TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-325
miRNA Sequence: CCUAGUAGGUGUCCAGUAAGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr1------11617
NM_000084chrX106685 6506 6037 5663 5646 2250 2207 1538 998 560 22564 418 12655 --
NM_000092chr224048 1418 13776 1810 14332
NM_000202chrX73548 3042 2571 1216 1008 865 785 --32701 2659 2575 --
NM_000212chr1732347 2300 2040 ----22481 591
NM_000214chr2021339 1215 --11429 --
NM_000276chrX21543 576 --12204 1685
NM_000289chr123349 340 252 ----1257
NM_000314chr1031204 997 395 1685 ----
NM_000332chr686305 5340 4864 4574 4428 2461 1108 743 ----16672
NM_000337chr536200 6155 692 182 36447 5888 2157 --
NM_000378chr114991 449 418 281 11181 ----
NM_000430chr1743797 2587 410 357 ----1798
NM_000480chr1131498 1194 1090 ------
NM_000489chrX63439 3260 2246 748 606 130 21239 1227 ----
NM_000533chrX2627 480 ----1226
NM_000627chr21312 --1653 --
NM_000868chrX22622 2180 ------
NM_000875chr1575994 5806 2707 2304 2069 1825 1275 24281 1379 ----
NM_000877chr232962 1873 345 ----12387
NM_000933chr202436 216 ----1457
NM_000944chr471978 1905 1898 1882 1513 323 281 22264 375 ----
NM_000950chrX53608 2498 1109 598 190 ------
NM_001001481chr862759 921 620 442 205 41 --1900 --
NM_001001586chr12546 64 ------
NM_001001664chr234140 3761 3396 --12631 --
NM_001002814chr873766 3660 2373 1486 1127 828 647 --12735 1698
NM_001002909chr171178 ------
NM_001003681chr221584 ----11996
NM_001003688chr41894 ----21199 316
NM_001003698chr641881 1303 1275 1241 --11307 --
NM_001004317chr683482 3190 3139 2998 1090 965 786 110 14191 ----
NM_001005386chr242082 751 400 355 11721 21835 316 --
NM_001005463chr104805 774 692 163 11608 --1724
NM_001006600chr541694 1550 798 630 --1750 --
NM_001006623chr22426 405 22482 594 ----
NM_001007097chr954709 4343 4329 4059 3164 ----1354
NM_001007214chr121862 209 11381 --1152
NM_001007246chr2151944 1266 603 497 467 1343 ----
NM_001007466chr644771 1368 436 346 15051 24775 397 --
NM_001007559chr18----136 1640
NM_001008239chr1853055 2758 1217 1186 640 1250 12512 --
NM_001008564chr1332243 1530 289 1386 ----
NM_001008925chr473307 2819 2158 978 693 297 104 1201 ----
NM_001009881chr11242 ------
NM_001009959chr25945 939 924 856 503 22477 1049 ----
NM_001010888chrX63346 3025 1702 1392 954 158 23155 1781 23777 229 --
NM_001010971chr11807 ------
NM_001010986chrX32218 766 523 ----1673
NM_001011538chr41949 ----1306
NM_001011553chr72703 31 1885 ----
NM_001012732chr42357 95 ------
NM_001012755chrX44215 3617 1841 852 --21927 719 11587
NM_001014809chr42382 163 ------
NM_001015882chr92856 247 1305 ----
NM_001017395chr333587 3436 654 --13020 13467
NM_001017923chr1441584 1241 517 109 ------
NM_001024226chr1------11177
NM_001024372chr832248 1448 219 --12257 --
NM_001024647chr12107433 7355 6842 5831 5251 4945 4925 531 512 217 11284 ----
NM_001024855chr321674 1310 21665 237 ----
NM_001024858chr1412995 ------
NM_001024948chr123245 984 11364 --12313
NM_001025108chr233771 660 73 33560 3524 600 ----
NM_001025580chrX53556 3345 3189 1293 842 22696 1221 11679 --
NM_001025780chr921249 618 1321 124 --
NM_001029858chr643113 2125 721 90 ----12922
NM_001029884chr632601 727 548 ----1776
NM_001030007chr1642989 1591 1047 401 --1539 --
NM_001030272chr113439 156 50 2469 81 ----
