TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-323a-5p
miRNA Sequence: AGGUGGUCCGUGGCGCGUUCGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52986 527 --1996 --
NM_000021chr14--1245 2362 150 --
NM_000068chr196556 525 457 443 289 98 21481 1260 --1218
NM_000084chrX116259 5124 5025 4420 4387 4240 2797 2011 1335 922 46 46196 4255 1414 1396 12142 11060
NM_000109chrX31999 1773 614 22427 600 ----
NM_000110chr13926 762 179 ------
NM_000125chr663413 3312 3254 2902 1469 65 ------
NM_000138chr1532187 342 187 11051 1168 1800
NM_000151chr1751830 1666 1411 1324 60 11524 11510 --
NM_000168chr773313 3246 2696 2271 2142 777 240 --12679 --
NM_000176chr51719 33172 919 313 12987 --
NM_000214chr2051802 1587 1279 1184 460 ------
NM_000217chr1284439 4236 4027 2009 1812 1806 1793 383 15111 ----
NM_000245chr782033 1552 1382 635 405 345 294 201 1650 ----
NM_000248chr342575 2338 2281 2267 ------
NM_000259chr1546261 1278 1102 724 34578 2230 964 14621 --
NM_000262chr2241551 448 50 37 ------
NM_000276chrX42188 1653 654 443 11435 ----
NM_000297chr411787 2688 276 --194
NM_000314chr1052669 2446 2072 563 555 12743 ----
NM_000330chrX41954 901 813 76 --12007 --
NM_000332chr646390 4426 2585 1375 16759 --11366
NM_000337chr5106341 6076 5487 4991 2541 2446 1375 1306 339 289 22349 1172 --16386
NM_000368chr974503 3526 3406 771 724 682 364 ----11031
NM_000391chr1141627 1244 650 513 11505 ----
NM_000428chr1462669 2175 2160 252 230 27 3507 379 207 ----
NM_000448chr1132244 1170 106 ------
NM_000461chr324309 1277 1284 2427 375 --
NM_000484chr212898 54 ------
NM_000554chr194725 575 366 254 1590 22397 155 --
NM_000555chrX77414 7120 6093 3010 2202 228 185 35207 5064 2684 16704 --
NM_000599chr223554 841 44113 3847 3605 3490 ----
NM_000609chr1073169 2695 2048 2002 994 974 480 1391 12868 --
NM_000612chr1173690 3569 3561 2772 2664 2622 59 43117 622 412 36 --12517
NM_000615chr1162943 2722 1839 1031 812 373 --22332 1013 --
NM_000618chr1265969 4799 1231 1024 493 37 25577 5443 ----
NM_000618chr1265969 4799 1231 1024 493 37 25577 5443 ----
NM_000633chr1821997 1313 ----35165 397 308
NM_000663chr1643069 988 614 416 11981 ----
NM_000702chr122223 1833 --1397 --
NM_000719chr1276019 4250 4200 1950 1337 1264 599 35183 4847 1830 15947 --
NM_000724chr1031461 635 292 --21919 439 --
NM_000761chr1531360 1170 1017 11185 ----
NM_000793chr1454274 3750 1987 1625 201 ------
NM_000809chr4106507 6256 5668 2811 1850 1703 953 387 364 242 17068 11612 16588
NM_000814chr1521550 940 13617 ----
NM_000818chr102360 118 ------
NM_000827chr552617 2049 1821 119 111 1102 ----
NM_000829chr1142128 1891 1418 640 ------
NM_000831chr176010 5868 5289 5001 1735 751 111 14816 13834 --
NM_000868chrX22048 666 12434 ----
NM_000875chr1596212 5498 5316 4773 4679 1931 1176 741 437 14505 14315 --
NM_000891chr1753378 2262 834 704 113 11224 ----
NM_000899chr1253747 3254 3141 3086 115 24113 1092 13396 23344 823
NM_000912chr862667 2589 2313 754 156 74 12177 ----
NM_000933chr2011730 41784 1416 1265 282 ----
NM_000950chrX42952 1364 357 120 172 1684 --
NM_000961chr20124033 3715 3601 3067 2920 1306 1215 977 854 427 416 116 33497 3364 2935 ----
NM_001001331chr352736 2677 2088 977 50 22197 314 ----
NM_001001342chr1031469 1068 480 ----11330
NM_001001433chr2052463 2311 2305 761 418 2831 617 12633 11171
NM_001001485chr33421 414 130 ------
NM_001001486chr33363 356 72 ------
NM_001001487chr33363 356 72 ------
NM_001001523chr151137 1131 978 862 212 11004 ----
NM_001001549chr742184 1117 960 391 11770 --1561
NM_001001550chr742184 1117 960 391 11770 --1561
NM_001001555chr742184 1117 960 391 11770 --1561
NM_001001685chr1782665 2470 2365 2243 1000 968 908 355 --139 1569
NM_001002762chr1042619 2530 889 21 --42839 2030 626 331 12367
NM_001002814chr853608 2492 1385 1070 427 1108 ----
NM_001002860chr1453579 2960 1468 1074 884 ------
NM_001003652chr1867480 6783 5349 3173 2370 1536 37155 2410 793 17611 --
NM_001003682chr15941 519 461 128 43 ------
NM_001003712chr1233947 1391 739 13833 ----
NM_001004065chr973910 2742 2694 2583 2535 597 369 --13075 --
NM_001004298chr103224 29 23 ------
NM_001004317chr634121 2930 448 24135 1697 14096 --
NM_001004329chr12--1399 11109 --
NM_001004419chr1254423 4345 3551 672 580 44392 1196 872 456 ----
NM_001005404chr1752854 1329 809 763 279 --12878 13282
NM_001005502chr1253819 3639 3412 1904 1341 131 45201 4950 3967 470 11194
NM_001005753chr232039 1724 1551 11482 --193
NM_001007023chr1454274 3750 1987 1625 201 ------
NM_001007024chr1773938 3722 3554 1088 776 725 32 23260 1664 11009 11321
NM_001007025chr1773938 3722 3554 1088 776 725 32 23260 1664 11009 11321
NM_001007097chr964786 4591 4429 4323 1632 935 1575 ----
NM_001007237chr152781 2673 613 495 30 11987 ----
NM_001007466chr641430 1383 1213 1173 1490 --14857
NM_001007527chr51183 ----127
NM_001008220chr553577 3445 3345 2731 2718 --23759 331 --
NM_001008239chr1811188 ----1401
NM_001008392chr382970 2358 2236 1208 1199 1172 1146 115 21309 1013 1333 --
NM_001008408chr7105919 5751 5743 5248 2375 2173 1924 1661 904 325 1233 15462 14320
NM_001008495chr811896 1890 1496 --
NM_001008536chr12744 44 1155 ----
NM_001008539chr835365 1361 997 13349 ----
NM_001009554chr471727 1677 1635 1528 999 853 313 ------
NM_001009554chr471727 1677 1635 1528 999 853 313 ------
NM_001009555chr451378 1362 1301 676 52 ------
NM_001009959chr222570 1809 32135 1827 509 ----
NM_001010000chr1812803 --11072 --
NM_001010846chr123359 3218 31436 998 289 ----
NM_001010853chr642794 962 793 262 13224 ----
NM_001010867chr186136 5887 5684 5421 5078 2117 1206 1158 --36465 4425 1294 11136
NM_001010888chrX34569 2964 888 21395 563 ----
NM_001010891chr525557 511 25232 2649 36412 5714 2338 --
NM_001010898chr173665 2569 2435 2421 468 363 320 23063 1096 --186
NM_001010934chr72888 468 1173 ----
NM_001010986chrX52088 2058 971 385 74 ------
NM_001011658chrX41761 1436 533 386 3862 733 401 ----
NM_001011663chr1021014 93 ------
NM_001011666chr746354 5148 1465 1401 1554 12454 --
NM_001012393chr1175106 4615 4277 1880 1799 863 632 11039 14651 14303
NM_001012423chr1532482 2214 1152 1517 11161 --
NM_001012642chr1542132 2031 784 455 --1361 11529
NM_001012755chrX44581 4515 1470 799 31334 489 145 ----
NM_001012761chr532157 1713 454 12033 --11909
NM_001012977chrX21335 444 ------
NM_001013031chr1063490 2958 2650 787 553 523 ------
NM_001013620chr1255463 2802 1371 777 48 35764 2975 1583 11252 --
NM_001013693chr152347 2254 1979 135 75 --2774 595 22949 2264
NM_001013693chr152347 2254 1979 135 75 --2774 595 22949 2264
NM_001014797chr1077890 7523 7087 6651 2278 2227 1004 23010 542 17301 15622
NM_001015508chr82539 132 1256 ----
NM_001015877chrX--11219 12040 1938
NM_001017368chr1721909 802 21852 1845 ----
NM_001017395chr353463 639 573 546 412 ------
NM_001017440chr747085 2172 1988 1844 47952 6484 1537 278 15936 --
NM_001017923chr1411221 11124 11661 --
NM_001017926chr821131 667 ----1326
NM_001018050chr2293476 3197 2641 2475 2243 1237 722 574 161 22383 370 22801 1132 --
NM_001018052chr2293476 3197 2641 2475 2243 1237 722 574 161 22383 370 22801 1132 --
NM_001018054chr11247 11302 ----
NM_001018064chr92812 702 1850 --189
NM_001018067chr145179 3918 3685 3378 44146 4114 1305 1012 ----
NM_001018068chr145179 3918 3685 3378 44146 4114 1305 1012 ----
NM_001018069chr145179 3918 3685 3378 44146 4114 1305 1012 ----
NM_001018074chr51719 33172 919 313 12987 --
NM_001018075chr51719 33172 919 313 12987 --
NM_001018076chr51719 33172 919 313 12987 --
NM_001018077chr51719 33172 919 313 12987 --
NM_001018089chr1532806 1069 918 2933 601 12465 --
NM_001018111chr742986 2880 2525 52 12463 1901 --
NM_001024094chr51719 33172 919 313 12987 --
NM_001024372chr822266 2053 ------
NM_001024680chr221790 730 1676 21616 1345 --
NM_001024948chr173061 2942 2877 2732 1072 942 769 12208 ----
NM_001025076chr10105971 5596 4250 4143 4122 1799 1565 1344 606 457 35661 5196 5157 25639 4958 --
NM_001025077chr10127329 6954 5608 5501 5480 4692 2923 2702 1964 1815 403 95 37019 6554 6515 26997 6316 --
NM_001025079chr344028 3343 1430 1101 11029 --13046
NM_001025108chr243281 3156 2641 1183 33965 2997 2869 ----
NM_001025356chr122288 210 32526 979 442 ----
NM_001025580chrX63854 3845 3191 1135 797 744 ------
NM_001029858chr663057 1328 1089 1025 610 229 12835 ----
NM_001029863chr643070 3040 2807 2063 12585 ----
NM_001030006chr1752248 1881 1726 226 197 1989 1108 --
NM_001030007chr1642558 1589 1165 461 ------
NM_001031690chr742860 2228 2144 2094 --12448 --
NM_001031695chr2225242 3820 23373 1430 35065 4960 1325 14359
NM_001031740chr131646 1471 686 --31494 675 258 --
NM_001031804chr1654392 3162 1730 107 28 197 1404 --
NM_001032288chr2061598 1446 1024 483 341 231 1558 --11350
NM_001032380chr1041638 1364 412 56 1180 1460 --
NM_001032999chr2045209 3662 1991 928 44062 1644 1513 875 14736 1305
NM_001033044chr131833 737 270 ------
NM_001033045chr264408 3506 3117 2816 1449 856 --23140 407 --
NM_001033056chr131833 737 270 ------
NM_001033057chr32701 567 1753 --11352
NM_001033117chr344735 4449 1626 1489 33182 630 534 --1885
NM_001033551chr1773212 3199 2897 2600 898 128 71 1767 23122 312 33752 1461 1113
NM_001033602chr1332504 2315 675 32384 1867 582 12556 --
NM_001034841chr1675416 4688 4153 3766 868 821 152 54523 4303 4002 1375 876 23524 2177 13511
NM_001034850chr521178 239 11192 ----
NM_001035003chr4273 52 21346 1079 1985 --
NM_001035004chr4273 52 21346 1079 1985 --
NM_001037164chr721328 456 31603 1388 229 ----
