TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-330-3p
miRNA Sequence: GCAAAGCACACGGCCUGCAGAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr842268 1907 382 376 12402 --1407
NM_000038chr542080 1652 420 245 --1517 --
NM_000061chrX------1407
NM_000080chr171961 --1899 --
NM_000081chr141407 1162 616 499 11173 11545 --
NM_000084chrX86951 6522 5556 2352 2332 942 445 272 --25278 621 15471
NM_000104chr252947 2835 2665 2507 2313 12645 22700 1999 11188
NM_000109chrX92656 2539 2495 2299 2285 1952 1880 417 93 --32485 518 244 --
NM_000112chr5135497 5333 5290 4744 4243 4212 3554 1697 1472 1336 1087 868 307 14102 25558 4081 --
NM_000125chr674183 4172 4083 4044 3729 2708 804 --14188 --
NM_000129chr61164 ----189
NM_000138chr1542413 1842 930 327 ------
NM_000141chr1031238 1206 585 --21342 1337 --
NM_000163chr52784 309 --1664 --
NM_000165chr631582 1069 373 ------
NM_000168chr793303 2779 2384 2369 2232 2078 682 487 79 22851 214 71323 716 476 469 464 369 71 13015
NM_000176chr553951 3296 109 94 87 --1123 --
NM_000192chr1241332 1322 1314 359 --21355 208 --
NM_000194chrX1458 --1137 --
NM_000210chr252308 2226 1878 1439 228 --41712 1654 1586 362 11616
NM_000216chrX133382 2914 2846 2650 2626 2608 1587 1189 1070 1035 974 465 263 11561 14015 --
NM_000217chr1274094 3644 3401 1948 1758 1485 93 --24983 342 --
NM_000240chrX21457 316 11524 22274 2236 11586
NM_000244chr11----1763 --
NM_000248chr392759 2308 1141 1101 907 840 813 516 122 ------
NM_000252chrX51237 1195 1066 602 217 --21080 402 --
NM_000259chr15115586 5449 5213 4979 4342 4277 4157 4002 2174 2107 1448 14991 ----
NM_000267chr1763133 2917 2910 2893 2630 110 --1821 --
NM_000278chr1021582 655 12254 11553 --
NM_000280chr114758 660 385 346 ----1922
NM_000291chrX3913 627 333 ------
NM_000304chr1731066 815 232 --31073 346 326 --
NM_000314chr1073039 2327 1224 893 471 384 146 22306 171 --12131
NM_000332chr6147140 6678 5272 5134 4771 4472 2766 2483 2467 2020 1494 1236 737 176 12000 36808 4380 4375 --
NM_000333chr361111 1042 292 234 151 101 1792 2366 299 --
NM_000346chr1791882 1681 1479 1390 713 681 607 106 98 --21900 120 11540
NM_000362chr2232400 859 100 22377 208 13380 --
NM_000368chr974644 3824 1903 1774 526 448 373 --14881 --
NM_000369chr1431570 571 348 --41855 586 581 576 --
NM_000390chrX41158 1023 925 591 22633 1123 1514 --
NM_000393chr222008 1893 --21571 1349 --
NM_000397chrX42454 2414 2372 722 1192 --11660
NM_000399chr103316 292 124 --21019 1014 --
NM_000408chr2123332 3185 3097 2991 2938 2713 2632 2142 1370 1274 912 253 --22718 264 --
NM_000411chr2173219 3167 2395 2369 2027 498 137 --1150 --
NM_000421chr17----1241 --
NM_000424chr122357 87 --1318 --
NM_000430chr17103754 3701 3350 3011 2527 1247 1078 981 884 346 --32644 712 595 --
NM_000439chr542326 2203 967 957 --31721 245 83 --
NM_000442chr171464 --1322 --
NM_000452chr1341543 1368 505 212 --21424 73 --
NM_000461chr354524 4371 4335 3095 1570 --14442 --
NM_000474chr7----1653 --
NM_000489chrX163409 2879 2565 2522 2425 2370 2273 2239 2181 2172 1346 1160 952 527 315 244 12670 22492 2328 --
NM_000495chrX41120 847 825 27 --1451 --
NM_000503chr821769 237 11598 ----
NM_000522chr731226 1148 181 --159 --
NM_000523chr23250 218 130 --1260 --
NM_000533chrX21679 1507 --21793 1740 11799
NM_000555chrX127308 6889 6739 6696 6649 6221 4859 4760 1506 1423 899 97 --36120 2937 2907 --
NM_000601chr72333 156 --1167 --
NM_000609chr1063046 2254 1158 831 311 120 --1125 --
NM_000615chr1192761 2541 2499 2290 2216 1103 965 845 716 ------
