TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-323b-3p
miRNA Sequence: CCCAAUACACGGUCGACCUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000809chr4118962 8519 8274 8179 7907 3644 2807 2187 1272 592 141 ----19229
NM_002270chr5125113 5068 4764 4449 4345 3802 2012 1496 1148 987 196 170 --15051 --
NM_005596chr955261 5109 1366 1087 459 22489 2420 11891 14297
NM_007249chr1399261 9080 9050 8883 8390 8168 7307 7209 6356 ----11952
NM_012081chr552958 1358 1345 973 332 13210 1250 12506
NM_015208chr1851057 771 252 221 25 23020 641 --1871
NM_017650chr775615 4282 1722 787 354 284 139 15350 1290 11883
NM_020390chr384361 3343 3171 3156 3145 647 575 365 21626 439 ----
NM_024345chr935482 465 457 14953 14626 13910
NM_024947chr3169194 8764 8391 8253 7892 7502 7265 7239 6743 6447 6073 3053 2848 2314 1673 848 12435 ----
NM_024989chr288063 6425 5749 5369 5137 2927 2870 2379 26504 5392 --1779
NM_153188chr5125113 5068 4764 4449 4345 3802 2012 1496 1148 987 196 170 --15051 --
NM_172071chr196556 5878 5692 5079 4827 2169 2085 1809 1715 ------