TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-323b-5p
miRNA Sequence: AGGUUGUCCGUGGUGAGUUCGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5--11027 --11084
NM_000052chrX32866 2222 1081 22845 2319 21390 677 --
NM_000084chrX77004 6800 2484 2423 2271 612 364 36859 2761 1626 ----
NM_000091chr232497 2213 2178 22776 2064 ----
NM_000109chrX3939 926 99 12424 ----
NM_000115chr133853 461 272 12562 ----
NM_000138chr1552669 898 779 472 98 32548 1048 185 --11825
NM_000176chr533406 2542 172 ----22633 1052
NM_000216chrX63856 3401 3338 1641 1565 1155 ----13192
NM_000217chr1265118 5016 4380 3887 923 509 14852 11888 --
NM_000232chr482365 2342 2137 1234 743 664 593 88 12152 ----
NM_000248chr362885 2719 2407 2356 1097 1021 42294 2119 400 193 ----
NM_000266chrX----137 1820
NM_000267chr1763330 3277 3167 2856 468 250 ------
NM_000314chr1053245 3084 981 874 427 ----12037
NM_000332chr686276 6079 5928 5852 4937 4404 2556 1354 --11031 --
NM_000337chr586529 6253 5940 5230 5217 4774 1870 766 15529 26037 5624 --
NM_000393chr251739 1502 253 185 24 ------
NM_000408chr243483 3275 933 458 41091 1020 61 24 ----
NM_000448chr1123080 2217 1343 21084 618 --
NM_000461chr323228 927 23568 373 --24115 257
NM_000503chr841744 1522 577 22 ----1712
NM_000555chrX106782 5465 4984 4968 3127 2739 2381 1761 583 483 36638 2842 870 12366 21464 226
NM_000599chr254242 3812 1130 589 184 24405 4250 13601 13369
NM_000601chr7295 38 ----1107
NM_000609chr1043068 2904 1152 78 22153 1190 ----
NM_000617chr1242265 1742 1597 740 ----1637
NM_000618chr12115840 5794 5370 4826 4376 1437 787 506 440 386 108 15069 ----
NM_000618chr12115840 5794 5370 4826 4376 1437 787 506 440 386 108 15069 ----
NM_000633chr1844194 3239 1207 679 14094 14336 24511 4495
NM_000719chr1276144 4695 4543 4397 2279 2044 734 14907 16601 --
NM_000809chr4108063 8056 7512 7007 6114 2594 1452 970 928 887 1951 ----
NM_000813chr584434 3881 3663 2246 2232 903 664 58 23936 352 1245 1943
NM_000838chr672774 2471 1878 807 643 537 398 ------
NM_000849chr162438 2316 1071 750 469 343 22915 706 23065 840 --
NM_000875chr1597013 6227 6060 2816 2691 2237 258 146 81 16174 ----
NM_000926chr11129200 9111 7728 7572 7105 6470 3519 3021 2789 1516 700 586 25759 2587 ----
NM_000958chr54914 531 235 113 1158 ----
NM_000963chr122260 1898 21852 1824 ----
NM_001001132chr2131460 1449 1239 ------
NM_001001323chr1241990 1125 950 53 ------
NM_001001331chr332712 820 112 12143 ----
NM_001001419chr564318 4267 1696 880 804 772 --14341 --
NM_001001420chr564318 4267 1696 880 804 772 --14341 --
NM_001001481chr822213 188 21363 1225 --12571
NM_001001484chr1032307 1960 167 22114 1892 1940 --
NM_001001549chr752338 2032 1949 936 355 22418 690 ----
NM_001001550chr752338 2032 1949 936 355 22418 690 ----
NM_001001555chr752338 2032 1949 936 355 22418 690 ----
NM_001001668chr1943288 2748 1142 1004 33847 3446 80 ----
NM_001001890chr2123322 1654 34291 3079 1260 13097 --
NM_001001974chr102645 323 1525 ----
NM_001002814chr852946 2841 2831 2517 2411 --12923 2787 86
NM_001002860chr1484457 4122 3270 1639 1093 918 99 67 14467 --22958 2942
NM_001003652chr1878662 5653 5414 2511 1841 1390 44 35437 3171 1534 --11816
NM_001003674chr1876779 6271 5497 4459 4272 2113 1154 ------
NM_001003675chr1876779 6271 5497 4459 4272 2113 1154 ------
NM_001003712chr1223400 2761 1961 ----
NM_001003760chr623424 573 23245 990 2893 646 --
NM_001004065chr983508 2424 879 651 626 588 355 65 21162 820 ----
NM_001004317chr663886 2769 1741 897 715 695 14180 ----
NM_001004342chr173838 3723 2274 2217 1356 117 82 1946 25210 1698 13860
NM_001004419chr1243459 924 814 125 33835 836 453 23921 3322 --
NM_001004441chr561361 1118 646 586 452 249 ------
NM_001005242chr1211322 11289 11470 --
NM_001005404chr1743488 1674 1205 470 34041 2963 840 ----
NM_001005473chr565822 5758 5023 4077 1413 359 26097 165 11503 15715
NM_001005753chr21693 21521 842 --22037 1722
NM_001007088chrX6970 952 300 208 201 139 --21228 1024 --
NM_001008392chr373486 3207 3191 3141 3130 1360 510 1170 1613 --
NM_001008495chr821785 295 --11834 --
NM_001008541chr102909 63 --1755 11634
NM_001008541chr102909 63 --1755 11634
NM_001009554chr413515 44380 3373 1245 1023 11750 11880
NM_001009554chr413515 44380 3373 1245 1023 11750 11880
NM_001009899chr365683 4883 2564 2493 696 350 14901 ----
NM_001009909chr1153806 3651 1156 556 182 43228 3003 722 396 ----
NM_001009959chr241987 1674 820 152 --21746 178 --
NM_001010853chr633077 586 570 1260 --12227
NM_001010888chrX54626 1400 1022 490 138 23118 1561 13591 --
NM_001010932chr7295 38 ----1107
NM_001011666chr796481 6173 5983 5269 5227 4587 2091 1660 485 26352 1480 ----
NM_001012279chr63402 245 149 ------
NM_001012393chr1144904 4258 470 395 --23770 1580 --
NM_001012755chrX64870 4560 4221 1976 1261 745 34528 3695 96 ----
NM_001012761chr512298 12155 --12030
NM_001013031chr1031284 165 128 23288 63 ----
NM_001013415chr461535 1512 1370 1237 387 135 11477 ----
NM_001014797chr1048172 5564 3018 1466 78164 7853 7299 6822 5972 2225 1186 26279 2096 --
NM_001015877chrX72785 2694 2076 730 648 595 502 11994 ----
NM_001015880chr1031697 1407 1086 --1367 --
NM_001017992chr521463 316 ----1169
NM_001018004chr151653 1594 1578 --
NM_001018006chr151653 1594 1578 --
NM_001018007chr151653 1594 1578 --
NM_001018020chr151653 1594 1578 --
NM_001018074chr533406 2542 172 ----22633 1052
NM_001018075chr533406 2542 172 ----22633 1052
NM_001018076chr533406 2542 172 ----22633 1052
NM_001018077chr533406 2542 172 ----22633 1052
NM_001018111chr743223 2906 679 201 12493 33299 1093 527 --
NM_001024094chr533406 2542 172 ----22633 1052
NM_001024455chrX52091 1737 829 804 160 22490 2368 1639 --
NM_001024647chr1297443 6847 6303 6276 5393 2575 2314 1879 1358 37352 5818 5014 --12025
NM_001025076chr1054140 3851 2189 1779 1151 15825 21371 700 --
NM_001025077chr1065498 5209 4887 4788 4671 2509 17183 22729 2058 --
NM_001025079chr353548 1010 713 361 284 --13251 --
NM_001025108chr233505 850 703 21210 340 --13154
NM_001025266chr374874 4581 4074 3447 1658 123 24 1171 13541 --
NM_001025596chr11--1446 1495 1351
NM_001029858chr693265 2973 2791 2752 2102 1270 812 603 233 ------
NM_001029863chr631035 338 303 --22140 557 --
NM_001030006chr1752182 2106 1756 358 156 1451 ----
NM_001031695chr2283605 3436 2083 1796 1755 1656 662 653 1637 132 1991
NM_001032392chr252645 2280 1964 825 263 --11821 --
NM_001033045chr254113 1771 1647 1285 686 1839 33614 1078 95 --
NM_001033087chr2053254 2391 1259 531 277 12051 1955 --
NM_001033117chr333612 3371 3217 44816 4538 4149 3139 --21412 216
NM_001033925chr1032112 2032 254 ------