NM_001037174chr222044 1498 --1139 --
NM_001037334chr1821818 418 1405 1143 --
NM_001037954chr1141157 914 205 141 11207 12603 --
NM_001039479chr145851 796 252 199 75 21731 98 ----
NM_001039569chr243123 1327 1191 1028 33316 2516 252 32949 2159 1350 --
NM_001039590chrX33948 3402 2441 ------
NM_001039591chrX33948 3402 2441 ------
NM_001039690chr1642103 2002 93 61 --21596 123 --
NM_001039709chr2045209 3662 1991 928 44062 1644 1513 875 14736 1305
NM_001039840chrX55202 4065 2355 2316 2212 ------
NM_001039937chr1363463 3452 3330 1222 634 21 ------
NM_001040101chr42603 220 --1165 --
NM_001040144chr1642103 2002 93 61 --21596 123 --
NM_001040146chr1642103 2002 93 61 --21596 123 --
NM_001040152chr785029 4290 2055 1299 1039 1017 441 161 83553 1950 1486 1112 1063 497 482 467 42044 1255 600 300 --
NM_001040157chr431983 996 416 22673 836 ----
NM_001040181chr3--2169 148 ----
NM_001040182chr3--2169 148 ----
NM_001040183chr3--2169 148 ----
NM_001040199chr3--2169 148 ----
NM_001040200chr3--2169 148 ----
NM_001040284chr1675921 5689 5186 4678 2162 1673 516 ------
NM_001040424chr2142655 2413 2214 2165 --1838 12550
NM_001040429chr1343115 2455 967 360 ------
NM_001040446chr522499 704 3650 509 304 1593 --
NM_001040450chr1542886 889 767 27 --12706 --
NM_001040453chr1542886 889 767 27 --12706 --
NM_001040665chr754573 3524 3312 1120 879 11134 ----
NM_001040875chr8------11917
NM_001042383chr352662 2269 1152 837 224 13057 ----
NM_001042413chr953069 3054 2541 711 52 23898 3859 ----
NM_001042424chr462560 2431 1146 1081 967 155 2890 255 12843 12113
NM_001042493chr621926 714 12026 ----
NM_001042494chr1533434 3029 1285 32657 1171 79 21442 1021 --
NM_001042495chr1533434 3029 1285 32657 1171 79 21442 1021 --
NM_001042496chr1533434 3029 1285 32657 1171 79 21442 1021 --
NM_001042497chr1533434 3029 1285 32657 1171 79 21442 1021 --
NM_001042533chr342767 2406 1130 865 ----12874
NM_001042537chrX42408 1827 616 67 12137 ----
NM_001042555chr1214084 13291 --13898
NM_001042599chr286515 6283 6033 5699 5523 2901 2503 787 11616 ----
NM_001042601chr332514 648 369 ------
NM_001042603chr1254499 1964 1170 454 42 14053 ----
NM_001042632chr2052526 1683 679 613 160 21840 415 32353 1754 378 --
NM_001042633chr2052526 1683 679 613 160 21840 415 32353 1754 378 --
NM_001042749chrX11652 12020 ----
NM_001042750chrX11652 12020 ----
NM_001042751chrX11652 12020 ----
NM_001043318chr1483434 3361 3342 3263 2898 838 747 510 12756 23498 1058 --
NM_001099678chr333911 1870 907 25407 4103 24795 1058 14083
NM_001106chr378035 6489 3652 2954 2620 1435 305 --11443 --
NM_001113490chrX52650 1194 1169 1088 1020 13337 --1793
NM_001122679chr52986 527 --1996 --
NM_001128chr1642558 1589 1165 461 ------
NM_001140chr173494 177 37 1421 ----
NM_001163chr92983 806 1826 1265 --
NM_001167chrX76404 6251 5889 5612 5053 4413 1102 35755 2140 2003 14079 --
NM_001177chr1242205 187 41 35 12096 1483 --
NM_001186chr2133171 2285 27 13140 178 --
NM_001198chr662233 1746 1559 945 876 834 11530 11797 --
NM_001204chr287084 6629 5125 4882 4810 2234 528 253 35519 1705 742 15809 15527
NM_001206chr932601 2543 537 ------
NM_001222chr1031855 1254 289 --11500 1560
NM_001232chr1--150 --1276
NM_001233chr731974 238 72 21960 1705 ----
NM_001257chr162528 282 --11071 --
NM_001259chr754871 1727 1645 1199 156 24292 1372 ----
NM_001282chr1752248 1881 1726 226 197 1989 1108 --
NM_001304chr1743506 1528 638 615 ------
NM_001310chr1242227 398 234 96 11043 ----
NM_001315chr642282 2073 1962 211 ------
NM_001331chr1122692 559 12546 12609 1646
NM_001343chr521441 565 1348 126 1493
NM_001346chr352123 1908 1013 858 142 --22175 2101 --
NM_001364chr1163944 3731 3632 3199 1628 1171 ------
NM_001386chr842356 1553 1492 569 11773 1241 --
NM_001390chr1863411 2550 2337 2212 566 100 22244 155 11162 --
NM_001401chr91288 1483 ----
NM_001406chr1741444 576 358 283 11578 21568 1284 --
NM_001412chrX42407 558 294 239 12927 13183 --
NM_001419chr1994533 4064 4058 3140 1679 1185 600 509 375 13959 24047 1443 23063 583
NM_001421chrX41663 1609 1592 376 ------
NM_001431chr62311 226 187 ----
NM_001448chrX4731 694 128 68 ------
NM_001465chr541675 813 205 105 ----1293
NM_001542chr152781 2673 613 495 30 11987 ----
NM_001587chrX42188 1653 654 443 11435 ----
NM_001649chrX62445 1735 1568 983 934 612 ------
NM_001650chr1833173 1200 885 --33690 2601 506 11603
NM_001668chr132170 2093 425 12245 ----
NM_001683chr352736 2677 2088 977 50 22197 314 ----
NM_001709chr1132210 1853 937 12152 --12038
NM_001777chr344028 3343 1430 1101 11029 --13046
NM_001789chr311266 11412 21093 556 --
NM_001858chr674809 4217 4201 3705 943 524 494 3970 859 700 ----
NM_001874chr1253819 3639 3412 1904 1341 131 45201 4950 3967 470 11194
NM_001918chr1109157 8672 7232 6673 2749 2418 2392 1862 1856 1540 38248 7052 2184 48627 1698 1674 355 --
NM_001923chr112238 75 ----1249
NM_001949chr623216 721 1857 21199 372 --
NM_001977chr431622 431 365 ------
NM_001981chr13803 351 82 11547 ----
NM_001987chr1244123 4116 1014 179 33623 3419 2914 1802 --
NM_002006chr432107 1511 1013 14174 14722 --
NM_002025chrX98877 8208 7578 6498 3609 3596 1022 307 251 18716 38585 1397 407 32878 2447 2189
NM_002035chr1843668 2775 1485 214 --11184 --
NM_002065chr131833 737 270 ------
NM_002069chr7------11837
NM_002076chr1252881 2749 2312 287 92 23131 493 ----
NM_002092chr421287 327 44675 4436 4301 1186 ----
NM_002128chr1332052 378 157 31997 1913 1903 ----
NM_002131chr641217 964 126 78 2155 105 21236 1143 --
NM_002137chr711978 ----22309 1829
NM_002139chrX3625 83 73 ------
NM_002158chr243691 3181 3136 2316 --12845 --
NM_002214chr745576 4686 1546 1312 11448 13930 --
NM_002218chr32430 323 ----183
NM_002223chr1241203 808 364 52 23928 3416 ----
NM_002227chr151281 969 926 825 490 41254 960 309 285 ----
NM_002264chr374841 4458 4381 3820 3697 1155 607 24483 1484 14897 --
NM_002267chr131243 149 1738 --
NM_002285chr243281 3156 2641 1183 33965 2997 2869 ----
NM_002334chr1121471 174 22059 781 ----
NM_002359chr1773335 1579 1525 852 844 402 38 11368 --1531
NM_002387chr563266 1636 1542 1380 1300 54 33784 1813 1503 11894 24341 641
NM_002397chr542192 854 576 562 ------
NM_002445chr851453 536 319 251 38 1233 ----
NM_002460chr653068 2359 1217 1194 438 12927 ----
NM_002480chr1241425 1262 223 56 11247 ----
NM_002508chr141929 1745 1232 100 1553 11511 --
NM_002519chr112565 494 ------
NM_002522chr1773851 3177 2434 1510 1060 1050 940 --13291 --
NM_002545chr1175106 4615 4277 1880 1799 863 632 11039 14651 14303
NM_002556chr1131998 1605 802 1143 1701 --
NM_002576chr112793 325 --11181 --
NM_002581chr942185 1541 1177 829 11909 ----
NM_002595chr12------11516
NM_002609chr551780 1346 1270 1252 758 --11329 --
NM_002613chr1675180 4790 4775 3545 3467 1065 1043 12133 24102 86 14520
NM_002655chr854532 4130 3223 1284 59 24605 1297 ----
NM_002709chr222257 80 23528 28 ----
NM_002725chr173857 3118 3038 2813 1444 1058 33 13141 12858 14327
NM_002731chr11763 1526 1225 --
NM_002745chr2254399 3051 494 440 360 ------
NM_002760chrY35469 4830 4419 14848 23916 1744 --
NM_002829chr92813 807 21205 284 ----
NM_002834chr1231587 1318 924 1484 2174 136 --
NM_002837chr1273430 3328 3043 1843 1148 1032 317 23194 1789 ----
NM_002849chr1211012 ----126
NM_002855chr1173664 3546 2937 2327 1392 1292 31 --22826 1277 --
NM_002886chr394300 4242 4115 4101 3204 2083 1823 1702 1127 11667 198 --
NM_002890chr51917 --1261 1792
NM_002906chr11--32068 477 44 ----
NM_002959chr173655 3485 3310 2895 596 589 419 --13154 --
NM_002998chr831553 794 34 11735 ----
NM_002999chr2061817 1776 498 457 313 259 ------
NM_003010chr1742062 1891 297 190 1837 ----
NM_003026chr961275 910 348 324 300 56 ------
NM_003029chr131355 1086 950 1212 1444 --
NM_003030chr3----1129 11264
NM_003034chr12117776 7714 7417 6640 6293 6227 5114 5004 2895 1862 1509 16507 --1813
NM_003043chr3124303 3640 3387 2962 2657 1711 1673 1421 1244 899 804 368 13399 ----
NM_003045chr13104912 3255 3193 1318 1149 901 688 242 224 99 13299 14977 --
NM_003046chr835365 1361 997 13349 ----
NM_003051chr141748 1456 789 770 ------
NM_003074chr342146 1994 688 153 21700 36 ----
NM_003100chr5182 196 ----
NM_003108chr287151 6793 6732 5733 4583 2594 2478 599 16091 11457 16719
NM_003112chr722767 2579 1599 ----
NM_003118chr542036 1912 1713 1646 21383 626 ----
NM_003156chr111387 --11141 1190
NM_003189chr172959 2952 2727 2598 2455 1325 431 12470 ----
NM_003199chr1825119 1088 --145 --
NM_003202chr541778 1224 485 45 --11455 --
NM_003234chr321621 201 11972 ----
NM_003236chr242205 592 218 125 --2576 373 --
NM_003246chr154831 689 415 91 ------
NM_003257chr1531032 968 64 11349 ----
NM_003262chr354357 3829 3511 1638 818 44695 4559 3926 1655 ----
NM_003298chr356225 5641 5145 2215 741 --11333 --
NM_003305chr43333 288 107 ------
NM_003320chr1184097 4076 3765 3731 3040 1614 1588 463 --13810 --
NM_003349chr2061598 1446 1024 483 341 231 1558 --11350
NM_003369chr1132591 2187 238 22729 1933 ----
NM_003373chr1021890 1690 11342 ----
NM_003392chr354274 2956 2915 1073 143 ------
NM_003410chrX21039 337 --1524 --
NM_003439chr732890 840 524 --12302 --
NM_003458chr353767 3749 2731 1583 293 51171 988 809 760 348 22748 237 11083
NM_003466chr252352 1931 683 487 426 ------
NM_003468chr243218 3047 1427 717 ------
NM_003472chr61504 1372 11203 --
NM_003473chr102815 792 1450 ----
NM_003483chr1262525 2226 2186 1106 471 192 12271 174 --
NM_003489chr2143160 2378 963 865 --1948 --
NM_003566chr1222613 79 22923 1295 ----
NM_003574chr1842156 1523 786 102 14606 --13702
