TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-323a-3p
miRNA Sequence: CACAUUACACGGUCGACCUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000264chr993370 3215 3040 2927 2719 2707 2456 1185 916 13236 --12649
NM_000899chr1274100 3952 3761 3294 1506 863 292 34211 3286 615 24290 502 --
NM_001003652chr18148486 8345 8268 7834 3369 2763 2600 2476 1472 1408 1186 618 245 190 138 17336 27245 317
NM_001007237chr122506 389 12794 1561 2343 255
NM_001009899chr3146306 5972 5409 5367 4933 4852 4551 2203 947 658 495 483 436 29 16200 ----
NM_001010891chr5116916 6862 6545 6200 5007 4642 4264 4237 2072 1229 671 --36597 4536 2167 --
NM_001011666chr771850 1747 982 857 843 712 538 ----15424
NM_001013031chr1023309 2749 13226 --23257 3252
NM_001013620chr12148409 7620 7426 7371 7174 6204 5735 5517 2376 2040 1689 1397 1337 410 --37915 7150 261 15881
NM_001018065chr964429 4048 3969 3804 1396 882 12241 12204 26028 4122
NM_001018066chr964429 4048 3969 3804 1396 882 12241 12204 26028 4122
NM_001025076chr10106129 5151 5145 3903 2176 1695 1295 991 829 136 15776 11047 13888
NM_001025077chr10117487 6509 6503 5261 4590 2653 2349 2187 1494 757 380 27134 684 12405 15246
NM_001033059chr661887 1718 1584 518 486 133 1141 21539 813 --
NM_001039590chrX73328 892 841 550 257 223 195 22748 678 --22493 567
NM_001039591chrX73328 892 841 550 257 223 195 22748 678 --22493 567
NM_001042555chr12103688 3383 3346 3083 3023 2973 1778 1274 662 404 34355 3319 158 13249 --
NM_001099678chr356440 5257 4267 1424 731 44722 2001 1721 1255 ----
NM_001356chrX82129 2033 1960 993 987 585 362 344 1306 11947 1689
NM_001432chr493601 3549 3511 3361 3336 3210 2842 731 182 33619 176 122 ----
NM_001542chr122506 389 12794 1561 2343 255
NM_001616chr252397 1199 502 470 335 --22880 2773 21039 780
NM_001634chr661887 1718 1584 518 486 133 1141 21539 813 --
NM_001918chr198857 7264 2014 1490 960 847 826 248 186 12200 15800 15906
NM_002025chrX159186 8819 8500 6981 6923 6902 6750 6695 3047 2942 2610 1691 1463 1311 1033 --16721 --
NM_002310chr555474 5348 1765 564 55 2546 164 26182 4569 11506
NM_002709chr263608 3348 2492 1228 358 106 13414 2811 347 --
NM_002734chr171647 1336 --21449 1407
NM_003112chr753134 3007 2915 2345 963 32168 2150 192 32233 1121 613 --
NM_003199chr18104859 3837 3789 1872 1482 885 860 834 571 486 --31297 1191 1023 15347
NM_003262chr394861 4798 4714 3722 3408 1852 1491 980 678 --25253 3225 24909 1321
NM_003463chr6103225 2824 2530 2516 2424 2276 1350 1138 716 682 32770 2523 2472 23095 1128 --
NM_003930chr722549 165 2434 191 2853 363 1405
NM_003994chr1274100 3952 3761 3294 1506 863 292 34211 3286 615 24290 502 --
NM_004745chr846979 6775 2008 594 1901 26825 2175 22000 1015
NM_004857chr1474621 4249 4157 4014 3700 1268 561 ----13676
NM_004904chr771850 1747 982 857 843 712 538 ----15424
NM_004999chr683976 3454 2961 1673 1346 943 446 263 44484 4193 609 600 ----
NM_005121chr1793226 3039 2696 1019 1012 754 690 289 102 23487 2504 ----
NM_005339chr474100 1365 1129 912 838 286 116 33925 1260 234 23148 1573 1785
NM_005359chr18115205 5145 5066 4931 4342 1671 1383 1068 1048 892 463 35013 4537 532 ----
NM_005433chr1852522 2419 1080 1074 267 1180 11067 --
NM_005665chr164855 4082 1181 961 272 233 34561 4479 3676 24076 3915 --