NM_000618chr12105098 5092 4860 4408 4402 2572 2072 891 726 455 --24872 4599 --
NM_000627chr2----2617 301 --
NM_000633chr18104996 4966 4935 4895 3717 3440 2009 1840 1805 959 ----14943
NM_000637chr81384 ------
NM_000682chr231869 598 396 ------
NM_000686chrX51550 1402 612 176 140 ----145
NM_000719chr1276240 1763 1536 851 787 777 759 --32579 1881 710 --
NM_000721chr152304 2229 987 293 183 --12286 12393
NM_000724chr1041319 1232 676 311 --1258 --
NM_000726chr241414 1177 499 247 ------
NM_000788chr471218 1077 959 569 186 119 50 ------
NM_000794chr53832 255 125 --11022 --
NM_000801chr2041115 947 262 164 ------
NM_000806chr561828 1781 1587 693 492 82 --1499 --
NM_000807chr4----156 --
NM_000828chrX61820 1689 874 814 704 544 --31701 1696 229 1718
NM_000834chr121118 ----11254
NM_000838chr622732 2258 1662 --11919
NM_000842chr111508 --1300 --
NM_000845chr7----1513 --
NM_000855chr112307 228 --198 --
NM_000859chr541560 1352 580 207 1321 11677 --
NM_000865chr61189 --2159 149 --
NM_000868chrX62389 2137 772 508 130 116 1872 ----
NM_000870chr531345 1286 253 ------
NM_000872chr1021563 1019 --1261 --
NM_000875chr15107036 6905 6618 6532 5883 5552 5474 2380 1506 1116 15286 36285 4541 1372 --
NM_000891chr1783229 3219 2454 2424 902 650 342 259 --2253 248 --
NM_000895chr121102 --1118 --
NM_000908chr51278 ------
NM_000922chr112796 393 --2452 295 --
NM_000925chr3------1377
NM_000926chr11139420 9370 9292 8773 8377 7648 6915 3679 3404 3285 3196 1391 682 --68804 3700 3123 1633 200 54 13388
NM_000944chr432059 937 316 --1501 --
NM_000958chr531246 1164 322 --11232 --
NM_000964chr171512 ----1538
NM_000990chr1124048 2682 22729 2654 23825 3634 --
NM_001001132chr213582 406 319 ------
NM_001001323chr1262837 2440 2292 1266 1197 476 22989 1080 22515 962 --
NM_001001331chr342688 2277 922 406 ----11727
NM_001001342chr1011200 --1240 --
NM_001001396chr164312 3978 2831 1344 1076 755 --12926 --
NM_001001433chr2093010 3001 2943 2872 2597 2373 2072 1282 193 --12863 12989
NM_001001436chr163816 684 358 --1221 --
NM_001001481chr863380 2885 1249 1143 338 199 --11254 23096 634
NM_001001483chr11137 --1423 --
NM_001001549chr732113 1761 415 1487 42758 2562 2453 2352 --
NM_001001556chr15----193 --
NM_001001557chr841543 776 333 272 2632 362 11822 --
NM_001001740chr12127 117 ------
NM_001001852chr221937 1140 ----
NM_001001875chr93446 423 95 --1280 --
NM_001001890chr2143426 1475 720 677 --33393 693 688 1602
NM_001001974chr1041523 902 764 702 --22068 1589 21595 927
NM_001001995chrX31697 1258 758 --11552 --
NM_001002000chr14----1363 --
NM_001002006chr22681 299 --1812 --
NM_001002026chr331616 773 90 --22475 2413 1853
NM_001002032chr174628 153 132 104 ------
NM_001002245chr17----1129 --
NM_001002255chr61362 ----1233
NM_001002295chr104917 792 439 111 ------
NM_001002762chr1042535 2174 1800 75 11885 ----
NM_001002838chrX3560 279 217 ------
NM_001002843chr1541245 1032 834 822 --11207 11150
NM_001002909chr1752022 835 327 168 132 ------
NM_001003406chr222544 440 ----13303
NM_001003674chr18125886 5862 5445 5433 4975 4946 4724 2452 622 573 475 373 --25127 1270 21995 281
NM_001003712chr12113846 3669 2782 2672 1592 1525 1348 1234 885 804 606 --13954 --
NM_001003760chr642857 2549 1292 1232 12911 11377 --
NM_001003792chr351225 992 943 457 124 ------
NM_001003800chr941476 990 480 170 1896 33220 2967 2608 --
NM_001003845chr23470 424 402 ------
NM_001003940chr1562714 2473 1093 468 117 96 ------
NM_001004051chrX2320 80 --162 --
NM_001004065chr963820 3442 3081 2878 2506 1534 11525 13932 12620