NM_003575chr781409 1382 1253 294 256 228 86 64 1319 1287 --
NM_003583chr1232720 915 285 23001 2703 ----
NM_003597chr221984 1710 2412 264 ----
NM_003615chr343302 2959 2550 2541 --22635 109 --
NM_003618chr221060 915 148 ----
NM_003622chr1242375 2176 576 377 32528 2390 950 ----
NM_003629chr162822 2441 2229 790 353 61 --13357 --
NM_003633chr532530 2455 2209 --1516 --
NM_003644chr17116491 6034 5298 5236 2619 2562 1795 1182 1146 637 103 24027 563 34877 4463 1494 14132
NM_003663chr333102 404 155 ------
NM_003672chr121725 183 ------
NM_003692chr93329 282 30 ------
NM_003758chr1521607 1460 ----11422
NM_003758chr1521607 1460 ----11422
NM_003763chr2052463 2311 2305 761 418 2831 617 12633 11171
NM_003768chr131477 686 92 --2456 46 --
NM_003831chr1831789 1333 194 11444 ----
NM_003873chr1042535 676 436 182 12350 1111 11967
NM_003884chr31362 21500 695 ----
NM_003885chr1782112 1825 574 566 491 446 224 216 198 12707 --
NM_003913chr633614 1229 417 22815 547 13059 --
NM_003927chr1821058 700 ------
NM_003966chr567712 6728 6505 856 308 206 22982 126 ----
NM_003980chr621221 1148 ----1118
NM_003994chr1253747 3254 3141 3086 115 24113 1092 13396 23344 823
NM_004006chrX31999 1773 614 22427 600 ----
NM_004007chrX31999 1773 614 22427 600 ----
NM_004009chrX31999 1773 614 22427 600 ----
NM_004010chrX31999 1773 614 22427 600 ----
NM_004011chrX31999 1773 614 22427 600 ----
NM_004012chrX31999 1773 614 22427 600 ----
NM_004013chrX31999 1773 614 22427 600 ----
NM_004014chrX31999 1773 614 22427 600 ----
NM_004015chrX31999 1773 614 22427 600 ----
NM_004016chrX31913 1687 528 22341 514 ----
NM_004017chrX31999 1773 614 22427 600 ----
NM_004018chrX31913 1687 528 22341 514 ----
NM_004020chrX31999 1773 614 22427 600 ----
NM_004021chrX31913 1687 528 22341 514 ----
NM_004022chrX31913 1687 528 22341 514 ----
NM_004023chrX31913 1687 528 22341 514 ----
NM_004028chr1833173 1200 885 --33690 2601 506 11603
NM_004035chr1754894 4589 3785 3152 642 24454 3350 21791 1767 13279
NM_004050chr1462225 2104 1961 1056 863 267 --11973 --
NM_004067chr74546 167 80 38 ------
NM_004077chr121839 1547 --129
NM_004096chr1051599 1499 1378 322 179 ------
NM_004117chr632121 2036 589 --21865 203 --
NM_004124chr1443180 2512 225 46 ------
NM_004136chr1531024 636 279 22491 1997 ----
NM_004171chr1156559 2224 2077 1798 753 23536 2092 ----
NM_004200chr1153047 2110 1173 379 60 33106 2536 2355 22897 2133 12647
NM_004232chr1813033 23364 736 ----
NM_004274chr1443040 2806 2778 2183 ------
NM_004279chr741677 626 596 361 21783 1664 1136 --
NM_004282chr63616 602 96 ------
NM_004296chr14123928 3690 3566 3288 3253 3115 2443 1615 1207 1077 490 446 23521 3382 42825 1403 779 521 --
NM_004311chr103957 591 565 11987 ----
NM_004321chr263271 2688 2678 614 518 450 --31313 890 741 1936
NM_004327chr2252478 2467 2123 1913 344 11794 3755 229 103 --
NM_004331chr841745 974 106 81 3384 330 280 ----
NM_004380chr1641817 1778 696 685 ----12089
NM_004391chr341429 769 646 199 21838 1472 196 --
NM_004393chr322318 88 --11932 --
NM_004397chr1132974 2878 476 12619 ----
NM_004411chr7------1743
NM_004432chr91122 21643 901 ----
NM_004440chr631407 242 200 1166 ----
NM_004454chr331537 621 368 1207 ----
NM_004458chrX22032 1736 ------
NM_004500chr1421703 1638 ------
NM_004501chr143839 3405 3081 896 --13430 --
NM_004538chrX3776 651 571 ------
NM_004567chr351596 1438 792 445 431 --11751 125
NM_004586chrX74859 4367 4143 4065 1717 1277 281 24741 3611 11542 --
NM_004598chr543038 2673 2207 1236 ------
NM_004612chr923391 1940 24826 433 ----
NM_004631chr11247 11302 ----
NM_004655chr172938 920 --1241 --
NM_004694chr171701 1148 ----
NM_004717chr74523 458 401 134 11414 ----
NM_004726chrX84579 3811 3668 2114 1306 1255 867 484 34106 1980 547 ----
NM_004734chr1332663 1228 59 12877 ----
NM_004742chr321220 1201 --1494 --
NM_004745chr875900 5245 2780 2422 2193 1703 416 46580 6022 2450 617 --15102
NM_004756chr1951092 968 518 286 134 1147 ----
NM_004759chr161874 1762 633 525 509 245 --31643 791 90 1338
NM_004775chr1842273 1816 1495 31 ------
NM_004779chr531349 1129 114 1263 ----
NM_004791chr132490 107 187 ----
NM_004798chr2032953 814 422 1553 23258 739 12822
NM_004808chr1073308 3145 3139 2964 2378 796 467 22367 2232 --12602
NM_004815chr164570 4529 3397 3330 3078 1383 13282 ----
NM_004822chr1763801 3570 2858 2821 1316 862 1492 22574 561 --
NM_004849chr63677 369 183 --1246 --
NM_004857chr1453589 1763 1615 874 174 ------
NM_004859chr1783023 2218 2188 1947 948 808 707 461 --1155 --
NM_004871chr1773938 3722 3554 1088 776 725 32 23260 1664 11009 11321
NM_004897chr10--1916 2669 359 --
NM_004904chr746354 5148 1465 1401 1554 12454 --
NM_004947chr37992 710 511 480 297 181 126 31730 1705 962 11858 --
NM_004956chr753449 1826 1160 734 534 1650 ----
NM_004976chr1194592 4467 4202 3956 1725 1438 1383 1118 906 1642 --1784
NM_004985chr1211720 --14418 --
NM_004992chrX58012 7816 7336 3404 1096 57484 6885 6337 2674 1072 18141 --
NM_004992chrX58012 7816 7336 3404 1096 57484 6885 6337 2674 1072 18141 --
NM_004999chr623889 423 --1289 --
NM_005056chr1264743 2208 1414 698 286 186 24297 217 ----
NM_005060chr151137 1131 978 862 212 11004 ----
NM_005063chr1033368 2554 1536 12399 ----
NM_005065chr1494797 2152 2085 1945 1846 1023 966 876 364 13818 14765 11959
NM_005093chr2045209 3662 1991 928 44062 1644 1513 875 14736 1305
NM_005116chr2063504 2894 1171 809 352 326 22788 1049 44002 3954 2883 693 --
NM_005135chr1533434 3029 1285 32657 1171 79 21442 1021 --
NM_005151chr1821818 418 1405 1143 --
NM_005155chr61674 --2485 95 --
NM_005156chr954802 2082 1876 1836 35 23558 997 ----
NM_005180chr1041369 1076 618 153 ------
NM_005197chr1434419 4056 36 24501 4070 12091 1610
NM_005206chr1731424 1054 432 ------
NM_005233chr332010 791 490 ------
NM_005235chr286515 6283 6033 5699 5523 2901 2503 787 11616 ----
NM_005277chr451402 443 317 132 66 ------
NM_005311chr742184 1117 960 391 11770 --1561
NM_005339chr433698 1715 1249 13458 --1492
NM_005342chrX42690 2479 2449 119 ----12066
NM_005347chr951673 1317 1311 1156 566 1582 21683 1179 --
NM_005359chr1875723 5499 2478 1840 1758 1691 47 12230 11746 --
NM_005397chr742986 2880 2525 52 12463 1901 --
NM_005402chr731817 1258 33 21715 434 ----
NM_005409chr42292 70 11089 ----
NM_005436chr1043090 2698 1416 1264 ----13301
NM_005458chr921981 1679 --2837 129 1495
NM_005497chr1786057 6036 5707 5527 5185 4642 1747 1452 64845 4597 2208 1905 1762 729 ----
NM_005504chr1266428 5529 1243 1085 1004 655 14390 11317 --
NM_005604chr622210 671 22224 1794 ----
NM_005607chr83940 780 364 --1129 --
NM_005610chr11120 ----2840 686
NM_005626chr12426 27 ------
NM_005647chrX33408 3364 2322 22736 711 13344 --
NM_005665chr174108 4087 4047 3012 1066 865 191 24836 646 ----
NM_005668chr533351 941 395 21042 808 --1146
NM_005700chr112248 120 1406 ----
NM_005717chr141143 528 469 74 ------
NM_005730chr1233234 690 534 12601 13529 12646
NM_005736chr1041465 614 605 181 1310 1364 1219
NM_005738chr721328 456 31603 1388 229 ----
NM_005746chr732024 1732 307 ------
NM_005759chr254716 4655 3622 691 237 14073 ----
NM_005779chr593469 3314 3216 2519 2440 2297 962 786 148 32530 2288 1230 12386 --
NM_005795chr232148 2098 528 22774 258 ----
NM_005808chr382970 2358 2236 1208 1199 1172 1146 115 21309 1013 1333 --
NM_005822chr662012 1739 1521 704 394 380 ----1486
NM_005828chr1774566 4203 3936 3788 3659 798 684 ------
NM_005840chrX87650 5712 5631 5474 4642 1498 843 798 15261 ----
NM_005853chr162106 72 ------
NM_005880chr1621599 597 ------
NM_005898chr1132311 1010 147 12271 ----
NM_005901chr1867480 6783 5349 3173 2370 1536 37155 2410 793 17611 --
NM_005909chr553515 2855 2692 1683 67 11572 ----
NM_005920chr183686 3202 3118 2455 1244 1056 909 57 1428 --12774
NM_005933chr1121938 1208 11921 32048 1996 1184 --
NM_005941chr853669 3505 2916 1531 1180 ----11553
NM_005955chr134252 2206 744 34177 2128 1994 14638 --
NM_005964chr1721436 268 --1458 11423
NM_005986chr1332549 1957 270 22135 541 2407 194 --
NM_006007chr943763 3116 2854 1010 1635 ----
NM_006011chr1584133 4107 3639 2718 2684 1126 385 222 33544 1585 707 13906 --
NM_006037chr263912 3433 3368 3062 1411 460 --11963 14668
NM_006047chr2043468 1246 848 272 ----1781
NM_006080chr711961 22311 198 ----
NM_006134chr2141543 1134 494 311 --1621 --
NM_006148chr1732745 2707 2378 ----11027
NM_006154chr1532085 769 95 32470 2211 252 ----
NM_006158chr841814 1532 1130 239 162 ----
NM_006162chr1821178 142 --1240 1422
NM_006180chr92812 702 1850 --189
NM_006201chrX------2776 334
NM_006203chr555448 5325 5106 1823 137 11353 ----
NM_006206chr42269 65 --32050 427 40 --
NM_006210chr193967 388 287 1958 ----
NM_006212chr141409 1176 1049 694 183 ----
NM_006237chr1321670 586 31502 575 440 ----
NM_006241chr311695 ----1953
NM_006267chr231369 704 385 21352 1300 ----
NM_006283chr885001 4826 4580 4544 1181 685 368 56 13958 ----
NM_006298chr633440 694 644 11262 ----
NM_006306chrX65354 5038 2167 1514 1262 278 11384 ----
NM_006315chr484348 4174 3799 3742 3526 3118 3018 1461 23393 165 24116 3032 11434
NM_006317chr52815 32 ------
NM_006328chr111642 ----1542
NM_006359chrX42408 1827 616 67 12137 ----
NM_006386chr221137 22450 1884 1810 --
NM_006424chr481907 1682 1660 1445 1316 539 336 87 11922 ----
NM_006449chr252003 1904 1765 1741 1586 11518 ----
NM_006467chr551903 1836 492 478 145 12406 ----
NM_006476chr112640 58 ------
NM_006482chr1232720 915 285 23001 2703 ----
NM_006500chr1151019 409 396 139 38 2523 206 ----
NM_006529chr421529 104 11554 ----
