24343 4134 15304 --
NM_001018066chr996042 5918 4574 4148 3975 2336 2003 1264 1241 24343 4134 15304 --
NM_001018067chr144646 3425 3281 248 24990 4394 24492 4034 --
NM_001018068chr144646 3425 3281 248 24990 4394 24492 4034 --
NM_001018069chr144646 3425 3281 248 24990 4394 24492 4034 --
NM_001018074chr523095 3088 11547 ----
NM_001018075chr523095 3088 11547 ----
NM_001018076chr523095 3088 11547 ----
NM_001018077chr523095 3088 11547 ----
NM_001018090chr1521844 153 183 ----
NM_001018091chr1521954 263 1193 ----
NM_001018102chr1521844 153 183 ----
NM_001018111chr7103457 3188 2560 2433 1459 1226 1148 1086 836 705 --13793 --
NM_001020658chr11588 ------
NM_001020658chr11588 ------
NM_001023567chr1542215 1951 887 538 21937 399 ----
NM_001024094chr523095 3088 11547 ----
NM_001024647chr12137030 6998 6503 6357 5826 5688 5272 5108 1716 1606 1380 612 275 25057 973 ----
NM_001024649chr562730 2639 2540 2187 1962 97 --1899 --
NM_001024660chr361504 620 503 497 248 199 1434 --1443
NM_001024736chr1541504 1420 520 386 ------
NM_001024948chr11344 13002 ----
NM_001025077chr10127092 6374 6311 6291 6207 5747 5166 5090 2378 1287 888 483 ------
NM_001025108chr244013 1589 390 217 ------
NM_001025201chr22572 226 ------
NM_001025252chr843178 3034 2498 854 --13106 12316
NM_001025253chr843178 3034 2498 854 --13106 12316
NM_001025356chr1232601 2437 353 1952 1185 12629
NM_001025579chr1721089 778 ------
NM_001025580chrX93762 3424 3006 2916 2846 2790 1685 300 210 31345 1196 523 ----
NM_001025596chr111391 ------
NM_001025780chr911596 ------
NM_001029863chr612654 ------
NM_001029882chr1151 ------
NM_001029882chr1151 ------
NM_001030055chr1464498 4360 3770 1524 1419 1283 1818 ----
NM_001030272chr113337 170 130 ------
NM_001030273chr113337 170 130 ------
NM_001031679chr1253432 2609 2577 847 313 --23311 2364 23459 2326
NM_001031681chr1751684 851 461 303 90 --1372 1584
NM_001031684chr221098 338 ------
NM_001031685chr12677 618 ----1254
NM_001031695chr22125310 5238 4252 4136 4123 3325 3302 1880 1677 1061 753 713 11527 13526 --
NM_001031702chr32643 147 ------
NM_001031732chr463528 3285 3155 2822 2649 2305 ------
NM_001032280chr631602 1561 473 11580 ----
NM_001032282chr81265 ----1876
NM_001032296chr1322018 1047 --1191 1365
NM_001032394chr672436 2091 2046 720 282 75 36 ------
NM_001032999chr20104456 3962 3579 3481 2110 1303 1095 924 562 545 --24518 1595 --
NM_001033117chr374661 4561 4383 3798 1894 1234 1113 --31846 523 512 --
NM_001033507chr12671 659 1225 ----
NM_001033564chr671731 1413 756 452 313 236 100 ------
NM_001033576chr1762542 1008 720 470 235 81 11880 1975 --
NM_001033578chr832008 1944 1665 --12391 --
NM_001033659chr1731630 1405 620 ------
NM_001033925chr101495 ----1313
NM_001034025chr124985 723 331 285 --1700 --
NM_001034841chr1655240 3750 3637 3408 1571 25370 5009 14632 --
NM_001034954chr1073275 2506 2216 1308 1106 643 352 12389 11254 --
NM_001034955chr1073275 2506 2216 1308 1106 643 352 12389 11254 --
NM_001034956chr1073275 2506 2216 1308 1106 643 352 12389 11254 --
NM_001034957chr1073275 2506 2216 1308 1106 643 352 12389 11254 --
NM_001035chr131234 888 222 ------
NM_001035260chr1031537 1529 1011 ----1363
NM_001037132chr731774 809 233 1845 ----
NM_001037133chr731774 809 233 1845 ----
NM_001037164chr751886 1737 1687 1572 137 --11748 --
NM_001037172chr351309 999 476 375 253 11223 ----
NM_001037317chr152692 2405 2310 2023 1873 --12216 --
NM_001037334chr1842434 1944 349 271 --127 --
NM_001037535chrX41158 558 407 24 --11522 --
NM_001037536chrX41158 558 407 24 --11522 --
NM_001037540chrX41158 558 407 24 --11522 --
NM_001037553chr21154853 4563 4181 3990 3489 3252 2048 1946 1691 1654 902 775 553 169 156 --1324 --
NM_001039091chrX41014 960 381 118 21304 556 ----
NM_001039457chr1188 ------
NM_001039465chr141355 ------
NM_001039547chr397796 7287 7166 6880 5407 1125 1060 848 68 56239 6151 3020 2754 2364 --1561
NM_001039577chr194352 3771 3582 3243 2860 1818 1527 1004 825 14330 ----
NM_001039585chr174126 3697 3568 1671 1629 400 394 23557 3523 23707 77 --
NM_001039590chrX43924 3395 1253 744 ------
NM_001039591chrX43924 3395 1253 744 ------
NM_001039618chr1165265 4797 4167 704 518 100 11044 ----
NM_001039693chr282969 2865 2764 2538 631 569 195 92 --11447 --
NM_001039709chr20104456 3962 3579 3481 2110 1303 1095 924 562 545 --24518 1595 --
NM_001039802chr111400 ------
NM_001039840chrX96062 5317 4773 4122 2027 2000 1020 1010 751 16044 14138 1810
NM_001039888chr12824 327 ------
NM_001039937chr1334183 3878 3584 --1293 12975
NM_001039960chr1251654 1484 1069 83 45 11732 11170 --
NM_001040001chr631877 443 397 ------
NM_001040101chr421230 1124 ----1321
NM_001040118chr112228 56 ------
NM_001040152chr784880 4795 4537 3633 3135 2024 1833 1720 24714 4392 11859 --
NM_001040284chr1675063 4845 4584 2078 606 103 51 --14351 --
NM_001040402chr422636 415 ------
NM_001040429chr1361236 945 926 870 367 180 ------
NM_001040441chr175213 5003 4817 4303 4153 3335 1804 --13981 --
NM_001040446chr542386 1767 588 350 1472 ----
NM_001040633chr731044 346 208 ------
NM_001040665chr734036 978 809 14824 ----
NM_001042413chr964120 2526 2510 1548 504 138 --22558 1044 --
NM_001042425chr631602 1561 473 11580 ----
NM_001042481chr1472200 2076 1063 794 370 279 244 11629 ----
NM_001042486chr201474 ------
NM_001042543chr421413 47 --11482 --
NM_001042599chr276487 3119 2538 2519 2102 1772 1071 15183 --22009 1729
NM_001042601chr352679 2650 2461 2347 1233 22705 2018 12327 --
NM_001042603chr1255124 4824 4807 2021 118 14312 14365 --
NM_001042604chr344602 1535 1403 665 13145 ----
NM_001042646chr331894 1840 1658 ------
NM_001042749chrX31440 638 222 ------
NM_001042750chrX31440 638 222 ------
NM_001042751chrX31440 638 222 ------
NM_001044385chr264035 3796 3118 919 716 354 ------
NM_001046chr532553 2073 1030 1530 11092 --
NM_001050chr171139 ------
NM_001079874chr121557 40 1327 2600 559 --
NM_001083621chr174525 3998 3284 3039 1663 1404 296 21124 397 ----
NM_001100108chr1137838 7587 7384 7312 7064 6925 6558 3134 3001 2701 2542 856 83 28181 3257 57758 7661 6633 2176 130 17365
NM_001106chr3219632 8488 8167 7364 6687 6537 3690 3258 2994 2875 2557 2525 2402 2255 2052 1950 1904 1736 1464 465 358 26718 6424 --23229 734
NM_001116chr1642107 1161 936 757 --22617 1247 --
NM_001121chr102161 96 --11899 --
NM_001126chr12370 141 ------
NM_001140chr171254 ------
NM_001160chr1252356 2229 954 455 385 12041 12029 --
NM_001167chrX66669 6530 6348 5456 4709 2623 22393 345 35938 5837 1168 --
NM_001173chr1464498 4360 3770 1524 1419 1283 1818 ----
NM_001178chr113337 170 130 ------
NM_001186chr2173261 2834 1292 843 801 471 291 --12921 --
NM_001198chr63868 390 171 ------
NM_001204chr2147386 6926 6476 6391 6331 6295 6275 6269 6130 5952 5347 2985 1878 1099 26705 5781 ----
NM_001206chr942981 2509 1984 476 --22299 1221 12955
NM_001233chr732393 1695 656 --21927 243 --
NM_001256chr1772915 2470 2285 1929 1811 1059 780 1333 ----
NM_001259chr7116388 5539 4594 4449 2162 1840 1828 1780 1764 1745 736 ----23885 864
NM_001260chr131265 ------
NM_001270chr52985 943 21085 833 ----
NM_001271chr1552736 2691 1241 706 332 11254 ----
NM_001273chr121401 ------
NM_001278chr1021107 90 ------
NM_001304chr1763361 2608 1512 906 502 325 --13570 --
NM_001308chr102113 28 ------
NM_001310chr1232712 210 191 ------
NM_001315chr641615 1502 474 285 --1570 --
NM_001343chr551419 545 487 426 402 --11353 --
NM_001356chrX52525 2426 1588 873 194 --12150 --
NM_001364chr1154438 3924 3395 1810 1044 --13025 --
NM_001385chr82303 156 ------
NM_001386chr852192 1929 1547 857 279 ------
NM_001390chr1843446 3311 2306 619 12747 1236 --
NM_001394chr82575 207 ------
NM_001396chr2162649 2528 2304 877 313 219 ------
NM_001402chr641984 819 138 59 11651 ----
NM_001412chrX73290 3215 2963 2630 2573 839 605 13739 13315 13001
NM_001419chr19114833 4614 4504 4361 4213 3900 1887 1457 968 946 718 --13802 --
NM_001420chr1923193 895 ------
NM_001430chr21787 ------
NM_001438chr193619 3168 2791 2566 2524 1421 729 154 80 --12284 --
NM_001453chr62339 210 ------
NM_001465chr562001 1984 1844 1593 1336 198 ------
NM_001530chr141723 ------
NM_001542chr142877 2495 2111 978 --12266 1310
NM_001604chr111702 ----1822
NM_001609chr10114435 4221 3972 3816 3243 2940 2840 1567 1472 1150 584 ------
NM_001616chr263322 2746 1258 1099 406 325 ----13261
NM_001621chr742146 1901 1148 907 21881 723 1470 --
NM_001621chr742146 1901 1148 907 21881 723 1470 --
NM_001650chr1863437 3169 1410 1197 672 38 --151 --
NM_001689chr23623 227 180 --11978 --
NM_001690chr322316 1018 --1852 12276
NM_001709chr1151772 845 699 343 25 ------
NM_001717chr1521237 580 ----129
NM_001721chrX1250 ------
NM_001746chr562730 2639 2540 2187 1962 97 --1899 --
NM_001754chr2132919 2610 785 ------
NM_001755chr1621508 484 ------
NM_001759chr1284426 4084 3982 3788 1429 1188 891 434 --34922 4641 1992 --
NM_001791chr111400 ------
NM_001792chr185791 755 262 152 70 ------
NM_001796chr16------168
NM_001822chr22572 226 ------
NM_001830chrX73663 3133 2967 2706 2459 1599 25 1996 1985 --
NM_001833chr91180 ------
NM_001839chr11588 ------
NM_001855chr91317 --1185 --
NM_001858chr684931 4658 4400 3427 1165 949 395 244 11631 ----
NM_001859chr983924 2828 2818 2763 2687 926 684 281 12777 ----
NM_001882chr51574 ------
NM_001904chr331081 394 74 --1183 --
NM_001918chr198370 8062 7915 7277 6792 6522 1965 1902 949 28048 2133 --16265
NM_001933chr1421348 430 ------
NM_001938chr111830 1253 1528 11788
NM_001957chr462137 1933 1850 600 588 44 1826 ----
NM_001968chr4------1132
NM_001977chr431545 455 207 ------
NM_001980chr1241610 677 90 39 12058 21986 684 --
NM_001981chr132043 691 525 --1604 --
NM_001987chr12114277 3770 3117 3036 1516 1458 1355 675 525 496 170 12891 --11319
NM_002006chr485728 5111 4968 3942 3600 768 535 354 --23522 1218 12076
NM_002015chr1332229 308 37 12643 ----
NM_002025chrX118829 7338 6835 6776 5845 3638 3363 527 493 450 393 11721 1242 --
NM_002026chr22960 85 ------
NM_002033chr1164132 4075 3533 2778 1173 1166 ------
NM_002040chr2162942 2502 2209 2066 547 412 12678 ----
NM_002063chrX2309 287 --1954 11208
NM_002069chr751670 1271 752 726 714 ----11181
NM_002072chr93711 679 179 ------
NM_002092chr443660 1170 544 483 --24266 4004 --
NM_002105chr1121053 102 ------
NM_002114chr61486 ------
NM_002126chr1773446 2970 2685 2589 1327 609 600 23867 1469 ----
NM_002128chr1341875 1835 1748 1037 22180 174 ----
NM_002137chr761783 720 711 625 349 79 21879 1577 --11730
NM_002138chr42779 229 ------
NM_002140chr91427 1953 ----
NM_002143chr11763 ------
NM_002156chr2179 ------
NM_002158chr262801 2538 1298 1290 699 615 --12422 --
NM_002166chr21666 ------
NM_002210chr242446 938 470 177 ------
NM_002214chr7104939 4877 4340 4111 2194 1520 1499 1142 262 188 --34304 1395 987 --
NM_002221chr172497 1828 762 600 567 255 243 --21083 970 --
NM_002223chr1262821 2459 1197 1187 1150 660 ------
NM_002235chr1211430 ------
NM_002241chr193016 2943 2842 2779 2512 669 636 466 274 --11116 --
NM_002246chr22777 313 ------
NM_002264chr384755 4556 3812 1697 1556 784 716 464 1591 24932 4320 --
NM_002270chr543695 3532 3526 820 24394 3769 13786 --
NM_002285chr244013 1589 390 217 ------
NM_002293chr132349 711 90 --11006 --
NM_002296chr121291 648 11391 ----
NM_002310chr586426 5682 4420 4310 4133 2641 630 193 --26330 1371 --
NM_002312chr131865 ----1306
NM_002336chr12134797 4461 4201 3888 3679 3563 3556 3145 1964 1929 1847 1283 412 ------
NM_002356chr632260 1119 1044 ------
NM_002384chr181878 ------
NM_002395chr6----2589 100 1947
NM_002429chr1231341 287 164 --3480 253 239 --