NM_001004196chr321144 1080 --21099 937 --
NM_001004308chrX41487 1248 1225 131 --1613 --
NM_001004329chr1241248 1100 481 131 --11094 --
NM_001004342chr156012 4197 2127 1636 327 25159 1374 13983 15765
NM_001004360chr241829 524 278 251 --31687 1604 773 --
NM_001004419chr1234112 4067 245 1859 ----
NM_001004439chr151113 ----11249
NM_001005266chr15--1198 1116 --
NM_001005366chr125759 359 275 202 46 --1170 21012 370
NM_001005386chr2102378 2188 1989 1650 1639 776 627 571 154 37 --3899 560 244 --
NM_001005404chr17104407 4354 4224 3887 3600 3293 3186 1747 1140 239 23347 830 23763 192 13723
NM_001005463chr1052559 2458 2290 2071 1656 --22106 875 --
NM_001005739chr22811 580 --1352 --
NM_001005849chr171432 ----1234
NM_001005862chr172468 455 --1497 --
NM_001005910chr33640 564 270 --2483 461 --
NM_001006115chr352122 1056 215 136 91 --12707 12480
NM_001006600chr552019 884 624 425 269 --11589 --
NM_001006636chr21808 ----1986
NM_001006681chrX----1140 --
NM_001007024chr17114400 4306 4278 3579 3399 2918 1385 385 247 210 190 --11618 --
NM_001007026chr12----1358 --
NM_001007072chr151170 --1189 --
NM_001007094chr1024171 665 ------
NM_001007097chr9105048 4943 4651 4559 4017 3630 1472 1151 907 340 --34133 4052 786 11575
NM_001007098chr13848 736 152 --2611 379 --
NM_001007099chr12690 149 --2325 195 1866
NM_001007102chr651601 1440 1164 51 37 --11618 --
NM_001007156chr1551803 1386 782 332 165 --21746 1403 128
NM_001007237chr152820 2376 839 474 245 --1984 --
NM_001007257chr161406 944 540 438 375 314 --11144 --
NM_001007466chr6144936 4704 4519 3644 3495 3273 1766 1586 1580 1574 1567 1554 1541 1222 ------
NM_001007468chr22----1259 --
NM_001007559chr1871623 1609 1603 796 746 704 321 1669 1531 --
NM_001007793chr102106 37 ------
NM_001008225chr72516 86 --1571 --
NM_001008239chr1863802 3646 3132 3018 1347 1316 --23468 1337 --
NM_001008392chr373228 2559 2534 2400 2376 857 231 12593 1146 --
NM_001008408chr7116200 5948 5272 5117 5081 4817 4713 1066 925 823 256 --66041 5841 5510 4750 2189 261 --
NM_001008493chr111568 ----11221
NM_001008495chr861914 1902 1509 1390 263 252 --3472 467 427 --
NM_001008539chr895379 5359 5280 5127 3420 1822 1350 1252 311 --14404 --
NM_001008564chr1352123 1846 1688 305 202 1111 12140 22282 2028
NM_001008660chr1121500 1368 --11171 --
NM_001008703chr6144 1129 1113 --
NM_001008707chr1431773 1691 1665 --183 --
NM_001008723chr10----1167 1460
NM_001008738chr562836 2499 2372 2268 935 449 --22742 2339 --
NM_001008777chr171526 --1445 --
NM_001008783chr63687 649 65 --1675 --
NM_001008925chr442313 717 632 493 --1291 23503 401
NM_001009569chr1031374 1066 376 1204 31668 1387 224 --
NM_001009571chr74487 349 215 49 --21437 96 --
NM_001009584chrX1372 1190 --1587
NM_001009881chr12449 195 ------
NM_001009899chr396190 4772 4721 4592 4002 3972 1822 814 754 --16301 --
NM_001009959chr252463 2078 1814 1724 664 ------
NM_001009993chr274284 3820 3672 3443 1030 944 835 --1209 --
NM_001009997chr102355 84 ------
NM_001010888chrX64583 4501 4344 3517 3358 1175 --24532 3400 --
NM_001010935chr15945 781 730 659 119 ------
NM_001010942chr1231309 1048 940 1521 21298 1072 --
NM_001010942chr1231309 1048 940 1521 21298 1072 --
NM_001010942chr1231309 1048 940 1521 21298 1072 --
NM_001010971chr11901 1279 2995 873 --
NM_001010989chr164508 491 451 130 133 ----
NM_001011513chr442587 2529 1625 1513 198 24048 2765 --
NM_001011515chr441051 946 781 262 --2906 171 --
NM_001011537chr352315 2293 1878 1692 352 --22119 2051 --
NM_001011666chr7154979 4652 4502 4128 2309 2112 1957 1750 1172 948 860 811 669 229 222 12128 22552 2547 12414