NM_001034841chr1675191 5014 3690 3392 2048 927 773 23682 908 11329 --
NM_001035003chr4--11111 --11073
NM_001035004chr4--11111 --11073
NM_001037164chr732032 734 587 1134 ----
NM_001037165chr798202 8048 7057 6400 1966 1531 749 496 100 38950 5603 2722 48709 8684 342 210 27513 1261
NM_001037553chr2134013 3950 86 12013 --24341 4201
NM_001037954chr1122754 266 13362 11174 13465
NM_001039538chr243171 2607 990 235 12826 ----
NM_001039547chr387342 5824 5430 4867 2691 2311 1026 86 37698 6316 2029 175 --
NM_001039580chr451706 1150 906 878 129 13384 ----
NM_001039585chr173916 3800 3601 1043 785 429 58 13720 ----
NM_001039590chrX63090 2957 1382 731 710 169 22754 363 ----
NM_001039591chrX63090 2957 1382 731 710 169 22754 363 ----
NM_001039618chr1151599 696 350 285 183 24647 3859 ----
NM_001039840chrX45822 4624 3705 2022 21518 1320 ----
NM_001039937chr1333169 1616 820 ------
NM_001040057chr731458 1382 219 ------
NM_001040107chr123552 280 153 2599 578 ----
NM_001040142chr232396 763 45 22188 226 ----
NM_001040143chr232396 763 45 22188 226 ----
NM_001040152chr794426 4415 3629 3287 1096 895 493 276 149 ------
NM_001040157chr452599 2407 2335 763 109 ------
NM_001040284chr1645524 5338 1992 1868 --1167 25783 5453
NM_001040402chr443052 2629 2564 2018 22483 2203 ----
NM_001040429chr1353260 2888 2397 2291 186 --32240 315 77 --
NM_001040441chr161890 1262 1036 519 384 265 1366 45326 4014 738 468 --
NM_001040450chr1541981 787 683 510 22011 153 ----
NM_001040453chr1541981 787 683 510 22011 153 ----
NM_001040624chr832566 1063 822 ----1871
NM_001040625chr832566 1063 822 ----1871
NM_001040626chr832566 1063 822 ----1871
NM_001040627chr832566 1063 822 ----1871
NM_001040628chr832566 1063 822 ----1871
NM_001040629chr832566 1063 822 ----1871
NM_001040630chr832566 1063 822 ----1871
NM_001040665chr763733 3502 3341 1850 984 247 33420 3037 1491 ----
NM_001040712chr912571 32807 2720 112 --12971
NM_001042404chr131989 106 90 ----1192
NM_001042473chr1062161 2138 1980 660 568 176 ----11999
NM_001042492chr1763330 3277 3167 2856 468 250 ------
NM_001042493chr611761 32023 719 133 1140 --
NM_001042510chr841896 1629 664 168 ------
NM_001042511chr841896 1629 664 168 ------
NM_001042517chr131807 ----1860
NM_001042555chr1241689 797 762 364 14458 --14417
NM_001042599chr256870 5495 2633 2507 805 46520 5879 2099 1159 14832 16031
NM_001044385chr273629 3558 3207 2970 2552 1123 570 13679 ----
NM_001048183chr183277 3256 3013 2997 2669 2500 962 132 23665 96 ----
NM_001049chr1452215 2110 377 188 130 --1153 --
NM_001109977chr41113 ----1833
NM_001122679chr5--11027 --11084
NM_001167chrX65984 5570 4745 4277 1930 1333 15135 --14954
NM_001198chr632060 1806 110 42282 1756 1676 1557 ----
NM_001204chr297804 6806 6725 6233 6204 6085 5854 5701 1499 12992 22175 1787 --
NM_001256chr1752235 935 831 222 26 ----12699
NM_001282chr1752182 2106 1756 358 156 1451 ----
NM_001304chr1733549 3392 400 11404 13102 1234
NM_001329chr1031558 1342 1325 21305 218 ----
NM_001332chr5--11415 --1131
NM_001356chrX2837 445 1179 1330 --
NM_001364chr1164264 4014 3399 1405 1102 24 11626 --14326
NM_001380chr1031063 976 947 ------
NM_001390chr1843240 584 453 118 32853 2753 564 12422 --
NM_001402chr62240 116 --11989 --
NM_001412chrX53776 3672 2740 2719 997 12324 ----
NM_001419chr1953879 1721 1515 156 77 --24490 3724 --
NM_001427chr742044 476 402 359 11871 11658 --
NM_001453chr651699 1536 1271 313 272 --11505 --
NM_001527chr663812 2976 1872 1579 852 461 --14566 --
NM_001584chr112817 386 ----1276
NM_001650chr1853342 3186 2865 1231 983 1274 13374 --
NM_001683chr332712 820 112 12143 ----
NM_001695chr834122 3880 2799 --124 --
NM_001709chr1172380 2132 1860 1035 729 204 151 ------
NM_001730chr1331619 1344 1025 2637 110 ----
NM_001730chr1331619 1344 1025 2637 110 ----
NM_001754chr2123322 1654 34291 3079 1260 13097 --
NM_001759chr1295325 5253 4549 3974 3938 2061 1633 1464 504 23666 782 13930 --
NM_001777chr353548 1010 713 361 284 --13251 --
NM_001806chr1922982 2765 12606 --1844
NM_001858chr664854 4685 3821 3736 1956 141 14955 --13482
NM_001859chr912502 ----11025
NM_001882chr52500 224 179 ----
NM_001918chr188516 8093 7450 6980 6677 3082 2837 1574 26879 907 ----
NM_001941chr1833530 3241 1546 22623 1092 1197 --
NM_001942chr1841703 1276 440 92 ------
NM_002015chr1383237 3077 2889 2257 2115 1094 541 49 22265 2039 ----
NM_002025chrX88725 8033 6562 5639 2178 2009 173 31 21744 616 12431 --
NM_002035chr1843888 3049 2690 1344 1862 1586 --
NM_002040chr2143068 1166 1038 1006 ------
NM_002053chr12681 402 ----1378
NM_002092chr464602 4228 3799 3227 1178 601 25037 1285 ----
NM_002128chr13163 ----11994
NM_002158chr263728 3158 1400 1153 624 341 12448 ----
NM_002214chr784956 4897 4615 4271 3740 2001 1240 541 34597 3879 2208 14256 --
NM_002241chr133023 2529 1086 32852 2293 707 ----
NM_002242chr251654 791 473 420 324 1544 ----
NM_002254chr262357 2150 836 597 524 396 --2745 555 --
NM_002264chr343318 1610 1204 1039 21153 420 11415 14428
NM_002265chr1721209 995 11223 124 --
NM_002270chr565183 5172 1906 1336 252 135 22025 1960 15358 --
NM_002285chr233505 850 703 21210 340 --13154
NM_002356chr632120 1966 1901 198 ----
NM_002374chr243171 2607 990 235 12826 ----
NM_002445chr821465 82 1541 ----
NM_002451chr943598 3484 797 581 --23764 183 --
NM_002487chr152632 521 2664 573 ----
NM_002515chr1441250 623 349 137 11552 ----
NM_002522chr1772941 2841 2678 947 727 474 138 ----23481 1118
NM_002545chr1144904 4258 470 395 --23770 1580 --
NM_002577chr353076 2983 2564 255 107 11031 --1147
NM_002581chr954883 3711 3651 1391 1376 2917 289 --11760
NM_002644chr141767 1599 1124 514 ----138
NM_002665chr252645 2280 1964 825 263 --11821 --
NM_002698chr1932201 919 840 22953 437 22440 1112 --
NM_002737chr17156618 5942 5319 5289 4756 4740 4581 4466 2669 2625 1943 1897 1677 680 525 54214 4207 4193 2227 180 45693 4515 4345 2271 --
NM_002837chr1244445 3124 3108 1286 --24197 354 --
NM_002839chr912571 32807 2720 112 --12971
NM_002868chr1262425 1628 291 135 82 55 11509 ----
NM_002874chr962142 2104 2070 2050 1542 417 2794 229 ----
NM_002977chr263037 2713 2221 1075 808 30 23289 749 ----
NM_003016chr1731376 744 37 21994 438 11762 --
NM_003022chrX51056 913 906 375 327 11115 ----
NM_003038chr252666 826 649 635 269 12052 ----
NM_003108chr266152 5537 5342 4647 1563 511 --46395 2101 2040 884 --
NM_003112chr732162 937 258 12305 --1628
NM_003113chr22545 60 1659 ----
NM_003161chr1723314 501 12244 1623 --
NM_003189chr163311 3032 2867 2200 775 717 22957 1323 --13089
NM_003199chr1844696 562 282 224 25162 1727 15621 --
NM_003221chr633718 2689 1056 23915 129 1235 --
NM_003257chr1531302 536 512 1467 ----
