TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-324-3p
miRNA Sequence: ACUGCCCCAGGUGCUGCUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr641550 1312 1012 605 11079 11208 --
NM_000248chr3----12005 --
NM_000555chrX25368 2870 --33111 1817 239 --
NM_000612chr1153509 2981 2735 2614 2375 12719 22860 2475 --
NM_000615chr11----12152 1637
NM_001003686chr7------1127
NM_001003794chr333058 2537 1987 2497 57 1610 12790
NM_001004317chr61540 --23202 2960 24366 1207
NM_001007466chr624697 1508 1640 14588 --
NM_001008220chr53811 582 425 --12957 23479 2873
NM_001008701chr1982351 1235 760 696 568 555 372 56 --21095 382 --
NM_001012393chr1143904 3764 3577 199 --1190 --
NM_001013693chr192563 2399 1848 1067 978 806 705 366 352 --62028 1172 1113 1092 823 185 --
NM_001024858chr1462512 2237 787 513 331 51 22027 1085 22784 271 12001
NM_001031679chr1251420 1315 588 385 105 11404 ----
NM_001031732chr423418 3289 ----1234
NM_001031804chr16------11636
NM_001039618chr1165253 4226 3833 1766 1716 729 ----11375
NM_001040709chr182375 2250 2045 1981 1590 770 162 136 --1325 --
NM_001042599chr236693 5350 2477 45290 5000 4769 3069 ----
NM_001206chr93975 357 332 1939 --1376
NM_001356chrX----11944 --
NM_001387chr522977 2645 --1435 128
NM_001408chr141640 1420 537 160 ----1636
NM_001416chr17----1184 --
NM_001701chr9----1486 --
NM_001830chrX63749 3026 1502 637 405 254 ------
NM_002025chrX21497 182 23062 2804 11309 --
NM_002146chr172903 66 ----1304
NM_002293chr12748 722 12035 144 1333
NM_002336chr12----1136 --
NM_002516chr19----1126 --
NM_002698chr1952693 2520 2470 2064 1044 22047 848 32023 2014 29 1682
NM_002941chr3------1577
NM_003108chr252523 2333 2326 2066 1896 25968 4659 2411 406 11935
NM_003131chr652128 1810 1548 564 125 ----11445
NM_003149chr321050 358 11606 ----
NM_003155chr8------1937
NM_003482chr1211873 --41965 1046 944 796 22230 152
NM_003498chr1662590 1974 1938 1860 218 59 --11821 --
NM_003664chr5------1110
NM_004427chr14364 319 122 104 11077 --1193
NM_004514chr1721128 535 --12932 12079
NM_004660chrY----11873 --
NM_004739chr11----1255 --
NM_004768chr1----1899 --
NM_005063chr1033477 691 449 --11514 --
NM_005065chr1424777 866 --11530 --
NM_005076chr133509 891 705 21541 1062 23327 3127 --
NM_005312chr972522 2421 477 214 145 48 38 1495 12533 --
NM_005596chr935786 5001 3880 11392 ----
NM_005598chr1------11297
NM_005602chr3----1879 --
NM_005668chr523795 1777 11731 13627 --
NM_005920chr153435 2995 1014 958 815 1797 53721 3643 2981 1533 1511 --
NM_005937chr17104138 3331 1442 1030 1009 953 851 841 651 533 21300 476 23627 584 --
NM_005938chrX1242 ------
NM_006047chr20--128 --12552
NM_006141chr161226 --1107 1777
NM_006212chr144795 1028 393 218 ----14154
NM_006244chr112555 506 ----1609
NM_006247chr19----1160 2167 74
NM_006252chr165933 5757 2835 1716 1133 125 22363 1293 ----
NM_006282chr2023476 1853 1493 --1950
NM_006546chr1794961 4764 4719 4674 4174 2467 1313 1076 849 145 26560 2595 11981
NM_006662chr16----1151 --
NM_006690chr2022252 1680 12242 2165 71 1882
NM_006814chr203734 639 96 ----1937
NM_006885chr1633893 3882 3373 1624 ----
NM_006888chr14----12728 --
NM_006988chr21----1973 1141
NM_007006chr162926 691 --12865 --
NM_007011chr1546325 4975 4900 124 45436 4865 4807 4687 46425 6407 5010 4893 --
NM_007249chr1328056 6266 --28157 712 --
NM_007278chr171163 --1366 --
NM_012193chr1144974 4860 3975 1499 ----13398
NM_012199chr124087 3722 13841 2272 102 --
NM_012297chr411631 ------
NM_012316chr134527 3849 72 25495 4981 --22224 297
NM_012395chr712391 --11296 12941
NM_013411chr1--176 --1258
NM_014345chr61432 ----1868
NM_014683chr17------12044
NM_014730chr1274905 4569 4276 4204 3923 3698 3672 --21983 1011 1485