NM_006538chr243889 3433 2996 1321 21588 177 33424 1061 161 13955
NM_006544chr1435091 797 750 1189 15448 --
NM_006546chr1766649 4927 4437 4273 1636 302 26493 6204 35761 2340 861 1718
NM_006548chr32272 214 11687 3688 625 107 --
NM_006557chr921435 653 1698 ----
NM_006561chr10105971 5596 4250 4143 4122 1799 1565 1344 606 457 35661 5196 5157 25639 4958 --
NM_006595chr1161800 1761 1621 792 634 219 ------
NM_006599chr1678039 6786 6588 6364 6224 1373 943 37277 1399 183 1327 --
NM_006603chrX11652 12020 ----
NM_006624chr102796 411 ------
NM_006650chr553577 3445 3345 2731 2718 --23759 331 --
NM_006654chr1214084 13291 --13898
NM_006699chr132296 1737 21 1735 --153
NM_006706chr52671 103 ------
NM_006722chr342575 2338 2281 2267 ------
NM_006729chrX35528 5402 2011 64554 4514 4481 4232 4096 2265 ----
NM_006750chr1636802 5453 2495 37656 2098 548 25794 933 --
NM_006761chr172251 26 190 136 1309
NM_006772chr661592 571 441 260 151 83 168 1624 --
NM_006777chrX--32664 1802 884 1667 --
NM_006814chr2052396 2127 1731 616 55 42465 2368 254 233 --11820
NM_006826chr2------1913
NM_006827chr1441291 814 408 160 32770 2635 95 --1708
NM_006851chr1252368 1798 1114 950 641 1715 ----
NM_006875chrX1674 2685 363 ----
NM_006884chr3----1129 11264
NM_006888chr1433452 884 242 21375 796 22319 1268 --
NM_006889chr331363 1090 439 --11189 --
NM_006896chr75459 422 344 307 168 ------
NM_006914chr91212 143 --11016
NM_006915chrX21601 640 1771 ----
NM_006930chr541318 622 379 259 ------
NM_006999chr551959 1280 830 772 128 11844 162 --
NM_007006chr1633528 558 127 --12489 --
NM_007007chr1234473 1823 1574 13984 122 --
NM_007011chr15106286 5615 4815 4399 2166 2057 1671 1640 880 573 86547 5270 2124 1772 1032 729 344 114 15441 --
NM_007042chr342452 943 240 145 22514 2419 ----
NM_007047chr662483 2166 2003 1594 407 226 --1249 --
NM_007050chr2047190 5340 1181 548 37521 7223 6542 2777 300 --
NM_007107chr332412 1929 1832 22004 1897 ----
NM_007114chr332171 1258 808 ------
NM_007124chr61567 --31596 690 389 --
NM_007137chrX65187 4743 4169 3600 1936 805 35416 1387 956 11745 --
NM_007146chr1732494 2060 1989 11039 1197 --
NM_007159chr331460 512 384 ----1353
NM_007175chr822765 650 --21401 86 1677
NM_007198chr831623 135 115 --1636 --
NM_007203chr973910 2742 2694 2583 2535 597 369 --13075 --
NM_007212chr112250 22005 1585 12220 --
NM_007222chr821131 667 ----1326
NM_007249chr1378649 6665 6593 6180 5876 5846 2220 21580 105 18413 --
NM_007292chr1754894 4589 3785 3152 642 24454 3350 21791 1767 13279
NM_007308chr4------1286
NM_012072chr2043861 1674 830 356 21541 41 13354 --
NM_012095chr1093498 3237 3056 3012 2772 2383 2253 683 264 32461 2298 2243 11240 --
NM_012097chr222044 1498 --1139 --
NM_012098chr941227 536 243 64 --1567 11314
NM_012104chr1162792 2782 2683 892 659 40 ------
NM_012104chr1162792 2782 2683 892 659 40 ------
NM_012134chr171892 1462 1387 1363 1308 352 22 ------
NM_012137chr151790 901 600 509 35 1611 22803 1127 --
NM_012141chr1363463 3452 3330 1222 634 21 ------
NM_012153chr112974 87 11028 ----
NM_012157chr31250 181 --1342
NM_012164chr957282 6757 6090 6033 5405 37017 6144 2492 12558 26353 1205
NM_012193chr1175210 4062 3847 3419 1398 1060 259 14209 14828 --
NM_012199chr154412 2909 965 614 64 ----1181
NM_012214chr242201 1498 1318 93 11259 21670 1341 --
NM_012234chr323115 2541 ----21486 158
NM_012250chr111496 ----1109
NM_012252chr744799 4148 3636 220 ------
NM_012262chr122081 259 11051 14448 --
NM_012287chr363427 3250 1518 1370 650 365 11385 --13707
NM_012294chr723801 271 31131 523 171 ----
NM_012297chr442509 2471 637 239 --11647 --
NM_012304chr562247 2241 1009 889 687 378 12583 ----
NM_012309chr1154421 4181 3706 3194 418 --14247 --
NM_012316chr154985 4672 3946 2146 188 3101 94 41 11552 11338
NM_012329chr1711539 11662 ----
NM_012334chr544753 3181 899 45 34044 1627 280 ----
NM_012338chr71181 1784 1503 --
NM_012434chr641420 1414 1270 1133 --11482 --
NM_012471chrX31334 454 134 --1372 --
NM_012479chr721700 951 2812 174 12691 --
NM_012481chr17------1730
NM_013231chr1442881 1763 1665 338 --13124 --
NM_013255chr726049 2487 32178 1300 134 --15747
NM_013261chr432717 1431 588 12364 ----
NM_013269chr1254350 4272 3478 599 507 44319 1123 799 383 ----
NM_013302chr1634284 4134 1068 44149 3981 575 440 33760 3415 3147 --
NM_013313chr2263526 3004 2994 2957 2321 841 13533 23428 419 --
NM_013316chr73173 158 70 ----1885
NM_013354chr811274 ----1420
NM_013372chr1522319 1177 --1889 --
NM_013411chr142028 806 485 40 1619 12728 --
NM_013436chr21740 1667 ----
NM_013449chr1232989 2941 2776 22413 1148 --12976
NM_013951chr252352 1931 683 487 426 ------
NM_013952chr272429 2008 760 564 503 53 46 --172 --
NM_013953chr272429 2008 760 564 503 53 46 --172 --
NM_013960chr8--1205 143 1234
NM_013989chr1454274 3750 1987 1625 201 ------
NM_013992chr272429 2008 760 564 503 53 46 --172 --
NM_014000chr1021890 1690 11342 ----
NM_014011chr22510 216 12512 11898 --
NM_014021chr143196 2143 1013 618 11041 ----
NM_014028chr622314 537 22820 2074 12978 --
NM_014057chr921475 1145 ----1254
NM_014112chr82405 254 25519 299 ----
NM_014154chr331404 1369 634 ------
NM_014155chr1157138 5606 2042 1520 887 14973 ----
NM_014160chr3------11400
NM_014220chr32789 237 1844 ----
NM_014231chr1252091 1963 1577 402 124 11752 ----
NM_014240chr353733 3394 3192 1406 171 --11431 --
NM_014253chrX31877 1598 274 1506 ----
NM_014289chrX31238 508 38 2556 515 --1534
NM_014293chr22113844 3810 3551 3542 2757 2710 1653 1479 795 746 432 23530 1377 13648 --
NM_014294chr81520 ----1235
NM_014296chr331580 1011 191 21461 502 1592 --
NM_014309chr2225232 3810 23363 1420 35055 4950 1315 14349
NM_014368chr931967 1664 409 1135 ----
NM_014382chr331386 574 284 --1564 --
NM_014392chr42603 220 --1165 --
NM_014415chr321670 1314 11232 ----
NM_014421chr431643 1540 133 ------
NM_014431chr1041578 1572 1407 410 1207 11562 --
NM_014469chr11177 1785 1645 --
NM_014491chr72933 57 ------
NM_014521chr241684 1415 444 316 --21677 655 --
NM_014548chr153445 277 81 ------
NM_014554chr1242243 2204 784 30 1426 22196 1639 --
NM_014563chrX41761 1436 533 386 3862 733 401 ----
NM_014573chr1731748 735 467 --11434 11664
NM_014615chr1663404 2683 2476 1070 1053 190 --12732 --
NM_014636chr974214 3313 3162 1581 273 225 149 --23791 3406 --
NM_014653chr1261710 1373 760 652 294 42 21748 192 22114 505 --
NM_014666chr53254 235 85 1428 ----
NM_014667chr322077 588 --11801 --
NM_014678chr223713 649 63 1323 1788 --
NM_014690chr742860 2228 2144 2094 --12448 --
NM_014705chr71648 --11360 --
NM_014707chr712111 11753 ----
NM_014721chr696442 5710 5223 2890 1714 1641 1523 1409 1395 65976 5660 4540 2641 2423 2110 12555 --
NM_014723chr20102936 2762 2156 2122 2017 614 544 510 435 390 --22251 40 --
NM_014730chr1253264 2061 903 825 178 --33202 1971 1146 --
NM_014730chr1253264 2061 903 825 178 --33202 1971 1146 --
NM_014739chr634240 2859 415 ------
NM_014743chr442646 2186 915 373 --1907 --
NM_014746chr273397 3262 3093 2838 1197 1168 542 ------
NM_014747chr152013 1984 535 366 201 11183 15412 --
NM_014755chr243607 1555 225 130 --1183 11340
NM_014758chr1142341 1844 1597 744 ----154
NM_014765chr132528 2025 756 ------
NM_014772chr1852961 2908 2245 978 766 23646 3220 13572 --
NM_014774chr152196 2172 923 177 121 1915 1977 --
NM_014783chr1531822 1763 369 31387 516 384 ----
NM_014797chr652803 2630 1168 1069 489 23130 1183 12418 --
NM_014810chr153165 2937 619 533 458 --21208 817 1127
NM_014828chr1461670 739 682 560 515 172 12121 ----
NM_014829chr532185 2101 2030 ------
NM_014835chr2041532 1409 652 65 ----12291
NM_014836chr1041638 1364 412 56 1180 1460 --
NM_014850chr344735 4449 1626 1489 33182 630 534 --1885
NM_014873chr154134 4111 3002 1337 880 43624 1487 1352 321 14806 --
NM_014877chr1787045 6447 6039 2297 2092 1858 1221 1126 16054 26733 1477 25576 1885
NM_014893chrY3926 739 201 1292 ----
NM_014897chr1722822 211 22963 2746 1168 --
NM_014898chr1941566 827 320 172 22082 1948 ----
NM_014903chr123694 350 77 31727 551 160 --11854
NM_014904chr1053476 3195 2826 689 88 23176 2654 ----
NM_014906chr1763524 3207 1083 760 301 263 23665 50 ----
NM_014909chr1473637 3338 3216 2886 2874 1412 573 ------
NM_014920chr633720 1533 581 23248 1297 ----
NM_014923chr1312074 12063 ----
NM_014924chr1452735 2497 2148 1163 970 23021 1944 1324 --
NM_014932chr331320 434 52 ------
NM_014935chr11282 13037 22590 592 --
NM_014937chr1041126 313 174 98 ------
NM_014961chr42488 283 1442 ----
NM_014989chr61378 --22009 1889 --
NM_014991chr42785 27 33318 2005 498 ----
NM_015000chr123867 155 117 152 ----
NM_015002chr1242053 1758 1589 811 --11599 --
NM_015008chr353463 639 573 546 412 ------
NM_015020chr1653091 2407 1126 733 589 1393 ----
NM_015025chr232393 2290 1842 ------
NM_015033chr932725 2451 271 31320 1273 1107 22218 186 --
NM_015035chr2074133 2225 2191 1792 1477 773 46 1184 25326 952 --
NM_015039chr164215 4005 3026 924 896 642 ------
NM_015040chr243072 2398 1046 101 --11130 --
NM_015042chr1574044 3805 3105 2668 1724 1218 1094 2468 459 33758 3072 180 12644
NM_015044chr1662749 2471 2368 2259 663 632 13090 ----
NM_015045chr1021535 670 12097 1139 --
NM_015049chr253088 3005 2836 2260 652 ------
NM_015057chr132693 98 ------
NM_015063chr1961338 1250 1217 322 309 30 ------
NM_015068chr763881 3142 1500 1277 907 151 2802 338 2896 107 --
NM_015071chr585430 5358 5053 4290 3991 1423 1127 571 22508 683 --14733
NM_015075chrX102163 1810 1511 1468 746 563 440 411 327 30 4663 207 157 151 --21880 718