NM_003298chr385679 4707 2394 2086 1377 1201 234 149 11425 --25286 551
NM_003339chr521445 300 --122 --
NM_003381chr62662 115 1833 2569 35 --
NM_003385chr261026 958 901 875 847 224 ------
NM_003400chr23787 767 652 ------
NM_003412chr352690 2187 1985 1051 96 1845 12743 --
NM_003458chr3114062 3417 3357 3300 3090 1094 873 475 375 307 115 11335 23287 1389 --
NM_003468chr294379 3669 3122 1737 1349 1105 965 322 291 12733 --14022
NM_003471chr33932 788 700 22226 184 ----
NM_003478chr1152415 1299 1250 1193 207 1143 ----
NM_003489chr2142548 1290 417 242 23305 3187 ----
NM_003506chr81184 1867 11295 --
NM_003574chr1865185 4838 4247 4118 1306 556 ------
NM_003583chr1233668 1485 184 --1381 12998
NM_003590chr243601 2546 1457 1281 13812 --189
NM_003603chr441603 732 578 179 11826 1513 1401
NM_003617chr144364 4352 1118 53 65007 4829 1968 1821 602 260 ----
NM_003629chr123179 3052 ----1498
NM_003644chr17116186 5956 5242 4967 4883 4650 2601 2308 1546 469 203 24461 1721 24197 153 --
NM_003671chr933204 1340 999 33617 2328 1047 ----
NM_003716chr33922 786 126 ------
NM_003759chr441181 1038 305 100 23644 298 --1384
NM_003800chr651692 867 548 406 355 ------
NM_003822chr152733 2379 2211 594 232 12804 12993 --
NM_003829chr92847 76 --21077 173 --
NM_003861chr1452750 1788 906 796 227 --12126 --
NM_003887chr272231 2214 2134 1909 1689 651 603 1618 --175
NM_003909chr842917 2665 658 508 1642 ----
NM_003913chr651698 1365 921 640 588 12812 ----
NM_003930chr782301 2086 1840 1775 701 568 518 80 1206 --11767
NM_003939chr1064106 3347 3085 1377 842 204 198 ----
NM_003941chr722397 1875 --12465 11779
NM_003958chr633194 977 645 32961 1418 571 23242 820 --
NM_003972chr101507 11232 --11332
NM_003983chr1673388 2978 1790 1644 1484 1033 59 --1862 --
NM_004006chrX3939 926 99 12424 ----
NM_004007chrX3939 926 99 12424 ----
NM_004009chrX3939 926 99 12424 ----
NM_004010chrX3939 926 99 12424 ----
NM_004011chrX3939 926 99 12424 ----
NM_004012chrX3939 926 99 12424 ----
NM_004013chrX3939 926 99 12424 ----
NM_004014chrX3939 926 99 12424 ----
NM_004015chrX3939 926 99 12424 ----
NM_004016chrX2853 840 12338 ----
NM_004017chrX3939 926 99 12424 ----
NM_004018chrX2853 840 12338 ----
NM_004020chrX3939 926 99 12424 ----
NM_004021chrX2853 840 12338 ----
NM_004022chrX2853 840 12338 ----
NM_004023chrX2853 840 12338 ----
NM_004028chr1853342 3186 2865 1231 983 1274 13374 --
NM_004035chr1735136 4383 966 11121 13913 1773
NM_004124chr1453491 3482 3100 2436 341 12249 ----
NM_004136chr1543252 820 650 328 2588 535 ----
NM_004171chr11159613 9344 8839 8221 6815 6352 3463 2890 2584 2556 1819 1298 1277 547 204 1751 16236 16330
NM_004274chr1422598 2524 2864 628 12997 --
NM_004316chr1231143 863 62 ------
NM_004329chr1041378 1321 450 211 21039 939 ----
NM_004338chr1876779 6271 5497 4459 4272 2113 1154 ------
NM_004349chr83900 214 33 140 ----
NM_004386chr1931907 1456 502 11570 1614 11420
NM_004392chr1342664 1999 611 273 22386 1839 ----
NM_004397chr1153909 3443 3250 744 503 --23275 1623 --
NM_004496chr142526 146 1119 1221 --
NM_004501chr163748 3439 2672 1214 1155 541 22930 413 11272 --
NM_004670chr1031697 1407 1086 --1367 --
NM_004673chr121126 206 --11333 --
NM_004726chrX65788 5196 3605 1907 1775 974 23908 363 1725 14161
NM_004734chr1362209 1998 1239 1188 959 663 12786 ----
NM_004736chr151947 1560 682 69 48 1290 1761 --
NM_004745chr896732 6587 5508 4836 4369 1839 497 457 189 26056 1322 36239 4808 4373 --
NM_004748chr1553410 3374 3173 1476 1252 --13306 --
NM_004788chr1161828 1092 1052 768 425 188 11105 ----
NM_004796chr1422275 544 1123 12104 --
NM_004804chr262673 1724 937 918 586 547 --12772 --
NM_004815chr144668 3792 1631 951 33279 1959 1455 ----
NM_004834chr253345 3040 1214 593 108 11058 --1101
NM_004856chr151479 1525 --1180
NM_004863chr1434360 3976 3789 33235 1290 270 148 14060
NM_004904chr796481 6173 5983 5269 5227 4587 2091 1660 485 26352 1480 ----
NM_004926chr1431564 506 171 11513 ----
NM_004929chr811561 11387 --1408
NM_004956chr732917 1670 1076 13819 13208 1612
NM_004976chr1175019 4272 3748 1861 1178 827 230 1904 1382 --
NM_004985chr1273746 3369 2895 1691 1425 1318 1142 21634 754 ----
NM_004992chrX78295 8119 6841 5859 3368 2127 965 26405 2483 17968 15594
NM_004992chrX78295 8119 6841 5859 3368 2127 965 26405 2483 17968 15594
NM_005006chr2--11013 2244 48 --
NM_005056chr1224659 619 45044 4060 744 464 ----
NM_005063chr1053670 2668 1501 375 164 --22925 335 --
NM_005065chr1494866 4634 4549 3349 3306 1762 519 231 33 14070 ----
NM_005233chr352342 1694 960 913 74 1709 ----
NM_005235chr256870 5495 2633 2507 805 46520 5879 2099 1159 14832 16031
NM_005311chr752338 2032 1949 936 355 22418 690 ----
NM_005339chr444260 4089 3488 3157 11713 ----
NM_005359chr1834246 2157 58 11416 16432 25049 4418
NM_005397chr743223 2906 679 201 12493 33299 1093 527 --
NM_005400chr231236 1188 869 --12373 12283
NM_005409chr411094 2738 387 --1214
NM_005436chr1053988 3682 3592 3324 197 12942 --11414
NM_005506chr442056 1902 1818 965 --11028 11156
NM_005509chr541647 1586 1385 1304 31896 1612 690 ----
NM_005562chr161373 1343 1213 1198 532 445 ------
NM_005578chr364654 4021 3649 3182 1032 864 34616 933 606 --44241 4148 1225 695
NM_005596chr976255 6119 5970 5928 4675 4565 401 1263 15076 --
NM_005603chr1841893 1769 1511 116 ------
NM_005647chrX53337 2690 2427 758 745 13291 22703 2475 --
NM_005665chr174586 4127 3984 3539 3078 1583 573 14106 14903 --
NM_005715chr662613 2490 2273 2215 2088 789 ------
NM_005725chr141934 838 747 299 ----1697
NM_005738chr732032 734 587 1134 ----
NM_005739chr154666 599 290 23 ------
NM_005748chr1242756 1361 432 105 11172 ----
NM_005759chr253968 3649 3502 3433 1326 12979 ----
NM_005795chr22976 544 1286 --11108
NM_005807chr1------1136
NM_005808chr373486 3207 3191 3141 3130 1360 510 1170 1613 --
NM_005822chr641990 898 259 198 1251 ----
NM_005840chrX56348 5981 5720 5357 455 26771 841 --17168
NM_005898chr114795 597 463 396 22866 2054 ----
NM_005901chr1878662 5653 5414 2511 1841 1390 44 35437 3171 1534 --11816
NM_005902chr1574229 4052 3879 1851 1747 656 327 14128 --11326
NM_005903chr564318 4267 1696 880 804 772 --14341 --
NM_005941chr863909 3249 3240 2599 787 690 1657 13935 1643
NM_005955chr174514 4219 3849 1924 1355 1071 587 --15246 14636
NM_005962chr102909 63 --1755 11634
NM_005962chr102909 63 --1755 11634
NM_005964chr1741490 1473 1264 1155 ------
NM_005999chr121347 303 ----11467
NM_006007chr954162 4097 3139 1796 188 54490 4220 3114 1113 969 1662 --
NM_006095chr433851 3247 3162 11369 ----
NM_006135chr121089 946 --11161 --
NM_006154chr1542679 2553 1134 382 32028 1051 49 1158 --