NM_002430chr2252167 1830 1710 1596 340 ------
NM_002438chr10--1229 --1658
NM_002481chr1137538 6850 6414 6002 5949 5892 2890 2513 2220 1259 1233 563 490 22956 1438 22782 2731 --
NM_002505chr661492 1457 1437 472 256 222 ------
NM_002518chr21125 ------
NM_002519chr11------11013
NM_002522chr1753642 2896 1160 515 229 --22905 847 12765
NM_002539chr21218 ------
NM_002545chr1184851 4840 4496 4463 4449 4177 3650 1760 ------
NM_002577chr383804 3797 3286 2932 2719 2527 587 380 13297 ----
NM_002581chr975516 4731 4712 3968 1118 1071 533 1645 ----
NM_002613chr1694939 4502 4326 3954 3828 2021 1973 1117 1107 --23361 2013 --
NM_002634chr172846 150 ----1749
NM_002635chr122322 148 ------
NM_002641chrX1250 ----1236
NM_002645chr1152921 2914 2286 1142 582 ------
NM_002649chr741629 1268 1177 112 11373 ----
NM_002655chr874701 4643 4409 3719 803 543 316 1528 14239 --
NM_002707chr21382 ------
NM_002709chr273551 3188 3046 2458 2410 968 31 22962 2666 --33395 3371 526
NM_002710chr121901 ----196
NM_002711chr72828 786 ------
NM_002713chr14914 863 472 112 --1333 --
NM_002715chr521188 839 11039 --11207
NM_002716chr1193258 3199 3073 2602 2566 1256 622 559 129 ------
NM_002718chr331728 495 219 11694 --1599
NM_002731chr12472 337 21249 972 ----
NM_002736chr741661 685 350 105 ------
NM_002737chr17106343 6051 5947 5909 5640 5275 4367 2073 1976 760 11458 1634 --
NM_002738chr1631015 965 136 ----1155
NM_002740chr372663 2186 2138 1992 921 574 484 --12073 --
NM_002745chr22104468 4393 4235 4124 3897 3086 1730 1724 41 23 ------
NM_002752chr52555 138 --1162 --
NM_002765chrX41014 960 381 118 21304 556 ----
NM_002793chr6131 ------
NM_002833chr1521565 1058 ------
NM_002834chr1243259 2549 1066 766 --11272 1224
NM_002858chr131365 1194 55 ----11393
NM_002869chr1161808 1622 1435 795 697 30 1257 ----
NM_002873chr5121 ----2456 421
NM_002886chr355095 4917 4526 4327 1578 23614 1288 11806 --
NM_002895chr202819 36 ------
NM_002901chr111326 --1121 --
NM_002959chr144085 2998 1068 583 ----13638
NM_002968chr162407 41 ------
NM_002970chrX1311 ------
NM_002973chr121233 ------
NM_002979chr12694 267 ------
NM_002994chr431834 1663 611 1794 ----
NM_002999chr201142 ------
NM_003002chr111145 ------
NM_003011chr921522 404 ------
NM_003012chr893002 2614 2348 2261 2197 1951 1271 453 221 --22862 667 12179
NM_003016chr1752045 1520 1474 428 122 ----2639 191
NM_003036chr131244 1071 332 ------
NM_003043chr3123770 3593 3526 3162 2745 1493 1330 967 526 345 274 54 14243 1975 --
NM_003045chr13104845 4821 4449 4393 3384 3181 3074 612 568 315 ------
NM_003051chr121239 453 ----1656
NM_003060chr531137 895 157 ------
NM_003070chr92342 229 ------
NM_003072chr19196 ------
NM_003099chr15136077 5411 5343 4912 4832 4227 4187 1780 1045 788 448 402 389 15052 ----
NM_003108chr297239 6353 5545 4856 2791 2164 1254 787 31 ------
NM_003111chr2------177
NM_003112chr732512 2365 763 --1585 12997
NM_003127chr91232 ------
NM_003133chr161074 772 389 233 116 108 11100 ----
NM_003144chr642208 2179 1903 579 --11979 --
NM_003161chr1733591 128 97 ----13051
NM_003174chr101120 ------
NM_003185chr2021291 1044 ------
NM_003194chr61557 ------
NM_003199chr1854070 1223 1055 704 246 11573 14996 --
NM_003213chr121195 ------
NM_003216chr2253340 2545 791 324 42 ----22245 419
NM_003220chr631602 1561 473 11580 ----
NM_003221chr633098 1293 805 ------
NM_003222chr2021096 493 ------
NM_003244chr183323 307 28 ------
NM_003247chr62195 171 ------
NM_003262chr385130 5084 4642 4388 3915 3304 1701 1014 24889 783 ----
NM_003298chr3105890 4935 4558 2358 2352 2264 1708 1648 730 697 25448 4857 ----
NM_003338chr101386 ------
NM_003344chr751464 1294 1264 158 24 ------
NM_003352chr21405 ------
NM_003368chr13689 541 530 ------
NM_003369chr11112623 2117 1972 1111 787 621 426 320 185 155 121 --1718 --
NM_003373chr1041721 1565 529 293 ------
NM_003374chr53793 696 57 ------
NM_003410chrX41031 519 467 278 --11045 --
NM_003420chr31163 ------
NM_003421chr1073537 3403 3294 3193 1761 1052 1038 1622 14344 --
NM_003439chr773465 2913 1367 1341 1261 946 55 --13133 11329
NM_003472chr621419 1155 ------
NM_003473chr101777 ------
NM_003489chr2183038 2159 1316 1253 1120 943 370 180 22538 240 11009 --
NM_003509chr6157 ------
NM_003511chr6143 ------
NM_003512chr6156 ------
NM_003520chr6160 ------
NM_003521chr6157 ------
NM_003524chr6136 ------
NM_003527chr6139 ------
NM_003529chr6144 ------
NM_003531chr6140 ------
NM_003536chr6144 ------
NM_003557chr171600 1267 637 586 399 305 209 ------
NM_003576chr1322018 1047 --1191 1365
NM_003583chr1273927 3672 2637 1025 535 208 78 13005 ----
NM_003607chr143717 3050 2918 247 --31382 218 162 13553
NM_003618chr211024 ------
NM_003620chr1731019 331 263 ------
NM_003627chr112538 425 ------
NM_003628chr22208 48 ------
NM_003630chr63628 179 75 ------
NM_003651chr122597 63 ------
NM_003654chr112507 244 ------
NM_003663chr343446 3317 2131 492 22308 894 ----
NM_003670chr311266 ------
NM_003671chr973148 2406 2353 707 688 349 195 --1253 --
NM_003672chr131625 416 38 --11402 --
NM_003679chr172150 1228 1097 1089 675 449 298 --33454 2685 222 --
NM_003681chr2174959 4830 2127 2036 814 559 83 --13803 --
NM_003692chr9183 1937 ----
NM_003701chr131733 ------
NM_003718chr71527 ------
NM_003743chr241773 1668 1577 110 ------
NM_003759chr474009 3875 3693 2905 1068 657 366 24030 3786 ----
NM_003760chr11565 ------
NM_003774chr1223280 477 --1711 --
NM_003780chr11159 ------
NM_003794chr32946 341 ------
NM_003822chr12817 619 ------
NM_003825chr1521202 71 --1227 11265
NM_003831chr1851706 1603 1433 1126 537 ------
NM_003845chr12179 ------
NM_003850chr132506 168 ------
NM_003870chr1542074 785 729 298 --21630 1512 1721
NM_003876chr17163 ------
NM_003877chr122651 244 ------
NM_003884chr341679 1451 358 25 1163 ----
NM_003885chr1762424 2233 2120 1801 1725 210 11632 ----
NM_003895chr2132075 557 283 ------
NM_003930chr752536 2115 1682 985 199 ------
NM_003941chr722460 949 ------
NM_003945chr51427 ------
NM_003966chr5116275 6217 6182 5898 5715 5516 5128 1676 1573 686 85 32389 2379 1970 ----
NM_003983chr16174152 4058 3901 3518 3444 3258 3160 3057 2792 1707 1400 1265 963 623 201 169 128 13252 1794 --
NM_003994chr1264153 3709 3135 2894 317 162 1389 ----
NM_004028chr1863437 3169 1410 1197 672 38 --151 --
NM_004035chr17104883 3456 3198 3148 1476 928 776 219 150 33 --13439 14151
NM_004047chr1188 ------
NM_004050chr1471802 1735 1686 1062 880 643 358 --22217 422 --
NM_004061chr52647 459 ------
NM_004100chr652404 966 787 446 148 ------
NM_004112chr1741571 1490 1243 419 --3674 588 189 --
NM_004132chr1041144 1092 470 23 ------
NM_004171chr11138783 8762 8527 8360 7943 7697 7014 6633 2715 2652 2471 1977 138 11720 27747 3306 18219
NM_004229chrX22260 698 ------
NM_004232chr1853741 3700 3223 2377 835 11212 11485 --
NM_004282chr63714 209 122 ------
NM_004290chr52345 221 ------
NM_004293chr983851 3137 3025 2934 2818 596 472 237 23349 360 --1998
NM_004302chr1252849 2451 2231 2157 872 --11083 --
NM_004327chr2261945 646 491 319 259 206 ------
NM_004337chr851624 1436 1424 790 464 --1611 --
NM_004338chr18117028 6953 6524 6194 5736 5698 2539 2389 2223 1006 534 12630 ----
NM_004342chr722001 485 1678 ----
NM_004354chr41137 ------
NM_004386chr1951868 1490 820 632 391 ----11537
NM_004392chr13174 ------
NM_004397chr1164137 3202 1490 586 481 129 ------
NM_004419chr105735 702 283 170 159 ------
NM_004430chr872470 2402 2258 824 785 723 279 12166 1737 --
NM_004432chr932073 2027 1845 ------
NM_004437chr1113474 3088 2731 2602 2356 1188 1016 808 555 492 96 23172 696 ----
NM_004440chr61403 ------
NM_004441chr31952 ------
NM_004442chr131533 1216 408 --11428 --
NM_004457chr211237 --141 --
NM_004458chrX72604 2342 1791 1044 849 535 388 1571 --11872
NM_004464chr463834 3788 1408 1045 64 42 ----21360 618
NM_004498chr15196 ------
NM_004501chr163669 3523 3416 3230 1501 1412 ------
NM_004504chr263005 2544 2052 946 831 300 12681 ----
NM_004514chr1762775 2684 1168 610 498 350 --1981 --
NM_004516chr191240 ------
NM_004575chr451174 1166 651 415 269 ------
NM_004586chrX115376 5239 4619 4590 3797 3781 1656 902 835 720 188 --23817 1292 13539
NM_004595chrX------1414
NM_004598chr552540 2343 2179 2089 710 --12402 --
NM_004612chr973266 3179 1922 605 451 417 38 ----13471
NM_004642chr12173 ------
NM_004660chrY32297 1530 187 11699 ----
NM_004663chr1531211 361 321 --11359 --
NM_004664chr12164 ------
NM_004673chr121497 1182 ------
NM_004680chrY126 ------
NM_004703chr1752511 2262 1712 967 254 11592 1736 --
NM_004709chrX31739 1631 346 --11574 --
NM_004719chr1252781 2043 2010 1951 386 ------
NM_004725chr101433 ------
NM_004726chrX64049 3933 1126 518 315 266 15097 13490 --
NM_004734chr1392629 2569 2452 2367 879 672 543 368 46 1246 ----
NM_004745chr8116870 5773 5084 4610 4365 2101 1409 1356 554 292 162 --35739 5282 2306 --
NM_004748chr1574071 3428 2998 1603 1129 822 97 12972 ----
NM_004760chr732067 1588 490 ----11747
NM_004774chr1762926 2735 2557 1931 953 834 ------
NM_004775chr1831915 937 384 --11758 --
NM_004788chr1132172 1879 1792 ------
NM_004796chr1431571 853 731 22101 1828 11872 --
NM_004798chr2093674 3395 3253 2941 2927 1280 1215 218 95 ------
NM_004799chr12340 31 ------
NM_004811chr11127 ------
NM_004815chr194936 4039 3454 1763 1349 1063 831 712 361 23673 3531 ----
NM_004824chr631277 955 281 --1510 --
NM_004845chrX53868 3004 2689 1565 1473 --13196 --
NM_004856chr151484 1582 ----
NM_004857chr1464731 4294 3735 3640 3090 3081 ------
NM_004862chr1641421 1273 1243 1131 ------
NM_004863chr1483987 3690 1311 1093 1037 771 463 22 ------
NM_004874chr82460 193 ------
NM_004891chr2164 ------
NM_004896chr1021452 1444 ----1278
NM_004898chr442633 865 827 512 1486 164 --
NM_004902chr201332 177 ----
NM_004904chr756513 5852 5777 1072 86 --14231 --
NM_004912chr711330 ------
NM_004924chr191761 ------
NM_004955chr62577 205 ------
NM_004956chr774373 4221 3912 3552 3384 3329 2815 21094 748 --13195
NM_004958chr12772 638 ------
NM_004966chr102892 242 ------
NM_004975chr205938 736 703 348 122 ------
NM_004992chrX128362 7914 6062 5205 3205 1929 1821 1700 970 872 210 139 --17869 --
NM_004992chrX128362 7914 6062 5205 3205 1929 1821 1700 970 872 210 139 --17869 --
NM_004999chr673737 3153 2741 1373 1004 728 486 11761 ----
NM_005006chr21924 ----1432
NM_005010chr731774 809 233 1845 ----
NM_005017chr32213 50 ------
NM_005020chr72570 216 ------
NM_005054chr261566 1498 1448 1102 611 326 ------
NM_005056chr1245368 5068 5051 362 14556 14609 --
NM_005065chr14115170 4960 4734 4647 4586 4206 4139 1341 1045 281 146 11119 14932 --
NM_005079chr843178 3034 2498 854 --13106 12316
NM_005093chr20104456 3962 3579 3481 2110 1303 1095 924 562 545 --24518 1595 --
NM_005095chr162243 1430 348 341 231 221 ------
NM_005121chr1731297 874 376 --23480 1425 --
NM_005151chr1842434 1944 349 271 --127 --
NM_005156chr9124807 3961 3876 3716 1702 1400 1019 905 870 504 294 56 ------
NM_005164chr1242140 1000 777 161 137 ----
NM_005168chr211316 ------
NM_005201chr321045 300 ------
NM_005207chr2283754 3557 3233 2571 2470 2376 1261 805 12478 ----
NM_005215chr181152 ------
NM_005235chr276487 3119 2538 2519 2102 1772 1071 15183 --22009 1729
NM_005238chr1163401 2950 2849 2758 1433 254 --32330 2180 1107 --
NM_005239chr214570 487 443 352 ------
NM_005252chr141250 ----1672
NM_005259chr221151 1097 ------
NM_005271chr1021189 428 ------
NM_005279chr2165 ------
NM_005321chr6157 ------
NM_005329chr1672337 1952 1581 834 760 298 233 ------
NM_005339chr453767 1080 673 558 534 13285 ----
NM_005358chr1331710 677 137 ------