NM_001031695chr2265269 5151 3654 1661 1631 70 23341 1026 ----
NM_001033566chr171762 ----174
NM_001037172chr32329 81 11259 --11221
NM_001039590chrX43429 3176 1007 613 --11223 --
NM_001040057chr761309 1294 1270 1011 250 84 ------
NM_001040108chr1433128 2286 535 12328 ----
NM_001040202chr462595 2329 2169 2068 1876 195 --12187 --
NM_001040214chr652371 2121 1950 879 638 ----1898
NM_001040429chr1332752 480 217 12539 ----
NM_001042355chr16105189 3812 3675 3471 3395 1913 1469 1370 907 761 23346 473 ----
NM_001042473chr1011752 --1224 134
NM_001042601chr372810 1059 864 846 807 263 185 11085 12109 --
NM_001121chr102639 215 ----11580
NM_001146chr83578 468 291 --21665 1471 1296
NM_001149chr1031250 1185 395 ------
NM_001206chr933049 2515 1024 ----12547
NM_001304chr1763840 1057 940 692 451 333 ------
NM_001351chr341628 1421 713 71 1131 ----
NM_001356chrX42431 2419 984 811 --11781 --
NM_001461chr1------1416
NM_001482chr153660 217 150 --1185 --
NM_001616chr263393 3073 2293 1134 371 53 32752 2458 2161 ----
NM_001656chr561933 1853 1804 1609 1267 297 11903 ----
NM_001668chr1----1602 --
NM_001792chr1811034 --199 --
NM_001893chr17170 ------
NM_001931chr1111297 1933 ----
NM_001939chrX42670 1401 561 536 12746 ----
NM_001946chr121720 1128 ----
NM_001949chr663099 3071 2498 2332 933 456 ----12034
NM_001955chr6----1747 --
NM_001957chr442237 2206 1999 299 ------
NM_001980chr1232001 1704 836 --12295 --
NM_002006chr4105647 5575 5073 5037 4902 4835 4731 4709 3609 1060 15060 25607 1630 --
NM_002025chrX98401 7642 7171 5735 3183 3136 3043 2125 1523 26607 6340 16978 --
NM_002061chr141816 1341 717 503 1439 ----
NM_002126chr1762920 1382 769 683 636 629 33375 608 287 ----
NM_002128chr1321889 463 1759 ----
NM_002137chr71812 --1401 --
NM_002139chrX2243 85 ------
NM_002158chr233542 2768 2389 12995 --1669
NM_002214chr785578 4932 4870 4456 1461 779 732 206 12085 ----
NM_002264chr364855 3886 3822 1655 1448 698 --11242 14038
NM_002270chr525021 2116 --34340 1248 148 --
NM_002310chr5136488 6042 6029 5345 4685 4646 4450 4381 2557 2318 916 900 601 --21647 52 --
NM_002515chr1452025 1752 750 365 338 ------
NM_002613chr1665052 4826 3839 3579 3261 1614 ------
NM_002670chr331570 1214 151 1278 ----
NM_002718chr322215 965 3907 875 517 1579 --
NM_002731chr123111 2150 2805 220 ----
NM_002740chr332768 708 166 12221 2452 190 --
NM_002748chr15164 ------
NM_002811chr16--1100 --169
NM_002822chr1241393 474 331 29 11265 ----
NM_002836chr201129 --1137 --
NM_002869chr1131536 1511 420 1762 1158 --
NM_002874chr932121 1547 614 22489 312 ----
NM_002938chr411864 --22000 674 --
NM_002968chr1631063 808 188 --1320 --
NM_003045chr1334691 4504 4404 14814 ----
NM_003095chr12----1299 --
NM_003139chr11----1907 --
NM_003161chr1793519 3012 2747 2683 2576 2447 2210 1123 806 ------
NM_003202chr551906 1511 750 529 78 ------
NM_003205chr1512029 11835 1528 --
NM_003211chr122198 93 ------
NM_003221chr653792 3626 881 815 109 ------
NM_003234chr311638 ----1133
NM_003269chr621202 1195 ------
NM_003337chr511630 11078 1610 --
NM_003350chr81762 ------
NM_003430chr192421 253 4528 360 276 192 ----
NM_003463chr662850 2095 2080 1021 777 66 ----125
NM_003468chr244047 3318 1614 1471 ----11549
NM_003483chr1222523 305 ------