NM_006203chr575368 4895 4510 3809 3772 2091 842 54729 1524 1470 1245 78 13605 11631
NM_006206chr422248 741 --1630 12499
NM_006251chr542516 571 477 98 22722 58 22746 2560 --
NM_006252chr166617 6503 6101 5123 734 338 27103 4836 --17125
NM_006283chr843780 3284 1223 167 ----11783
NM_006306chrX85571 5563 5395 5030 4384 4266 1029 454 35746 5176 3778 --15079
NM_006315chr454499 1820 785 459 277 11227 ----
NM_006352chr11540 ----21987 1854
NM_006380chr1734169 3518 385 33927 1151 552 ----
NM_006475chr13249 35 1528 ----
NM_006482chr1233668 1485 184 --1381 12998
NM_006489chr1441250 623 349 137 11552 ----
NM_006496chr12591 443 12009 ----
NM_006520chrX31390 1165 267 21088 535 ----
NM_006538chr254174 3545 3161 1542 1489 --23452 3302 --
NM_006544chr1495783 5613 5537 5492 5457 4752 4662 4304 1790 26075 109 14021 --
NM_006546chr1796451 5845 5276 4575 4487 1480 1439 737 35 12119 24342 1588 --
NM_006549chr1272994 2381 2011 1188 1017 730 270 --1365 12932
NM_006560chr11--1446 1495 1351
NM_006561chr1054140 3851 2189 1779 1151 15825 21371 700 --
NM_006599chr1658197 7654 2643 2137 1558 26174 1666 17891 --
NM_006614chr333263 2371 2273 32517 1036 557 ----
NM_006626chr951753 1660 977 680 381 ------
NM_006628chr1573924 3512 1573 1382 872 743 108 1468 --13292
NM_006654chr1241689 797 762 364 14458 --14417
NM_006699chr122275 952 ----21735 601
NM_006717chr962493 959 896 764 752 117 ------
NM_006722chr362885 2719 2407 2356 1097 1021 42294 2119 400 193 ----
NM_006729chrX64653 4393 3675 3520 2082 1895 24551 3848 ----
NM_006750chr1687554 7075 6836 5994 3094 2895 2038 142 ----17244
NM_006766chr832250 526 209 1871 ----
NM_006777chrX52867 2586 718 531 409 12661 ----
NM_006805chr531603 1154 54 --1418 11348
NM_006807chr1731043 353 346 --1229 1542
NM_006838chr1231931 1877 1389 ----1604
NM_006850chr14971 797 347 237 ------
NM_006873chr263298 3029 2960 2321 1032 162 --127 --
NM_006914chr931397 1066 998 --1284 1631
NM_006915chrX32132 794 699 ----1588
NM_006924chr1753878 3617 3019 768 64 24351 1134 12905 --
NM_006948chr2142189 267 245 117 ----1299
NM_006955chr1052861 2351 1386 916 489 33499 831 170 ----
NM_006962chrX6970 952 300 208 201 139 --21228 1024 --
NM_006980chr71835 ----1221
NM_006981chr972892 2389 1876 1090 1039 298 166 42656 2210 1833 397 --12234
NM_007007chr1294379 4369 4296 3728 3188 1465 1003 921 524 ------
NM_007011chr1556391 5958 5640 4619 2362 24297 1487 12247 11769
NM_007030chr574800 3608 3370 1861 949 423 339 34044 1268 1262 1647 --
NM_007038chr21115585 5317 5026 4225 4156 3883 3778 2275 1487 629 32 23807 901 25894 1922 --
NM_007050chr2068054 3142 2261 1586 1047 476 35660 602 240 11814 17338
NM_007159chr31380 1399 --1544
NM_007172chr2233323 3268 111 13119 ----
NM_007173chr1141922 821 512 285 21622 891 ----
NM_007175chr843489 1116 792 682 13274 12651 12559
NM_007203chr983508 2424 879 651 626 588 355 65 21162 820 ----
NM_007249chr1397567 7493 6706 6483 3720 3306 2514 1942 442 36851 6275 2305 19016 --
NM_007292chr1735136 4383 966 11121 13913 1773
NM_007350chr1234029 1253 723 --14670 --
NM_012069chrX31899 968 420 198 1118 32145 724 657
NM_012089chr1--11087 1337 11381
NM_012095chr1063319 3256 2750 2713 2555 2313 --1313 --
NM_012098chr931061 293 80 --2251 213 --
NM_012104chr1143510 2701 2378 1142 1657 ----
NM_012104chr1143510 2701 2378 1142 1657 ----
NM_012120chr622203 903 ----12591
NM_012141chr1333169 1616 820 ------
NM_012164chr9117387 5815 5473 3021 2817 2536 2284 2133 1764 1476 62 57014 5549 1606 820 128 --16449
NM_012214chr266378 5326 4854 2260 2103 2048 25173 4235 22275 230 --
NM_012234chr363457 3392 3243 3188 531 318 1234 ----
NM_012249chr22240 203 1275 11052 --
NM_012262chr154648 3872 3466 231 105 21921 1564 ----
NM_012281chr742359 2140 759 738 ------
NM_012288chr685315 4975 4888 3919 2134 1817 1614 114 11158 24259 651 --
NM_012294chr7112877 2844 2766 1312 1105 965 671 510 467 328 114 1627 ----
NM_012309chr1134615 1942 1042 ----24374 3399
NM_012382chr553922 1089 928 873 793 24241 2868 ----
NM_012471chrX31421 602 233 ----11332
NM_013231chr1473851 3453 2726 1603 1048 717 34 --23170 1496 --
NM_013269chr1243386 851 741 52 43762 1796 763 380 23848 3249 --
NM_013381chr1222181 2166 12390 --1472
NM_013386chr131612 1539 46 ------
NM_013438chr931779 717 44 ----11175
NM_014028chr643250 2167 559 56 22866 267 ----
NM_014048chr1684352 3810 816 738 716 534 397 242 14056 ----
NM_014112chr855462 4571 4265 4198 3474 1224 --15172
NM_014155chr1157015 6893 1667 1582 915 17200 --1225
NM_014160chr331406 1015 534 31343 263 161 ----
NM_014181chr21945 42476 2450 395 43 12512 --
NM_014233chr1742089 1869 310 231 12081 ----
NM_014263chr1021230 1120 11471 ----
NM_014309chr2283595 3426 2073 1786 1745 1646 652 643 1627 122 1981
NM_014317chr10--1310 --194
NM_014331chr496251 5279 5072 5056 2981 1166 524 280 93 37790 6052 816 11256 --
NM_014379chr84964 422 234 173 1225 ----
NM_014491chr71754 31010 66 55 1125 --
NM_014607chr241445 1323 817 253 ----1214
NM_014613chr562933 2745 2358 2150 875 197 12574 12869 --
NM_014615chr1643633 2422 575 333 1212 --12400
NM_014636chr962786 2702 2660 1182 458 344 23727 1567 11606 --
NM_014682chr852358 929 846 672 22 ----11420
NM_014683chr1731767 614 154 ------
NM_014702chr643216 3065 2832 1026 13002 1593 --
NM_014711chr1641448 1305 703 697 1498 --1585
NM_014720chr1021299 524 --11604 198
NM_014721chr626684 5532 1914 17222 1300
NM_014729chr831881 850 563 ------
NM_014733chr551682 1438 853 499 32 11650 11520 --
NM_014746chr213442 13927 1447 12741
NM_014765chr122633 2415 --11999 1844
NM_014774chr142863 2094 670 63 33261 1263 218 ----
NM_014812chr131989 106 90 ----1192
NM_014819chr542455 920 475 389 ------
NM_014824chr1141898 1784 1509 1470 2604 34 ----
NM_014840chr1253330 2093 994 866 97 12834 --13358
NM_014850chr333612 3371 3217 44816 4538 4149 3139 --21412 216
NM_014864chr121254 821 34210 3133 58 11028 --
NM_014873chr144723 3496 1905 336 13251 --13745
NM_014877chr1777567 6897 6430 5981 1602 823 211 27775 7432 ----
NM_014898chr1932197 1591 593 1108 --1397
NM_014905chr231818 541 189 1453 ----
NM_014906chr1793171 3165 2978 1292 935 707 542 287 249 ----23251 1108
NM_014912chr1053495 2925 1319 1094 40 --1532 --
NM_014920chr653665 3610 3155 1492 1015 13148 ----
NM_014939chr1841521 1187 1067 306 ------
NM_014942chr642431 2272 960 792 --12465 --
NM_014946chr252908 2297 2190 2064 88 ------
NM_014947chr142950 990 609 159 ----23048 138
NM_014953chr1353957 3606 1329 412 254 12998 13443 --
NM_014961chr441949 699 344 42 --11365 11915
NM_014989chr6--21969 1572 --1101
NM_015000chr1253138 2246 1123 523 73 126 --12976
NM_015026chr1223434 1825 23276 464 --13558