NM_001011708chr242502 373 207 140 11851 1851 --
NM_001011713chr1481547 1413 1302 1153 1110 1029 1000 194 --21260 79 11596
NM_001011722chr11148 --1174 --
NM_001012279chr62479 461 ------
NM_001012329chr152311 841 752 572 358 ------
NM_001012426chr621131 418 --13330 --
NM_001012514chr23980 827 242 --11083 1850
NM_001012761chr541986 742 233 167 1934 1214 1552
NM_001012977chrX41426 1414 1114 468 ------
NM_001013031chr1063460 3280 3096 977 534 496 --13027 11272
NM_001013406chr71645 --11183 --
NM_001013415chr451614 1451 1216 517 257 ------
NM_001013438chr34981 756 642 632 ------
NM_001013622chr411166 --11054 --
NM_001013690chr1252207 1962 1923 809 729 --1419 --
NM_001013693chr122237 925 ----12923
NM_001013703chr152501 443 ------
NM_001015053chr1711399 --11536 --
NM_001015877chrX102934 2892 2167 2046 1067 1046 971 627 156 72 --22474 985 12150
NM_001015881chrX51286 1174 431 67 43 11122 21041 1036 1936
NM_001017395chr393478 3288 3200 2617 2343 2219 1068 920 138 ----11029
NM_001017424chr121379 265 1339 ----
NM_001017440chr7128184 7425 7269 7068 6823 5250 2467 2152 1312 743 226 216 25385 966 22781 1082 15182
NM_001017926chr881604 1428 1332 1283 1199 1183 708 98 ------
NM_001017969chr92178 143 --1560 147
NM_001018004chr15136 --246 41 --
NM_001018037chr931459 1324 1256 ------
NM_001018041chr6----1300 --
NM_001018054chr15996 907 404 391 220 --21448 429 --
NM_001018064chr951934 1926 1697 1580 568 11984 ----
NM_001018067chr1115387 5291 5055 4807 4379 1874 1637 366 235 202 149 --33324 1668 444 --
NM_001018089chr1583915 3345 2834 2605 1580 721 218 181 --23906 2692 12852
NM_001018108chr1541987 720 267 224 ------
NM_001020658chr131285 426 236 ----11312
NM_001023560chr62167 150 1313 ----
NM_001023567chr1542360 2196 938 355 ------
NM_001024218chr141318 126 1246 --
NM_001024226chr131132 1091 41 --11120 --
NM_001024455chrX32520 2116 1898 ------
NM_001024460chr621016 854 ----1333
NM_001024649chr542956 2287 879 288 --1518 --
NM_001024660chr331396 1259 366 --11377 1604
NM_001024680chr2----1159 --
NM_001024847chr342243 1608 578 311 --12233 1799
NM_001024934chr63515 507 181 --191 --
NM_001024948chr193253 2840 2500 2259 1347 1164 1146 267 230 ----12766
NM_001025068chr361851 1691 1302 1132 648 275 --11262 --
NM_001025076chr10125920 5878 5470 5206 4234 4036 3794 1886 1790 1298 1050 967 25579 1426 31502 1175 646 --
NM_001025077chr10177278 7236 6828 6564 5592 5394 5152 4950 4710 2656 2408 2325 1394 1044 656 568 306 26937 2784 42860 2533 2004 255 --
NM_001025079chr373813 3607 2844 2831 1362 695 454 23885 3452 12724 --
NM_001025105chr5------2363 348
NM_001025356chr1242887 2163 2110 42 1646 1735 --
NM_001025579chr1751070 1011 859 853 447 ------
NM_001025580chrX104054 3921 3746 3737 610 481 350 339 309 198 14282 23053 285 --
NM_001025777chr221614 1418 --11203 --
NM_001025780chr931106 310 83 --21589 1241 --
NM_001029858chr653410 3390 2770 2284 47 --23147 351 --
NM_001029863chr652365 2209 1975 987 142 ------
NM_001029875chr572418 2398 1979 1103 524 218 105 --11083 --
NM_001029989chr152367 69 ------
NM_001030007chr1663675 3656 3555 3412 3132 1380 --23665 2847 12635
NM_001031623chr671669 1347 1236 586 127 121 70 --1156 --
NM_001031679chr1283465 3389 2943 2583 487 467 223 110 ------
NM_001031680chr112503 12331 22476 1043 --
NM_001031684chr231382 1028 933 ------
NM_001031695chr22145447 5178 4740 4576 4542 3946 3787 3729 3698 3335 2187 2181 1719 1148 13555 24664 1709 --