NM_003489chr2173245 1032 732 347 285 198 138 33352 3255 2404 ----
NM_003558chr93684 553 496 ------
NM_003566chr1273279 3070 2341 2223 2183 552 81 1111 ----
NM_003574chr1865079 3902 2158 1625 1253 1006 1643 --1193
NM_003615chr332527 1277 879 --23928 1484 --
NM_003620chr172833 749 ----1330
NM_003655chr172761 726 ----1731
NM_003778chr3----1682 --
NM_003895chr2132003 1862 1688 12074 --11514
NM_003927chr182691 177 1821 --1289
NM_003932chr2241703 1496 392 303 --1215 --
NM_003941chr731782 1722 580 ----11703
NM_003955chr17----11517 --
NM_004080chr731476 304 135 ----1161
NM_004086chr143501 290 111 192 1814 --
NM_004124chr1483576 3031 2685 2617 2542 2471 374 293 43073 368 327 52 13520 --
NM_004162chr32982 372 --11248 --
NM_004171chr11118562 6912 6367 5988 3800 2988 1814 1803 1442 1073 453 29606 7526 23659 2532 19466
NM_004242chr6----1106 --
NM_004272chr51306 11554 ----
NM_004274chr1453222 2081 1031 666 566 11246 ----
NM_004319chr163088 3055 2220 1066 1009 351 12817 13211 --
NM_004331chr872507 2249 1946 1927 706 311 180 ------
NM_004389chr22608 165 2787 758 ----
NM_004392chr1322194 1789 21656 862 11686 --
NM_004397chr1122784 1497 ----12624
NM_004411chr71700 ------
NM_004458chrX32213 1980 1738 ------
NM_004459chr1741531 1455 569 231 11434 ----
NM_004504chr252651 848 782 773 366 123 --1448
NM_004537chr1211173 ----11178
NM_004578chr12947 760 --1753 1848
NM_004586chrX115353 5146 5120 4972 4347 3704 2131 1598 558 537 419 ------
NM_004642chr12----1505 --
NM_004660chrY62336 2289 864 596 398 333 1884 11713 --
NM_004719chr1262848 2590 1820 1769 886 256 32406 694 283 11923 --
NM_004745chr835665 4994 4784 --24652 2217 12558
NM_004770chr8----1251 --
NM_004775chr1842031 2011 1493 559 1709 12161 --
NM_004788chr115951 466 344 323 129 --22531 2021 --
NM_004831chr192208 197 --1856 --
NM_004834chr253375 3303 839 586 26 1290 12113 --
NM_004841chr121096 1033 ------
NM_004852chr181514194 12577 12115 11304 10831 9738 9340 8912 8790 5313 5064 4861 4803 4378 1048 --24818 2573 --
NM_004890chr17168 ----173
NM_004969chr102601 518 ----1104
NM_004985chr12114224 1809 1574 972 781 686 650 562 396 73 34 13877 1566 --
NM_004992chrX22240 292 --27082 685 16231
NM_005080chr221887 --1919 1241
NM_005126chr352321 760 573 489 409 --11716 --
NM_005156chr965329 4789 3849 3736 1617 753 --13946 --
NM_005188chr11108251 8105 3189 3165 2279 1198 856 801 782 499 --11545 16104
NM_005222chr71850 ------
NM_005233chr362557 2012 1908 488 231 91 12278 --11820
NM_005277chr421629 254 11811 11533 --
NM_005324chr1721858 284 1294 ----
NM_005375chr61224 ------
NM_005392chr921802 1400 ------
NM_005406chr1821112 214 ------
NM_005430chr12----1914 --
NM_005578chr354740 4200 3684 1301 111 2740 65 24846 3823 --
NM_005596chr986003 4352 2575 2232 2160 1983 1777 1137 16403 16373 --
NM_005610chr1----1134 --
NM_005611chr1651295 1198 1152 1033 955 ------
NM_005639chr1231748 1558 1406 11343 11418 --
NM_005665chr1104701 4660 4298 4262 3152 1415 1349 1329 1292 1220 11006 ----
NM_005688chr3--1434 --1454
NM_005746chr722000 591 31791 955 659 12786 --
NM_005748chr1253120 2132 670 573 321 ------
NM_005802chr92521 68 --1230 --
NM_005824chr74590 484 301 199 2293 121 1203 --
NM_005933chr112509 300 --12680 --
NM_005941chr864015 3988 3924 3221 2738 872 13474 ----