NM_015039chr164395 2648 1278 788 667 22 33204 3000 1079 13099 --
NM_015040chr243373 2195 2148 1330 23151 958 ----
NM_015042chr1554215 1158 1108 642 434 1297 --13577
NM_015064chr1273055 2554 2520 2247 1193 841 263 --1110 --
NM_015071chr5115894 5762 5112 5083 4822 4722 4524 4085 830 611 237 24779 4369 56503 4923 4620 719 50 14905
NM_015076chr633418 857 481 1617 ----
NM_015077chr1754335 4085 3580 1843 510 13978 24195 97 --
NM_015092chr16114391 4026 2891 2880 1773 780 771 492 378 208 170 23448 441 ----
NM_015097chr311860 11787 --11974
NM_015115chr443052 2629 2564 2018 22483 2203 ----
NM_015156chr1453942 3710 2531 1226 537 13624 11359 2870 478
NM_015176chr141409 1280 1178 120 ------
NM_015215chr142918 2661 2357 2190 12209 22200 216 --
NM_015216chr51523 --11156 1407
NM_015267chr1262082 1806 702 485 422 116 --21895 536 11613
NM_015272chr1631980 1673 1371 32118 1873 1744 ----
NM_015278chr652916 2306 1334 1236 638 23198 1109 ----
NM_015288chr553690 3137 2613 1404 66 21107 746 11418 --
NM_015299chr1473206 2929 2794 2648 2493 1048 831 13661 ----
NM_015310chr878310 8086 7125 5117 2871 2403 1477 15919 17201 --
NM_015317chr22399 78 1491 12508 --
NM_015326chr142982 2890 2397 2128 --21881 696 --
NM_015375chr154814 4084 1993 1180 336 11329 13877 --
NM_015387chr21297 21575 284 ----
NM_015393chr453230 2555 1397 1172 162 23302 2809 198 --
NM_015455chr554021 3576 3268 1364 730 --123 13019
NM_015458chr851750 622 481 447 359 11344 13721 --
NM_015553chr664112 1748 1588 1396 871 628 21530 1403 ----
NM_015554chr1522606 1858 42281 721 653 616 ----
NM_015564chr583111 2326 2284 2267 1410 1273 913 274 1412 1783 --
NM_015565chr2121936 461 1335 11915 --
NM_015569chr154564 3557 3482 1713 1353 11311 164 --
NM_015571chr672646 2585 2410 2373 792 520 67 ------
NM_015576chr332254 771 356 21991 1129 --1442
NM_015695chr631480 757 691 11464 ----
NM_015713chr823325 2445 22999 2678 ----
NM_015879chr1888543 7913 7348 6513 5682 5593 3437 2223 58529 7557 2581 1907 1245 37785 2956 1995 17696
NM_016018chr852739 2589 1119 934 165 ------
NM_016023chr822119 1929 31363 366 100 ----
NM_016040chr112164 42759 2723 2212 570 ----
NM_016047chr2------147
NM_016075chr1352719 1043 973 966 406 12075 ----
NM_016076chr142761 2382 553 389 22951 2156 ----
NM_016079chr21693 21521 842 --22037 1722
NM_016083chr662571 2503 2491 893 647 342 13727 ----
NM_016096chr841896 1629 664 168 ------
NM_016206chr368953 8406 7230 7046 2749 2573 1923 --18083
NM_016257chr143263 3029 2371 961 --12704 12976
NM_016260chr286832 4785 2608 2123 1744 1326 520 70 37446 6392 2384 --11704
NM_016376chr1774042 3535 3529 1505 1398 1357 626 11438 ----
NM_016396chr1542911 2722 2474 477 11047 ----
NM_016436chr2082001 1656 1080 1058 778 748 658 33 --12411 --
NM_016441chr241666 587 195 42 21574 498 --1542
NM_016513chr653665 3610 3155 1492 1015 13148 ----
NM_016522chr1161359 628 541 298 122 70 21263 84 ----
NM_016531chr411668 43981 1580 490 313 24024 3128 --
NM_016548chr931495 629 297 1343 --1503
NM_016578chr113548 520 473 ----1585
NM_016622chr242146 1891 1606 126 ----12007
NM_016946chr173599 3184 3168 2854 1275 871 304 ----1418
NM_016953chr275912 3944 3908 1949 1626 1286 38 34393 4387 4250 ----
NM_017412chr831098 1083 362 ------
NM_017420chr1423787 2552 11164 --13577
NM_017423chr451833 1561 1428 711 24 ------
NM_017548chr322034 379 3430 402 62 ----
NM_017563chr376034 5951 4113 2430 1605 721 239 15497 ----
NM_017633chr653091 2587 1167 635 312 33742 612 273 12762 --
NM_017634chr811725 ----11911
NM_017637chr978962 8071 7421 7263 6007 3082 382 46217 1202 1046 855 28617 6773 --
NM_017643chr1742405 2298 1134 205 2887 881 ----
NM_017645chr93434 230 75 1874 --12762
NM_017650chr756073 5848 5497 4741 2321 25621 977 ----
NM_017658chr1464220 3990 3867 3146 1399 611 12832 13859 22858 370
NM_017666chrX3682 505 28 1105 --1379
NM_017769chr1443030 1228 800 50 12311 ----
NM_017826chr131607 --156 1570
NM_017848chrX54126 3577 3568 2879 430 11222 11794 1560
NM_017902chr1075516 4867 4657 3853 1466 1364 423 13674 --12304
NM_017919chr965223 5166 1187 860 816 353 35074 4629 3571 ----
NM_017958chr222448 574 1590 21996 38 --
NM_018014chr21462 ----11054
NM_018036chr1463882 3110 2726 1474 475 63 1159 23044 972 --
NM_018046chr51664 ----11342
NM_018084chr262951 2696 2340 2152 1018 351 ----12166
NM_018092chr1621064 346 1102 ----
NM_018155chr332328 990 429 12278 --1524
NM_018176chr461661 1510 1147 636 337 319 --11017 --
NM_018195chr1142136 1998 564 410 21310 450 1578 --
NM_018243chr453406 1416 809 442 192 13828 ----
NM_018299chr822213 188 21363 1225 --12571
NM_018302chr411885 1377 1294 21547 514
NM_018315chr461535 1512 1370 1237 387 135 11477 ----
NM_018325chr911413 2299 35 --11432
NM_018351chr1284671 4194 3564 3542 3531 1823 1298 355 21682 717 14248 --
NM_018362chr1143791 2538 1282 1134 32464 673 555 ----
NM_018375chr1431774 67 54 11390 --11256
NM_018425chr1042502 1912 506 371 2682 169 --11709
NM_018566chr155050 3665 2003 1755 862 13155 ----
NM_018717chr472749 2400 1029 399 162 135 27 ----1600
NM_018947chr785034 4388 4084 3964 3734 1839 1620 680 24667 724 ----
NM_018958chr1573153 2761 740 724 432 240 154 12806 ----
NM_018970chr772399 2149 1975 1097 782 756 124 ------
NM_018976chr1242302 1105 956 246 1415 --12048
NM_019080chr1321514 71 1583 ----
NM_019106chr2253311 3221 2429 2314 381 23443 3263 21111 484 --
NM_019117chrX52672 2564 2401 2261 1216 11160 ----
NM_019610chr112205 21468 656 ----
NM_020122chr265766 5417 5021 2072 1261 23 21026 65 ----
NM_020132chr2134013 3950 86 12013 --24341 4201
NM_020144chr761574 1530 409 240 117 95 ------
NM_020177chr572335 2314 2137 2127 1192 664 77 13254 ----
NM_020205chr143271 2916 785 277 21304 857 ----
NM_020336chr2051546 752 479 263 148 21387 202 13273 --
NM_020338chr1082662 2601 2482 1346 982 889 863 572 12361 13587 --
NM_020390chr363926 3877 3208 3198 996 98 1537 --11616
NM_020403chr132724 557 191 --11349
NM_020425chr611761 32023 719 133 1140 --
NM_020440chr163102 3059 2774 520 480 220 22064 773 ----
NM_020443chr1106501 5985 5812 5436 5244 742 734 481 382 32 16821 ----
NM_020466chr674359 3926 3160 1696 1061 597 72 43594 3319 1517 262 ----
NM_020673chr2087394 6892 6041 5116 2933 1994 1078 474 ------
NM_020699chr1115184 4988 4892 4786 4604 4523 4367 4250 3386 1085 661 24756 1204 ----
NM_020711chr241987 1674 820 152 --21746 178 --
NM_020717chrX74941 4651 4359 3785 3732 1578 365 24585 1408 24046 1865 --
NM_020718chr1675461 4566 4317 2562 2016 1968 1546 1214 ----
NM_020739chr1553410 3374 3173 1476 1252 --13306 --
NM_020748chr1731976 1834 71 ------
NM_020752chr1022779 975 --1940 12454
NM_020772chr17108664 7691 5878 5658 5260 2354 829 764 372 182 28597 5786 ----