NM_001031700chr452404 2207 1694 1561 53 3381 298 186 12224 --
NM_001031710chr751089 975 933 694 84 --297 57 --
NM_001031715chr151209 ------
NM_001031732chr4112942 2537 2435 1277 1104 1069 885 852 820 488 324 --22321 749 1372
NM_001031804chr1694062 3715 1405 1290 1088 823 493 313 239 --33340 2849 2844 33308 3086 1182
NM_001031812chr522128 213 --22242 232 11830
NM_001032282chr821198 946 ------
NM_001032288chr2041216 1092 1086 1067 ------
NM_001032363chr151986 1669 1578 1552 118 --1169 --
NM_001032393chrX2701 203 ------
NM_001032394chr662843 2669 2662 2456 2148 1130 --11067 --
NM_001032999chr2044206 1350 797 704 11670 15246 --
NM_001033047chr442602 1006 581 158 --1648 11788
NM_001033057chr331721 797 315 --11402 --
NM_001033087chr2073074 2917 2340 2306 2284 1290 341 --12297 12923
NM_001033112chr52785 720 --1731 --
NM_001033518chr73627 290 236 ------
NM_001033557chr251356 1136 1119 50 28 ------
NM_001033561chr175878 748 678 155 87 --1766 --
NM_001033578chr842234 916 340 295 ----1187
NM_001033925chr1071929 1663 1448 762 579 523 361 --32077 1567 144 --
NM_001034025chr121877 --1813 --
NM_001034837chr5----1244 --
NM_001034852chr1422080 285 --1158 --
NM_001035003chr42340 127 --11223 --
NM_001037132chr721780 708 ------
NM_001037164chr771940 1772 1447 1435 1428 389 118 --41422 674 335 123 --
NM_001037339chr131687 1419 1251 ------
NM_001037494chr121238 ------
NM_001037558chr11----1224 --
NM_001037582chr431118 139 54 --21510 211 --
NM_001037872chr2----1127 --
NM_001037954chr1153415 3403 3369 3070 1405 ------
NM_001038493chr21485 --31523 1469 1398 --
NM_001038707chr171826 1805 1648 1603 808 419 349 ------
NM_001039199chr2034661 985 464 14908 1276 14954
NM_001039348chr211054 --1421 --
NM_001039350chr741580 1508 464 151 --1658 --
NM_001039459chr71989 --11018 --
NM_001039465chr143446 394 98 ------
NM_001039479chr1442127 1810 1698 805 --12102 --
NM_001039538chr253643 1294 1068 1010 979 --33690 2468 258 13352
NM_001039570chr2254609 4170 1261 735 569 ------
NM_001039573chr17----1443 --
NM_001039577chr1114498 4200 4194 4010 3893 1465 1049 950 515 396 33 --21591 186 --
NM_001039590chrX53567 3450 3273 1491 1414 --2985 199 12593
NM_001039618chr11145714 5685 4705 4692 4626 4117 4054 3972 3922 3884 1552 1473 1412 1339 25592 4661 45812 1611 395 332 --
NM_001039619chr142334 128 ----1326
NM_001039802chr141362 479 466 280 --31152 415 410 --
NM_001039840chrX165615 5558 5348 5093 4809 4758 2371 2088 1982 1472 1169 713 510 494 462 447 --45290 2431 1836 196 24682 3897
NM_001039916chr1221201 765 --1996 --
NM_001039937chr1364137 3904 3314 1576 1039 610 --1420 --
NM_001040020chr711601 --11606 --
NM_001040100chr341268 1047 1039 200 ----21230 911
NM_001040142chr272220 1802 1727 749 636 366 110 ------
NM_001040152chr754998 4581 4533 3451 3338 23778 1932 ----
NM_001040153chr133928 835 110 --2976 307 --
NM_001040158chr55373 176 157 137 112 ------
NM_001040159chr431297 563 433 1252 --1186
NM_001040181chr33765 465 81 ------
NM_001040202chr462419 2283 1934 1590 174 123 ----11577
NM_001040284chr16125967 5961 5562 2150 2139 1935 1873 1506 1207 876 687 457 11402 15238 --
NM_001040402chr483008 2824 2742 1293 888 831 563 45 --21009 194 --
NM_001040429chr1363584 1450 1186 896 814 113 1202 13467 12221
NM_001040440chr51157 --1531 --
NM_001040450chr1522122 831 ----12558
NM_001040624chr832754 2334 842 --1778 12109
NM_001040633chr741015 895 204 61 --11027 --
NM_001040665chr754931 4593 4282 4208 3948 --44069 240 235 230 25005 3718
NM_001040709chr122531 1834 1124 12308 --