NM_005359chr18106370 5952 4621 4544 1725 1619 595 313 211 190 14575 ----
NM_005375chr631024 768 32 ------
NM_005392chr951900 1647 1311 1151 36 --11868 --
NM_005397chr7103457 3188 2560 2433 1459 1226 1148 1086 836 705 --13793 --
NM_005402chr721198 556 11527 ----
NM_005417chr2041887 768 723 618 ------
NM_005424chr11359 ------
NM_005426chr12677 618 ----1254
NM_005433chr1842821 2001 1115 709 1826 ----
NM_005445chr101104 ------
NM_005461chr2021952 1394 ------
NM_005465chr142024 1656 508 458 ------
NM_005475chr1263314 2363 1324 605 581 290 --12291 --
NM_005476chr941095 913 880 301 ------
NM_005487chr2222016 1645 ------
NM_005497chr17126127 5877 5770 4396 3800 2294 2068 2009 1528 855 525 134 13723 12045 --
NM_005502chr972975 2579 2522 1245 1089 572 515 12823 1789 --
NM_005504chr12115922 5842 5696 5535 4785 4621 4512 4188 1714 1644 1124 25469 4173 --26245 306
NM_005509chr531459 1226 176 ------
NM_005519chr102501 421 ------
NM_005537chr1321032 256 ------
NM_005563chr12677 354 ------
NM_005587chr151677 ------
NM_005593chr12------1220
NM_005596chr934479 4323 1334 15956 ----
NM_005599chr121300 392 ------
NM_005600chr11202 ------
NM_005610chr11313 ------
NM_005614chr72889 144 ------
NM_005618chr61128 ------
NM_005625chr82973 172 ------
NM_005627chr62642 261 ------
NM_005634chrX1641 ------
NM_005639chr1221614 1481 ------
NM_005655chr81265 ----1876
NM_005656chr213490 95 84 ------
NM_005665chr164494 3963 3781 3595 1429 355 21811 1502 ----
NM_005668chr564328 3279 2929 1349 570 375 ------
NM_005715chr682646 2081 2046 2018 1978 1049 709 412 ------
NM_005717chr131311 977 873 ------
NM_005721chr22862 203 ------
NM_005722chr262505 2167 1743 1699 546 268 ------
NM_005724chr151246 ------
NM_005725chr151881 428 414 392 339 ------
NM_005732chr541476 1067 932 43 ------
NM_005738chr751886 1737 1687 1572 137 --11748 --
NM_005739chr1521665 1507 --1503 --
NM_005742chr23781 537 22 --188 --
NM_005746chr732376 2101 1809 ------
NM_005748chr1263416 2519 2289 1046 720 154 13011 ----
NM_005759chr2133300 1792 1639 1628 1573 1433 1177 916 519 330 308 293 41 ------
NM_005761chr12140 ------
NM_005766chr131482 ------
NM_005776chr14------1195
NM_005786chr1831137 476 277 --11271 --
NM_005796chr161355 ------
NM_005797chr112224 129 ------
NM_005798chr1354852 3227 1512 804 67 24668 2063 ----
NM_005801chr171816 ------
NM_005808chr361248 1099 1069 376 357 53 ----1486
NM_005819chr162946 2411 2237 528 400 382 ------
NM_005822chr652381 1801 1526 769 138 --12110 --
NM_005828chr1794786 4228 3589 3474 3333 1686 1447 926 857 --14020 --
NM_005839chr11826 ------
NM_005840chrX116530 4677 2627 2472 2316 1866 1470 1114 1083 607 257 --26496 725 --
NM_005843chr231420 505 258 11704 ----
NM_005853chr161119 --1481 --
NM_005871chr103928 345 89 --1263 --
NM_005885chr551419 1283 1233 469 137 ------
NM_005888chr122322 148 ------
NM_005898chr1173123 3054 2832 2307 2101 1056 509 1760 1247 --
NM_005900chr43414 249 136 ------
NM_005901chr18107343 7219 6607 5904 5672 3458 3275 3156 1284 176 11931 15293 15825
NM_005902chr1574503 4044 3415 1838 1186 861 606 13713 23450 2937 --
NM_005903chr574783 3834 3644 2098 1794 242 198 14026 24061 916 --
NM_005909chr563997 3674 775 766 527 317 ------
NM_005911chr211036 --11150 --
NM_005927chr54916 204 67 47 21200 1132 ----
NM_005935chr453233 3227 1125 1067 1026 ----14615
NM_005955chr1124992 4381 3898 3679 2075 1645 1433 1171 910 578 535 127 --15163 --
NM_005957chr194825 4276 3565 3153 3029 1641 1611 1575 1128 1830 14123 --
NM_005962chr1042149 1900 899 214 21599 452 ----
NM_005962chr1042149 1900 899 214 21599 452 ----
NM_005964chr1721135 159 ------
NM_005967chr124694 628 36 22 ------
NM_005977chr133908 748 639 1656 ----
NM_005998chr1195 ------
NM_005999chr11283 ------
NM_006011chr1534225 3413 629 12693 ----
NM_006016chr642149 2008 815 660 21548 778 1484 --
NM_006037chr244021 1771 1759 1380 ------
NM_006038chr2041839 406 231 88 ----1173
NM_006047chr2032728 564 402 13056 --12232
NM_006048chr111278 ------
NM_006054chr1141145 1118 215 208 11490 ----
NM_006055chr261211 1146 647 609 181 132 --12865 12424
NM_006067chr1641046 919 812 767 ------
NM_006070chr3192 ------
NM_006079chr6296 75 1320 ----
NM_006080chr752926 2314 2200 2144 975 ------
NM_006090chr11273 ------
NM_006095chr472930 2806 1571 1440 1206 850 140 31431 990 820 24362 421 --
NM_006106chr1163370 3077 2889 369 361 355 --23184 2848 --
NM_006107chr171215 --124 --
NM_006108chr1142294 1556 749 717 ------
NM_006113chr121557 40 1327 2600 559 --
NM_006147chr13328 179 69 ------
NM_006186chr22376 314 ------
NM_006195chr951208 901 555 534 51 ------
NM_006197chr841673 1657 711 382 2869 506 ----
NM_006203chr564442 3763 1101 645 369 154 14886 24785 2224 --
NM_006224chr1742474 2235 2172 687 ------
NM_006241chr372169 2027 1857 735 638 148 36 ------
NM_006252chr196868 6507 5716 4630 1967 1948 642 613 519 12065 16259 --
NM_006256chr132515 2132 825 ------
NM_006259chr44720 665 188 83 1640 ----
NM_006265chr851315 1224 259 238 189 --195 --
NM_006275chr2041809 1766 1651 598 ------
NM_006282chr2084449 4214 4155 3340 3014 1573 241 126 1201 11544 --
NM_006283chr894649 4513 4346 4177 3108 1310 1099 798 642 13315 11014 13304
NM_006306chrX85211 4711 3913 3852 3622 1480 1021 482 ------
NM_006315chr464170 4120 3373 3114 1061 652 11513 ----
NM_006320chr42781 34 ------
NM_006322chr133918 625 591 ------
NM_006335chr12867 58 ------
NM_006350chr5136 ------
NM_006364chr141831 ------
NM_006371chr384913 4320 4176 3928 3202 2006 442 91 --11938 --
NM_006380chr17103679 3455 3119 1270 1114 1045 821 781 768 582 --12837 --
NM_006393chr1034062 3725 3322 ----13591
NM_006434chr1073275 2506 2216 1308 1106 643 352 12389 11254 --
NM_006459chr102677 81 ------
NM_006467chr541783 1679 1508 862 --1912 --
NM_006471chr181264 ------
NM_006482chr1273927 3672 2637 1025 535 208 78 13005 ----
NM_006504chr1072349 2108 2070 905 793 380 261 ------
NM_006509chr191372 ------
NM_006517chrX42298 2120 757 495 ------
NM_006526chr2021881 288 --1697 1401
NM_006529chr421404 38 --11473 --
NM_006536chr1------132
NM_006538chr2103909 3600 3429 2654 1456 1417 1047 710 415 136 13981 1768 --
NM_006540chr831557 978 312 11353 1261 --
NM_006544chr1464639 4620 2326 1524 473 255 ------
NM_006546chr17106327 4611 4605 4581 2518 2354 1284 886 338 123 ------
NM_006549chr1252872 2588 1967 904 320 1333 ----
NM_006560chr111391 ------
NM_006575chr1411358 1316 ----
NM_006595chr1131833 1706 304 ------
NM_006599chr16138119 7649 6999 6816 6408 6186 5605 5396 3024 2705 2618 1860 655 15596 ----
NM_006603chrX31440 638 222 ------
NM_006609chr231172 532 256 ----11975
NM_006620chr684623 4597 4544 3773 1741 1468 1304 110 --11923 --
NM_006621chr15532 485 456 418 187 ------
NM_006624chr103696 395 44 ------
NM_006628chr1533409 1776 1621 --13667 23807 3248
NM_006629chr1852680 1052 680 297 290 1741 ----
NM_006675chr12133328 3228 3119 2875 2671 2659 2627 2489 1123 944 738 571 151 --1716 1556
NM_006682chr732544 925 248 11987 1990 --
NM_006708chr651190 1151 390 263 31 ------
NM_006710chr2133 ------
NM_006717chr932608 2394 663 ------
NM_006731chr995291 4461 4238 4044 2017 1223 1096 845 529 25746 4684 11150 --
NM_006738chr15114623 3823 3367 3185 3170 3017 1457 901 776 568 253 --1234 --
NM_006746chrX41158 558 407 24 --11522 --
NM_006750chr16137759 7512 7437 7247 6385 5718 5390 3052 2861 2264 1579 644 414 --17885 12338
NM_006751chr23739 307 240 ------
NM_006756chr821473 170 1567 ----
NM_006769chr11730 --140 --
NM_006777chrX62928 2296 2255 1980 598 55 ------
NM_006791chr151635 ------
NM_006805chr531620 1164 635 ------
NM_006838chr121434 ------
NM_006851chr1282681 2434 1164 1079 1013 742 415 103 1166 ----
NM_006856chr1211092 ------
NM_006885chr1653233 3059 1521 1156 531 1453 1506 --
NM_006892chr2041159 1143 985 323 --1379 1875
NM_006892chr2041159 1143 985 323 --1379 1875
NM_006895chr242010 1991 1506 254 1779 ----
NM_006908chr731084 300 213 11170 1452 --
NM_006912chr132438 2143 587 ------
NM_006920chr231632 1498 583 ----11979
NM_006924chr17103869 3784 3665 3310 1523 1262 1070 466 240 98 ------
NM_006925chr141355 ------
NM_006940chr1241610 1485 1362 1176 11790 --1364
NM_006947chr42702 456 ------
NM_006981chr952888 2518 2338 949 844 ------
NM_006999chr52459 270 ----1513
NM_007027chr31119 ------
NM_007038chr21115458 5172 4556 4459 3874 2421 2289 1491 1449 1343 771 25971 743 ----
NM_007039chr1442104 1990 1976 1789 1691 ----
NM_007042chr332393 2078 290 ------
NM_007050chr20177950 7924 7305 7019 6731 6689 6461 6273 6229 5719 5155 4908 3072 2957 2089 1372 85 27966 1654 32882 2468 1820 --
NM_007064chr361504 620 503 497 248 199 1434 --1443
NM_007078chr1072978 2224 1120 560 349 248 182 --1666 --
NM_007084chr1331259 1065 224 ------
NM_007096chr91180 ------
NM_007106chr1352317 929 922 91 80 --12154 --
NM_007112chr13197 29 22 ------
NM_007125chrY31240 585 196 ------
NM_007129chr131989 ------
NM_007137chrX105178 3647 2219 2088 1663 1559 997 355 159 54 --25073 2044 --
NM_007146chr1742678 2171 1064 509 12704 ----
NM_007159chr321637 536 ------
NM_007170chr11929 ------
NM_007200chr15114623 3823 3367 3185 3170 3017 1457 901 776 568 253 --1234 --
NM_007202chr171778 ------
NM_007212chr121818 1722 --11703 --
NM_007222chr831416 421 299 ------
NM_007238chr20114154 4009 3499 3351 3334 1122 601 561 294 278 92 1884 21871 425 --
NM_007249chr13219419 9248 9205 9178 9094 8379 7334 7141 7102 7011 6176 6038 5916 3601 2747 2225 2008 1597 963 899 550 26469 1894 --11720
NM_007292chr17104883 3456 3198 3148 1476 928 776 219 150 33 --13439 14151
NM_007324chr12340 31 ------
NM_007331chr452615 2308 1780 649 75 --1143 11961
NM_007345chr1851917 732 447 375 153 ----1229
NM_007347chr1562782 2174 2122 708 619 190 11158 22461 491 --
NM_007350chr1274239 3807 3478 3338 1269 1200 496 --14591 --
NM_007375chr122259 1047 ----11034
NM_012081chr563499 3255 2666 2487 2452 2305 1328 1839 --
NM_012084chrX1417 ------
NM_012089chr151428 988 235 181 67 ------
NM_012090chr11809 ------
NM_012096chr373262 2696 2411 977 796 576 360 --1707 --
NM_012111chr141169 ------
NM_012120chr632967 1000 41 12308 11052 --
NM_012137chr152878 2777 2753 2189 854 1360 ----
NM_012141chr1334183 3878 3584 --1293 12975
NM_012164chr997148 6683 5410 4890 4603 2580 1176 1042 931 1937 34986 4928 2439 --
NM_012180chr43513 502 37 ------
NM_012193chr11105254 5117 4455 4431 3800 3554 3377 1118 841 472 24485 433 13614 --
NM_012197chr941154 1123 114 30 ------
NM_012214chr256302 6136 6082 4118 1661 24876 4834 1193 --
NM_012233chr2132 --1430 --
NM_012238chr1011311 ------
NM_012249chr252641 2598 247 132 43 31430 1414 1012 ----
NM_012259chr6149 ------
NM_012262chr164717 3974 3761 1728 1216 309 14145 --14585
NM_012278chrX149 ----159
NM_012307chr181932 ------
NM_012308chr1162460 2429 2090 1720 890 717 ------
NM_012309chr11104492 3670 3527 1553 1529 1158 1135 918 464 172 ------
NM_012316chr1135516 5482 5237 4583 4549 4296 3985 3755 3466 1495 1431 1290 809 12016 11975 --
NM_012325chr2021462 86 ------
NM_012334chr574706 4384 3963 3260 3177 1825 235 14431 --13650
NM_012338chr741223 890 828 79 ------
NM_012382chr594297 4286 4081 3733 3052 1721 1507 1251 120 ------
NM_012384chr2072387 2262 1975 1942 1724 741 205 --1638 --
NM_012408chr20198 ------
NM_012463chr1251357 1292 591 74 30 1325 ----
NM_013229chr1252356 2229 954 455 385 12041 12029 --
NM_013231chr1463486 3141 2971 1612 823 379 ----22952 1646
NM_013254chr121548 ------
NM_013255chr7118747 8595 8406 7521 7292 6947 6674 5501 2820 782 323 11121 18085 16084
NM_013257chr832008 1944 1665 --12391 --