NM_020774chr1875891 4785 3999 1172 721 533 397 ------
NM_020783chr1821517 710 --1315 --
NM_020805chr1841297 561 505 98 ------
NM_020809chr114873 836 134 58 11974 ----
NM_020810chr1442568 2415 1052 904 11087 --12392
NM_020839chr351407 1034 365 273 37 11554 ----
NM_020841chr1223400 2761 1961 ----
NM_020917chr1933302 2465 1269 13682 --12994
NM_020918chr1053164 1053 637 311 201 ------
NM_020921chr1451412 1391 681 482 110 11008 ----
NM_020948chr133409 1276 1203 ------
NM_020964chr1844697 3448 1641 1620 21289 574 24813 386 --
NM_021007chr232396 763 45 22188 226 ----
NM_021033chr1313391 31364 1091 332 ----
NM_021038chr383265 3203 2641 2126 2114 844 604 167 122 ----
NM_021069chr441603 732 578 179 11826 1513 1401
NM_021072chr552567 1655 1638 385 122 12260 ----
NM_021079chr1753166 2810 1161 1113 155 --22941 2585 12901
NM_021090chr2274569 4197 3702 1931 1659 1273 910 33149 1061 430 ----
NM_021116chr7108777 8197 8092 6965 6875 6630 5776 3401 3003 2938 32982 2608 740 21130 436 27779 6710
NM_021148chr742202 911 673 246 11856 ----
NM_021156chr201728 ----1189
NM_021176chr241882 1774 1572 263 1451 1294 --
NM_021622chr102645 323 1525 ----
NM_021633chr121306 494 1462 11297 11173
NM_021647chr413515 44380 3373 1245 1023 11750 11880
NM_021813chr6105464 5291 5283 1989 1733 1445 1050 1011 388 227 ------
NM_021815chr282997 2817 2792 2384 2242 1237 739 188 12259 ----
NM_021911chr584434 3881 3663 2246 2232 903 664 58 23936 352 1245 1943
NM_021914chr142907 248 12289 ----
NM_021956chr641490 1479 1423 85 ----1366
NM_021961chr1167310 5655 5485 2870 382 300 --22363 2337 1920
NM_021964chr3106064 5709 5527 4421 1894 1504 1209 1022 686 314 ------
NM_021977chr673762 1362 1264 918 684 344 251 12456 ----
NM_022041chr1622640 965 22419 2015 ----
NM_022048chr1546270 5154 2271 706 55756 5047 4888 4317 1253 14417 14667
NM_022051chr12578 131 ----199
NM_022085chr631526 1502 1394 11266 ----
NM_022114chr141280 1274 1178 438 ----21649 265
NM_022166chr1665198 4205 4110 995 943 177 24508 4474 15666 1919
NM_022456chr1297443 6847 6303 6276 5393 2575 2314 1879 1358 37352 5818 5014 --12025
NM_022469chr153288 3208 923 664 541 13009 1601 --
NM_022739chr172164 40 --2387 53 --
NM_022753chr142689 2604 469 437 ----12274
NM_022802chr1031558 1342 1325 21305 218 ----
NM_022893chr233065 1237 365 ----11184
NM_022894chr22331 129 31796 1395 1191 1114 --
NM_022898chr1464241 1874 1822 1481 853 641 23793 3379 ----
NM_022901chr941889 1571 1367 116 ------
NM_022912chr262541 2404 2164 657 468 347 11153 ----
NM_022918chr1111346 11997 12152 12104
NM_023923chr183277 3256 3013 2997 2669 2500 962 132 23665 96 ----
NM_024345chr965987 5149 2258 1872 1509 1456 25451 3801 15082 14561
NM_024512chr363381 3018 2309 1286 1046 843 --11156 --
NM_024524chr352801 594 377 229 134 1196 ----
NM_024590chr431739 1674 335 11204 ----
NM_024639chr622724 364 --12879 --
NM_024665chr353118 3082 1222 1163 873 1115 24691 343 --
NM_024721chr852214 1972 1009 564 551 --12298 --
NM_024740chr1143004 2988 783 506 34033 1237 679 --130
NM_024770chr2105291 4813 4437 4136 2467 1339 1258 736 592 83 16502 36390 5442 1851 25225 1356
NM_024930chr572688 2244 1746 1730 629 543 167 ----153
NM_024947chr3109413 9221 8806 8128 7378 3806 2638 1191 983 822 12930 17148 13735
NM_024949chr431347 570 347 --24073 232 --
NM_024989chr2106522 5995 5309 5004 4943 2859 2255 1906 1468 86 --27734 1009 13057
NM_025074chr482756 2369 2123 529 441 232 147 120 --1924 --
NM_025138chr135536 333 198 135 66 11373 ----
NM_025179chr134699 3539 3109 14335 --11471
NM_025191chr133330 3080 2350 32593 1224 122 11362 --
NM_025208chr112788 637 52070 1860 1595 314 87 ----
NM_025221chr4--11111 --11073
NM_030576chr1752654 2608 2219 2087 2052 12367 ----
NM_030621chr1494092 3933 3296 3046 779 764 221 148 136 13860 ----
NM_030625chr1042298 955 180 137 ------
NM_030627chr523662 2541 1397 1863 --
NM_030647chr785967 5433 5145 4411 3971 1884 1506 1040 1178 ----
NM_030648chr475624 4785 3467 1231 434 245 70 25305 4029 --180
NM_030650chr294266 3620 3302 3057 1374 664 462 314 242 ------
NM_030664chr1032307 1960 167 22114 1892 1940 --
NM_030786chr121458 289 1586 ----
NM_030806chr187713 7574 7257 6612 5735 3339 1923 371 37084 6375 708 37683 7429 3347 --
NM_030810chr631526 1502 1394 11266 ----
NM_030885chr341619 947 714 179 11942 ----
NM_030918chr185061 3971 3895 3729 1633 1428 1118 964 --13428 --
NM_030920chr141924 1730 1668 393 ------
NM_030945chr572593 2287 2154 2125 1889 1763 161 22184 990 ----
NM_030953chr531288 317 98 21573 1225 ----
NM_031362chr232423 2139 2104 22702 1990 ----
NM_031365chr252559 2275 2240 1812 78 22838 2126 ----
NM_031366chr252559 2275 2240 1812 78 22838 2126 ----
NM_031469chr663945 1468 1341 1071 884 666 22621 1582 ----
NM_031483chr2083004 2780 2769 1162 1011 832 623 90 --11283 --
NM_031844chr163748 3439 2672 1214 1155 541 22930 413 11272 --
NM_031845chr243171 2607 990 235 12826 ----
NM_031847chr243171 2607 990 235 12826 ----
NM_031911chr452392 527 389 257 119 12434 ----
NM_032012chr964699 4683 4389 1513 598 48 33996 1360 993 15239 --
NM_032041chr832566 1063 822 ----1871
NM_032047chr322441 1529 ------
NM_032121chrX62852 2546 2201 2052 1741 423 11989 --12804
NM_032160chr1843797 3688 1718 682 1828 13274 --
NM_032199chr1063188 3024 2996 1369 501 340 --1175 --
NM_032208chr262218 1059 836 816 492 205 1148 13640 23457 3007
NM_032256chr12238 25 1400 --1811
NM_032369chr123552 280 153 2599 578 ----
NM_032373chr1021565 1435 35472 4240 100 ----
NM_032439chr1021471 393 3592 521 131 ----
NM_032458chrX83115 3024 2406 2125 1060 978 925 832 12324 --12151
NM_032505chr332127 392 195 --11963 1301
NM_032560chr141753 2880 328 ----
NM_032581chr751198 467 278 49 27 ------
NM_032638chr311026 --1257 2610 300
NM_032682chr342871 2686 1214 1149 11060 2436 132 --
NM_032804chr1042507 2070 916 151 ------
NM_032828chr19124900 4076 1715 1358 1351 1273 1257 1014 885 800 728 558 ------
NM_032837chr1761721 1475 809 668 69 37 1555 ----
NM_032859chr1323337 2815 22672 1116 --1388
NM_032866chr1562688 2655 963 594 578 109 22045 288 --33021 2251 1999
NM_032873chr1163647 3632 1532 649 402 98 14103 11540 11273
NM_032876chr1432128 2020 1832 ----1660
NM_032900chr1073660 3541 2544 2508 1397 1103 916 13218 ----
NM_032968chrX73892 2817 1518 992 880 679 429 12845 ----
NM_032969chrX73892 2817 1518 992 880 679 429 12845 ----
NM_032973chrY73884 2839 2812 1518 992 880 679 ------
NM_032975chr1843240 584 453 118 32853 2753 564 12422 --
NM_032980chr1843240 584 453 118 32853 2753 564 12422 --
NM_032983chr753220 3123 3091 2828 361 ------
