TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-324-5p
miRNA Sequence: CGCAUCCCCUAGGGCAUUGGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr666675 2250 1461 1324 1038 828 ----2396 372
NM_000337chr546293 4357 1985 1606 --14907 11814
NM_000399chr101368 1832 --1806
NM_000859chr5------1458
NM_000875chr1576717 6555 5046 4711 2554 1452 55 26728 5255 34537 4337 175 --
NM_000919chr5----1567 --
NM_001001664chr2----1969 --
NM_001001995chrX1658 21907 1248 --1142
NM_001003674chr182247 241 36408 5161 4630 1276 --
NM_001005609chrX103687 3649 2701 2625 2494 1493 1153 1014 439 381 13148 --13800
NM_001008564chr1311637 ------
NM_001011708chr212058 --1441 --
NM_001024226chr11832 ----1287
NM_001030055chr1423452 3112 --1513 13369
NM_001032393chrX----179 --
NM_001037631chr21174 --1236 21073 296
NM_001039762chr10------1230
NM_001106chr377530 6397 3903 3427 2225 1963 610 47324 6565 818 272 16386 --
NM_001121chr10------1107
NM_001938chr121608 1279 --2415 128 --
NM_002054chr2----156 --
NM_002687chr1421295 86 --1400 --
NM_002858chr1------1309
NM_003406chr8----1232 --
NM_003410chrX12807 --12961 1998
NM_003558chr9----1181 --
NM_003779chr1----191 --
NM_004073chr1----1265 --
NM_004171chr1158369 6954 1658 321 243 --23575 1610 --
NM_004238chr2----1302 --
NM_004586chrX65064 4419 3599 3555 2126 373 ----15026
NM_004630chr11----11178 --
NM_004902chr20------1313
NM_004921chr1------136
NM_005257chr18----11097 --
NM_005399chr11138 ----11683
NM_005400chr223060 816 12981 12487 146
NM_005520chr5--1307 ----
NM_005789chr1731852 1411 271 ----21705 1368
NM_006016chr61136 2743 126 ----
NM_006313chr1231174 343 311 ------
NM_006612chr171521 ------
NM_006930chr5----11397 --
NM_007146chr17----1918 --
NM_007236chr15----1620 --
NM_012164chr965710 5642 5158 4709 165 36 2265 59 16796 11697
NM_012259chr6------11122
NM_012399chr2211589 ----1604
NM_013231chr1453523 3274 1571 1441 1233 ------
NM_014368chr9----1493 --
NM_014488chr11------1543
NM_014689chr2----1576 --
NM_014901chr511765 --1834 1724
NM_014988chr411918 ------
NM_014994chr15----1708 --
NM_015001chr1----1659 --
NM_015288chr583448 3055 2562 2536 2452 1524 1371 1071 --12470 1549
NM_015328chr7----1654 --
NM_016021chr621966 603 12355 --1836
NM_016061chr211333 ------
NM_016588chr6----1805 --
NM_017423chr4----11712 --
NM_017434chr151181 ------
NM_017637chr959160 8573 6122 2280 91 13227 37533 7086 845 19392
NM_017902chr1085171 4936 2107 1808 1760 1724 1714 590 --14437 2897 840
NM_017922chr14------172
NM_017944chr111361 1707 1228 22555 1906
NM_018254chr12422 148 --12032 --
NM_020791chr17----1173 --
NM_020988chr16----1930 --
NM_021252chr10----1477 --
NM_021813chr645038 1923 1145 1041 --15129 13729
NM_021964chr3----14114 16382
NM_022041chr16------22495 2412
NM_023012chr12----1501 1767
NM_024529chr1----1442 --
NM_025076chr21153 ----151
NM_031492chr11----189 --
NM_032457chr433743 3323 2429 ------
NM_033225chr8----1598 --
NM_053023chr11----12541 12053
NM_058172chr4----11482 --
NM_133468chr72767 722 --12528 --
NM_139177chr17----11629 --
NM_144578chr1434830 217 160 ------
NM_144726chr511009 11212 11176 --
NM_152622chr51927 32922 1306 439 ----
NM_152695chrX12014 11820 1515 --
NM_152774chr71430 12034 22380 2347 --
NM_153685chr12------11209
NM_153689chr2------181
NM_153810chr1073929 3324 2015 895 715 206 130 --11371 --
NM_173468chr456016 5396 3964 945 709 ------
NM_173822chr2----12081 --
NM_178539chr121399 ------
NM_178565chr8----11728 --
NM_181521chr1656505 5500 5263 5242 4904 12769 1931 14925
NM_194285chr1143222 2845 594 537 --11097 --
NM_198859chr323381 94 13571 --11829
NM_199423chr16------1472