NM_013263chr16269 56 ------
NM_013269chr1264499 4048 3893 3099 1809 657 23038 387 ----
NM_013309chr1552434 815 660 535 198 ------
NM_013314chr10135 ------
NM_013316chr731045 697 291 ------
NM_013322chr751658 1076 1069 682 627 11172 21462 575 1457
NM_013374chr353044 2680 2176 1930 31 1333 ----
NM_013377chr121693 ------
NM_013381chr123750 339 35 ------
NM_013411chr162686 2461 2161 1774 362 130 1937 12485 --
NM_013437chr821138 175 --1893 --
NM_013958chr82464 421 --150 --
NM_013959chr82464 421 --150 --
NM_013961chr82464 421 --150 --
NM_013962chr82464 421 --150 --
NM_013989chr1454318 3966 3833 3192 2059 ------
NM_013995chrX42265 2006 1983 302 12586 ----
NM_014000chr1041721 1565 529 293 ------
NM_014028chr672928 2051 1168 1114 1070 123 66 32646 2469 2039 ----
NM_014048chr16135231 3948 3571 3472 3409 3372 2036 2012 2001 1773 1072 755 565 2936 291 34370 3699 1440 --
NM_014106chr1542987 2878 1079 915 22702 358 ----
NM_014110chr14914 863 472 112 --1333 --
NM_014112chr894447 3403 1940 1430 1239 1155 727 688 548 --14810 --
NM_014154chr31255 ------
NM_014155chr11125730 5536 5108 4810 2799 2748 2159 2092 2032 1344 1004 601 47515 6126 5932 5909 ----
NM_014178chr143423 141 116 --1560 --
NM_014181chr251143 941 507 301 223 12269 ----
NM_014217chr141656 1460 664 301 --11520 1762
NM_014230chr172558 514 ------
NM_014245chr35689 348 260 180 36 --1937 --
NM_014250chr2222016 1645 ------
NM_014253chrX22032 264 ------
NM_014263chr1041374 1198 1127 456 ------
NM_014264chr42225 95 ------
NM_014271chrX1703 ------
NM_014283chr131393 502 115 ------
NM_014290chr9134 ------
NM_014309chr22125300 5228 4242 4126 4113 3315 3292 1870 1667 1051 743 703 11517 13516 --
NM_014319chr121276 11232 11589 --
NM_014325chr1262271 2112 1427 910 814 125 ------
NM_014331chr4126721 6709 6219 5735 5498 4981 3080 2390 1307 1081 775 684 24987 522 17000 1510
NM_014333chr116685 650 550 427 378 47 --22334 537 12369
NM_014335chr151127 ------
NM_014350chr51106 ------
NM_014382chr331721 1571 571 ----2514 335
NM_014388chr1134958 4209 3916 1878 1723 1705 1510 1268 1136 1093 960 210 153 21738 1005 13874 --
NM_014392chr421230 1124 ----1321
NM_014393chr81337 1465 2951 45 22064 633
NM_014421chr43741 349 83 ------
NM_014423chr585309 4443 3694 2181 2151 1904 1581 994 14189 11893 --
NM_014454chr61103 ------
NM_014456chr1021890 1156 11202 126 --
NM_014470chr121109 ------
NM_014497chr2194 ------
NM_014575chr32527 499 ------
NM_014586chr21114387 4276 3702 3639 3116 1880 1767 1068 986 529 231 11128 2999 328 11465
NM_014600chr231593 1375 21 --11330 --
NM_014607chr242103 1903 310 161 --1422 --
NM_014612chr91132 ------
NM_014615chr1653518 3008 2727 2547 1350 ----12897
NM_014620chr122665 613 ------
NM_014630chr1563771 2912 1547 873 432 387 11600 ----
NM_014636chr9103786 3376 3043 2773 1519 1468 1461 1319 124 29 --23117 447 --
NM_014637chr821386 250 --1554 --
NM_014646chr1852420 2060 935 415 164 ----184
NM_014666chr53955 193 170 ------
NM_014676chr11588 ------
NM_014679chr1151410 1138 549 518 54 132 ----
NM_014701chr1582638 2166 2130 1146 1089 843 737 210 --1622 --
NM_014702chr663481 3405 2637 2152 966 779 21331 352 1181 --
NM_014705chr71700 ------
NM_014721chr6117051 6516 6410 6141 5666 2285 1652 1512 896 860 824 --16239 --
NM_014723chr2073220 2851 930 597 526 321 301 --22517 2444 --
NM_014729chr831826 816 240 ----1312
NM_014730chr1294046 4037 3690 3493 1622 1348 1116 448 326 11674 1691 --
NM_014730chr1294046 4037 3690 3493 1622 1348 1116 448 326 11674 1691 --
NM_014733chr52470 357 1543 ----
NM_014735chrX11325 ----1490
NM_014743chr462129 2013 1929 386 275 119 --12985 --
NM_014747chr1105451 5084 4542 4279 4203 3992 1439 1136 934 687 15615 14363 --
NM_014755chr252734 1501 667 214 102 1414 ----
NM_014774chr142758 1157 402 196 12092 12245 --
NM_014776chr1241114 760 78 62 --11190 --
NM_014781chr821186 455 --1354 --
NM_014795chr21240 ------
NM_014802chr122446 77 ------
NM_014803chr1032491 2336 44 12861 ----
NM_014819chr55952 730 704 541 506 22375 2099 ----
NM_014822chr41110 ----1163
NM_014826chr143717 3050 2918 247 --31382 218 162 13553
NM_014829chr522047 210 --1917 --
NM_014832chr1362072 1955 1522 1327 286 38 1262 ----
NM_014835chr2061917 1504 752 544 524 515 ------
NM_014838chr2292785 2674 1830 1062 1038 955 670 633 118 1383 22745 593 12757
NM_014840chr1242927 2370 1172 332 11243 12164 --
NM_014841chr611033 ------
NM_014850chr374661 4561 4383 3798 1894 1234 1113 --31846 523 512 --
NM_014869chr32403 56 ------
NM_014870chr174525 3998 3284 3039 1663 1404 296 21124 397 ----
NM_014873chr174823 4814 3220 3059 909 352 41 --11434 --
NM_014877chr17147401 6856 6543 6313 5431 5421 5006 2893 2751 2012 1880 1618 1522 1359 15272 26294 2509 12860
NM_014897chr1753138 1255 781 271 91 12877 ----
NM_014899chr522615 678 --1309 --
NM_014902chr201474 ------
NM_014903chr1211909 ------
NM_014904chr1083316 2871 2545 1056 378 330 308 98 --1260 --
NM_014906chr1772848 1623 1304 1166 931 818 584 34091 3854 852 ----
NM_014912chr1092248 1353 881 830 651 520 413 405 71 ------
NM_014913chr1871498 1239 561 452 371 230 137 ------
NM_014918chr1521464 1177 --11429 --
NM_014920chr633712 2360 1010 --1715 13608
NM_014934chr1353284 2933 1072 276 179 --13809 --
NM_014946chr243066 2824 2604 2333 22295 660 12589 --
NM_014947chr152880 2152 1252 1144 310 --12804 --
NM_014951chr1072622 2539 2347 2244 2201 2057 664 11047 ----
NM_014952chr1511562 --11855 --
NM_014965chr392340 1843 1771 1713 1642 680 385 377 315 ------
NM_014969chr11438 ------
NM_014982chr1464106 3317 1817 1326 871 599 24236 4057 ----
NM_014989chr611423 ------
NM_014990chr141896 ------
NM_014992chr142731 312 ------
NM_014996chr32995 788 --1332 --
NM_014997chr772846 2766 2530 2140 1086 741 132 12487 ----
NM_015000chr1263109 2970 2574 2421 1163 699 ----140
NM_015001chr12791 767 ------
NM_015009chr31287 ------
NM_015026chr1284100 4051 3689 3664 3548 3054 1009 367 --13760 --
NM_015032chr1332923 915 566 --11899 --
NM_015039chr173844 3574 3172 3063 1315 1053 859 ------
NM_015042chr1593863 3013 2928 1347 1291 1247 941 542 201 ------
NM_015044chr1692837 2702 2667 2264 1132 776 732 673 447 --2740 334 --
NM_015049chr263191 3104 2750 1280 1055 218 --12333 12700
NM_015059chr15103499 3470 2722 2695 2487 1150 911 422 312 246 12753 23381 504 --
NM_015068chr793732 3647 3389 2485 1364 989 876 685 572 23566 3244 1711 --
NM_015071chr586454 5907 5244 2612 2254 2041 1574 329 1345 12091 --
NM_015074chr1124620 3617 3480 3439 3248 3201 3093 1944 1919 1490 1351 496 --24916 4465 --
NM_015076chr644379 3510 3303 1418 23168 1097 12969 --
NM_015077chr1794392 3262 3053 1471 1227 860 788 483 377 ------
NM_015091chr141793 ------
NM_015092chr1684685 4227 4156 555 463 404 180 68 13675 ----
NM_015093chr631470 1383 488 ------
NM_015094chr2294646 4574 3881 3814 3702 3612 3537 3396 847 ----11667
NM_015115chr422636 415 ------
NM_015132chr751758 1664 1262 514 364 --11531 --
NM_015138chr152688 260 ------
NM_015149chr111422 ------
NM_015153chr62630 285 ------
NM_015156chr1463567 3238 2540 1401 419 339 158 13433 13159
NM_015161chr161140 ----1364
NM_015170chr82789 648 22027 137 1271 12044
NM_015172chr151337 1202 407 322 114 2440 64 ----
NM_015173chr4101717 1498 1215 1185 1160 655 542 381 251 108 1201 ----
NM_015176chr121593 112 --11661 --
NM_015180chr142675 170 --1877 --
NM_015191chr1182490 2104 983 709 671 477 305 30 ------
NM_015192chr20122 1592 ----
NM_015200chr452319 2098 1785 494 110 ------
NM_015206chr1553805 678 453 149 60 ------
NM_015215chr132401 316 45 12430 1508 --
NM_015225chr953175 3061 3000 2989 299 --12310 --
NM_015236chr42236 136 ------
NM_015239chr91462 ------
NM_015242chr112228 56 ------
NM_015245chr682759 2481 2211 630 503 426 397 260 --11864 --
NM_015256chr52606 520 ------
NM_015263chr151263 ------
NM_015269chr13543 403 139 1169 ----
NM_015271chr444019 1655 1014 584 ------
NM_015275chr1242047 1973 826 693 1704 2810 301 --
NM_015278chr633113 1042 252 21143 544 --12822
NM_015282chr242179 2087 908 54 ------
NM_015285chr183823 192 158 --12271 --
NM_015291chr153190 1198 807 108 33 13011 12865 --
NM_015293chr61161 ------
NM_015305chr141548 --190 --
NM_015310chr897176 6239 5672 2435 1927 1880 1523 1482 253 --13239 --
NM_015313chr1174478 4234 3406 1842 1419 336 259 1980 1313 --
NM_015328chr793094 2487 2178 1983 1907 1245 974 834 737 --12341 --
NM_015335chr1252379 1010 910 690 102 ------
NM_015336chr1242252 2241 2062 474 11920 ----
NM_015339chr204847 768 322 184 ------
NM_015344chr841807 1370 560 362 11715 ----
NM_015353chr1762545 2164 1749 1732 944 217 --12068 --
NM_015365chrX93762 3424 3006 2916 2846 2790 1685 300 210 31345 1196 523 ----
NM_015367chr2251560 1239 1125 649 543 --11525 --
NM_015378chr162125 2052 1915 626 275 199 --2819 696 --
NM_015385chr1073275 2506 2216 1308 1106 643 352 12389 11254 --
NM_015387chr222098 1429 1410 ----
NM_015396chr341210 585 238 193 --2411 145 --
NM_015435chr83972 564 84 ----1287
NM_015443chr1731453 129 54 --1309 --
NM_015455chr563294 3133 1372 1335 719 412 12550 ----
NM_015458chr895274 4077 3743 3727 3464 1773 1122 759 111 --14233 --
NM_015460chr331992 1334 174 ------
NM_015461chr181101 ------
NM_015463chr22744 39 155 ----
NM_015477chr151890 ------
NM_015497chr151893 ------
NM_015508chr331128 603 117 1997 ----
NM_015532chr1521844 153 183 ----
NM_015542chr1011234 ------
NM_015550chr763411 2588 1447 1031 690 472 12536 ----
NM_015553chr673376 3209 1925 1385 1274 1187 142 --34251 1934 1327 13892
NM_015554chr1562336 1838 1150 972 812 64 11116 ----
NM_015564chr542724 2508 2257 606 132 11368 --
NM_015565chr2151887 1726 627 177 161 ------
NM_015568chr20123553 3323 2862 1659 1134 613 548 473 431 412 130 120 13643 13089 --
NM_015569chr184759 3996 3876 2960 1421 721 375 188 23818 357 ----
NM_015570chr731591 363 190 ------
NM_015571chr662642 2369 2273 2124 1848 33 22207 131 1709 11791
NM_015575chr293044 2963 2800 2603 2332 985 824 193 129 1683 13107 --
NM_015576chr32912 500 --22634 1008 --
NM_015577chr581616 1289 1256 735 229 185 175 52 ------
NM_015602chr141603 1595 251 76 --1353 --
NM_015630chr221122 1097 11078 ----
NM_015640chr144646 3425 3281 248 24990 4394 24492 4034 --
NM_015844chr181878 ------
NM_015846chr181878 ------
NM_015847chr181878 ------
NM_015878chr841932 1386 757 24 2433 196 ----
NM_015879chr18167900 7795 7110 7099 6880 6461 5641 5310 3433 2701 2414 2326 1740 1234 943 69 26700 3239 15252 25379 347
NM_015886chr8114700 4302 4107 3871 3580 1609 1533 1366 1162 1146 1059 25574 4952 ----
NM_015906chr1134790 3951 3458 3255 1647 1631 1568 1529 1282 1224 1170 454 155 11559 21436 487 --
NM_015907chr41264 --1304 --
NM_015926chr31248 ------
NM_015955chr21358 ------
NM_015960chr101323 ------
NM_015975chrX41793 1614 306 143 ------
NM_015995chr15124742 4529 3781 3741 3721 1900 1882 1692 1621 1212 1190 252 --1127 15443
NM_016018chr862498 2349 2286 2242 908 286 22763 2082 12817 --
NM_016021chr653012 2290 978 935 160 --12400 --
NM_016025chr1641300 636 230 25 1727 ----
NM_016027chr8140 ------
NM_016075chr1392776 2688 2571 1074 718 362 352 244 191 ------
NM_016076chr162922 2253 476 462 135 25 185 ----
NM_016083chr683696 3676 3476 3439 3246 2847 2723 2602 ------
NM_016089chr381848 1523 1517 1409 1399 224 140 56 ------
NM_016106chr141183 ------
NM_016132chr1562430 2412 2398 1209 453 403 ------
NM_016133chr2180 ------
NM_016203chr731044 346 208 ------
NM_016205chr441146 1093 953 279 ------
NM_016206chr3108125 7972 6077 3121 3015 2316 2214 1798 1396 509 ------
NM_016224chr621991 88 1395 --22144 1920
NM_016227chr131393 502 115 ------