NM_015077chr1734461 3138 1626 24543 3760 13235 23747 2867
NM_015092chr164819 665 637 244 14036 11595 --
NM_015093chr6------11528
NM_015094chr2293118 3067 1613 1556 1329 775 543 350 32 13641 24516 257 --
NM_015100chr141556 820 743 700 1125 ----
NM_015113chr1742274 1821 1655 769 1506 22085 120 --
NM_015124chr2272118 2082 1887 1688 970 501 352 1413 22151 239 11604
NM_015130chr41484 --1966 --
NM_015132chr7--1177 11405 --
NM_015143chr421243 127 ------
NM_015149chr131704 597 79 1545 1697 11923
NM_015156chr1473626 1331 761 480 279 73 35 --13171 --
NM_015192chr20274 36 22694 463 188 --
NM_015206chr1542730 1145 786 457 1978 --2649 38
NM_015208chr1813862 2741 335 23885 2840 --
NM_015210chr182917 26 1272 ----
NM_015225chr932405 1045 107 1511 --1682
NM_015231chr111278 --158 1363
NM_015233chr1332504 2315 675 32384 1867 582 12556 --
NM_015267chr1231913 1822 41 21870 103 --11404
NM_015270chr1232310 2075 1774 ------
NM_015272chr1651701 1595 1566 1451 205 ------
NM_015288chr5103319 3245 3066 3013 2827 2570 1390 1298 632 249 --12820 --
NM_015310chr867554 7059 5266 2914 2753 2069 27966 2267 --16547
NM_015313chr1174819 4634 3762 3399 3265 1691 122 ------
NM_015315chr542611 2597 1328 795 22808 538 ----
NM_015328chr722742 2111 ----23045 490
NM_015335chr1241828 795 714 265 --1107 --
NM_015336chr1252285 2211 2088 1898 1719 ------
NM_015347chr1242053 1919 1139 654 21913 974 ----
NM_015349chr642302 1195 534 332 ------
NM_015365chrX63854 3845 3191 1135 797 744 ------
NM_015375chr165043 4356 4350 1968 751 609 23721 652 14652 --
NM_015387chr231421 655 293 ------
NM_015423chr111686 ----11452
NM_015435chr8271 30 1406 ----
NM_015453chr372004 1658 830 689 644 408 33 11543 1240 --
NM_015458chr894779 4144 3778 3327 1890 1583 1443 1332 423 21484 814 13987 --
NM_015508chr31235 1438 1183 --
NM_015526chr192348 290 ----11413
NM_015550chr733520 2522 105 --22563 856 --
NM_015553chr644170 3706 1643 155 24304 1502 ----
NM_015564chr563065 2926 2442 2242 1247 385 12876 ----
NM_015568chr2053937 3622 2770 1651 487 43405 3368 2923 572 23337 721 --
NM_015569chr144463 4055 3980 454 ----11278
NM_015575chr253412 2546 2338 1294 837 12561 ----
NM_015576chr342789 1926 923 218 42851 903 720 131 ----
NM_015640chr145179 3918 3685 3378 44146 4114 1305 1012 ----
NM_015686chrX62227 2211 945 910 738 609 ----1528
NM_015714chr1------1357
NM_015879chr18178402 7859 7698 7445 6574 6490 5529 5508 3206 2706 2583 2526 2355 1979 865 787 529 56659 6151 1951 1161 488 12489 --
NM_015898chr1972392 1965 1835 658 261 71 64 --1801 11757
NM_015904chr21755 1628 ----
NM_015906chr143762 3552 1642 1359 2937 639 --1910
NM_015981chr572688 2667 2077 788 194 121 113 12699 ----
NM_015995chr15125387 5366 5291 3929 3770 1917 1699 1487 1339 1303 1046 185 --24897 4546 --
NM_016021chr662138 2094 1854 633 585 377 1653 12755 --
NM_016022chr13916 238 123 1863 --1954
NM_016025chr1621752 814 ----1105
NM_016073chr15--2344 248 1390 --
NM_016079chr232039 1724 1551 11482 --193
NM_016083chr643729 2821 1170 136 23136 2835 13224 --
NM_016131chr25807 751 128 68 35 1733 ----
NM_016201chr352268 2212 2105 1760 1690 22296 877 21897 134 --
NM_016205chr4------1267
NM_016206chr3118207 7522 5589 3214 3075 2884 2815 2730 1122 954 318 ------
NM_016221chr551805 1703 360 314 41 12128 ----
NM_016248chr1333565 301 198 ------
NM_016252chr22286 216 ------
NM_016255chr653178 2661 2650 840 129 13338 ----
NM_016257chr153474 3159 2256 1248 944 12589 2171 46 12749
NM_016260chr256657 6168 5424 2179 226 16419 1643 --
NM_016271chr1822276 1744 ------
NM_016272chr2261806 644 607 586 540 40 --11849 1731
NM_016275chr342313 1797 889 253 ------
NM_016301chr12123 --1399 --
NM_016356chr642866 2418 299 115 11873 ----
NM_016418chr22113619 3275 3212 3113 1472 1280 1271 1063 398 112 77 22365 1487 21311 799 --
NM_016424chr1721544 464 ----1623
NM_016485chr631708 904 81 11851 ----
NM_016507chr1743056 2949 2941 563 ------
NM_016513chr633720 1533 581 23248 1297 ----
NM_016530chr1531410 570 114 21369 703 ----
NM_016598chr341052 191 53 23 1922 11286 --
NM_016605chr552299 2079 629 161 27 21769 267 ----
NM_016613chr432004 527 464 1567 ----
NM_016621chr1183754 3587 3113 1451 794 692 595 209 11718 13074 --
NM_016641chr1621321 1250 3635 532 171 --11618
NM_016823chr1731294 924 302 ------
NM_016829chr32654 316 1646 2204 99 164
NM_016929chr673788 3486 3413 3324 3220 175 46 --14328 --
NM_016952chr1162967 2927 1558 1444 1037 573 3713 588 385 ----
NM_016953chr295715 5347 4530 4460 2312 2135 1833 1789 34 55152 4610 4475 1699 899 1849 14011
NM_017415chr564383 4164 3492 557 473 327 11152 ----
NM_017420chr142375 153 13475 ----
NM_017443chr941352 1224 379 38 11239 ----
NM_017444chr841530 1392 1335 1261 21504 1194 ----
NM_017481chr112222 205 1215 ----
NM_017489chr82951 48 1514 --1129
NM_017522chr11247 11302 ----
NM_017548chr31375 152 2335 110 --
NM_017580chr1062437 2012 1729 916 203 141 ------
NM_017582chr12227 39 11737 ----
NM_017594chr943314 2273 472 174 1161 ----
NM_017602chrX5841 249 190 61 26 1785 ----
NM_017610chr1531657 1484 543 1605 12061 --
NM_017623chr262022 1869 1843 1797 358 107 32512 2437 1884 ----
NM_017626chr1041457 1368 392 21 1383 11677 11205
NM_017633chr623308 664 ----11574
NM_017637chr969177 8021 6164 5856 2724 722 --16825 11068
NM_017650chr775623 4106 2433 2091 1442 657 205 24121 914 1535 --
NM_017676chr541556 686 622 372 11774 ----
NM_017686chr13966 851 740 1325 1957 --
NM_017737chr161770 1651 1586 1441 823 426 ------
NM_017744chr13978 643 493 2719 37 11715 --
NM_017754chr685044 3911 3527 1872 1433 1302 1173 59 2411 45 11895 --
NM_017762chr1532048 541 293 --1520 --
NM_017769chr1433128 1133 981 ------
NM_017772chr66387 156 127 98 65 56 --1187 --
NM_017779chr132461 1954 845 ------
NM_017787chr1022898 2085 ------
NM_017812chr7--129 --2114 99
NM_017813chr895737 5684 5453 5291 4971 4900 4168 3716 1307 25362 2091 ----
NM_017824chr1032535 2082 620 --1916 --
NM_017831chr1874792 4156 3983 3733 3039 1797 593 42906 1812 1012 341 131 --
NM_017848chrX63612 3396 3090 2977 1637 1176 1536 --11438
NM_017849chr263115 2562 1143 1112 1090 709 --2496 112 --
NM_017910chr22350 283 ------
NM_017919chr995534 5216 4977 4688 4595 2242 1951 1342 481 24454 953 ----
NM_017944chr1152891 2803 2594 1243 165 161 ----
NM_017994chr712522 21832 454 --12059
NM_018018chr1221515 1489 2427 139 ----
NM_018036chr1433838 2705 1486 --21608 1509 --
NM_018043chr11--11004 1130 --
NM_018045chr172425 2155 1210 1195 1188 978 639 12085 1931 --
NM_018061chr131743 1667 24 11131 ----
NM_018110chr164433 339 178 172 21151 426 21264 890 11019
NM_018133chr331878 629 105 ------
NM_018155chr332690 804 57 12648 ----
NM_018157chr1243127 3001 2490 1224 22856 722 ----
NM_018159chrX3588 390 162 ------
NM_018182chr1752152 1763 855 636 42 ------
NM_018184chr322120 1628 1676 1292 --
NM_018191chr1331540 830 354 --11844 1104
NM_018207chr151626 1568 531 98 43 21682 650 31696 310 37 --
NM_018225chr985307 4224 3895 2148 1571 660 523 161 35283 3382 675 14247 --
NM_018227chr453177 2406 1268 480 217 13129 133 --
NM_018243chr483980 3162 2970 2812 2631 2488 1050 361 1821 33087 3027 2656 --
NM_018257chr203998 749 497 ------
NM_018293chr322162 701 12593 ----
NM_018325chr941491 1434 1161 294 ------
NM_018328chr2--1122 --1481
NM_018340chr1654603 4044 3822 3795 3567 23237 3217 21590 1060 --
NM_018362chr1153318 3304 3250 2477 1453 13454 ----
NM_018364chr11832 11566 13707 --
NM_018369chr52766 112 --135 --
NM_018374chr733378 1893 1752 24636 2104 --13558
NM_018375chr1431723 1364 1258 11797 ----
NM_018383chr242040 1989 1420 1351 21366 514 ----
NM_018388chrX31284 1173 259 1222 ----
NM_018403chr332988 2982 2532 1192 ----
NM_018429chr532807 752 503 12782 1797 --
NM_018440chr8107976 7384 6196 5760 5669 2077 1204 901 346 260 23391 2732 ----
NM_018448chr123349 37 24 1219 ----
NM_018452chr6_random73099 2962 2502 2354 1499 1211 462 23021 2952 2851 643 --
NM_018464chr101386 ----170
NM_018471chr2157 ----1612
NM_018555chr1961702 1447 1402 838 773 237 11633 --12008
NM_018557chr241510 626 523 179 ------
NM_018566chr154229 644 257 112 33 33593 1997 132 ----
NM_018602chr1561542 1472 1360 1159 1094 213 --11261 --
NM_018638chr1223986 3953 ------
NM_018689chr1572283 2269 2094 1002 301 171 24 12648 ----
NM_018712chr1131504 547 404 --2570 168 --
NM_018718chr742020 403 199 105 --1172 1742
NM_018841chr153977 3080 2730 1205 94 22542 530 ----
NM_018945chr653645 3013 2856 2834 1141 22544 1357 --13136
NM_018947chr763827 3379 3043 1897 836 65 11912 34959 4364 4190 --
NM_018963chr213515 421 259 ------
NM_018970chr773175 3031 2360 1093 633 539 229 12239 ----
NM_018972chr8------11917
NM_018999chr1054515 4363 740 617 381 --13838 --
NM_019000chr521178 239 11192 ----
NM_019008chr2253257 2628 855 577 121 --43530 3114 1504 292 --
NM_019027chr43705 41 29 12294 ----
NM_019041chr632581 2322 1629 12221 1437 --
NM_019044chr264149 3005 1549 473 368 57 24466 4371 23260 3206 --
NM_019072chr543580 3490 742 228 11476 --14028
NM_019084chr1031976 1751 789 ----12420
NM_019087chr51548 1233 11315 --
NM_019106chr2293061 2748 2536 2390 2190 1219 712 657 71 32765 2309 62 ----
NM_019593chr2062718 2679 2060 923 729 409 ------
NM_019610chr172162 1775 1758 1506 634 88 78 --1292 --
NM_019895chr3--2169 148 ----
NM_020122chr275541 4760 3724 2406 2109 1112 535 36011 5864 5169 25879 1842 --
NM_020133chr686153 5075 4996 4807 4170 2591 1386 493 26513 4787 ----
NM_020148chr1832967 2210 869 12447 11995 --
NM_020245chr641336 1289 1119 1079 1396 --14763