NM_006040chr1621018 328 --1270 --
NM_006139chr232914 2777 2592 --12681 --
NM_006141chr1642797 890 749 58 ----12478
NM_006154chr1572594 1124 1093 674 472 372 83 1905 ----
NM_006158chr821392 1385 11689 11253 --
NM_006194chr1411115 11280 ----
NM_006206chr43748 667 529 --12056 --
NM_006224chr171679 ----11729
NM_006364chr142492 116 ------
NM_006380chr1734326 3331 2945 --11668 13336
NM_006415chr92886 297 ------
NM_006451chr551016 853 288 232 119 2780 767 ----
NM_006467chr562362 2019 1576 480 360 162 ------
NM_006547chr722020 783 ------
NM_006577chr221278 1196 ----11172
NM_006599chr1677300 7015 6593 5738 1009 902 683 15189 1914 1347
NM_006614chr362979 2571 2543 999 533 317 --22279 28 --
NM_006626chr9102245 2154 2117 1764 995 888 776 620 413 44 ------
NM_006682chr731797 1079 443 11086 21881 1093 12366
NM_006751chr21423 1882 --1177
NM_006777chrX52920 2166 2041 539 325 --31992 965 513 --
NM_006832chr143971 860 168 ------
NM_006873chr263557 3078 928 920 606 73 42976 1293 752 396 12433 --
NM_006914chr92512 94 --1557 --
NM_006930chr541316 744 307 226 1778 ----
NM_006981chr921177 633 11142 ----
NM_006988chr2151083 503 418 333 285 11271 ----
NM_006996chr121458 746 --11222 --
NM_007011chr1566831 5497 2724 2049 308 199 --15131 --
NM_007030chr534647 4029 3554 14131 24835 4477 --
NM_007047chr622471 281 --32499 2440 983 --
NM_007054chr553835 2530 743 327 223 13754 ----
NM_007106chr1321002 484 1818 12012 --
NM_007107chr341735 1610 732 212 ------
NM_007137chrX85570 5101 4496 4454 1925 784 689 234 ------
NM_007146chr1732868 2278 327 22702 2306 --11993
NM_007175chr883597 3152 3053 2685 1206 899 584 578 12601 ----
NM_007202chr173690 498 260 1250 --1308
NM_007236chr1521915 112 ----12336
NM_007238chr2064892 4881 4846 4162 1601 1204 --11656 24645 439
NM_007249chr13117889 6065 5953 5773 3324 2266 2136 1811 1347 1076 802 11701 ----
NM_007285chr161473 --1102 --
NM_007358chr141665 470 138 83 ------
NM_012090chr131226 296 157 ------
NM_012095chr1053113 2963 2858 2646 2308 --165 --
NM_012129chr742323 1801 1556 1548 22037 212 1151 --
NM_012158chr1371880 1720 1652 1313 1301 696 87 ------
NM_012199chr124000 3537 23180 538 13744 13627
NM_012207chr103790 300 247 --1304 151
NM_012290chr21661 21202 358 ----
NM_012297chr442632 2544 1805 905 ----1722
NM_012300chr572536 2257 2134 1826 1679 1562 522 --149 --
NM_012309chr1124280 3711 21921 1781 11753 --
NM_012334chr574461 4414 3687 3102 1386 341 227 --14244 13707
NM_012479chr752545 2241 990 654 38 31998 1090 291 11100 --
NM_013231chr1443981 3897 1303 1031 13293 13386 --
NM_013262chr641365 1207 60 50 --1386 --
NM_013281chr2041464 1202 305 79 11043 ----
NM_013309chr1551946 761 488 463 155 ------
NM_013374chr322819 543 33156 2885 365 12865 --
NM_013381chr1232024 943 902 --21710 204 --
NM_013396chr21111477 1371 1337 1283 1160 1091 974 562 475 467 88 1485 ----
NM_013437chr83932 495 183 1419 ----
NM_014016chr321597 186 11144 1421 --
NM_014112chr895075 4494 4068 3855 3842 3734 868 272 85 25334 389 --11417
NM_014240chr364185 4134 4105 3995 3790 3611 --13348 --
NM_014294chr82561 51 --11322 11294
NM_014319chr1221997 1833 ------
NM_014331chr4106891 6138 5719 5405 5175 4868 2796 1461 621 285 47386 5734 3079 1331 26142 5626 --
NM_014393chr832103 499 451 1589 187 12341