NM_005668chr554007 3617 3397 2796 1220 11658 1256 13631
NM_005840chrX86092 5332 2427 2217 1778 1423 810 788 57006 6972 6149 2933 1697 --15585
NM_005901chr18148486 8345 8268 7834 3369 2763 2600 2476 1472 1408 1186 618 245 190 138 17336 27245 317
NM_006007chr983792 3185 1785 1243 1233 1059 372 95 1937 --11191
NM_006106chr1192984 2934 2661 2221 2152 1297 1124 970 963 22694 177 ----
NM_006252chr167506 5675 5624 5618 4870 1644 36972 6904 564 12035 11496
NM_006561chr10106129 5151 5145 3903 2176 1695 1295 991 829 136 15776 11047 13888
NM_006599chr16127926 5857 5387 3012 2255 2247 2111 1937 1694 1507 415 225 15486 ----
NM_006654chr12103688 3383 3346 3083 3023 2973 1778 1274 662 404 34355 3319 158 13249 --
NM_006924chr17103991 3631 3568 3358 3207 3054 1473 1296 776 727 13163 1195 --
NM_007007chr12124713 3906 3869 1671 1114 849 843 512 464 438 370 289 14265 33556 1076 409 --
NM_007038chr2174561 2250 2046 1933 1334 1324 1170 24394 4368 14454 --
NM_007114chr342956 1264 1134 62 13153 1399 23308 2045
NM_007347chr1542859 2280 272 237 ----33212 2019 443
NM_012096chr333232 740 408 43743 1066 611 201 --13524
NM_013231chr1454281 4151 2701 2681 770 34204 2830 508 12694 --
NM_013255chr787801 7715 5477 2749 2322 1907 1214 833 27139 541 16698 18844
NM_013261chr483554 3508 3440 3410 3347 690 610 285 21070 1049 13197 --
NM_013281chr203563 501 59 1198 --21178 963
NM_014112chr865050 4671 2177 1650 825 786 11505 23562 68 14876
NM_014155chr1187266 6815 6089 5988 5394 2429 1040 484 26492 6081 16529 --
NM_014423chr5115493 5112 4144 3910 3665 3428 1998 1779 1628 1524 1022 44038 1194 1116 405 23764 2145 --
NM_014739chr633858 3709 3683 11354 23166 1500 1966
NM_014765chr192304 2244 2151 1927 1653 910 705 594 130 12285 --12134
NM_014774chr142922 2625 2375 191 ----23174 1998
NM_014877chr17115090 2934 2703 2023 1875 1077 987 750 736 586 194 1434 ----
NM_014982chr1464900 4835 4143 2027 1826 1183 34946 1673 480 1721 13988
NM_015026chr1233833 2957 567 43654 3213 1438 326 22931 1066 11838
NM_015092chr1654522 3465 958 909 100 34181 3079 936 24381 1123 --
NM_015879chr1898065 5780 5523 3233 2217 1614 1456 898 602 28026 830 13176 16562
NM_015886chr8105647 5487 4820 4083 4054 4037 1618 489 240 144 14848 14543 1408
NM_015906chr183812 3233 3071 1429 1104 1058 1042 500 ------
NM_015975chrX51490 1422 1157 707 229 --11213 11163
NM_016018chr852428 1964 1929 1005 68 1261 2125 100 12725
NM_016260chr234857 4644 2960 14876 36754 2665 892 17167
NM_016485chr681935 1799 1649 1639 1423 746 632 227 22133 1959 1354 --
NM_017637chr998836 6905 6500 6080 3619 2993 2960 2844 977 36734 6199 555 27733 5967 13516
NM_018351chr1254733 4396 3001 1219 206 24638 3264 1892 12883
NM_018566chr174118 3791 1865 1849 1470 1455 169 13160 2458 351 --
NM_018638chr12104844 4798 4671 4021 2241 1811 1805 744 719 170 55295 5227 4410 1504 506 15586 --
NM_020346chr1141444 1196 543 31 --11663 21659 83
NM_020772chr17118545 8527 8494 7815 7041 6798 6690 6493 6364 5716 1219 21767 863 25441 1376 --
NM_020844chr8127380 7039 6902 6593 6444 5798 5159 1935 1817 1760 483 310 26816 2898 --17322
NM_020940chr1052909 2021 1834 343 179 12633 22699 761 12495
NM_020951chr1952340 2015 875 725 277 3673 664 647 1458 3748 733 684
NM_021964chr395183 4933 4888 4803 4533 1832 1714 479 449 ----14601