NM_020310chr1762565 2215 2171 1832 1792 240 --22241 175 12464
NM_020336chr2031389 1319 75 1124 22444 1041 --
NM_020338chr1073402 3298 2822 2665 2363 1425 1039 33473 1341 534 2271 95 --
NM_020341chr2051954 1293 800 766 624 ------
NM_020374chr1221748 1419 ------
NM_020390chr331519 1054 528 34253 1206 1069 ----
NM_020425chr621926 714 12026 ----
NM_020429chr752869 2565 2338 1981 227 22663 2031 1108 140
NM_020440chr173329 2881 865 775 734 555 458 1983 ----
NM_020456chr1342346 1766 852 148 21914 1781 ----
NM_020463chr221445 515 --11259 --
NM_020647chr83787 688 429 ------
NM_020673chr2086502 6082 5622 5321 2997 1944 414 225 45187 2946 657 79 15630 --
NM_020686chr1643069 988 614 416 11981 ----
NM_020699chr143795 3783 743 179 14338 --14477
NM_020711chr222570 1809 32135 1827 509 ----
NM_020717chrX114922 4916 4742 4587 3728 3294 3063 1232 700 345 139 --24765 3630 --
NM_020718chr1696167 5286 4725 4255 4188 2571 2035 1940 708 15089 11737 --
NM_020734chr1233302 2991 2173 --12270 --
NM_020742chrX2799 277 1310 1991 --
NM_020762chr123962 685 266 ------
NM_020766chrX33858 3130 796 14451 ----
NM_020772chr1777832 7271 6521 5229 3421 2261 231 ------
NM_020781chr731249 1147 972 ----11218
NM_020791chr1721398 1359 11259 ----
NM_020809chr1142327 866 404 160 32180 1461 1403 ----
NM_020810chr1452427 1110 725 454 325 1377 13147 --
NM_020819chr63785 348 331 ------
NM_020834chr1461539 1457 1249 426 348 175 --11362 --
NM_020841chr1233947 1391 739 13833 ----
NM_020845chr1252277 2214 707 500 346 --1365 1217
NM_020850chr1661084 970 849 805 676 174 1329 22915 2387 --
NM_020858chr1511619 1551 --1767
NM_020859chr4113974 3697 2980 2900 2835 2657 1018 525 503 81 31 13942 21517 1287 --
NM_020870chr421955 678 ------
NM_020899chr1762410 1734 812 481 376 37 159 11603 --
NM_020927chr1661989 925 891 835 246 149 --2883 427 --
NM_020935chr264472 4290 3205 2845 1867 1399 54449 1693 1552 1431 355 11044 --
NM_020962chr1531844 515 44 --1848 --
NM_020983chr1232310 2075 1774 ------
NM_021033chr1323397 2968 1871 1366 --
NM_021079chr1763141 2624 2551 2393 933 67 21048 141 ----
NM_021097chr232473 2389 415 1161 ----
NM_021155chr1992939 2597 2374 2313 1839 936 856 357 335 1720 ----
NM_021190chr12545 51 ------
NM_021191chr125892 535 442 166 151 ------
NM_021202chr2062999 2965 2879 1912 1011 952 12505 ----
NM_021205chr122754 1102 11824 --12637
NM_021255chr1431377 1014 915 1847 ----
NM_021574chr2252478 2467 2123 1913 344 11794 3755 229 103 --
NM_021629chr333248 3133 1774 1146 14250 --
NM_021647chr471727 1677 1635 1528 999 853 313 ------
NM_021648chr652758 949 469 329 43 21913 857 11905 2786 530
NM_021809chr2041578 611 159 92 31799 1621 1543 ----
NM_021912chr1521550 940 13617 ----
NM_021947chr171903 11324 1879 --
NM_021949chrX72826 1928 1154 828 213 88 63 12089 ----
NM_021961chr1142586 2414 1982 956 --15086 --
NM_021964chr356527 6347 4078 4053 512 34463 2207 1248 ----
NM_021988chr2061598 1446 1024 483 341 231 1558 --11350
NM_022048chr1554919 4433 4192 3960 1909 35067 4346 1256 --13873
NM_022085chr631268 1244 75 --11365 --
NM_022093chr12989 302 137 ----
NM_022114chr1114313 4183 3932 3841 3405 1045 727 402 334 199 101 --1998 21143 853
NM_022133chr821458 763 21822 347 --1458
NM_022166chr1695596 4854 4263 2307 1167 926 879 789 24 14979 15156 12422
NM_022351chr822907 508 23392 2858 ----
NM_022442chr2061598 1446 1024 483 341 231 1558 --11350
NM_022465chr1252814 2158 788 47 31 12610 1114 12403
NM_022473chr1574161 2974 1611 1145 776 677 70 --21663 1337 --
NM_022477chr2061230 584 480 191 113 24 21567 1245 151 --
NM_022484chr71462 31378 409 43 ----
NM_022497chr393003 2631 2585 2526 2513 1294 1221 722 311 --12490 13073
NM_022648chr244530 4400 3677 480 13050 34442 446 74 11508
NM_022650chr51917 --1261 1792
NM_022658chr1231009 869 133 ------
NM_022716chr121062 141 42949 2133 731 215 ----
NM_022719chr2253190 2878 1373 648 116 --31430 1260 938 --
NM_022758chr641187 1170 606 90 --32633 2617 2236 --
NM_022763chr322194 413 12449 ----
NM_022781chr912692 ----11059
NM_022784chr152901 442 ----132
NM_022828chr5150 21135 137 ----
NM_022831chr121250 42 2283 57 ----
NM_022841chr1532293 2234 1083 1349 ----
NM_022843chr13158 ----11073
NM_022893chr243121 2662 479 54 ------
NM_022894chr221416 1281 --1219 --
NM_022977chrX22032 1736 ------
NM_023929chr832055 2033 406 1754 ----
NM_024055chr5--1248 --1669
NM_024080chr271551 1370 780 645 306 138 85 ------
NM_024294chr641187 1170 606 90 --32633 2617 2236 --
NM_024312chr1231252 538 23 21267 606 ----
NM_024416chr921475 1145 ----1254
NM_024513chr362797 2677 2598 973 844 176 --13320 1292
NM_024541chr1051809 1789 1408 691 135 11478 11637 --
NM_024607chr894026 3426 3137 2895 2737 1190 1184 1009 388 --11032 --
NM_024611chr1532806 1069 918 2933 601 12465 --
NM_024639chr61251 --22744 2632 --
NM_024645chr841209 558 477 398 174 ----
NM_024674chr172920 2670 2490 2069 909 867 242 22370 133 ----
NM_024713chr1541373 1234 1149 1087 3382 372 150 ----
NM_024740chr1163648 3212 2918 906 616 32 13077 ----
NM_024762chr192831 608 2794 620 ----
NM_024770chr2106504 4755 4696 4249 2322 2154 1707 1551 883 54 42706 2563 1566 1169 ----
NM_024784chr115758 436 278 76 36 3962 827 293 ----
NM_024812chr822160 1947 ------
NM_024834chr1041750 1722 540 501 1719 ----
NM_024884chr143509 281 121 11073 ----
NM_024885chrX3351 215 42 1366 ----
NM_024939chr161530 21530 644 ----
NM_024949chr433564 1864 538 1623 ----
NM_024953chr1282401 1880 1058 597 586 443 84 52 1285 2742 219 --
NM_024989chr257558 6343 2599 2313 248 65513 3253 2550 2462 2328 529 ----
NM_024993chr231305 1220 1098 1154 ----
NM_025054chr863856 3648 3011 2924 403 66 13445 ----
NM_025180chr352662 2269 1152 837 224 13057 ----
NM_025191chr131311 818 247 13073 --12587
NM_025221chr4273 52 21346 1079 1985 --
NM_025222chr372905 2891 2748 2556 2244 1965 971 22158 496 12313 --
NM_025248chr1742727 2586 329 261 --11181 --
NM_025250chr792717 2439 1956 851 715 687 466 442 254 2994 198 178 --
NM_030576chr1771999 1835 1620 527 466 370 222 1589 42105 2027 833 578 --
NM_030621chr1454199 3820 3659 3397 2615 24108 3504 ----
NM_030625chr1022527 2192 1896 11757 12156
NM_030634chr162229 2046 1748 975 765 114 1128 --1815
NM_030640chr12--1810 --1632
NM_030670chr1232045 1525 580 1339 ----
NM_030671chr1232045 1525 580 1339 ----
NM_030674chr1254583 4017 3848 2311 74 15359 --14611
NM_030761chr152558 2366 704 76 31 32386 1669 342 1274 --
NM_030766chr1241077 986 259 102 1672 --1142
NM_030780chr831724 629 475 21411 644 11125 --
NM_030806chr189264 8954 8611 8505 3329 1010 975 703 26378 2103 --19319
NM_030810chr631268 1244 75 --11365 --
NM_030816chr153679 3487 3214 3161 380 ------
NM_030881chr221137 22450 1884 1810 --
NM_030918chr125400 1959 11974 2813 186 --
NM_030934chr131402 1184 670 --1254 --
NM_030939chr631042 902 70 ------
NM_030962chr1141605 1421 1070 310 ------
NM_031243chr711978 ----22309 1829
NM_031268chr1675180 4790 4775 3545 3467 1065 1043 12133 24102 86 14520
NM_031314chr1421703 1638 ------
NM_031427chr1485703 4932 4717 4191 3941 1240 655 124 --11486 24730 916
NM_031442chrX31288 439 416 22385 32 ----
NM_031468chr747085 2172 1988 1844 47952 6484 1537 278 15936 --
NM_031844chr143839 3405 3081 896 --13430 --
NM_032013chr2061230 584 480 191 113 24 21567 1245 151 --
NM_032105chr1117743 7557 7041 6655 5482 2414 2240 2070 1278 979 259 16924 25013 2263 15742
NM_032154chr1021014 93 ------
NM_032160chr1853571 3352 1114 422 199 33894 3761 3400 ----
NM_032174chr151293 600 558 225 137 --1360 --
NM_032182chr1021455 1073 11111 11485 --
NM_032189chr1394331 4285 4107 3967 3952 2006 619 573 477 21342 458 24162 1682 1352
NM_032199chr1052673 2461 1489 1354 555 13738 ----
NM_032208chr241419 1311 463 238 1951 ----
NM_032246chr1521109 1068 ------
NM_032287chr22103785 3004 1669 1662 1426 1357 1048 1037 322 35 23999 1681 1275 --
NM_032289chr571595 1281 1242 609 468 284 78 ----1460
NM_032291chr11632 1163 ----
NM_032321chr243192 2872 2097 1041 32088 562 292 ----
NM_032329chr273227 2910 1609 450 431 347 85 22998 156 53750 3692 3645 1530 505 --
NM_032373chr1044130 3950 733 206 ------
NM_032423chr1931456 1018 213 51534 1401 1033 147 32 ----
NM_032434chr231343 1314 598 --11400 --
NM_032440chr102724 687 ------
NM_032446chr532361 789 763 13862 11526 --
NM_032449chr152718 2510 1905 648 441 11773 22537 2148 --
NM_032457chr423340 195 2493 475 --1805
NM_032458chrX----12370 11268
NM_032491chr1241232 1226 527 325 ------
NM_032499chr1541195 529 473 378 21568 135 ----
NM_032510chr1841840 727 547 101 ------
NM_032521chr2072581 2289 1189 1147 1008 622 550 42332 1023 762 637 ----
NM_032538chr662697 2435 1891 1034 110 63 21994 932 ----
NM_032547chr42394 329 --1912 --
NM_032590chr1251111 397 227 154 103 ------
NM_032646chr1781801 1537 1468 1285 1259 639 576 256 1349 ----
NM_032711chr1773335 1579 1525 852 844 402 38 11368 --1531
NM_032727chr1051164 1144 653 409 166 21185 93 ----
NM_032778chr342767 2406 1130 865 ----12874
NM_032801chr1142184 1024 493 360 ----1145
NM_032828chr1974604 4281 3686 3660 3411 3101 1770 53133 1346 1082 873 284 13709 --
NM_032829chr1251131 947 747 300 205 ------
NM_032833chr1136 22177 1745 ----
NM_032842chr721135 241 1531 ----
NM_032859chr1323639 3003 1853 ----
NM_032865chr1731418 685 479 1176 ----
NM_032933chr182540 148 1618 11464 --
NM_032968chrX13664 31448 1285 1124 ----
NM_032969chrX13664 31448 1285 1124 ----
NM_032973chrY13656 31448 1285 1124 ----
NM_032975chr1863411 2550 2337 2212 566 100 22244 155 11162 --