NM_014415chr321372 542 21643 1274 1210 --
NM_014458chr131097 455 379 ------
NM_014494chr1642226 2177 1986 497 ------
NM_014500chrX167 ------
NM_014572chr1341764 1607 676 297 --11803 --
NM_014607chr232079 1823 1565 11835 2808 192 2222 70
NM_014616chr343235 2352 736 367 1450 1791 12905
NM_014701chr1562802 2701 2561 1270 1194 861 ----11145
NM_014702chr663311 2183 1360 1294 1048 371 22497 1329 12374 --
NM_014779chr331113 456 319 1130 ----
NM_014810chr163178 3163 2322 1334 1296 693 --1267 --
NM_014820chr3--11440 --11648
NM_014838chr221557 1310 ----
NM_014872chr9------22051 615
NM_014877chr17107769 7248 7142 6782 6609 4985 2776 2344 1711 1035 14787 --26658 143
NM_014893chrY31783 729 39 --12267 --
NM_014932chr32806 89 --11745 11491
NM_014946chr23918 636 436 32882 2823 2420 ----
NM_014961chr441723 1597 832 75 12240 12114 --
NM_014962chr2042172 1836 765 556 --11810 11137
NM_014989chr621746 1558 ----11940
NM_014991chr453163 3071 2311 2061 1013 --11248 --
NM_015020chr1683274 3210 3161 3119 2376 1513 696 554 161 11181 --
NM_015025chr222381 1041 22412 2257 ----
NM_015026chr1284408 4321 3823 3002 1555 943 707 374 23863 418 ----
NM_015052chr71287 --1220 --
NM_015061chr93888 587 277 ------
NM_015076chr644430 3666 3624 541 33166 1306 1095 11472 --
NM_015087chr131843 ------
NM_015092chr1663845 3702 3294 1627 1290 500 43898 3457 3089 2956 --11083
NM_015097chr362299 2278 1964 1603 1551 101 1465 ----
NM_015137chr842503 892 749 529 1151 1854 --
NM_015144chr1611098 ------
NM_015153chr61110 --182 --
NM_015163chr1461971 1902 1394 765 572 390 21978 359 --1484
NM_015176chr121368 1152 --1594 --
NM_015199chr321840 1191 ----22356 711
NM_015215chr142547 2414 2305 420 ------
NM_015236chr441472 343 192 36 ------
NM_015263chr151952 ------
NM_015313chr1143566 3106 1602 1065 34086 4013 3219 --13641
NM_015336chr1252183 1900 767 734 522 21955 1771 ----
NM_015344chr852063 1963 1660 613 380 ----11889
NM_015347chr1272866 2356 988 945 704 387 248 1915 ----
NM_015355chr171497 ------
NM_015429chr33985 874 92 2145 131 ----
NM_015455chr553043 2824 1646 1208 162 --1764 1204
NM_015475chr21390 2777 27 1394 --
NM_015483chr711097 ------
NM_015534chr12934 24 ------
NM_015553chr661702 1495 1341 1074 1049 792 --25155 249 11799
NM_015565chr2161716 1482 685 520 451 248 ------
NM_015569chr184477 4308 4198 3199 892 452 196 127 1649 33983 3897 514 --
NM_015570chr711371 ----11403
NM_015576chr312866 1827 --147
NM_015635chr91141 12019 ----
NM_015850chr842420 2150 2001 518 12372 ----
NM_015878chr811626 --1124 --
NM_015906chr1124840 4540 4528 4473 4349 3313 3288 3223 2963 1841 1054 674 34789 1339 154 14532 --
NM_015915chr142303 293 --1307 --
NM_016009chr1104900 4092 3741 3471 3154 1439 993 908 603 373 ----1296
NM_016018chr822697 1989 22285 1015 11000 --
NM_016021chr662602 2299 2005 1881 1046 361 1493 ----
NM_016040chr141945 681 595 355 --11722 --
NM_016083chr683819 3778 3541 3396 3314 1303 738 471 2879 412 13550 --
NM_016098chr61116 ------
NM_016131chr272334 2242 1946 1848 1742 919 886 --21852 1573 --
NM_016231chr1741504 1430 102 23 1166 ----
NM_016248chr1323795 3070 13124 11173 21413 332
NM_016258chr12583 304 ------
NM_016315chr261766 1475 750 611 452 233 --11770 --
NM_016353chr882384 2306 1694 989 714 398 389 220 ----11699