NM_001040712chr983511 3490 3397 3335 3248 3233 3196 2708 1783 21185 841 1416
NM_001042355chr1655225 4863 3520 605 158 1624 21174 1065 --
NM_001042413chr993878 3669 3495 3088 1462 775 614 168 61 --33991 3887 683 --
NM_001042440chr541552 1544 431 83 --1507 --
NM_001042465chr10----11099 --
NM_001042473chr1051763 1581 855 343 108 --12107 1823
NM_001042481chr14112487 2400 2313 2234 2213 2164 1963 1623 1074 819 316 --22383 1850 --
NM_001042493chr681991 1629 1585 1579 1381 689 323 262 --1381 --
NM_001042494chr1543827 1342 718 32 --23842 653 --
NM_001042506chrX41387 1124 578 468 ------
NM_001042510chr831727 1704 79 --21374 1369 11653
NM_001042533chr363129 2557 2267 1029 754 309 --12586 --
NM_001042537chrX62512 2323 2169 1696 928 221 11617 ----
NM_001042555chr12104729 4389 4365 4302 3796 3731 3441 3116 2958 807 3991 933 396 23234 601 --
NM_001042599chr287125 5917 5394 5137 2968 2961 2887 629 26025 105 37769 1992 661 17273
NM_001042601chr342880 1269 340 143 ----1209
NM_001042603chr12184766 4618 4294 4118 3872 3512 3454 3396 3338 2144 1945 1915 1404 1315 1301 1143 1105 880 1742 24279 1665 12011
NM_001042683chr681832 1744 1717 1527 1353 1274 715 399 ------
NM_001042749chrX91915 1844 1788 1764 1642 524 473 281 159 ------
NM_001042762chr72715 172 --1842 --
NM_001043318chr1484050 3796 3605 3190 3162 1620 701 300 ------
NM_001043351chr142067 815 774 116 11967 2907 309 --
NM_001044305chr631516 459 212 ------
NM_001046chr562975 2964 2166 1178 1040 413 --23003 502 11195
NM_001049chr1442224 2194 2030 207 --22294 2267 --
NM_001064chr3------198
NM_001079874chr132055 1582 371 --21993 1753 --
NM_001092chr173831 334 268 --1653 --
NM_001094chr171768 1784 3803 752 747 --
NM_001099678chr334049 1736 259 --26118 1948 --
NM_001100108chr1178358 8317 8222 7320 5988 5746 3180 3081 3053 2403 2396 2378 2325 1837 1200 79 63 --11395 27524 1936
NM_001106chr3149651 8808 8144 7460 7214 7033 6739 6257 5987 3248 2443 2093 1235 533 12712 273 68 13148
NM_001121chr1041710 1591 601 453 1198 21824 1495 --
NM_001123chr102339 323 ------
NM_001126chr11395 --1987 --
NM_001144chr1621419 1172 --21396 1177 --
NM_001146chr822179 1960 --12113 --
NM_001160chr1272116 1959 585 483 433 403 195 --32860 2632 606 12752
NM_001165chr111580 --1125 --
NM_001167chrX146703 6490 5509 4995 4877 2442 2365 2212 1456 1045 708 494 472 140 --21055 420 16619
NM_001174chrX52083 2048 1961 1670 1543 ------
NM_001177chr1222141 227 --1501 1540
NM_001186chr2182978 2549 2053 989 553 249 100 48 ----12076
NM_001187chr211505 --1235 --
NM_001191chr201342 ----1411
NM_001198chr662445 2187 1897 977 936 746 ------
NM_001201chr4133919 3722 3593 3379 2572 1304 1195 876 782 500 464 276 69 1406 --11486
NM_001202chr14------1209
NM_001204chr2167491 7344 7288 6667 6291 2361 1983 1977 1724 1511 834 419 206 196 134 86 16796 27429 500 17664
NM_001206chr9102715 2471 2324 1929 1049 484 297 291 269 163 --2982 761 1840
NM_001222chr1041964 1714 441 207 ------
NM_001238chr193528 166 86 --1480 --
NM_001241chr22478 232 ----12262
NM_001259chr7176356 5472 5153 5018 4760 4469 2461 2353 2075 2033 1735 1616 1469 1213 973 967 792 --21361 1005 1172
NM_001271chr1543051 712 346 101 12587 ----
NM_001290chr441061 822 786 433 ------
NM_001293chr111398 --1524 --
NM_001300chr10----1399 --
NM_001304chr17103818 3219 3128 3089 2779 2460 1396 1342 359 110 22630 163 12715 --
NM_001305chr7----2783 35 --
NM_001310chr12112994 2771 2472 2449 1986 1878 622 409 385 326 174 --22216 1949 --
NM_001316chr201142 ----1341
NM_001326chr113454 422 81 ------