NM_032980chr1863411 2550 2337 2212 566 100 22244 155 11162 --
NM_033014chr921475 1145 ----1254
NM_033018chrX------2776 334
NM_033020chr143762 3552 1642 1359 2937 639 --1910
NM_033030chr221535 1309 1653 ----
NM_033083chr353425 2273 1096 580 462 --12638 --
NM_033118chr205754 582 545 252 168 --1712 1623
NM_033121chr1221245 696 1290 ----
NM_033129chr2062072 1552 1531 721 507 397 --1526 --
NM_033181chr643729 2821 1170 136 23136 2835 13224 --
NM_033224chr745792 2711 1400 371 47954 6744 2659 39 ----
NM_033225chr843050 2647 969 80 13181 ----
NM_033290chrX53547 3364 997 687 51 11052 23129 2309 --
NM_033300chr11247 11302 ----
NM_033309chr162911 328 --1227 193
NM_033315chr1731694 585 549 21938 1599 1771 --
NM_033326chr1112482 1829 1871 11976
NM_033360chr1211841 --14539 --
NM_033389chr1764647 4318 3336 1951 1571 305 24105 1373 ----
NM_033421chr2041870 644 566 23 11184 11697 --
NM_033425chr1141157 914 205 141 11207 12603 --
NM_033427chr7------1129
NM_033429chr1542292 898 458 218 ----12864
NM_033449chr551802 1613 283 217 62 169 11475 --
NM_033505chr244541 1921 1390 1344 165 ----
NM_033512chr842872 2557 2445 52 1664 ----
NM_033551chr542611 2597 1328 795 22808 538 ----
NM_033624chr1242053 1758 1589 811 --11599 --
NM_033631chr163326 3176 1523 968 270 183 11349 1580 --
NM_052818chr1311780 ----21888 1470
NM_052845chr1273226 2965 2420 2120 1228 546 157 32143 697 557 11121 --
NM_052851chr1312184 --1789 11805
NM_052869chr1781801 1537 1468 1285 1259 639 576 256 1349 ----
NM_052885chr1243430 3173 1484 319 ------
NM_052896chr162213 2135 1832 1826 370 320 32234 28 22 12021 --
NM_052898chr821922 1846 1127 11674 --
NM_052900chr841516 466 406 161 ------
NM_052918chr1063689 3157 2849 986 752 722 ----184
NM_052928chr1721414 428 11713 2451 130 --
NM_052934chr11546 1626 --1688
NM_052948chr191359 ----199
NM_053016chr9117198 7138 6830 6784 6688 5788 5221 4852 2752 942 49 47966 7307 6561 73 26530 6472 17533
NM_053023chr1122284 132 12991 1614 --
NM_053043chr7105919 5751 5743 5248 2375 2173 1924 1661 904 325 1233 15462 14320
NM_057159chr91288 1483 ----
NM_057175chr442286 2132 484 38 ----1897
NM_057178chr1721909 802 21852 1845 ----
NM_058172chr42520 362 21540 1267 11177 --
NM_078487chr953331 3119 3055 1085 997 --1262 --
NM_080607chr205891 400 272 249 149 --2291 69 21067 127
NM_080617chr201828 --1874 --
NM_080669chr1774459 3689 3059 1360 1145 857 159 14168 13497 14701
NM_080672chr203564 152 128 --194 --
NM_080743chr62637 227 22238 2182 ----
NM_080867chr1441911 1878 1847 768 13712 13801 --
NM_080872chr823875 616 23036 1243 23997 784 --
NM_130385chr1111036 12074 --149
NM_130438chr2151290 1139 581 245 235 2111 90 ----
NM_130443chr112248 120 1406 ----
NM_130830chr333644 2663 2643 13034 ----
NM_130846chr1211012 ----126
NM_133170chr2047190 5340 1181 548 37521 7223 6542 2777 300 --
NM_133171chr2031077 953 245 1224 2445 155 --
NM_133264chr1763512 1524 1154 808 688 599 13872 ----
NM_133265chrX52650 1194 1169 1088 1020 13337 --1793
NM_133330chr462560 2431 1146 1081 967 155 2890 255 12843 12113
NM_133331chr462560 2431 1146 1081 967 155 2890 255 12843 12113
NM_133335chr462560 2431 1146 1081 967 155 2890 255 12843 12113
NM_133473chr193450 278 99 21717 1582 1122 --
NM_133478chr252426 1894 1030 967 40 --2618 193 --
NM_133496chr144389 3473 3186 3172 53052 959 826 646 347 ----
NM_133625chr331345 987 164 ------
NM_133647chr1533434 3029 1285 32657 1171 79 21442 1021 --
NM_134325chr1181 1161 --1223
NM_138288chr1411509 21822 1376 12234 169
NM_138338chr2293476 3197 2641 2475 2243 1237 722 574 161 22383 370 22801 1132 --
NM_138395chr24816 312 191 184 1751 ----
NM_138415chr2251546 1406 1400 580 401 --1267 --
NM_138444chr1384836 3398 3035 1372 1089 345 295 262 --14490 --
NM_138468chr266090 5171 5037 4508 1417 154 22426 2088 11440 --
NM_138473chr1234869 747 487 14936 ----
NM_138563chr191440 180 2574 505 --
NM_138621chr243889 3433 2996 1321 21588 177 33424 1061 161 13955
NM_138694chr623094 2637 --2733 354 13274
NM_138713chr1678039 6786 6588 6364 6224 1373 943 37277 1399 183 1327 --
NM_138714chr1678039 6786 6588 6364 6224 1373 943 37277 1399 183 1327 --
NM_138717chr61674 --2485 95 --
NM_138727chr13978 643 493 2719 37 11715 --
NM_138728chr13978 643 493 2719 37 11715 --
NM_138731chr1463340 2792 2679 1373 168 34 14178 --1813
NM_138775chr111194 2688 155 ----
NM_138782chr51127 11610 ----
NM_138959chr166609 6364 4210 861 547 466 26600 2023 21096 145 --
NM_138969chr84489 178 115 105 ------
NM_138971chr1162792 2782 2683 892 659 40 ------
NM_138971chr1162792 2782 2683 892 659 40 ------
NM_138972chr1162792 2782 2683 892 659 40 ------
NM_138972chr1162792 2782 2683 892 659 40 ------
NM_138973chr1162792 2782 2683 892 659 40 ------
NM_138973chr1162792 2782 2683 892 659 40 ------
NM_139012chr642282 2073 1962 211 ------
NM_139014chr642362 2153 2042 291 150 ----
NM_139048chr321187 27 ------
NM_139057chr1562537 2422 2274 670 529 81 22505 2289 --11808
NM_144498chr2041532 1409 652 65 ----12291
NM_144571chr416055 16651 --14520
NM_144578chr1455556 5081 4757 4325 924 23640 1354 ----
NM_144582chr232510 1970 99 --21851 1625 --
NM_144583chr23662 460 243 ------
NM_144599chr1554749 4730 974 951 219 35119 4297 3783 24929 1076 --
NM_144775chr17134557 4492 4476 3726 3471 3295 1325 1016 1008 971 648 610 568 34677 843 304 24361 784 --
NM_144778chr1352618 2149 896 230 143 12478 ----
NM_144949chr22510 216 12512 11898 --
NM_144973chr1273671 3534 3344 1691 1477 1047 942 ------
NM_145055chr1811188 ----1401
NM_145115chr721694 809 128 1599 --
NM_145117chr1172301 674 511 488 217 189 67 ------
NM_145174chr222569 351 1501 ----
NM_145259chr256544 5616 4627 4347 2411 1630 ----
NM_145268chr71376 167 1971 --
NM_145307chr1034432 3463 3287 ------
NM_145320chr733520 2522 105 --22563 856 --
NM_145321chr733520 2522 105 --22563 856 --
NM_145322chr733520 2522 105 --22563 856 --
NM_145351chr1762378 1690 1018 949 612 77 12528 --11877
NM_145733chr223850 325 179 198 ----
NM_145735chr1352218 2040 1964 853 779 22507 2159 --12709
NM_145754chr84625 433 256 160 1186 1132 --
NM_145800chrX1193 2826 306 1358 --
NM_145802chrX1142 2775 255 1307 --
NM_145808chr712307 ----1153
NM_145899chr641217 964 126 78 2155 105 21236 1143 --
NM_145901chr641217 964 126 78 2155 105 21236 1143 --
NM_145902chr641217 964 126 78 2155 105 21236 1143 --
NM_145903chr641217 964 126 78 2155 105 21236 1143 --
NM_145904chr641217 964 126 78 2155 105 21236 1143 --
NM_145905chr641217 964 126 78 2155 105 21236 1143 --
NM_145912chr2284027 3990 3683 3050 2869 1186 961 303 34086 185 63 14286 --
NM_147150chr973910 2742 2694 2583 2535 597 369 --13075 --
NM_147156chr1021078 981 1266 ----
NM_147181chr4273 52 21346 1079 1985 --
NM_147182chr4273 52 21346 1079 1985 --
NM_147183chr4273 52 21346 1079 1985 --
NM_147202chr952616 2559 1994 593 352 22215 743 --12723
NM_147223chr231811 188 130 ------
NM_148898chr72933 57 ------
NM_148899chr72933 57 ------
NM_152253chr2254189 3751 3571 777 332 --21198 87 --
NM_152261chr1252254 2117 1569 554 71 ------
NM_152271chr8------21023 182
NM_152407chr553247 2245 1198 1139 1125 12262 ----
NM_152409chr522908 955 ----11384
NM_152424chrX94630 4527 4066 3171 1664 1547 1149 509 180 24195 3324 23045 931 --
NM_152470chr1843166 1588 1150 374 --13185 23449 2923
NM_152519chr242169 2104 2078 535 ------
NM_152529chr264408 3506 3117 2816 1449 856 --23140 407 --
NM_152608chr151982 1733 763 615 172 1630 ----
NM_152622chr522368 1130 12431 --23128 360
NM_152624chr537483 6349 509 24870 1192 17126 --
NM_152629chr953069 3054 2541 711 52 23898 3859 ----
NM_152667chr2031308 1063 987 11078 ----
NM_152733chr676292 6269 4627 4263 1954 961 676 --16067 14939
NM_152739chr74909 347 143 111 11003 ----
NM_152793chr775173 4597 4147 3746 3293 1406 153 --14204 13212
NM_152835chr121037 837 --11142 11830
NM_152836chr821458 763 21822 347 --1458
NM_152837chr821458 763 21822 347 --1458
NM_152838chr2043468 1246 848 272 ----1781
NM_152896chr92582 283 ------
NM_152924chr15106286 5615 4815 4399 2166 2057 1671 1640 880 573 86547 5270 2124 1772 1032 729 344 114 15441 --
NM_152999chr754573 3524 3312 1120 879 11134 ----
NM_153029chr1673981 3744 3373 3340 3071 2809 1420 1447 24098 2682 --
NM_153035chr143233 511 365 263 --13053 --
NM_153182chr342767 2406 1130 865 ----12874
NM_153184chr32187 86 132 ----
NM_153234chr542129 2013 676 102 1561 ----
NM_153343chr461985 1904 1646 1640 446 113 137 --1587
NM_153354chr5134 --1816 --
NM_153450chr112248 235 --1594 --
NM_153487chr644412 1355 1237 637 34637 4425 1809 34618 4203 3758 --
NM_153616chr1511619 1551 --1767
NM_153617chr1511619 1551 --1767
NM_153618chr1511619 1551 --1767
NM_153619chr1552857 866 527 460 265 11178 41219 624 591 300 --
NM_153686chr422420 399 11737 ----
NM_153712chr253783 2715 2325 1193 539 12340 12637 --
NM_153831chr83940 780 364 --1129 --
NM_153836chr221937 433 --180 --
NM_170606chr72518 454 1427 --11878
NM_170665chr1243180 3012 2938 1782 43495 3291 1376 1199 ----
NM_170686chr731249 1147 972 ----11218
NM_170706chr164215 4005 3026 924 896 642 ------
NM_170731chr1132210 1853 937 12152 --12038
NM_170732chr1132210 1853 937 12152 --12038
NM_170733chr1132210 1853 937 12152 --12038
NM_170734chr1132210 1853 937 12152 --12038
NM_170735chr1132210 1853 937 12152 --12038
NM_171825chr572688 2667 2077 788 194 121 113 12699 ----
NM_171998chrX62403 1931 1834 1805 753 272 ------
NM_172071chr176445 5996 5443 2330 1072 604 450 45937 5315 2345 149 ----
NM_172169chr1031855 1254 289 --11500 1560