NM_014731chr2041383 1181 244 230 1509 11650 --
NM_014747chr195806 4750 4154 1903 1731 1651 980 857 357 --35462 4564 1666 1400
NM_014770chr1261272 942 844 529 417 387 21124 61 2936 824 1345
NM_014828chr1411774 ----12130
NM_014877chr1716605 --1492 25924 1118
NM_014891chr71309 --1194 --
NM_014935chr183428 3173 3078 2985 1315 1073 719 705 --12427 11082
NM_014952chr1551440 793 339 139 58 11391 51674 1337 787 327 52 --
NM_015009chr3------151
NM_015020chr1653587 1259 1073 644 550 12808 149 --
NM_015044chr161755 1702 12176 1482
NM_015094chr2283806 3795 3742 3651 3405 2924 335 86 22915 1103 14227 13961
NM_015124chr22--12280 11855 22010 262
NM_015192chr20----12342 --
NM_015205chr1311798 ----12020
NM_015270chr123916 365 88 --52092 1849 1468 828 232 --
NM_015299chr1463163 2979 1350 603 342 333 --12554 --
NM_015315chr522257 179 13073 32761 2370 41 --
NM_015393chr423734 2362 12660 --1627
NM_015508chr3--1506 ----
NM_015609chr132909 575 327 --22301 685 12396
NM_015645chr11------1122
NM_015649chr19------1148
NM_015686chrX52273 2162 1617 637 380 --31952 627 109 12495
NM_015872chr12512 96 --41534 1429 670 635 1177
NM_015981chr543165 2683 2069 748 21137 449 33144 2001 927 --
NM_016436chr204437 394 41 28 ------
NM_017551chr1052234 557 342 334 169 2849 818 1885 --
NM_017590chr2252518 2059 1035 431 81 1455 12479 --
NM_017600chr12194 ------
NM_017628chr413438 14016 14702 --
NM_017728chr1752980 2849 2545 327 201 --32690 2595 102 32743 2497 2076
NM_017742chr18--1539 --11617
NM_017848chrX21823 1567 23288 696 23492 3456 --
NM_018013chr6--11151 ----
NM_018014chr22550 524 ----1999
NM_018205chr1022300 1642 --22233 103 2897 35
NM_018240chr14366 306 77 22 ----137
NM_018416chr1252589 2164 2081 1742 1731 ------
NM_018444chr811691 2878 52 ----
NM_018534chr21552 ------
NM_018945chr61252 22830 54 --1648
NM_019084chr1021629 1041 12203 ----
NM_019116chr1613287 ----23257 3239
NM_020418chr34494 478 380 219 --3527 178 27 --
NM_020699chr154725 3981 3712 1196 609 --23969 3685 1564
NM_020772chr1747420 3292 2753 1533 --1668 11248
NM_022157chr1------1130
NM_022465chr1232380 2224 1940 11990 1393 --
NM_022491chr1212308 23389 2325 --1492
NM_024046chr34402 193 131 37 --126 1985
NM_025146chr322424 1723 1335 1603 --
NM_025222chr361843 720 709 640 419 39 22308 2057 12734 --
NM_030647chr7--21934 216 15716 11485
NM_030648chr445281 4467 3865 2175 ------
NM_030918chr125158 4489 13789 --14304
NM_032457chr431453 1150 57 ------
NM_032580chr174496 113 106 61 --123 2420 42
NM_032765chr5121 ------
NM_033083chr322576 411 ----12621
NM_033133chr1733034 1397 212 1675 1428 --
NM_033315chr1731708 84 49 1562 21673 73 21968 1475
NM_033389chr1723015 1594 --152 11906
NM_033656chr2125552 1099 25670 5105 --1226
NM_052896chr132111 792 644 12192 2891 68 --
NM_138357chr10----11286 197
NM_138959chr156548 2481 1907 848 484 11341 16470 16167
NM_145166chr352929 1121 871 351 162 1814 3913 907 649 1848
NM_145257chr123133 1158 1191 --11215
NM_152253chr2233385 1522 215 24095 3070 23589 1449 --
NM_152622chr5----1529 --
NM_152756chr512639 ----13893
NM_153487chr653971 3938 1725 1375 738 --21078 101 24194 458
NM_173595chr1275096 5043 5025 4849 4839 3706 1732 34088 3845 799 31328 1117 519 25057 115
NM_175709chr2282923 2343 1173 1133 876 525 240 225 --42773 498 485 81 --
NM_175736chr1256755 2465 2278 1248 977 22601 596 12568 --
NM_177963chr1141566 1357 670 344 --32044 1336 512 --
NM_182580chr152477 2145 1995 1882 1697 11602 22325 607 --
NM_182970chr2053633 2943 2863 1156 77 11041 33368 1478 468 --
NM_198081chr612574 1607 --12464
NM_198560chr373645 2944 2538 2316 1318 1179 695 11010 42888 2675 2370 1530 12824
NM_199262chr175780 732 376 152 40 12192 32335 1954 1860 --