NM_016357chr122962 299 1193 ----
NM_016436chr2032264 978 589 11755 --12639
NM_016441chr222245 136 ----11579
NM_016472chr1451199 530 412 392 285 ------
NM_016531chr463600 3348 2754 2689 2577 1187 1366 1388 --
NM_016626chr1871591 1513 1143 1128 601 213 158 1569 1195 --
NM_016644chr51390 ------
NM_017415chr573982 3272 2829 1278 582 475 395 1645 --1384
NM_017520chr13----1602 --
NM_017548chr321358 405 1585 11567 1441
NM_017628chr465014 4282 4102 3889 344 267 --24191 2086 13972
NM_017637chr9107974 7499 7172 6981 6382 6333 3117 974 797 720 22799 1126 ----
NM_017658chr1432841 569 281 44214 4019 3009 1179 14120 --
NM_017694chr23802 673 663 ------
NM_017770chr642581 2498 640 31 --1154 --
NM_017810chr164733 709 682 105 ----1114
NM_017812chr71230 ----1633
NM_017848chrX94392 3984 3872 3641 1709 1200 1150 691 662 ----11641
NM_017905chr13------1579
NM_017944chr1142987 2922 1169 893 ----1275
NM_017974chr21968 --1267 --
NM_018084chr253045 924 408 277 252 ----1212
NM_018252chr1------1560
NM_018270chr201674 ------
NM_018293chr32971 122 --11035 --
NM_018362chr1163823 3442 1205 983 230 65 13105 11220 --
NM_018364chr1103764 3189 3153 2858 1520 1137 1008 954 840 226 ------
NM_018373chr1486002 5075 5067 1586 1393 1196 244 63 1364 12464 --
NM_018383chr2----11759 12027
NM_018566chr155017 3586 1085 262 31 11296 13693 --
NM_018584chr1199 ------
NM_018704chr142173 2021 1398 769 ------
NM_018710chr81994 --1189 --
NM_018712chr1141575 1362 602 406 11488 1413 --
NM_018898chr542305 1652 1495 185 ------
NM_018970chr731141 660 441 1737 1648 --
NM_018976chr122433 63 1834 --11085
NM_018979chr1232373 587 534 1821 2437 94 --
NM_018999chr10114801 4320 3935 3901 3516 3462 1668 1472 1139 1068 808 34881 3927 1552 1868 --
NM_019042chr72936 141 --11247 --
NM_019050chr442024 1579 774 156 11785 ----
NM_019063chr242136 2093 782 218 1288 1397 1613
NM_019067chrX64666 4597 3734 3484 1161 277 ------
NM_019114chr931723 333 202 11882 ----
NM_019116chr1623536 1467 ----13701
NM_019593chr20103170 2984 2934 2467 1111 1079 1025 928 818 688 ------
NM_019610chr142082 1760 252 90 12105 --1411
NM_020148chr1863001 2986 2878 2804 2157 725 12714 ----
NM_020177chr562955 2059 689 468 440 334 11283 ----
NM_020337chr422054 2002 11931 --159
NM_020341chr2041612 1578 1405 1295 1531 ----
NM_020342chr242139 636 588 303 12091 12133 --
NM_020357chr311657 --1307 --
NM_020390chr374770 4559 4547 4500 3946 3853 3710 13466 --14218
NM_020403chr133548 420 284 21158 202 ----
NM_020429chr743025 2925 922 898 ----1459
NM_020432chr751963 847 838 776 160 11668 ----
NM_020443chr186440 6204 5278 2537 2202 2187 1339 236 14715 16532 --
NM_020640chr312227 1493 --11721
NM_020649chr17------1206
NM_020676chr32854 829 ------
NM_020734chr1263366 3309 2687 2458 816 535 --1162 --
NM_020748chr1742054 1605 713 63 11706 11609 --
NM_020752chr1082845 2497 1795 1088 785 726 656 452 ----12273
NM_020772chr1797830 7395 7246 5975 5939 5733 5688 5559 3033 25478 1190 --18251
NM_020774chr18116245 5418 5219 4792 4223 4180 2313 2133 1655 1389 751 1118 --11359
NM_020783chr18138 2193 124 ----
NM_020801chr52786 668 11989 1562 --
NM_020830chr263185 2899 2661 2640 2412 2243 23233 3097 --12478
NM_020921chr1442982 2817 1356 936 21015 440 11322 --
NM_021097chr232705 2207 140 ------