NM_033121chr1261576 1507 1335 1134 352 115 21278 1243 ----
NM_033132chr1332131 736 71 1232 1816 --
NM_033135chr112788 637 52070 1860 1595 314 87 ----
NM_033181chr662571 2503 2491 893 647 342 13727 ----
NM_033211chr532046 1948 1775 11956 ----
NM_033224chr7117350 7190 6671 5167 4918 3013 2567 1791 1683 378 212 43127 1275 1135 1019 1177 --
NM_033281chr5131 ----1773
NM_033285chr843818 1672 1586 1515 195 --1106
NM_033290chrX53262 3171 345 328 267 ------
NM_033331chr933204 1340 999 33617 2328 1047 ----
NM_033360chr1293867 3490 3016 2829 2819 1812 1546 1439 1263 21755 875 ----
NM_033425chr1122754 266 13362 11174 13465
NM_033427chr73777 722 60 1165 ----
NM_033428chr941705 1644 1592 498 1778 ----
NM_033632chr461535 1512 1370 1237 387 135 11477 ----
NM_033637chr1064106 3347 3085 1377 842 204 198 ----
NM_033656chr2154284 2266 1473 1101 415 25790 5544 ----
NM_052832chr863045 2894 2266 450 423 75 13013 ----
NM_052885chr1233647 339 103 1158 24475 3326 --
NM_052918chr1031483 364 327 23487 262 ----
NM_053016chr988028 7974 7265 6849 6675 2193 668 174 12889 37368 5056 2157 --
NM_080654chr1131208 844 228 1901 ----
NM_080669chr1793746 3653 3530 1377 791 698 391 293 206 34996 4757 1778 13124 --
NM_080676chr2053254 2391 1259 531 277 12051 1955 --
NM_080759chr1342664 1999 611 273 22386 1839 ----
NM_080760chr1342664 1999 611 273 22386 1839 ----
NM_080821chr2032244 1778 506 --2797 777 1941
NM_080836chr2054630 4171 4160 1049 133 24291 3328 14050 11867
NM_080874chr451733 1632 1597 1340 1251 ------
NM_080927chr343372 2795 2390 806 ----12380
NM_080928chr71837 1274 --1303
NM_130391chr912571 32807 2720 112 --12971
NM_130392chr912571 32807 2720 112 --12971
NM_130393chr912571 32807 2720 112 --12971
NM_130439chr102909 63 --1755 11634
NM_130439chr102909 63 --1755 11634
NM_133170chr2068054 3142 2261 1586 1047 476 35660 602 240 11814 17338
NM_133264chr1763916 3818 1472 1421 1112 1019 13869 ----
NM_133334chr485699 4993 4734 4436 3949 3933 174 148 21637 76 ----
NM_133367chr61582 13477 --1555
NM_133493chr644359 4059 3470 1701 24014 407 ----
NM_138444chr1374617 4475 4416 4177 3744 3311 3147 14875 ----
NM_138468chr265730 5041 4983 2444 1616 392 15536 ----
NM_138555chr151479 1525 --1180
NM_138559chr21452 ----11044
NM_138576chr1464241 1874 1822 1481 853 641 23793 3379 ----
NM_138621chr254174 3545 3161 1542 1489 --23452 3302 --
NM_138638chr142907 248 12289 ----
NM_138694chr651332 1068 785 528 287 12356 12709 198
NM_138713chr1658197 7654 2643 2137 1558 26174 1666 17891 --
NM_138714chr1658197 7654 2643 2137 1558 26174 1666 17891 --
NM_138731chr1444042 2859 1473 1279 12583 ----
NM_138970chr1422275 544 1123 12104 --
NM_138971chr1143510 2701 2378 1142 1657 ----
NM_138971chr1143510 2701 2378 1142 1657 ----
NM_138972chr1143510 2701 2378 1142 1657 ----
NM_138972chr1143510 2701 2378 1142 1657 ----
NM_138973chr1143510 2701 2378 1142 1657 ----
NM_138973chr1143510 2701 2378 1142 1657 ----
NM_139076chr42374 143 11230 --11058
NM_139136chr1221060 284 ----11073
NM_139207chr124453 298 73 56 --130 1487
NM_139312chr1021230 1120 11471 ----
NM_144571chr476894 5838 5280 1958 1519 697 626 1263 16129 14861
NM_144578chr1464190 3520 1447 423 140 116 21351 185 ----
NM_144778chr1331904 516 147 22757 2110 11727 --
NM_144973chr1261878 1608 1221 1152 384 126 11552 24486 1561 1911
NM_145011chr1041422 711 457 113 148 ----
NM_145176chr651258 1022 984 884 723 33179 2836 1177 2482 145 --
NM_145203chr131710 3872 674 112 ----
NM_145259chr266192 5371 5233 1834 1524 150 11159 25985 2161 14625
NM_145307chr1044131 1768 1509 235 13314 ----
NM_145686chr253345 3040 1214 593 108 11058 --1101
NM_145687chr253345 3040 1214 593 108 11058 --1101
NM_145698chr1062161 2138 1980 660 568 176 ----11999
NM_145733chr2241100 1010 218 103 21232 1052 ----
NM_145893chr1651746 1493 1283 641 105 1658 ----
NM_147150chr983508 2424 879 651 626 588 355 65 21162 820 ----
NM_147181chr4--11111 --11073
NM_147182chr4--11111 --11073
NM_147183chr4--11111 --11073
NM_148170chr1115161 32077 250 36 --14241
NM_148898chr71754 31010 66 55 1125 --
NM_148899chr71754 31010 66 55 1125 --
NM_152253chr2284068 3477 3269 3119 2981 854 366 57 --42751 2637 1066 875 --
NM_152263chr185422 5165 4752 4441 3985 2213 1673 1219 15710 13856 --
NM_152277chr51342 1280 --1255
NM_152280chr152768 2431 2347 1217 303 13295 --21257 1222
NM_152388chr273629 3558 3207 2970 2552 1123 570 13679 ----
NM_152407chr543272 2053 811 760 11987 ----
NM_152409chr543255 2852 2700 326 13615 ----
NM_152470chr1842677 2626 1121 1067 24013 3824 21363 558 --
NM_152529chr254113 1771 1647 1285 686 1839 33614 1078 95 --
NM_152622chr512580 ----13371
NM_152624chr576168 6101 5571 5118 2145 727 186 14580 14565 26752 1189
NM_152744chr7113552 3497 3396 3319 3162 2773 2634 2474 1326 712 40 ----171
NM_152756chr543363 592 564 178 --12992 --
NM_152787chrX32607 1215 479 1660 13446 --
NM_152789chr731458 1382 219 ------
NM_152793chr744445 4293 1681 1149 1152 11136 --
NM_152914chr17104357 4037 3589 3444 3318 3175 3060 2995 2894 995 --14012 --
NM_152924chr1556391 5958 5640 4619 2362 24297 1487 12247 11769
NM_152996chr131628 1575 101 --1281 --
NM_152999chr763733 3502 3341 1850 984 247 33420 3037 1491 ----
NM_153050chr2274569 4197 3702 1931 1659 1273 910 33149 1061 430 ----
NM_153051chr2274569 4197 3702 1931 1659 1273 910 33149 1061 430 ----
NM_153188chr565183 5172 1906 1336 252 135 22025 1960 15358 --
NM_153207chr1273785 3504 3119 3100 480 271 63 ------
NM_153262chr153142 2651 2505 2081 2062 --12883 --
NM_153332chr833017 2172 245 22374 1191 ----
NM_153343chr442008 1665 1488 450 2310 106 12048 --
NM_153371chr133882 528 463 21802 425 ----
NM_153499chr1263092 2479 2109 1115 828 368 --1463 13030
NM_153500chr1263092 2479 2109 1115 828 368 --1463 13030
NM_153619chr1573348 3010 2878 2678 2669 2483 1381 --3994 310 186 --
NM_153645chr2233323 3268 111 13119 ----
NM_153748chr1221060 284 ----11073
NM_153810chr1064765 3898 3527 1308 583 483 34874 4749 475 1225 1305
NM_170706chr164395 2648 1278 788 667 22 33204 3000 1079 13099 --
NM_170719chr135536 333 198 135 66 11373 ----
NM_170731chr1172380 2132 1860 1035 729 204 151 ------
NM_170732chr1172380 2132 1860 1035 729 204 151 ------
NM_170733chr1172380 2132 1860 1035 729 204 151 ------
NM_170734chr1172380 2132 1860 1035 729 204 151 ------
NM_170735chr1172380 2132 1860 1035 729 204 151 ------
NM_171998chrX42407 834 721 419 --1336 --
NM_172058chr841744 1522 577 22 ----1712
NM_172059chr841744 1522 577 22 ----1712
NM_172060chr841744 1522 577 22 ----1712
NM_172071chr176835 5009 4730 2372 2272 2161 1479 ----1948
NM_172159chr33932 788 700 22226 184 ----
NM_172160chr33932 788 700 22226 184 ----