NM_024345chr985052 4716 4538 4491 4461 3972 3844 932 34849 4822 4670 --14032
NM_024665chr354146 4021 1756 923 406 24530 4209 1806 23466 1105
NM_024989chr268148 5770 5705 5247 3276 2279 46370 5159 1953 972 36236 5282 152 15836
NM_025054chr883939 3758 3429 2625 417 387 381 297 24180 1033 12592 --
NM_025191chr162624 2446 2316 1350 345 114 33350 3032 1185 1769 13465
NM_030627chr564075 3367 2789 2699 1360 923 23555 2803 24140 2783 --
NM_030647chr765705 4780 4443 1872 736 470 26259 298 1289 14522
NM_032189chr1344693 4526 4343 761 ----24733 1860
NM_032968chrX23262 1524 32802 787 277 --32795 1600 549
NM_032969chrX23262 1524 32802 787 277 --32795 1600 549
NM_032973chrY33257 1524 431 32797 787 277 --32790 1599 549
NM_033020chr183812 3233 3071 1429 1104 1058 1042 500 ------
NM_033505chr296692 6514 5478 4950 4775 4601 1179 1081 804 22224 1412 26029 5808 26520 1147
NM_052918chr1033508 2948 2286 13425 --23456 3451
NM_053016chr976643 5476 3134 2912 1423 1016 530 35398 2770 487 37785 5442 364 --
NM_057175chr452156 1778 775 542 130 12074 22430 799 11783
NM_080867chr1454730 4564 1947 1747 529 --24046 1146 14057
NM_133496chr123486 2955 --21827 507 21544 1055
NM_138468chr246085 4364 4245 2533 24077 1194 36206 1746 612 14679
NM_138713chr16127926 5857 5387 3012 2255 2247 2111 1937 1694 1507 415 225 15486 ----
NM_138714chr16127926 5857 5387 3012 2255 2247 2111 1937 1694 1507 415 225 15486 ----
NM_138731chr1443442 2755 1571 681 34016 3977 3118 --1917
NM_145259chr286865 6270 5256 4698 1361 1287 958 432 11492 14482 --
NM_145808chr762983 2335 2134 2123 1904 406 12294 --22544 420
NM_152624chr5106527 6024 5424 4861 2837 1613 1215 914 577 407 27322 302 27004 2224 17441
NM_173214chr16127926 5857 5387 3012 2255 2247 2111 1937 1694 1507 415 225 15486 ----
NM_173468chr4106011 5947 5708 5535 5141 4387 3930 1178 806 228 25992 2320 ----
NM_173582chr1175073 4614 4238 4022 2301 639 317 45729 3821 1201 894 25733 1050 --
NM_173642chr195793 5695 3422 2119 1885 1332 434 235 80 27228 1132 27232 1965 --
NM_175861chr12105735 5440 4027 3944 2018 1912 1211 893 58 34 35935 4183 961 15260 --
NM_181358chr1114059 3796 2769 1627 1497 1409 1368 1341 1231 731 585 11644 33869 3607 694 --
NM_182762chr7116204 5834 5402 4841 4558 4424 3887 1496 1411 849 43 ----1928
NM_182898chr771850 1747 982 857 843 712 538 ----15424
NM_182899chr771850 1747 982 857 843 712 538 ----15424
NM_183238chr1283634 3184 1252 1174 1106 653 581 257 1438 --11544
NM_194314chr1105549 4650 4571 4345 4094 3833 2163 1547 1298 1112 21992 614 24527 4231 15212
NM_198268chr1114059 3796 2769 1627 1497 1409 1368 1341 1231 731 585 11644 33869 3607 694 --
NM_198269chr1114059 3796 2769 1627 1497 1409 1368 1341 1231 731 585 11644 33869 3607 694 --
NM_198391chr203563 501 59 1198 --21178 963
NM_198581chr2115520 4893 2806 2551 2524 1334 1077 1066 904 885 445 2809 371 32857 2061 747 --
NM_198715chr196238 5604 5476 5447 5381 5063 262 212 171 24907 495 24529 1951 --
NM_199421chr1454730 4564 1947 1747 529 --24046 1146 14057
NM_206876chr263608 3348 2492 1228 358 106 13414 2811 347 --
NM_207406chr485853 4924 4521 4396 1565 1329 795 522 46312 4501 4464 1605 1353 14579
NM_212471chr171647 1336 --21449 1407
NM_212472chr171647 1336 --21449 1407
NM_213589chr285514 4621 3803 3558 1656 1576 1115 101 15207 31975 920 115 --