NM_021132chr101457 ------
NM_021140chrX51051 768 378 275 38 ------
NM_021148chr732483 2472 1817 22190 72 12476 --
NM_021155chr1961096 934 871 575 388 294 --11058 --
NM_021190chr13543 465 196 1345 11309 --
NM_021215chr2012063 ------
NM_021238chr1272118 2091 1342 1298 775 415 327 22029 1938 ----
NM_021269chr1942069 1517 310 206 4709 395 145 61 ----
NM_021629chr374326 3801 3303 2032 1703 1140 587 11287 --1112
NM_021643chr21746 ----1718
NM_021814chr641581 690 450 275 --11479 --
NM_021914chr1441594 929 676 73 12142 22374 1573 --
NM_021925chr211639 297 57 --1396
NM_021943chr62195 89 --1208 11491
NM_022048chr1564012 3952 2059 1671 644 320 11958 15283 --
NM_022058chr221989 755 ------
NM_022075chr11264 --1915 --
NM_022118chr133496 488 259 131 ----
NM_022130chr511223 11395 1440 --
NM_022482chr2022132 140 --1642 11734
NM_022728chr71109 ----1231
NM_022755chr932244 1040 352 ----1436
NM_022763chr322651 2336 12046 ----
NM_022781chr943261 3247 2819 903 ------
NM_022841chr15102602 2379 2277 2162 1851 1841 1712 497 212 93 ------
NM_022893chr242943 1282 1135 740 ----12521
NM_022897chr551032 999 991 985 332 ----1789
NM_022902chr51119 ----1124
NM_023016chr272798 1790 838 710 505 477 57 ------
NM_024590chr421828 1297 1709 ----
NM_024612chr17----11155 --
NM_024624chr21191 21613 1050 ----
NM_024639chr672591 2218 2158 2150 2056 511 317 11815 ----
NM_024761chr975216 5145 4246 3246 1654 1415 717 1336 1189 --
NM_024947chr3149424 8494 8189 8021 7725 6927 5845 5827 5810 3701 2733 2388 2039 951 49128 8409 1028 284 2765 403 --
NM_024948chr101218 ------
NM_025047chr32499 342 ----1316
NM_025134chr1612350 11612 --1823
NM_025138chr1341327 1232 1050 420 11272 1450 --
NM_025146chr31712 ------
NM_025179chr154307 3679 1353 931 842 ------
NM_025191chr143396 2986 2732 1056 22846 2676 ----
NM_025208chr1132115 1585 96 --1100 --
NM_025235chr1062198 2089 771 753 423 338 11568 ----
NM_030625chr1051950 816 310 87 33 21958 488 ----
NM_030647chr785830 5808 5785 5339 4146 2508 1643 1394 13869 24150 642 --
NM_030806chr1159446 8762 8756 6804 6255 6212 3508 3439 3255 1938 1716 1497 1393 563 33 15951 46283 3629 2628 228 --
NM_030949chr611449 ----1154
NM_031216chr1871532 1441 841 817 566 185 132 ------
NM_031442chrX53058 3018 2412 1177 76 --13004 --
NM_031866chr10----1117 --
NM_032144chr221393 1368 21182 614 ----
NM_032199chr1033906 3109 494 11381 ----
NM_032217chr43535 140 94 --1557 --
NM_032221chr2021374 512 ------
NM_032352chr142426 36 ------
NM_032373chr1085666 4430 4006 2329 1833 1676 952 196 14223 1171 24638 2334
NM_032440chr1062620 2461 1847 615 414 48 --1642 --
NM_032547chr421119 1018 21266 1025 11123 --
NM_032839chr31159 --1163 --
NM_032866chr15------1846
NM_032905chr101418 --1810 --
NM_033132chr1341848 1567 765 708 12086 ----
NM_033224chr755460 5190 2585 1525 763 26529 4936 12330 --
NM_052879chr1223589 657 13720 ----
NM_053002chr33423 267 117 ----11175
NM_053025chr321417 215 --11463 --
NM_053056chr1152625 2090 2040 1967 829 ------
NM_080872chr854094 3541 3123 1369 212 1400 12577 1827
NM_101395chr2153327 3122 1326 549 438 --1394 --
NM_130386chr18----1439 --
NM_133264chr1732748 2735 776 --1251 --
NM_133367chr633368 1124 411 1746 --23161 2854
NM_138375chr1821153 65 1144 --170
NM_138426chr722531 2012 1889 ----