NM_016248chr1353925 3330 3125 2714 2603 12985 ----
NM_016257chr183152 2830 2699 2684 2551 2322 2229 1183 --11344 --
NM_016258chr13316 272 108 ------
NM_016260chr2147590 7550 7199 7150 6530 5900 2893 2592 1174 1026 788 480 378 350 16909 ----
NM_016275chr362655 2045 1723 1700 1072 565 1864 ----
NM_016289chr282055 1925 915 785 424 409 327 226 ------
NM_016297chr263514 2393 1363 993 873 664 1570 ----
NM_016312chr121151 --175 --
NM_016338chr531217 446 34 --1858 --
NM_016351chr7198 ------
NM_016356chr642567 684 602 458 --11956 --
NM_016401chr111117 ------
NM_016410chr91404 ------
NM_016422chr1163057 2611 2322 2298 910 789 --1929 1360
NM_016424chr1711720 --124 --
NM_016442chr531720 1464 893 11770 ----
NM_016485chr651458 847 832 618 139 ------
NM_016492chr171130 ------
NM_016506chr113279 262 80 ------
NM_016507chr1752163 2069 1986 952 362 ------
NM_016513chr633712 2360 1010 --1715 13608
NM_016530chr15133679 3387 3379 3199 2871 2766 1406 1145 1001 590 334 123 80 --13285 --
NM_016577chr3104453 4293 3992 1810 1735 1598 1400 1237 1085 768 ------
NM_016591chr51426 ------
NM_016598chr321434 28 ------
NM_016621chr1184094 3645 3220 3040 2889 1846 1543 392 --11645 --
NM_016622chr261950 1779 1457 418 398 138 ------
NM_016631chr213915 172 156 ------
NM_016824chr102161 96 --11899 --
NM_016929chr653444 3110 2927 824 435 --1341 --
NM_017412chr831385 1058 396 --1434 --
NM_017415chr573436 3155 1117 1022 927 821 739 ------
NM_017420chr1433526 2758 134 12570 --13417
NM_017437chr144593 335 199 131 --12223 --
NM_017447chr2174041 3442 3268 3122 2930 1433 530 1683 ----
NM_017449chr131533 1216 408 --11428 --
NM_017515chr1171533 1163 1097 423 330 275 89 ------
NM_017551chr1062673 2585 2269 2036 836 588 --12568 --
NM_017563chr3166379 5572 5190 4929 4652 4507 4480 4421 4162 2308 2271 2127 1610 1240 1193 341 34633 2341 1302 1806 --
NM_017569chr131314 ------
NM_017590chr2282410 2148 2045 1052 800 677 668 339 ------
NM_017623chr272269 2221 486 332 243 151 116 ------
NM_017628chr455288 1797 552 195 163 --11912 --
NM_017637chr998255 7123 3672 2923 2644 2274 2210 1952 1220 32862 731 623 ----
NM_017644chr384724 3957 3444 3201 1843 1689 1383 597 11700 --24544 4363
NM_017650chr7105948 5129 4780 4324 3826 2263 1779 1649 1425 923 25044 2304 ----
NM_017655chr111179 --11496 11286
NM_017657chr22664 371 ------
NM_017666chrX61811 586 578 280 192 152 1375 ----
NM_017693chr1331434 1232 1139 1182 ----
NM_017714chr203941 41 30 ------
NM_017719chr351949 962 768 297 40 --1676 --
NM_017742chr1831458 786 242 ------
NM_017744chr151968 1937 1929 1741 505 --12225 --
NM_017745chrX1153 ------
NM_017752chrX51620 1335 847 620 81 ----11661
NM_017754chr694787 4282 4250 3463 3385 3278 3219 1534 622 --13959 --
NM_017762chr152644 516 --1538 --
NM_017769chr1452333 2196 1137 584 545 1937 ----
NM_017770chr651992 1933 571 366 218 12391 --21151 992
NM_017778chr81468 --11372 --
NM_017799chr1431590 705 288 --1567 --
NM_017801chr392608 2434 2196 2157 1979 1955 1878 1656 392 11046 21616 445 --
NM_017813chr855428 5316 4598 3771 956 15732 33636 2175 1129 --
NM_017845chr43526 77 31 ------
NM_017848chrX64601 4580 4105 1286 580 174 1564 ----
NM_017866chr81965 ----1784
NM_017896chr2013333 --159 --
NM_017902chr10135694 5293 4872 4555 4317 4262 4141 4095 3953 2279 1428 1271 141 1652 ----
NM_017919chr994712 4258 4188 4107 3754 3729 1744 1216 425 2443 228 15152 --
NM_017933chr23653 317 131 11054 --11038
NM_017935chr44669 650 136 129 ------
NM_017938chrX32173 1949 814 ------
NM_017948chr9196 ------
NM_017994chr7122712 2659 2650 2574 2411 2279 2069 2062 1977 1211 1036 177 ------
NM_018009chr121126 ------
NM_018015chrX2891 179 ------
NM_018036chr14123886 3776 3379 3300 3277 1298 1185 1049 628 107 72 52 22724 1133 23211 1618 --
NM_018045chr192394 2302 2097 1223 908 668 646 559 37 ----1359
NM_018085chr1168055 7569 6273 5646 5633 5461 5212 3223 3197 2497 2240 1556 825 493 354 152 1430 ----
NM_018095chr113279 262 80 ------
NM_018098chr311006 ------
NM_018105chr871177 1014 446 425 231 183 116 ------
NM_018121chr1042097 790 771 647 1336 ----
NM_018125chr12166 21 ------
NM_018137chr111278 ------
NM_018156chr162125 2052 1915 626 275 199 --2819 696 --
NM_018157chr1262876 2590 1995 657 609 554 --1452 --
NM_018169chr122473 105 ------
NM_018171chr122667 273 --2258 238 --
NM_018176chr451675 1457 1270 127 93 ----11162
NM_018191chr1351857 1622 1374 520 107 ------
NM_018200chr1552570 2219 1824 375 258 ------
NM_018206chr16191 ------
NM_018214chr61952 --1445 --
NM_018247chr682912 2750 2706 2506 917 888 781 437 ------
NM_018254chr11896 --11832 --
NM_018266chr311093 ----2948 33
NM_018290chr431321 1118 454 ------
NM_018293chr352771 2312 1007 456 179 --12344 12506
NM_018299chr843385 3221 3193 2680 --22801 2439 --
NM_018313chr362287 1791 882 633 595 478 11729 ----
NM_018319chr1451394 1209 1054 593 585 ------
NM_018361chr874038 3198 3014 1301 1114 975 311 ------
NM_018371chr821032 980 ------
NM_018373chr14136157 5020 4792 4532 4509 2548 1918 1450 1260 1176 1044 889 217 14930 26260 4053 --
NM_018374chr794775 4133 4020 4002 3721 3499 1402 844 569 24952 3343 11520 --
NM_018383chr221549 644 1825 ----
NM_018394chr321207 456 ------
NM_018409chr442584 1069 351 213 ------
NM_018427chr1641086 679 624 380 11506 ----
NM_018429chr532325 816 239 2617 607 11089 --
NM_018440chr8117785 7621 6977 6313 2790 2669 1639 1597 1496 731 378 27763 3065 ----
NM_018448chr124909 794 510 180 ------
NM_018456chr31131 ------
NM_018462chr33727 557 192 ------
NM_018471chr22495 195 ------
NM_018488chr171768 ------
NM_018553chr1721171 530 ------
NM_018638chr12105316 5094 4713 4180 3858 1529 1372 1322 1294 635 11304 ----
NM_018640chr1242397 2156 1968 180 ------
NM_018650chr132109 850 635 ------
NM_018689chr1582605 2475 2358 2291 959 881 868 800 ------
NM_018700chr541404 1267 1106 24 ------
NM_018717chr452419 2358 1778 1025 647 ------
NM_018718chr772277 1586 1478 844 177 164 46 ------
NM_018840chr201314 ------
NM_018844chr751852 1667 1384 396 80 21885 173 ----
NM_018847chr951888 1592 1245 454 228 2782 95 ----
NM_018890chr731084 300 213 11170 1452 --
NM_018898chr54467 229 117 108 ------
NM_018899chr54467 229 117 108 ------
NM_018900chr54467 229 117 108 ------
NM_018901chr54467 229 117 108 ------
NM_018902chr54467 229 117 108 ------
NM_018903chr54467 229 117 108 ------
NM_018904chr54467 229 117 108 ------
NM_018905chr54467 229 117 108 ------
NM_018906chr54467 229 117 108 ------
NM_018907chr54467 229 117 108 ------
NM_018908chr54467 229 117 108 ------
NM_018909chr54467 229 117 108 ------
NM_018910chr54467 229 117 108 ------
NM_018911chr54467 229 117 108 ------
NM_018947chr7124949 4798 4692 4660 4431 3648 3036 1529 730 392 332 96 23728 1374 23921 1080 --
NM_018948chr12443 363 --21138 92 --
NM_018963chr212417 304 ------
NM_018970chr743042 2223 2037 175 ------
NM_018976chr1262650 2428 804 750 513 466 ------
NM_018979chr1231737 240 160 1823 ----
NM_018999chr1053981 3687 961 537 248 --13485 1932
NM_019001chr344602 1535 1403 665 13145 ----
NM_019006chr151645 ------
NM_019042chr74977 237 208 80 ------
NM_019050chr452234 1918 738 701 127 ----1276
NM_019072chr534043 2686 1142 --23078 679 --
NM_019084chr1072583 1935 1653 935 856 719 556 1119 --11757
NM_019087chr551481 600 350 166 125 ------
NM_019088chr192229 28 ------
NM_019094chr1251005 825 338 220 143 --12944 --
NM_019114chr942350 713 498 273 11764 ----
NM_019116chr1693702 3119 2883 2726 2708 2550 1115 527 84 ------
NM_019591chr123889 248 156 2824 51 ----
NM_019592chr91207 ------
NM_019596chr2162718 2472 1916 1002 597 392 --11177 --
NM_019600chr152646 254 ------
NM_019859chr1041478 1017 648 635 11568 ----
NM_019860chr1031526 1065 683 11616 ----
NM_019903chr102161 96 --11899 --
NM_020116chr421532 316 ------
NM_020132chr21154853 4563 4181 3990 3489 3252 2048 1946 1691 1654 902 775 553 169 156 --1324 --
NM_020135chr61307 ------
NM_020141chr151679 1594 752 694 388 --12304 --
NM_020144chr74737 640 140 113 ------
NM_020163chr372153 2018 681 376 270 206 114 ------
NM_020177chr553316 3075 2721 2358 2319 13166 12772 --
NM_020179chr11185 ------
NM_020182chr2093339 3208 3087 2936 2874 2861 2279 708 65 ------
NM_020198chr1721088 98 ------
NM_020225chr41172 ------
NM_020245chr644958 4336 334 313 11983 ----
NM_020336chr2073405 3383 3244 3185 2814 986 416 ----1561
NM_020338chr1083619 3575 3350 1101 775 645 154 90 ------
NM_020348chr1092713 2486 2180 1976 1875 1823 818 443 186 1617 ----
NM_020390chr384267 3862 3519 3281 1689 1657 318 125 --11153 14683
NM_020405chr17104009 3812 3593 3502 3212 3051 2962 1474 1132 807 ----11191
NM_020432chr742125 2002 1987 1925 ------
NM_020443chr195250 5102 2447 2361 1982 1764 1081 334 85 --36618 5967 437 --
NM_020453chr471808 1569 1316 721 432 284 227 ------
NM_020455chr672436 2091 2046 720 282 75 36 ------
NM_020456chr1362116 2001 1952 872 642 621 ------
NM_020466chr664372 3386 1897 1813 1249 729 24876 1238 ----
NM_020473chrX1250 ----1236
NM_020640chr372207 2096 1911 1528 767 291 113 ------
NM_020645chr113446 178 150 ------
NM_020651chr241593 1516 1341 440 ------
NM_020654chr321098 505 11043 11214 11160
NM_020673chr2096998 5616 5056 4900 2783 1655 1552 1375 1276 26679 4799 25269 2501 --
NM_020711chr282304 2268 1692 1630 970 906 887 604 ----12203
NM_020727chr2173774 3625 3591 1523 1392 808 467 --1615 --
NM_020739chr1574071 3428 2998 1603 1129 822 97 12972 ----
NM_020755chr621689 129 ----11186
NM_020766chrX53110 1286 1069 994 109 ------
NM_020768chr572200 1298 959 781 647 637 112 --12901 --
NM_020772chr17158241 8187 7162 6943 6140 5995 5339 3269 3211 3026 2548 2534 2468 1840 990 15628 35674 5399 1726 1822
NM_020774chr1894692 4205 3870 2422 2221 1850 1370 660 570 12496 15896 --
NM_020775chr11139 ------
NM_020781chr742866 1001 812 324 --22446 602 --
NM_020782chr1263576 3506 3493 3215 1894 1488 1519 14309 13088
NM_020783chr1832066 409 237 --1578 --
NM_020794chr111086 ----1510
NM_020796chr552271 976 772 533 22 --12862 --
NM_020805chr1851852 1770 1698 1530 231 --2336 190 --
NM_020810chr1463497 3488 2445 1459 605 266 13378 ----
NM_020839chr331545 1225 1149 --1599 --
NM_020841chr1253282 2993 2971 1318 542 ------
NM_020844chr887724 7190 5421 5305 2377 1470 528 269 15071 22611 409 --
NM_020854chr182629 254 ------
NM_020856chr191607 ------
NM_020859chr474068 3771 2696 1331 1094 853 335 --12792 --
NM_020861chr66508 405 369 270 262 70 ------
NM_020866chr131868 ------
NM_020871chrX21035 268 ------
NM_020918chr1033239 2500 599 12988 --1847
NM_020922chrX51422 1280 430 272 39 --11412 --
NM_020935chr264509 4215 1523 1516 1492 121 ------
NM_020940chr1042114 1948 837 509 11823 12434 --
NM_020948chr173638 2804 2664 2422 1288 578 277 13243 1996 11181
NM_020964chr1831523 1010 520 33280 154 147 1961 --
NM_020980chr1541154 672 606 48 ------
NM_020981chr21728 ------
NM_021005chr1521166 1026 ------
NM_021033chr1342306 1201 642 128 ----12618
NM_021038chr373100 2882 1307 1286 1171 808 721 12794 ----
NM_021061chr8104105 3349 3283 3200 3168 3073 2920 2768 1407 177 11252 33838 3007 1669 --
NM_021072chr52814 638 --22380 59 --
NM_021090chr2284997 4310 4137 3449 1541 1202 946 805 --14583 --
NM_021096chr2283018 2952 2686 2459 2277 691 487 59 --12227 1994
NM_021111chr931293 374 355 --11187 --
NM_021116chr7168826 8138 7843 7744 7567 7213 6031 5886 5834 2474 1492 1037 856 711 349 314 15774 18387 --
NM_021132chr1051280 1085 950 336 309 --1528 --
NM_021140chrX2353 210 ------
NM_021148chr762460 2285 716 611 477 242 ------
NM_021174chr81633 ------
NM_021190chr121154 67 ------