NM_001332chr541528 1102 397 273 --170 --
NM_001338chr2131236 985 969 21216 292 ----
NM_001343chr521296 166 1113 31670 1306 1301 1374
NM_001351chr32424 318 143 ----
NM_001356chrX32185 996 721 12083 --1384
NM_001364chr11114459 3808 1583 1242 1221 1085 764 352 219 104 87 --14194 --
NM_001378chr2----1179 --
NM_001386chr872063 2019 1909 1822 1729 868 95 --22134 2055 --
NM_001387chr51726 --1182 23145 49
NM_001390chr1863657 3165 2653 2647 1007 752 --13534 1905
NM_001395chrX2977 953 ------
NM_001396chr2192665 2450 2442 1127 1108 901 397 53 36 --3457 452 442 11074
NM_001400chr121285 378 2367 256 ----
NM_001402chr621361 426 --1157 1486
NM_001407chr331144 490 224 --11719 --
NM_001412chrX92946 2907 2300 1151 1145 1138 1128 875 284 --12901 32669 767 319
NM_001415chrX61791 1558 1244 801 300 288 --21817 311 11935
NM_001416chr17----1457 --
NM_001419chr19134457 4255 4239 4188 4170 3743 3507 1573 1164 1153 1143 989 307 14522 54094 1220 1204 977 467 --
NM_001431chr65850 317 283 277 217 --1917 --
NM_001432chr463552 889 848 393 149 137 13809 ----
NM_001438chr163064 3040 2758 2366 840 797 1965 11027 --
NM_001453chr661300 604 484 349 334 259 --11652 --
NM_001491chr662758 2707 2279 609 330 60 --22727 1833 --
NM_001493chrX----1575 --
NM_001497chr932179 880 700 --11860 --
NM_001530chr1411066 --21141 436 --
NM_001546chr661240 1079 988 982 579 271 ----1389
NM_001560chrX32456 1630 186 --1328 1879
NM_001584chr1151101 442 360 321 226 --1429 --
NM_001609chr1054441 1384 1162 440 249 12874 23036 1321 --
NM_001612chr111167 ----125
NM_001616chr2103085 2655 2204 1384 1270 1085 840 800 752 429 --23371 666 12885
NM_001627chr342343 389 347 213 --11799 --
NM_001635chr721061 676 --1237 --
NM_001650chr1844158 3481 2974 821 --11334 --
NM_001660chr33681 324 299 --1733 1292
NM_001662chr7----1300 --
NM_001663chr1452028 1689 862 392 221 12641 ----
NM_001668chr182185 1785 1775 1671 1400 856 365 52 --11815 --
NM_001678chr1731748 1306 1173 ------
NM_001690chr352178 1951 1902 1875 147 1110 1482 12200
NM_001695chr833922 1495 1355 1797 62877 2872 2867 2862 839 376 --
NM_001701chr931566 1505 1493 11052 ----
NM_001706chr3121 --1350 --
NM_001709chr1192902 2879 2651 818 567 514 458 450 308 --62581 2576 2261 890 587 561 --
NM_001718chr6----11147 --
NM_001730chr1321372 1283 --11502 --
NM_001742chr72664 480 --1174 1606
NM_001744chr52169 104 ------
NM_001753chr731700 1228 669 ------
NM_001755chr1662255 1857 1769 866 532 207 12122 2507 462 --
NM_001759chr12115259 5007 4600 3516 3355 2044 1911 1883 644 83 68 25296 4646 11665 --
NM_001792chr1861108 1046 962 718 401 122 ------
NM_001802chr162798 690 --1119 1867
NM_001826chr12344 338 --1153 --
NM_001842chr9----1477 --
NM_001845chr1321391 911 ------
NM_001858chr6164987 4902 4060 4037 3953 3560 3321 2017 1847 1813 1462 828 750 613 486 93 14248 34024 3546 215 25109 3622
NM_001859chr963967 3920 2605 1323 1153 203 ------
NM_001860chr911171 --1403 --
NM_001901chr631000 688 108 ----1699
NM_001902chr1----1350 --
NM_001905chr12101 77 1747 ----
NM_001933chr1421176 313 --1514 --
NM_001935chr24737 294 281 51 ------
NM_001938chr151948 1652 1584 619 40 --1639 --
NM_001939chrX33825 3213 888 ----13852
NM_001945chr511300 --1154 1943
NM_001949chr693086 2819 2792 2786 2264 2139 2016 990 636 --32758 2225 226 --
NM_001955chr6----31078 1073 211 --
NM_001965chr21415 --1420 --
NM_001968chr43821 695 676 --1875 --
NM_001977chr431702 664 112 ------
NM_001992chr532211 597 132 --11381 1664
NM_001995chr421462 1438 11427 11278 --