NM_172216chr1272994 2381 2011 1188 1017 730 270 --1365 12932
NM_172226chr1263092 2479 2109 1115 828 368 --1463 13030
NM_173083chr14822 476 432 85 1907 1349 --
NM_173198chr972892 2389 1876 1090 1039 298 166 42656 2210 1833 397 --12234
NM_173200chr972892 2389 1876 1090 1039 298 166 42656 2210 1833 397 --12234
NM_173214chr1658197 7654 2643 2137 1558 26174 1666 17891 --
NM_173353chr12181 --1191 1687
NM_173511chr233406 2733 262 ----12663
NM_173552chr322490 851 12138 ----
NM_173576chr101271 ----12007
NM_173582chr1175353 4293 2117 1845 1494 667 51 15668 ----
NM_173642chr176635 6455 6058 3140 2060 1698 1408 36792 2363 360 49125 6484 6240 3117 --
NM_173667chr531779 1645 311 21939 140 132 --
NM_173694chrX22253 1588 191 ----
NM_173794chrX3190 138 123 1113 ----
NM_173808chr164080 3649 928 834 781 288 13421 ----
NM_173825chr372764 809 702 548 465 159 86 ------
NM_173829chr574829 4630 4524 4332 1646 1596 104 --25320 1398 --
NM_174911chr853450 3371 3178 3164 675 33381 2796 2435 ----
NM_174916chr1532345 966 37 22231 895 1878 126
NM_175610chr1531302 536 512 1467 ----
NM_175623chr1297443 6847 6303 6276 5393 2575 2314 1879 1358 37352 5818 5014 --12025
NM_175624chr1297538 6942 6398 6371 5488 2670 2409 1974 1453 37447 5913 5109 --12120
NM_175625chr1297538 6942 6398 6371 5488 2670 2409 1974 1453 37447 5913 5109 --12120
NM_175634chr83900 214 33 140 ----
NM_175635chr83900 214 33 140 ----
NM_175636chr83900 214 33 140 ----
NM_175736chr12107582 6388 6323 5983 5131 2919 2761 2381 1470 1317 27075 5219 ----
NM_175767chr571709 1503 1364 411 341 238 124 ------
NM_175861chr1245554 3672 1998 1869 45011 1952 1818 93 ----
NM_175873chr52486 344 --11129 --
NM_177438chr1494092 3933 3296 3046 779 764 221 148 136 13860 ----
NM_177937chr931495 629 297 1343 --1503
NM_177966chr361761 1607 1405 715 404 388 ------
NM_178011chr1042983 2824 730 344 22892 2486 22652 1087 --
NM_178037chr1273055 2554 2520 2247 1193 841 263 --1110 --
NM_178038chr1273055 2554 2520 2247 1193 841 263 --1110 --
NM_178140chr542750 2066 1030 1018 1833 --1429
NM_178151chrX106782 5465 4984 4968 3127 2739 2381 1761 583 483 36638 2842 870 12366 21464 226
NM_178152chrX106782 5465 4984 4968 3127 2739 2381 1761 583 483 36638 2842 870 12366 21464 226
NM_178153chrX106782 5465 4984 4968 3127 2739 2381 1761 583 483 36638 2842 870 12366 21464 226
NM_178505chr1052532 2480 1385 1018 198 ----11374
NM_178554chr362355 1291 1198 628 484 366 13009 33132 2763 1168 1684
NM_178832chr101100 ----11206
NM_181339chr14971 797 347 237 ------
NM_181481chr1876779 6271 5497 4459 4272 2113 1154 ------
NM_181482chr1876779 6271 5497 4459 4272 2113 1154 ------
NM_181483chr1876779 6271 5497 4459 4272 2113 1154 ------
NM_181504chr554081 3971 3466 3003 1439 22962 263 ----
NM_181521chr1697106 6927 5904 4773 1714 1571 1542 1433 370 16875 12489 16778
NM_181523chr554081 3971 3466 3003 1439 22962 263 ----
NM_181524chr554081 3971 3466 3003 1439 22962 263 ----
NM_181706chr1142197 2072 519 381 11995 ----
NM_181789chr1542599 611 337 109 53249 2654 2258 1091 557 12453 --
NM_181809chr142722 2695 2578 623 11506 --23890 1167
NM_181838chr521445 300 --122 --
NM_182898chr796481 6173 5983 5269 5227 4587 2091 1660 485 26352 1480 ----
NM_182899chr796481 6173 5983 5269 5227 4587 2091 1660 485 26352 1480 ----
NM_182907chr632060 1806 110 42282 1756 1676 1557 ----
NM_182975chr11205 ----136
NM_183078chr633100 883 551 32867 1324 477 23148 726 --
NM_183393chr33922 786 126 ------
NM_183394chr33922 786 126 ------
NM_194282chr443083 2983 2340 567 22502 920 ----
NM_194286chr12116174 5677 5511 5082 4162 2485 1985 1890 1454 791 502 35666 1878 1672 46043 2035 1737 1686 --
NM_194314chr155199 5044 4293 4036 832 14273 ----
NM_194434chr1865185 4838 4247 4118 1306 556 ------
NM_194435chr62662 115 1833 2569 35 --
NM_198086chr1432128 2020 1832 ----1660
NM_198158chr362885 2719 2407 2356 1097 1021 42294 2119 400 193 ----
NM_198159chr362885 2719 2407 2356 1097 1021 42294 2119 400 193 ----
NM_198177chr362885 2719 2407 2356 1097 1021 42294 2119 400 193 ----
NM_198178chr362885 2719 2407 2356 1097 1021 42294 2119 400 193 ----
NM_198181chr1572153 2035 2023 1857 580 459 407 12333 ----
NM_198281chr463130 3021 2625 2125 543 239 --1614 --
NM_198400chr1542679 2553 1134 382 32028 1051 49 1158 --
NM_198581chr2126489 5544 4917 4657 2780 2609 2446 2224 2156 1645 1271 1170 56290 5944 5622 1995 262 14597 16897
NM_198700chr11--1446 1495 1351
NM_198715chr176104 6028 5751 5484 3998 2522 2489 14450 ----
NM_198793chr353544 1006 709 357 280 --13247 --
NM_198859chr314174 13533 11044 23646 1263
NM_198900chr12107582 6388 6323 5983 5131 2919 2761 2381 1470 1317 27075 5219 ----
NM_199000chr721847 1520 21751 586 ----
NM_199355chr1631590 725 674 --1635 --
NM_199436chr252908 2297 2190 2064 88 ------
NM_199454chr141280 1274 1178 438 ----21649 265
NM_199462chr154814 4084 1993 1180 336 11329 13877 --
NM_199482chr21297 21575 284 ----
NM_201432chr17116186 5956 5242 4967 4883 4650 2601 2308 1546 469 203 24461 1721 24197 153 --
NM_201433chr17116186 5956 5242 4967 4883 4650 2601 2308 1546 469 203 24461 1721 24197 153 --
NM_203394chr1242205 2105 611 559 1524 ----
NM_203406chr512014 1905 --1483
NM_203458chr131155 384 183 11518 ----
NM_203459chr142295 1957 612 138 ------
NM_203487chr132724 557 191 --11349
NM_205768chr11540 ----21987 1854
NM_205860chr152733 2379 2211 594 232 12804 12993 --
NM_206853chr663642 3620 3479 1611 1381 306 12747 ----
NM_206854chr674903 4881 4740 3464 1567 1074 79 24008 47 ----
NM_206855chr675868 5846 5705 4429 2532 2039 1044 24973 1012 ----
NM_206907chr542516 571 477 98 22722 58 22746 2560 --
NM_206909chr878310 8086 7125 5117 2871 2403 1477 15919 17201 --
NM_207012chr1063319 3256 2750 2713 2555 2313 --1313 --
NM_207015chr322052 678 1545 ----
NM_207292chr383265 3203 2641 2126 2114 844 604 167 122 ----
NM_207293chr383265 3203 2641 2126 2114 844 604 167 122 ----
NM_207294chr383265 3203 2641 2126 2114 844 604 167 122 ----
NM_207295chr383265 3203 2641 2126 2114 844 604 167 122 ----
NM_207296chr383265 3203 2641 2126 2114 844 604 167 122 ----
NM_207297chr383290 3228 2666 2151 2139 869 629 192 147 ----
NM_207304chr1331791 403 34 22644 1997 11614 --
NM_207371chr10--11236 --11428
NM_207372chr1042272 2163 2099 920 22082 1521 ----
NM_207396chr151658 1302 1226 472 168 ----11777
NM_207405chr431967 769 446 --32215 2183 873 12036
NM_207406chr494731 4709 4402 4315 3956 2175 1872 1307 557 24560 2441 --1935
NM_212460chr732032 734 587 1134 ----
NM_212467chr152939 581 21957 256 --1645
NM_213589chr274888 3738 2171 1744 1503 1004 901 149 13403 --
NM_213651chr131612 1539 46 ------