NM_021215chr2062310 1606 1594 658 179 135 ------
NM_021239chr1431301 1199 30 ------
NM_021252chr1021983 563 139 ----
NM_021255chr1433028 2752 2521 21100 642 ----
NM_021574chr2261945 646 491 319 259 206 ------
NM_021627chr341163 953 884 215 ------
NM_021629chr394965 4319 4292 3789 3629 3386 846 265 113 11453 35031 4363 3987 --
NM_021638chr4104645 4533 3971 3134 1894 1538 1255 1000 718 28 --1703 --
NM_021639chr12866 807 ------
NM_021647chr454489 1117 941 552 254 43966 3939 3672 1643 34540 3037 1279 --
NM_021705chr661492 1457 1437 472 256 222 ------
NM_021722chr7157 ------
NM_021723chr7198 ------
NM_021728chr145715 227 159 106 91 ------
NM_021738chr101120 ------
NM_021813chr695513 5210 4898 4148 3602 1150 1130 702 348 14934 24200 987 14878
NM_021814chr631365 1167 1055 ------
NM_021911chr572237 2091 1057 990 570 315 287 ----1983
NM_021912chr1553304 2678 1462 1170 424 13101 1913 --
NM_021914chr1482455 2100 1753 1723 1637 1617 368 312 ------
NM_021942chr41140 ------
NM_021960chr192618 2560 2126 2029 1955 1857 1847 520 271 ------
NM_021961chr1186425 6409 6399 5028 4629 4556 2432 257 16580 --11326
NM_021964chr3104341 4192 2603 2539 2303 2027 975 929 664 234 35345 4305 2385 15413 1757
NM_021977chr643660 3049 1141 243 13239 12995 --
NM_021998chrX31379 575 545 1318 ----
NM_022041chr1652704 1892 1025 666 512 12372 1719 --
NM_022048chr15116063 5852 5475 5295 5083 4395 4136 1324 870 576 25 --24291 970 --
NM_022049chr121894 1503 ------
NM_022058chr241970 1354 455 62 ------
NM_022085chr621353 101 ------
NM_022087chr72571 462 ------
NM_022123chr141199 ------
NM_022133chr831561 1516 755 ------
NM_022140chr551532 853 720 257 94 --12201 --
NM_022143chr731497 1372 555 ------
NM_022166chr16146331 6104 5613 5380 4756 4220 4186 2267 2253 2196 1777 1136 496 320 11580 11915 14365
NM_022336chr272343 2209 1971 1487 602 462 206 ------
NM_022346chr431310 1216 923 --1366 --
NM_022361chr61114 ------
NM_022367chr11698 ------
NM_022456chr12137030 6998 6503 6357 5826 5688 5272 5108 1716 1606 1380 612 275 25057 973 ----
NM_022458chr793173 2568 2357 937 849 644 444 391 107 --22787 2618 --
NM_022459chr13115675 5137 4769 4702 2245 1260 1239 962 477 226 28 24299 3890 15715 --
NM_022469chr153212 2555 997 948 444 ------
NM_022475chr41472 ------
NM_022484chr731280 550 491 ------
NM_022495chr141108 ------
NM_022497chr382813 2740 2711 2564 1096 788 619 489 13351 ----
NM_022716chr132910 2584 2094 1293 --12542
NM_022726chr631531 585 139 ------
NM_022728chr71696 ------
NM_022733chr141121 390 344 252 ------
NM_022735chr181495 1436 1179 667 570 525 425 203 --11265 --
NM_022763chr322326 280 163 --1503
NM_022780chr22447 57 ------
NM_022781chr973066 2933 2877 2540 1316 1002 386 ------
NM_022826chr21810 ------
NM_022831chr141150 571 340 161 ------
NM_022842chr31318 ------
NM_022843chr131161 ------
NM_022845chr1621462 438 ------
NM_022894chr231710 1426 1251 ------
NM_022977chrX72604 2342 1791 1044 849 535 388 1571 --11872
NM_023016chr252261 928 817 515 182 32639 2034 1157 12646 --
NM_023018chr131640 1474 331 ------
NM_023037chr1351139 1060 1019 347 193 ------
NM_023039chr51296 ------
NM_024007chr562781 2656 2525 568 504 95 ------
NM_024019chr41190 ------
NM_024052chr1752831 2609 2263 852 644 12689 ----
NM_024061chr71155 ------
NM_024337chr52294 89 ------
NM_024345chr995951 5855 5095 4942 4247 2372 1949 838 64 25407 4730 1885 --
NM_024429chr731044 346 208 ------
NM_024513chr383832 3289 3244 2825 2529 457 207 129 ----1475
NM_024529chr111071 ------
NM_024546chr131400 1365 ----
NM_024548chr331718 1649 146 --11622 --
NM_024596chr864948 4584 3675 1096 631 190 24643 3395 34938 3846 453 24377 3867
NM_024607chr883758 3350 3289 3211 2995 1508 1336 177 --1347 --
NM_024624chr221078 280 ----11491
NM_024639chr6102864 2843 2110 2003 1025 426 286 97 90 79 1895 --22832 959
NM_024641chr642615 2516 2143 1048 1937 --12645
NM_024659chr21173 ------
NM_024665chr354707 3398 1492 1271 494 ------
NM_024689chrX31819 1255 722 ------
NM_024692chr281770 1381 1358 580 528 276 256 139 --1742 --
NM_024700chr13305 237 63 ------
NM_024713chr1521533 1518 ------
NM_024744chr252562 2295 1769 531 52 21694 712 ----
NM_024749chr162097 1821 1686 1655 905 873 1471 ----
NM_024770chr2136729 6340 6309 6226 5630 5437 5295 5258 5087 849 816 713 529 ----1626
NM_024817chr1574632 4467 4451 4215 4182 2266 1758 15380 22035 782 --
NM_024854chr1251568 1484 1304 1297 1018 ----1224
NM_024884chr1474015 3787 3775 2816 1708 938 213 13672 11156 --
NM_024889chr1031753 1560 37 ------
NM_024941chr521387 239 ------
NM_024947chr369347 3396 3329 2101 1805 1096 21361 981 13513 --
NM_024949chr484928 4584 3840 3653 3447 3337 1741 145 ------
NM_024953chr1232082 1928 1074 --1547 1680
NM_024979chr1311145 ------
NM_024989chr266962 6109 5820 1824 1250 1159 --11555 18141
NM_024991chr1073275 2506 2216 1308 1106 643 352 12389 11254 --
NM_024993chr221453 1299 ------
NM_025040chr1961594 908 461 386 147 64 ------
NM_025054chr884152 3259 3002 2710 1362 983 942 219 12760 ----
NM_025112chr31103 ------
NM_025114chr12----1126 --
NM_025146chr321757 269 --1967 --
NM_025147chr22399 81 ------
NM_025154chr741290 1175 458 246 ------
NM_025160chr154279 3679 3615 2745 857 11242 --1771
NM_025184chrX1809 ------
NM_025191chr163292 2936 2565 2185 889 262 12696 ----
NM_025195chr851401 1360 755 741 574 11277 ----
NM_025222chr32961 59 ------
NM_025237chr171290 ------
NM_030579chr1663648 3263 2957 864 462 178 --21291 150 --
NM_030625chr1032198 1996 1040 1845 11839 --
NM_030627chr583736 2940 2716 1125 967 754 288 34 ------
NM_030637chr142685 662 ------
NM_030647chr775542 4979 4287 1950 1803 539 431 13864 ----
NM_030648chr453742 1870 1653 1279 23 ----1585
NM_030650chr284180 3897 3839 3102 1541 991 966 124 1251 12985 --
NM_030665chr1721423 170 ------
NM_030806chr1168517 8149 7804 7725 7718 7653 5966 5960 3724 3109 2651 2581 2337 2079 1870 544 19133 28573 683 28125 369
NM_030810chr621353 101 ------
NM_030817chr1283294 3158 2690 2671 1190 756 648 515 ------
NM_030918chr1175267 4934 4684 4516 4485 4312 4298 3780 3748 3688 2155 1744 1179 882 769 668 182 14529 22061 1921 --
NM_030926chr241113 1102 424 394 ------
NM_030934chr131241 274 130 11760 21529 26 --
NM_030963chr61536 ------
NM_030964chr543092 2726 1435 287 --1811 --
NM_031212chr10130 ------
NM_031243chr761783 720 711 625 349 79 21879 1577 --11730
NM_031262chr91370 1896 ----
NM_031263chr91427 1953 ----
NM_031267chr71527 ------
NM_031268chr1694939 4502 4326 3954 3828 2021 1973 1117 1107 --23361 2013 --
NM_031283chr2156 ------
NM_031298chr171167 ------
NM_031365chr282685 2395 1922 1033 560 491 440 40 ------
NM_031366chr282685 2395 1922 1033 560 491 440 40 ------
NM_031369chr42779 229 ------
NM_031370chr42779 229 ------
NM_031411chr54467 229 117 108 ------
NM_031418chr1172498 2404 1849 1799 258 246 212 22705 438 ----
NM_031427chr14145561 4605 3705 2252 2157 1417 1301 1248 1137 565 485 451 430 393 ------
NM_031442chrX22877 2539 12583 1954 --
NM_031453chr1072586 2197 1899 815 790 243 69 1429 ----
NM_031469chr693627 3593 3221 2909 1363 1312 1138 1085 191 32523 944 551 12657 --
NM_031483chr2052568 1358 1110 185 142 23051 2946 --13482
NM_031844chr163669 3523 3416 3230 1501 1412 ------
NM_031849chr54467 229 117 108 ------
NM_031857chr54467 229 117 108 ------
NM_031860chr54467 229 117 108 ------
NM_031934chr17121 ------
NM_032012chr9124666 4330 4303 4015 3501 3454 3430 3398 1994 1602 1120 209 --35140 1169 799 1981
NM_032042chr562604 2350 739 556 449 95 1890 ----
NM_032047chr332013 1719 1699 ----11633
NM_032102chr1152905 2657 2189 1022 159 --12721 --
NM_032127chr111110 ------
NM_032144chr241664 1293 1183 647 1107 1442 --
NM_032160chr1883097 3074 3051 2660 1646 1433 916 654 ------
NM_032182chr1011591 1520 --1100
NM_032189chr1332019 1307 1300 --11466 1452
NM_032208chr273537 3210 2785 2292 1182 216 32 --11432 13453
NM_032217chr41501 ------
NM_032236chr131022 710 684 --1969 --
NM_032242chr3103315 3201 2848 2243 2181 1250 752 703 253 227 --23274 600 --
NM_032268chr1632064 757 681 12025 --11154
NM_032281chr1923193 895 ------
NM_032299chr113260 244 193 ------
NM_032320chr111293 ------
NM_032373chr1065756 5054 4949 3641 1546 700 --13702 --
NM_032424chr1131164 330 59 ----1553
NM_032431chr1111022 ------
NM_032438chr631624 392 124 ------
NM_032439chr1021253 154 ------
NM_032440chr1062573 2365 2295 829 693 200 12770 22678 1046 --
NM_032452chr142285 179 ------
NM_032457chr463654 3267 793 674 547 465 11096 --12828
NM_032505chr352644 2277 911 565 86 12329 1455 12694
NM_032509chr822342 573 --11783 --
NM_032521chr2042299 1995 263 24 ------
NM_032523chr22520 148 ------
NM_032557chr441010 953 943 246 ------
NM_032569chr1621933 1500 --1566 --
NM_032622chr461542 1199 1060 604 446 158 ----11162
NM_032632chr1441741 1734 510 410 ------
NM_032682chr382906 2843 2216 1375 1329 1015 791 650 13082 ----
NM_032777chr81541 ------
NM_032784chr61201 ------
NM_032826chr795391 4687 3869 3355 2077 1438 1308 656 156 14030 ----
NM_032828chr1934397 1425 451 13439 1982 13977
NM_032833chr152531 914 435 170 159 ------
NM_032837chr1771784 1646 705 649 568 558 307 ------
NM_032839chr32117 68 ------
NM_032846chr1431377 414 45 ------
NM_032859chr1352707 1392 1294 1264 887 ----23385 3122
NM_032873chr1194371 3047 3020 1768 1650 998 725 180 103 1929 11476 13675
NM_032892chr151216 ------
NM_032924chr731167 172 101 ------
NM_032932chr1776214 6047 4555 1944 1238 998 520 12495 1632 --
NM_032968chrX94235 3924 2973 2698 1582 967 188 88 29 1427 ----
NM_032969chrX94235 3924 2973 2698 1582 967 188 88 29 1427 ----
NM_032973chrY94227 3916 2968 2693 1581 967 188 88 29 1427 ----
NM_032975chr1843446 3311 2306 619 12747 1236 --
NM_032980chr1843446 3311 2306 619 12747 1236 --
NM_033012chr131733 ------
NM_033020chr1134790 3951 3458 3255 1647 1631 1568 1529 1282 1224 1170 454 155 11559 21436 487 --
NM_033030chr231499 593 365 ------
NM_033044chr11809 ------
NM_033055chr12423 160 ----1295
NM_033071chr61161 ------
NM_033081chr201260 --2574 88 --
NM_033132chr1341899 1597 1460 101 ----1905
NM_033138chr722001 485 1678 ----
NM_033139chr722001 485 1678 ----
NM_033140chr722001 485 1678 ----
NM_033143chr474165 4119 1739 1376 395 373 284 ----21691 949
NM_033157chr722001 485 1678 ----
NM_033181chr683696 3676 3476 3439 3246 2847 2723 2602 ------
NM_033224chr7107916 7768 7253 6418 5691 5639 5429 5154 1974 548 43097 2746 1629 735 37848 1933 1202 --
NM_033225chr843227 2674 2268 306 22385 1069 1377 --
NM_033285chr863965 1402 1247 398 219 154 1607 ----
NM_033290chrX52732 2597 709 608 553 ----1130
NM_033326chr1162001 1545 701 630 521 358 ----1383
NM_033331chr973148 2406 2353 707 688 349 195 --1253 --
NM_033380chrX1162 ------
NM_033381chrX1162 ------
NM_033421chr2081917 1898 1738 1720 1210 682 471 172 --1563 --
NM_033426chr1462624 2488 2095 1910 744 640 21813 1137 ----
NM_033427chr71744 ------
NM_033429chr1553244 3128 3083 1072 616 ------
NM_033542chr2021333 61 ------
NM_033631chr173812 3731 3695 3537 1327 1163 530 ----1147
NM_033656chr2185357 4777 2207 1773 1750 1731 1508 1393 13646 21949 882 --
NM_052811chr1354852 3227 1512 804 67 24668 2063 ----
NM_052832chr852780 898 816 707 91 ------
NM_052834chr183823 192 158 --12271 --
NM_052840chr1541377 1253 1097 336 11570 ----
NM_052867chr1351447 1262 1234 1149 953 ----11322
NM_052879chr1283899 3069 2655 1470 997 800 699 322 13722 13976 13800
NM_052885chr1284715 4151 3947 3842 3589 3457 1930 763 2620 602 ----
NM_052905chr21205 --1121 --
NM_052910chr1342141 2081 1386 703 ------
NM_052918chr1043239 2655 2348 317 ----13531