NM_172170chr1031855 1254 289 --11500 1560
NM_172171chr1031855 1254 289 --11500 1560
NM_172173chr1031855 1254 289 --11500 1560
NM_172375chr1431041 903 211 --180 --
NM_172387chr1821131 95 --1193 1375
NM_172388chr1821178 142 --1240 1422
NM_172389chr1821178 142 --1240 1422
NM_173083chr12516 305 ----1455
NM_173214chr1678039 6786 6588 6364 6224 1373 943 37277 1399 183 1327 --
NM_173468chr464803 4760 4664 4586 1142 461 13753 ----
NM_173511chr233351 403 54 11552 ----
NM_173519chr831363 429 54 1519 ----
NM_173552chr331662 969 248 22141 61 ----
NM_173582chr1165925 5579 4861 4621 1684 1296 14971 25521 4667 --
NM_173595chr1284997 4499 3329 1914 1700 986 591 164 14810 14198 --
NM_173602chr1223391 3181 22344 1152 12691 --
NM_173642chr1178451 7119 6802 6461 5749 5739 3471 2787 2453 2358 2347 2034 1704 1686 1264 770 506 1496 ----
NM_173694chrX52154 2124 1037 451 140 ------
NM_173808chr121555 1035 --11330 --
NM_173809chr1031469 1068 480 ----11330
NM_173825chr342665 2485 2439 1150 181 ----
NM_173829chr575990 5524 5481 3821 3815 2413 139 ------
NM_173833chr82100 89 --21398 81 2642 266
NM_173851chr833857 3736 3480 22651 2622 23907 40 --
NM_174916chr1542292 786 537 397 1551 --1706
NM_175610chr1531032 968 64 11349 ----
NM_175624chr12107752 7616 6488 6006 5025 2923 2876 2752 891 113 67481 7136 5817 1691 1573 1514 --1776
NM_175625chr12107752 7616 6488 6006 5025 2923 2876 2752 891 113 67481 7136 5817 1691 1573 1514 --1776
NM_175709chr223618 230 150 31903 812 275 32411 363 258 12834
NM_175733chr1131615 185 49 11772 1470 --
NM_175736chr12147869 7807 7137 6646 5463 5361 5261 5017 3068 1394 1371 1298 817 626 36589 6539 5671 16365 --
NM_175767chr52757 261 1611 ----
NM_175852chr152973 2665 2509 2160 915 --1738 11053
NM_175861chr1265414 5368 5308 3976 2176 1647 24060 1812 --15137
NM_175862chr331363 1090 439 --11189 --
NM_175907chr1822859 1129 2633 507 ----
NM_175921chr532973 959 378 1154 12877 --
NM_176814chr72174 166 175 1961 --
NM_177424chr121961 78 ----1440
NM_177438chr1454199 3820 3659 3397 2615 24108 3504 ----
NM_177972chr1184097 4076 3765 3731 3040 1614 1588 463 --13810 --
NM_177985chr222044 1498 --1139 --
NM_177990chr2051954 1293 800 766 624 ------
NM_177999chr963545 2996 2477 1331 1220 720 32808 2420 985 12599 --
NM_178006chr1312184 --1789 11805
NM_178007chr1312184 --1789 11805
NM_178026chr20------1462
NM_178151chrX77414 7120 6093 3010 2202 228 185 35207 5064 2684 16704 --
NM_178152chrX77414 7120 6093 3010 2202 228 185 35207 5064 2684 16704 --
NM_178153chrX77414 7120 6093 3010 2202 228 185 35207 5064 2684 16704 --
NM_178426chr132270 2193 525 12345 ----
NM_178427chr132170 2093 425 12245 ----
NM_178470chrX31272 695 131 ------
NM_178496chr311523 1438 ----
NM_178509chr1733871 2966 471 13233 ----
NM_178539chr123436 344 100 ------
NM_178554chr392956 2868 2615 2379 2237 1369 1357 469 92 ------
NM_178565chr811469 21128 146 ----
NM_178578chr2052396 2127 1731 616 55 42465 2368 254 233 --11820
NM_178585chr42785 27 33318 2005 498 ----
NM_178835chr44745 187 91 70 1200 --1238
NM_180989chr132908 303 ------
NM_181332chrX2799 277 1310 1991 --
NM_181349chr752869 2565 2338 1981 227 22663 2031 1108 140
NM_181351chr1162943 2722 1839 1031 812 373 --22332 1013 --
NM_181356chr63704 255 171 1799 ----
NM_181359chr182316 2238 2095 1828 1645 1014 462 200 22278 752 ----
NM_181528chr202388 303 ------
NM_181828chr22113619 3275 3212 3113 1472 1280 1271 1063 398 112 77 22365 1487 21311 799 --
NM_181829chr22113619 3275 3212 3113 1472 1280 1271 1063 398 112 77 22365 1487 21311 799 --
NM_181830chr22113619 3275 3212 3113 1472 1280 1271 1063 398 112 77 22365 1487 21311 799 --
NM_182503chr685060 4429 4232 1968 1644 1014 511 378 --12101 --
NM_182527chr2281869 1846 1629 802 789 396 273 58 --21690 1387 --
NM_182757chr632714 2298 1403 23444 2729 ----
NM_182762chr776038 5442 5373 4368 2038 1040 564 1984 12061 15340
NM_182764chr2031077 953 245 1224 2445 155 --
NM_182765chr1011733 12086 --1949
NM_182797chr2011750 41804 1436 1285 302 ----
NM_182830chr142739 110 2789 90 ----
NM_182898chr746354 5148 1465 1401 1554 12454 --
NM_182899chr746354 5148 1465 1401 1554 12454 --
NM_182907chr662233 1746 1559 945 876 834 11530 11797 --
NM_182948chr11763 1526 1225 --
NM_182964chr1172301 674 511 488 217 189 67 ------
NM_182970chr2064288 4081 2782 2723 2649 1258 --31445 296 44 --
NM_182972chr152784 2651 2087 1027 695 1520 --12629
NM_182978chr182726 221 ----1128
NM_183228chr17------1730
NM_183229chr17------1730
NM_183230chr17------1730
NM_183231chr17------1730
NM_183232chr17------1730
NM_183244chr203564 152 128 --194 --
NM_183246chr203564 152 128 --194 --
NM_183419chr8271 30 1406 ----
NM_194278chr1483434 3361 3342 3263 2898 838 747 510 12756 23498 1058 --
NM_194282chr432837 2423 1078 11093 ----
NM_194283chr523688 1121 --11144 --
NM_194285chr1153200 2945 2762 1017 290 --12227 --
NM_194286chr1242047 1028 740 60 54922 1963 1675 1317 241 24818 901 --
NM_194328chr912692 ----11059
NM_194329chr912692 ----11059
NM_194330chr912692 ----11059
NM_194332chr912692 ----11059
NM_194434chr1842156 1523 786 102 14606 --13702
NM_197941chr552631 2525 323 126 68 32255 1943 874 --12593
NM_197970chr221535 1309 1653 ----
NM_198066chr1432718 2452 659 22277 2192 12092 --
NM_198123chr841516 466 406 161 ------
NM_198124chr841516 466 406 161 ------
NM_198128chr1822276 1744 ------
NM_198158chr342575 2338 2281 2267 ------
NM_198159chr342575 2338 2281 2267 ------
NM_198177chr342575 2338 2281 2267 ------
NM_198178chr342575 2338 2281 2267 ------
NM_198212chr731936 200 34 21922 1667 ----
NM_198225chr1041638 1364 412 56 1180 1460 --
NM_198270chrX12610 ----12193
NM_198281chr433113 3054 1124 ------
NM_198320chr1253819 3639 3412 1904 1341 131 45201 4950 3967 470 11194
NM_198324chr121839 1547 --129
NM_198392chr642167 2080 305 192 1317 ----
NM_198400chr1532085 769 95 32470 2211 252 ----
NM_198465chrX21177 928 1727 --1552
NM_198484chr395997 5384 4853 4327 2432 2155 1921 1581 391 16238 12105 12457
NM_198513chr82520 46 --1271 --
NM_198793chr344024 3339 1426 1097 11025 --13042
NM_198834chr1731766 171 74 ----12189
NM_198836chr1731766 171 74 ----12189
NM_198837chr1731766 171 74 ----12189
NM_198838chr1731766 171 74 ----12189
NM_198839chr1731766 171 74 ----12189
NM_198900chr12147869 7807 7137 6646 5463 5361 5261 5017 3068 1394 1371 1298 817 626 36589 6539 5671 16365 --
NM_198989chr131104 ----132
NM_199044chr133069 2380 2239 12154 12613 --
NM_199050chr2152834 865 405 128 52 22412 212 33397 3329 3288 --
NM_199078chr262022 1869 1843 1797 358 107 32512 2437 1884 ----
NM_199144chr2061598 1446 1024 483 341 231 1558 --11350
NM_199160chr941908 1605 834 350 176 ----
NM_199203chr2061598 1446 1024 483 341 231 1558 --11350
NM_199245chr1292497 2369 1983 1667 808 530 418 268 102 12158 ----
NM_199421chr1441911 1878 1847 768 13712 13801 --
NM_199454chr1114313 4183 3932 3841 3405 1045 727 402 334 199 101 --1998 21143 853
NM_199462chr165043 4356 4350 1968 751 609 23721 652 14652 --
NM_199482chr231421 655 293 ------
NM_201263chr121795 356 --177 11803
NM_201348chr173857 3118 3038 2813 1444 1058 33 13141 12858 14327
NM_201413chr212898 54 ------
NM_201414chr212898 54 ------
NM_201432chr17116491 6034 5298 5236 2619 2562 1795 1182 1146 637 103 24027 563 34877 4463 1494 14132
NM_201433chr17116491 6034 5298 5236 2619 2562 1795 1182 1146 637 103 24027 563 34877 4463 1494 14132
NM_201567chr311266 11412 21093 556 --
NM_201570chr1031461 635 292 --21919 439 --
NM_201571chr1031461 635 292 --21919 439 --
NM_201572chr1031461 635 292 --21919 439 --
NM_201590chr1031461 635 292 --21919 439 --
NM_201591chr451402 443 317 132 66 ------
NM_201592chr451402 443 317 132 66 ------
NM_201593chr1031461 635 292 --21919 439 --
NM_201596chr1031461 635 292 --21919 439 --
NM_201597chr1031461 635 292 --21919 439 --
NM_201632chr541778 1224 485 45 --11455 --
NM_201634chr541877 1323 584 144 --11554 --
NM_203327chr2063504 2894 1171 809 352 326 22788 1049 44002 3954 2883 693 --
NM_203349chr1511901 ----1130
NM_203390chr821777 1383 --11320 --
NM_203394chr1242078 2000 452 76 21732 139 ----
NM_203406chr522105 2099 31862 1109 104 ----
NM_203453chr921797 362 --11618 11278
NM_203504chr442509 2471 637 239 --11647 --
NM_203505chr442509 2471 637 239 --11647 --
NM_205842chr21740 1667 ----
NM_205848chr152435 2313 869 110 40 ------
NM_206853chr644077 3163 816 257 13052 ----
NM_206854chr655338 4424 2077 1518 986 24313 652 11014 --
NM_206855chr666303 5389 2483 1951 635 452 25278 1617 11979 --
NM_206866chr2133171 2285 27 13140 178 --
NM_206876chr222257 80 23528 28 ----
NM_206909chr867554 7059 5266 2914 2753 2069 27966 2267 --16547
NM_206914chr1251852 851 720 377 217 ----1102
NM_207012chr1093498 3237 3056 3012 2772 2383 2253 683 264 32461 2298 2243 11240 --
NM_207015chr321717 496 ------
NM_207171chr141556 820 743 700 1125 ----
NM_207303chr1073884 3213 1254 944 685 535 409 1219 13473 --
NM_207304chr1362505 2036 1021 783 117 30 12365 ----
NM_207311chr1261285 899 865 254 219 194 --1278 122
NM_207325chr1922017 1861 --11551 --
NM_207362chr22646 34 ------
NM_207387chr1721754 139 --2401 128 1243
NM_207406chr475139 5105 4562 2275 2189 2010 614 11904 24800 4170 --
NM_207422chrX3923 128 31 --1930 --
NM_212460chr721328 456 31603 1388 229 ----
NM_212464chr1531940 1600 36 11325 --1180
NM_212467chr1542517 2177 1833 282 11902 ----
NM_213594chr1241232 1226 527 325 ------
NM_213606chr1012218 2784 642 11854 152
NM_213648chr541778 1224 485 45 --11455 --
NM_213654chr331404 1369 634 ------