NM_138453chr5----172 --
NM_138473chr1274337 3505 3331 3311 2031 1327 892 13486 11760 --
NM_138731chr141822 13877 ----
NM_138966chr181544 1592 ----
NM_139136chr1211007 1113 1970 --
NM_144571chr486883 6535 5260 4823 2124 1860 1640 1396 12062 11183 --
NM_144578chr1465281 4746 4300 2185 1141 652 11443 14331 194
NM_144607chr1752615 2116 1652 844 518 12000 --12566
NM_145284chrX51981 1829 1553 187 128 ------
NM_145307chr1094625 4404 3716 3605 3204 3095 3077 2830 681 --34217 933 128 --
NM_152263chr175977 5942 4947 4741 4123 2312 1075 --31953 892 764 --
NM_152265chr131158 1088 95 ------
NM_152342chr16----1525 --
NM_152344chr1711423 ------
NM_152437chr1252395 2214 1958 513 411 11497 12218 --
NM_152520chr21775 ------
NM_152586chr103735 691 371 ------
NM_152622chr553209 2860 2492 1385 1300 --13259 --
NM_152678chr342591 758 292 121 --1503 --
NM_152686chr551708 652 547 392 105 ----12276
NM_152723chr112246 137 --1813 --
NM_152756chr554081 3509 3114 464 134 31548 624 499 ----
NM_152896chr91584 --1711 --
NM_153020chr641432 1360 1127 530 11632 ----
NM_153267chr91898 3201 81 27 1216 --
NM_153456chr1396228 5322 4612 4463 4323 4188 1399 1065 594 1609 ----
NM_153607chr533207 2702 209 1486 1213 --
NM_153619chr1563027 1408 1238 945 242 73 ------
NM_153810chr1075082 4468 4055 3820 3556 3094 865 1559 11303 1196
NM_153825chr431129 404 284 ------
NM_172071chr1117230 5901 5282 5178 5105 4943 4887 1390 1353 827 152 45667 2480 538 525 ----
NM_173468chr475460 5186 4120 476 459 451 173 11299 ----
NM_173552chr321848 357 1806 ----
NM_173647chr251013 979 313 247 203 ----1123
NM_173648chr22981 674 ------
NM_173667chr5--12280 11543 --
NM_173808chr163790 3059 3040 2948 1539 1451 --23743 318 --
NM_173834chrX------1422
NM_174890chr106806 667 510 284 151 74 ------
NM_175061chr721980 660 ------
NM_176814chr72985 524 ------
NM_176823chr123067 1118 13112 --13153
NM_177424chr141487 609 368 135 1596 1643 --
NM_178313chr21409 --11978 --
NM_178558chr721189 1173 2973 451 ----
NM_178815chr1031008 384 73 12417 12120 --
NM_178863chr161504 1434 ----
NM_182485chr4123760 3664 2635 2488 1193 635 604 593 557 435 322 198 12407 ----
NM_182503chr664623 4478 4020 3666 1812 196 --22140 1492 --
NM_182691chr711083 ------
NM_182717chr1021043 1025 1406 ----
NM_182765chr1032089 1523 502 1826 2378 369 --
NM_194282chr452727 2534 2134 766 757 12295 12065 --
NM_198270chrX41340 995 525 114 13219 11003 --
NM_198511chrX21182 627 ------
NM_198581chr297473 7416 7237 7038 5952 1223 962 540 455 37321 5019 1217 1121 --
NM_199168chr1031514 1342 258 --11356 --
NM_199320chr432128 1114 235 152 22449 2119 --
NM_199461chr1073325 2973 2615 2591 2354 1422 387 ----23330 1193
NM_203301chr1451220 1147 576 110 53 ------
NM_203364chr1161131 811 385 272 181 97 --1499 --
NM_203394chr1242327 2280 821 424 --12556 --
NM_203459chr172357 1930 1860 1609 650 599 303 22410 270 1681 --
NM_205852chr1231879 1344 729 ----21603 851
NM_206853chr6133814 3559 2807 2697 2636 1485 1101 1069 1043 764 617 251 225 ----24073 2862
NM_207303chr1013250 23684 642 --1933
NM_207406chr495478 5031 2543 1522 1325 1273 528 313 245 46464 6016 1540 1202 ----
NM_207435chr121871 2969 136 1875 --
NM_207647chr992514 2346 1940 1627 660 406 399 171 62 ------
NM_213609chr321093 795 --1738 --