NM_052937chr872533 2503 1951 1701 1095 321 228 ------
NM_052965chr12271 81 ------
NM_053001chr8------1351
NM_053016chr977953 7924 7177 7124 5614 5313 4881 16312 ----
NM_053023chr1162851 2132 1199 930 590 35 12273 12164 --
NM_053025chr341612 1129 1110 144 ------
NM_053026chr341612 1129 1110 144 ------
NM_053027chr341612 1129 1110 144 ------
NM_053028chr341612 1129 1110 144 ------
NM_053031chr341612 1129 1110 144 ------
NM_053032chr341612 1129 1110 144 ------
NM_053042chr462998 2467 2327 1273 339 120 ------
NM_053043chr755584 4329 1693 1256 207 25358 1816 1337 14368
NM_053064chr1463104 2181 1225 904 802 558 ------
NM_054016chr141794 1489 659 432 --11521 --
NM_054016chr141794 1489 659 432 --11521 --
NM_054016chr141794 1489 659 432 --11521 --
NM_054035chr171631 ------
NM_057158chr82575 207 ------
NM_057169chr1241114 760 78 62 --11190 --
NM_057170chr1241114 760 78 62 --11190 --
NM_057175chr452218 2109 2086 1845 382 22628 985 ----
NM_058170chr131205 1103 1068 11544 ----
NM_058172chr431387 517 92 ------
NM_058191chr212908 364 ----190
NM_058229chr8126 ------
NM_078483chr573550 2848 1492 1419 1400 717 66 --23276 741 176
NM_080546chr951951 1695 1479 935 327 1487 --1636
NM_080591chr942745 1191 282 212 ------
NM_080596chr6143 ------
NM_080599chr1011234 ------
NM_080669chr17114713 3685 3667 3526 3316 1627 1505 1447 1322 1261 1166 --24696 4684 --
NM_080717chr1211182 ------
NM_080723chr631399 1349 1104 ------
NM_080738chr171978 1802 1751 1478 1275 611 598 ------
NM_080743chr622323 1735 ------
NM_080759chr13174 ------
NM_080760chr13174 ------
NM_080818chr134764 267 256 227 ------
NM_080832chrX21689 222 ------
NM_080867chr1454820 4768 4596 1756 1126 11766 13794 --
NM_080872chr833686 2497 1521 23528 2733 23219 249 --
NM_080927chr343287 970 756 281 --13349 --
NM_130395chr61307 ------
NM_130434chr1521152 851 ------
NM_130435chr1072349 2108 2070 905 793 380 261 ------
NM_130436chr2162649 2528 2304 877 313 219 ------
NM_130438chr2153226 3105 2881 890 796 ------
NM_130439chr1042149 1900 899 214 21599 452 ----
NM_130439chr1042149 1900 899 214 21599 452 ----
NM_130446chr3114205 4121 3895 3583 3444 3332 3326 2919 695 473 206 ----1390
NM_130798chr1521202 71 --1227 11265
NM_130809chr562901 2278 2022 1983 1238 459 --22621 2158 --
NM_130830chr3113939 3878 3741 3616 3551 3510 3475 3447 2876 1565 1460 --12654 --
NM_133170chr20177950 7924 7305 7019 6731 6689 6461 6273 6229 5719 5155 4908 3072 2957 2089 1372 85 27966 1654 32882 2468 1820 --
NM_133264chr1753482 2640 2455 1498 26 11240 156 --
NM_133334chr4105787 5746 5155 5042 4842 4802 2098 1800 660 398 12265 12209 --
NM_133338chr5121 ----2456 421
NM_133339chr5121 ----2456 421
NM_133340chr5121 ----2456 421
NM_133341chr5121 ----2456 421
NM_133342chr5121 ----2456 421
NM_133343chr5121 ----2456 421
NM_133344chr5121 ----2456 421
NM_133367chr6103330 2711 2673 2654 2150 1361 1346 1095 1071 577 ------
NM_133370chr463528 3285 3155 2822 2649 2305 ------
NM_133372chr53526 371 163 --12853 1918
NM_133443chr1632100 1791 330 ------
NM_133445chr973757 3443 3320 2414 1381 962 731 23813 2872 23767 2961 --
NM_133477chr483127 2543 2082 2019 1170 1077 903 89 1995 1868 --
NM_133482chr541476 1067 932 43 ------
NM_133494chr1199 ------
NM_133638chr541294 531 93 77 --11088 --
NM_133646chr295518 5081 4732 4302 3374 2066 1729 1312 765 15218 ----
NM_133650chr61161 ------
NM_138270chrX103401 3323 3312 3086 2993 2176 1175 1151 885 415 ------
NM_138292chr1152874 2285 860 822 777 ------
NM_138333chr92206 164 ----22175 905
NM_138348chr5136225 5759 5560 5546 4452 2620 2364 2302 1590 1571 944 448 226 11935 14366 --
NM_138369chr53600 464 76 1503 ----
NM_138415chr221103 ------
NM_138423chr1521588 21 --1667 --
NM_138426chr752136 1958 836 663 56 1509 --1535
NM_138444chr1384803 4729 3202 3007 1955 1361 1223 373 13175 24042 857 --
NM_138459chr653493 2907 1415 1337 545 1571 --11301
NM_138468chr285302 2358 2009 1980 1919 791 751 77 1273 --15375
NM_138473chr1293805 3789 3648 3216 1912 1520 1291 1114 1090 13670 14158 --
NM_138555chr151484 1582 ----
NM_138558chr14914 863 472 112 --1333 --
NM_138621chr2103909 3600 3429 2654 1456 1417 1047 710 415 136 13981 1768 --
NM_138635chr761988 1971 1198 762 203 176 --12638 1135
NM_138638chr1482455 2100 1753 1723 1637 1617 368 312 ------
NM_138713chr16138119 7649 6999 6816 6408 6186 5605 5396 3024 2705 2618 1860 655 15596 ----
NM_138714chr16138119 7649 6999 6816 6408 6186 5605 5396 3024 2705 2618 1860 655 15596 ----
NM_138727chr151968 1937 1929 1741 505 --12225 --
NM_138728chr151968 1937 1929 1741 505 --12225 --
NM_138766chr55645 609 580 49 21 ------
NM_138779chr13185 ------
NM_138782chr571965 939 856 472 340 236 107 11494 ----
NM_138795chr131275 501 23 ------
NM_138821chr55645 609 580 49 21 ------
NM_138822chr55645 609 580 49 21 ------
NM_138927chr211180 ------
NM_138959chr1116352 5768 5234 5052 4191 2400 2209 1885 1846 1012 537 14270 ----
NM_138970chr1431571 853 731 22101 1828 11872 --
NM_139012chr641615 1502 474 285 --1570 --
NM_139045chr92342 229 ------
NM_139057chr1552760 2044 927 727 32 22076 256 139 --
NM_139068chr53686 269 79 ------
NM_139069chr53686 269 79 ------
NM_139070chr52555 138 --1162 --
NM_139169chr102558 265 ------
NM_139181chr112228 56 ------
NM_139312chr1041374 1198 1127 456 ------
NM_139319chr1231441 1148 259 11346 ----
NM_144498chr2061917 1504 752 544 524 515 ------
NM_144571chr486854 5606 5361 5224 2727 2141 965 108 26892 5296 ----
NM_144578chr14114082 3773 3510 1753 1534 1497 1403 1112 546 215 131 43968 1445 718 189 11411 --
NM_144599chr1575149 4908 4744 4685 4260 3946 1328 15219 2718 376 --
NM_144632chr211947 1899 ----
NM_144642chr33895 486 173 --11357 --
NM_144664chr1132457 385 327 1528 ----
NM_144726chr531151 320 280 ------
NM_144767chr15114623 3823 3367 3185 3170 3017 1457 901 776 568 253 --1234 --
NM_144778chr1322418 379 ------
NM_144973chr1255311 4851 3494 818 214 --1277 --
NM_144979chr41151 ------
NM_145011chr1062146 2055 2000 1475 519 264 2211 52 ----
NM_145025chr62464 254 ------
NM_145055chr1863635 2743 1297 1066 458 93 1722 13301 --
NM_145117chr1193343 2414 2204 2051 1262 807 684 477 110 ------
NM_145165chr1462324 2306 1810 864 324 118 ------
NM_145203chr131376 ----1736
NM_145253chr162467 259 ------
NM_145259chr2136993 6784 6367 6336 5892 5831 5492 4551 1970 1406 1065 1032 889 --11599 --
NM_145263chr442264 1744 863 86 1178 1500 --
NM_145268chr71390 ------
NM_145307chr1064674 4419 4282 900 874 57 11406 ----
NM_145320chr763411 2588 1447 1031 690 472 12536 ----
NM_145321chr763411 2588 1447 1031 690 472 12536 ----
NM_145322chr763411 2588 1447 1031 690 472 12536 ----
NM_145341chr1021890 1156 11202 126 --
NM_145693chr232009 1889 562 1995 22107 785 --
NM_145735chr131596 --2700 59 --
NM_145739chr22520 148 ------
NM_145756chr1821261 434 ------
NM_145808chr742572 2447 967 335 1664 ----
NM_145861chr171978 1802 1751 1478 1275 611 598 ------
NM_147188chr153488 166 52 2560 101 ----
NM_147233chr241773 1668 1577 110 ------
NM_148174chr841932 1386 757 24 2433 196 ----
NM_148177chr8126 ------
NM_148955chr15136077 5411 5343 4912 4832 4227 4187 1780 1045 788 448 402 389 15052 ----
NM_152261chr1262507 2306 2174 712 649 427 ------
NM_152263chr185453 4815 4771 1944 1839 1498 605 404 35872 1735 507 ----
NM_152265chr111194 --1624 --
NM_152271chr821018 95 ------
NM_152282chr351309 999 476 375 253 11223 ----
NM_152291chr411081 --1110 1275
NM_152305chr352196 2035 1576 660 593 --1300 148
NM_152330chr1472200 2076 1063 794 370 279 244 11629 ----
NM_152332chr1462866 2537 2224 2099 855 611 32158 1886 181 --1347
NM_152388chr264035 3796 3118 919 716 354 ------
NM_152390chr21430 ------
NM_152400chr441299 696 419 378 11485 ----
NM_152418chr81252 ----11826
NM_152420chr93695 522 177 --1726 --
NM_152433chr1131514 484 312 ----21265 1171
NM_152470chr1843222 3017 2817 1253 ------
NM_152499chr12327 90 ------
NM_152538chr341810 1633 1203 25 --11408 --
NM_152551chr662686 2264 1099 698 376 224 --22399 912 --
NM_152553chr61481 ------
NM_152574chr93427 396 304 ------
NM_152588chr1221818 522 ------
NM_152594chr1542074 1502 1452 939 ------
NM_152597chr153628 611 29 --1716 --
NM_152622chr573392 3035 2962 2345 2239 1161 62 --23301 810 --
NM_152624chr587428 6359 6311 5826 4569 2327 1694 1594 17395 186 --
NM_152629chr964120 2526 2510 1548 504 138 --22558 1044 --
NM_152636chr1172953 2710 2673 658 455 325 171 1855 ----
NM_152641chr1262115 1862 1812 1038 484 264 ------
NM_152666chr12811 685 ------
NM_152695chrX32112 2006 433 --1200 --
NM_152726chr131415 ------
NM_152740chr72682 672 1708 ----
NM_152745chr711075 11132 ----
NM_152756chr564025 3446 3144 1711 553 71 13743 13355 --
NM_152765chr841757 1633 792 201 ------
NM_152774chr712317 12368 ----
NM_152793chr775086 4626 4326 4073 3411 1131 181 --13315 --
NM_152826chr15136077 5411 5343 4912 4832 4227 4187 1780 1045 788 448 402 389 15052 ----
NM_152836chr831561 1516 755 ------
NM_152837chr831561 1516 755 ------
NM_152838chr2032728 564 402 13056 --12232
NM_152989chr1241610 1485 1362 1176 11790 --1364
NM_152991chr112709 123 ------
NM_152995chr42559 338 144 132 --
NM_152996chr131794 787 570 --1136 --
NM_152999chr734036 978 809 14824 ----
NM_153000chr181611 ------
NM_153035chr192958 2569 2546 2059 1238 972 638 448 340 1430 ----
NM_153042chr641321 641 319 248 1499 1197 --
NM_153050chr2284997 4310 4137 3449 1541 1202 946 805 --14583 --
NM_153051chr2284997 4310 4137 3449 1541 1202 946 805 --14583 --
NM_153183chrX2332 24 ------
NM_153184chr341941 1601 1551 70 ------
NM_153188chr543695 3532 3526 820 24394 3769 13786 --
NM_153226chr103995 940 801 1366 ----
NM_153235chr662325 2179 1934 1909 619 155 ------
NM_153256chr1051500 1295 1168 418 403 2716 601 ----
NM_153261chr1641337 520 288 231 11079 ----
NM_153262chr153106 2865 2712 2231 1285 12503 ----
NM_153331chr31209 ------
NM_153371chr1372365 1637 1571 372 240 233 44 ------
NM_153456chr13106038 5184 4515 4261 4103 2492 1494 1083 916 24 14209 2896 471 --
NM_153607chr562646 2348 1169 730 487 184 ------
NM_153620chr751200 1110 680 369 318 11528 ----
NM_153633chr122665 613 ------
NM_153686chr462207 2195 1903 845 442 180 12453 22306 2075 --
NM_153689chr242223 2200 1577 651 171 ----
NM_153756chr151978 1451 1227 699 240 ------
NM_153810chr10104683 4361 4030 3444 1557 1337 758 272 95 68 ------
NM_170610chr6145 ------
NM_170686chr742866 1001 812 324 --22446 602 --
NM_170695chr183323 307 28 ------
NM_170706chr173844 3574 3172 3063 1315 1053 859 ------
NM_170709chr832008 1944 1665 --12391 --
NM_170731chr1151772 845 699 343 25 ------
NM_170732chr1151772 845 699 343 25 ------
NM_170733chr1151772 845 699 343 25 ------
NM_170734chr1151772 845 699 343 25 ------
NM_170735chr1151772 845 699 343 25 ------
NM_170751chr631277 955 281 --1510 --
NM_170752chr631277 955 281 --1510 --
NM_170768chr1141369 1360 247 61 --11682 --
NM_172070chr261817 1468 891 602 331 285 ------
NM_172071chr1116645 5817 5789 5710 5461 2463 2420 1084 792 489 238 --25046 4763 --
NM_172103chr652404 966 787 446 148 ------
NM_172105chr652404 966 787 446 148 ------
NM_172127chr411544 ----11652
NM_172216chr1252872 2588 1967 904 320 1333 ----
NM_172230chr1111022 ------
NM_172337chr145715 227 159 106 91 ------
NM_172373chr1341155 311 191 143 --1466 --
NM_172375chr141254 ------
NM_173075chr421784 111 ------
NM_173083chr121107 204 ------
NM_173167chr1762542 1008 720 470 235 81 11880 1975 --
NM_173171chr22376 314 ------
NM_173172chr231087 1067 622 ------
NM_173173chr22376 314 ------
NM_173198chr952888 2518 2338 949 844 ------
NM_173200chr952888 2518 2338 949 844 ------
NM_173207chr183323 307 28 ------
NM_173208chr183323 307 28 ------
NM_173209chr183323 307 28 ------
NM_173210chr183323 307 28 ------
NM_173211chr183323 307 28 ------
NM_173214chr16138119 7649 6999 6816 6408 6186 5605 5396 3024 2705 2618 1860 655 15596 ----
NM_173468chr474569 2161 1889 1391 1035 799 774 34027 1858 1301 24238 2150 --
NM_173470chrX62613 2377 996 509 327 109 ------
NM_173478chr172973 418 --1787 --
NM_173500chr1531037 571 447 31345 1020 441 ----
NM_173511chr223080 2571 --151 --
NM_173560chr63496 399 73 ------
NM_173562chr682991 2935 2745 2485 2183 581 544 460 ----1859
NM_173564chr71869 ------
NM_173582chr1175447 4507 4442 4177 1816 714 591 ------
NM_173642chr1138059 7998 7210 6496 6235 5817 3390 3384 3285 3112 3049 2038 524 ----22567 1086
NM_173654chr342158 2007 1895 59 ------
NM_173698chrX21717 1611 1247 ----
NM_173809chr1031129 275 198 ------
NM_174886chr183323 307 28 ------
NM_174890chr101602 ------
NM_174916chr1551883 1576 1486 898 802 ------
NM_174938chr91357 ------
NM_175055chr1140 ------
NM_175058chr1171193 1166 1019 487 322 115 48 ------
NM_175061chr721566 1532 --11660 --
NM_175623chr12137030 6998 6503 6357 5826 5688 5272 5108 1716 1606 1380 612 275 25057 973 ----
NM_175709chr2283051 2890 2339 2280 1957 1169 543 189 --11061 --
NM_175733chr1141957 1718 1474 865 ------
NM_175736chr12217738 7627 7495 7024 6787 6300 5536 5204 5178 4905 3016 2982 2589 2508 1948 1930 1238 849 255 83 36 --15787 --
NM_175767chr561760 1488 1291 569 540 157 1314 ----
NM_175848chr2041159 1143 985 323 --1379 1875
NM_175848chr2041159 1143 985 323 --1379 1875
NM_175849chr2041159 1143 985 323 --1379 1875
NM_175849chr2041159 1143 985 323 --1379 1875
NM_175850chr2041159 1143 985 323 --1379 1875
NM_175850chr2041159 1143 985 323 --1379 1875
NM_175852chr172978 2679 971 544 460 387 368 --12483 --
NM_175856chr52318 206 ------
NM_175907chr1872356 1803 975 476 461 344 57 12389 ----
NM_175921chr584016 3204 3062 2800 1351 486 400 358 --23962 1251 --
NM_176812chr201757 ------
NM_177398chr12671 659 1225 ----
NM_177399chr12671 659 1225 ----
NM_177974chr1521588 21 --1667 --
NM_177983chr21382 ------
NM_178010chr1241610 1485 1362 1176 11790 --1364
NM_178011chr103704 621 449 ------
NM_178033chr12464 206 ------
NM_178151chrX77325 7251 5971 5389 2033 1844 904 --11824 --
NM_178152chrX77325 7251 5971 5389 2033 1844 904 --11824 --
NM_178153chrX77325 7251 5971 5389 2033 1844 904 --11824 --
NM_178423chr72344 72 ------
NM_178425chr72344 72 ------
NM_178539chr1252102 1769 1612 1411 529 ------
NM_178554chr3123321 3044 2937 2913 2457 1272 1221 1203 1119 984 887 385 --1186 --
NM_178557chr431542 1373 85 --11731 --
NM_178565chr831274 1226 1189 ------
NM_178566chr951657 1597 1543 410 351 ------
NM_181054chr142869 125 ------
NM_181077chr1532208 1949 887 1399 ----
NM_181351chr1162852 2089 2061 658 410 346 --22328 935 --
NM_181356chr61744 ------
NM_181442chr204847 768 322 184 ------
NM_181481chr18117028 6953 6524 6194 5736 5698 2539 2389 2223 1006 534 12630 ----
NM_181482chr18117028 6953 6524 6194 5736 5698 2539 2389 2223 1006 534 12630 ----
NM_181483chr18117028 6953 6524 6194 5736 5698 2539 2389 2223 1006 534 12630 ----
NM_181486chr1211182 ------
NM_181504chr544186 992 860 589 22720 1482 ----
NM_181521chr16166795 5930 5438 5019 4878 4792 2787 2762 2217 1999 1783 1686 1279 1046 402 78 --26488 6481 1776
NM_181523chr544186 992 860 589 22720 1482 ----
NM_181524chr544186 992 860 589 22720 1482 ----
NM_181552chr71658 ------
NM_181705chr565772 5126 5027 5019 1410 394 1206 --14728
NM_181712chr141805 1767 794 216 ------
NM_181723chr842226 476 441 269 --11634 --
NM_181782chr642251 1885 1808 134 ------
NM_181836chr552616 2234 1906 548 359 11816 ----
NM_181861chr1252356 2229 954 455 385 12041 12029 --
NM_181868chr1252356 2229 954 455 385 12041 12029 --
NM_181869chr1252441 2314 1039 540 470 12126 12114 --
NM_181897chr331728 495 219 11694 --1599
NM_182487chr994132 4110 3963 1459 1331 996 466 350 293 12935 12774 --
NM_182492chr221265 ------
NM_182493chr1685252 5243 5174 4238 3673 3633 1817 803 12035 32150 1572 419 --
NM_182515chr19124922 4615 4522 4320 4172 4086 2267 2162 1311 811 776 502 11441 ----
NM_182540chrX2682 333 ------
NM_182551chr2103382 3326 2470 2409 2399 2196 1409 843 647 434 13389 22900 71 --
NM_182663chr162069 1616 612 580 84 35 ------
NM_182664chr162199 1746 742 710 214 165 ------
NM_182665chr162069 1616 612 580 84 35 ------
NM_182680chrX136 ------
NM_182691chr72536 112 ------
NM_182692chr72536 112 ------
NM_182697chr751464 1294 1264 158 24 ------
NM_182762chr7105968 5356 5245 4295 3916 2413 2151 591 314 163 --11661 --
NM_182763chr192607 2549 2115 2018 1944 1846 1836 509 260 ------
NM_182765chr1031930 696 642 ------
NM_182767chr1221887 612 --1104 --
NM_182835chr141183 ------
NM_182896chr361384 1290 1248 1239 691 404 --1535 --
NM_182898chr756513 5852 5777 1072 86 --14231 --
NM_182899chr756513 5852 5777 1072 86 --14231 --
NM_182907chr63868 390 171 ------
NM_182910chr142675 170 --1877 --
NM_182913chr142675 170 --1877 --
NM_182914chr142675 170 --1877 --
NM_182948chr12472 337 21249 972 ----
NM_182961chr61161 ------
NM_182964chr1193343 2414 2204 2051 1262 807 684 477 110 ------
NM_182970chr2053951 3479 3466 3429 343 ------
NM_182972chr142806 2433 546 437 ----12741
NM_182975chr111018 ------
NM_183006chr201474 ------
NM_183043chr133908 748 639 1656 ----
NM_183044chr133908 748 639 1656 ----
NM_183047chr20198 ------
NM_183048chr20198 ------
NM_183237chr35751 410 322 242 98 --1999 --
NM_183397chr20124378 4233 3723 3575 3558 1346 825 785 518 502 316 187 11108 1649 --
NM_183398chr52345 221 ------
NM_183399chr52345 221 ------
NM_183400chr52345 221 ------
NM_183401chr52345 221 ------
NM_183404chr20124 ------
NM_183419chr83972 564 84 ----1287
NM_184234chr201332 177 ----
NM_194071chr7155099 4471 4337 4264 3818 3464 2046 1605 1232 1091 1005 976 825 586 129 25117 1646 13930 --
NM_194247chr264394 4372 3990 3773 1105 253 43665 1210 656 321 ----
NM_194285chr1163237 2571 814 703 91 63 23341 170 ----
NM_194286chr12116068 5729 5709 5020 4245 4219 4174 3968 1090 492 216 --25768 1123 --
NM_194314chr164991 4414 3937 3844 820 117 ------
NM_194317chr242373 1963 1734 884 ------
NM_194328chr973066 2933 2877 2540 1316 1002 386 ------
NM_194329chr973066 2933 2877 2540 1316 1002 386 ------
NM_194330chr973066 2933 2877 2540 1316 1002 386 ------
NM_194332chr973066 2933 2877 2540 1316 1002 386 ------
NM_194356chr1241733 800 213 162 12181 22109 807 --
NM_194442chr121291 648 11391 ----
NM_194454chr711330 ------
NM_194455chr711330 ------
NM_194456chr711330 ------
NM_197941chr521969 436 ------
NM_197970chr231499 593 365 ------
NM_198189chr2133 ------
NM_198212chr732355 1657 618 --21889 205 --
NM_198217chr1321032 256 ------
NM_198218chr1321032 256 ------
NM_198219chr1321032 256 ------
NM_198270chrX3916 731 333 ------
NM_198273chr542992 959 921 364 12086 --12949
NM_198279chrX1321 ------
NM_198281chr422591 146 ----12889
NM_198291chr2041887 768 723 618 ------
NM_198404chr132934 298 ------
NM_198428chr72319 298 ------
NM_198439chr1131514 484 312 ----21265 1171
NM_198465chrX92637 1826 1009 686 387 340 300 69 62 --12227 --
NM_198485chr362097 1991 1659 1039 767 281 ------
NM_198503chr13863 592 133 ------
NM_198581chr297160 6986 6069 5179 4954 2678 2425 2395 2030 1321 14907 --
NM_198595chr4104645 4533 3971 3134 1894 1538 1255 1000 718 28 --1703 --
NM_198700chr111391 ------
NM_198794chr1411358 1316 ----
NM_198829chr731084 300 213 11170 1452 --
NM_198834chr1752275 2236 1916 1711 141 ------
NM_198836chr1752275 2236 1916 1711 141 ------
NM_198837chr1752275 2236 1916 1711 141 ------
NM_198838chr1752275 2236 1916 1711 141 ------
NM_198839chr1752275 2236 1916 1711 141 ------
NM_198889chr41501 ------
NM_198896chr1161808 1622 1435 795 697 30 1257 ----
NM_198900chr12217738 7627 7495 7024 6787 6300 5536 5204 5178 4905 3016 2982 2589 2508 1948 1930 1238 849 255 83 36 --15787 --
NM_198902chr151246 ------
NM_198904chr541519 1411 594 560 1350 ----
NM_198935chr2022766 806 12210 1977 --
NM_198947chr111220 ------
NM_198968chr1353284 2933 1072 276 179 --13809 --
NM_198989chr131372 ------
NM_199003chr861461 1298 515 467 400 122 ------
NM_199005chr951020 286 97 90 79 1890 --1954
NM_199040chr1251005 825 338 220 143 --12944 --
NM_199053chr41162 ------
NM_199078chr272269 2221 486 332 243 151 116 ------
NM_199169chr2093339 3208 3087 2936 2874 2861 2279 708 65 ------
NM_199170chr2093339 3208 3087 2936 2874 2861 2279 708 65 ------
NM_199171chr2093339 3208 3087 2936 2874 2861 2279 708 65 ------
NM_199181chr201249 ------
NM_199188chr1283899 3069 2655 1470 997 800 699 322 13722 13976 13800
NM_199190chr1283899 3069 2655 1470 997 800 699 322 13722 13976 13800
NM_199205chr81633 ------
NM_199324chr453347 3057 2794 353 210 13242 ----
NM_199421chr1454820 4768 4596 1756 1126 11766 13794 --
NM_199436chr243066 2824 2604 2333 22295 660 12589 --
NM_199440chr2179 ------
NM_199482chr222098 1429 1410 ----
NM_201428chr1141145 1118 215 208 11490 ----
NM_201429chr1141145 1118 215 208 11490 ----
NM_201430chr1141071 1044 141 134 11416 ----
NM_201437chr821473 170 1567 ----
NM_201441chr121195 ------
NM_201443chr121195 ------
NM_203281chrX1250 ------
NM_203342chr1113474 3088 2731 2602 2356 1188 1016 808 555 492 96 23172 696 ----
NM_203343chr1113474 3088 2731 2602 2356 1188 1016 808 555 492 96 23172 696 ----
NM_203372chr211237 --141 --
NM_203399chr12677 354 ------
NM_203401chr12677 354 ------
NM_203437chr22664 371 ------
NM_203446chr2142885 1093 593 235 ------
NM_203453chr931535 731 125 ----11403
NM_203458chr143681 2362 696 556 --1711 --
NM_203459chr161772 791 780 397 251 24 1272 ----
NM_203463chr2114285 3742 3734 3416 3297 3230 1747 1557 1443 415 248 ------
NM_205860chr12817 619 ------
NM_206594chr193619 3168 2791 2566 2524 1421 729 154 80 --12284 --
NM_206595chr193619 3168 2791 2566 2524 1421 729 154 80 --12284 --
NM_206839chr151635 ------
NM_206853chr663905 3790 3507 3011 290 37 ------
NM_206854chr685166 5051 4768 4272 1551 1298 1027 771 --1335 --
NM_206855chr6106131 6016 5733 5237 2516 2263 1992 1736 816 171 1467 21300 37 --
NM_206866chr2173261 2834 1292 843 801 471 291 --12921 --
NM_206876chr273551 3188 3046 2458 2410 968 31 22962 2666 --33395 3371 526
NM_206909chr897176 6239 5672 2435 1927 1880 1523 1482 253 --13239 --
NM_206937chr131865 ----1306
NM_207009chr101375 ------
NM_207292chr373100 2882 1307 1286 1171 808 721 12794 ----
NM_207293chr373100 2882 1307 1286 1171 808 721 12794 ----
NM_207294chr373100 2882 1307 1286 1171 808 721 12794 ----
NM_207295chr373100 2882 1307 1286 1171 808 721 12794 ----
NM_207296chr373100 2882 1307 1286 1171 808 721 12794 ----
NM_207297chr373125 2907 1332 1311 1196 833 746 12819 ----
NM_207304chr1322305 266 ------
NM_207361chr13104910 4561 4159 3935 1594 1502 1406 1044 118 42 --15848 15305
NM_207391chr191863 --11253 --
NM_207412chr81290 ------
NM_207418chr1_random2867 253 ------
NM_207429chr1161946 1916 357 300 251 207 ------
NM_207517chr1541997 1334 742 688 ------
NM_212460chr751886 1737 1687 1572 137 --11748 --
NM_212474chr22960 85 ------
NM_212475chr22960 85 ------
NM_212476chr22960 85 ------
NM_212478chr22960 85 ------
NM_212482chr22960 85 ------
NM_212558chr943984 3057 2652 674 --1532 --
NM_213589chr253887 1508 1294 84 77 34035 3555 111 ----
NM_213590chr1354852 3227 1512 804 67 24668 2063 ----
NM_213606chr1062682 913 894 382 360 31 ------
NM_213611chr122322 148 ------
NM_213654chr31255 ------