NM_002006chr4145829 5790 5519 4872 4787 4033 3901 3633 3557 1795 1747 1569 1395 268 ----14717
NM_002009chr15112736 2557 2551 2502 2289 1011 929 887 497 165 60 11884 1946 --
NM_002015chr1371106 811 658 481 371 331 322 --12542 12733
NM_002017chr1121021 320 --21178 48 --
NM_002024chrX102191 2168 2110 1829 860 747 741 681 390 218 --2754 456 --
NM_002025chrX189200 9193 9136 9105 9070 8451 6970 5793 5766 5657 2990 2955 2574 1118 733 293 263 116 --49147 8169 7906 3305 27222 1332
NM_002035chr18112925 2764 2696 2571 1510 1166 908 808 732 232 100 --33705 3542 2488 --
NM_002039chr43873 642 355 --1168 --
NM_002040chr21132893 2823 2743 2555 2543 2325 2214 2040 1968 1055 769 420 408 --22418 832 --
NM_002041chr15------149
NM_002056chr21784 --1711 --
NM_002063chrX21168 1060 1378 1849 --
NM_002069chr731702 600 363 11354 1141 --
NM_002073chr2211187 --11074 --
NM_002074chr141527 1235 419 251 --1387 --
NM_002114chr6124 --1148 --
NM_002128chr1342343 1687 526 115 --1418 --
NM_002140chr931036 758 197 --21160 350 --
NM_002145chr171309 --1102 --
NM_002148chr21140 --1126 --
NM_002158chr283843 3574 3239 2562 1492 1411 1009 690 33283 2678 682 22631 750 22429 1212
NM_002160chr9----1226 --
NM_002165chr202386 362 --1321 --
NM_002166chr21658 ----1681
NM_002168chr15----1218 --
NM_002181chr2----1740 --
NM_002196chr20----1432 --
NM_002199chr43844 652 43 --148 --
NM_002202chr52811 145 --11020 --
NM_002214chr7125734 5589 4541 4196 3786 3544 1990 1647 1355 980 864 565 15473 1664 --
NM_002221chr152643 2520 2147 2140 198 12745 --12655
NM_002224chr62721 699 1153 ----
NM_002227chr12952 381 1856 1412 --
NM_002232chr1175 --1179 --
NM_002239chr211182 --1900 --
NM_002241chr142211 2082 603 462 --11160 --
NM_002247chr1051762 1701 1520 427 87 1406 31717 1501 398 --
NM_002264chr3124875 4521 4132 4099 3864 3579 3437 1015 963 643 254 101 14738 11969 --
NM_002265chr173785 774 750 --2755 405 --
NM_002267chr13112443 2163 1725 1655 1569 1549 985 955 937 691 215 12259 --2769 117
NM_002270chr595120 4770 4285 3857 3806 3489 2190 2154 1226 --63813 3742 2145 2140 2135 513 --
NM_002271chr1351753 1576 961 776 714 --175 --
NM_002293chr152750 2406 1731 848 576 ----12126
NM_002296chr171730 1718 1560 1519 445 412 352 ------
NM_002310chr5136558 5978 5624 5440 5351 4817 2216 1481 1460 706 687 334 157 --1568 --
NM_002336chr12154984 4793 4555 4328 3608 3586 3351 1668 1367 1255 1155 1024 950 897 539 13208 14897 --
NM_002345chr123238 218 38 --1121 --
NM_002356chr6102668 2655 2063 1057 999 977 798 307 163 79 32722 2168 1104 22056 1083 --
NM_002358chr44681 631 619 82 ------
NM_002359chr1773784 2988 2741 1629 1283 1250 1182 13695 23282 198 --
NM_002376chr144555 502 482 43 --1496 --
NM_002382chr1411143 ----1827
NM_002397chr522248 774 --31605 881 133 --
NM_002399chr1521366 1260 ------
NM_002401chr1752144 1636 721 699 406 --1806 12009
NM_002408chr144743 658 629 97 1790 1562 1552
NM_002430chr2232597 820 417 --3644 474 359 --
NM_002442chr122421 254 --21651 1458 --
NM_002479chr11689 --3700 556 551 --
NM_002480chr1261095 1033 535 203 196 176 ------
NM_002481chr1138002 7874 7714 6729 6704 6450 5846 5780 5306 5087 1669 993 896 27903 4815 27812 100 --
NM_002482chr14660 284 193 37 1120 ----
NM_002501chr1912549 --23993 1187 --
NM_002505chr621308 464 ------
NM_002515chr143729 163 28 11979 1205 --
NM_002518chr241202 996 489 483 --11010 --
NM_002519chr111334 1256 1397 --
NM_002524chr1121 --1837 --
NM_002536chrX3508 452 284 --2209 160 --
NM_002537chr1521007 166 --1400 --
NM_002547chrX53649 3447 3161 3113 2896 --1703 1232
NM_002553chr71455 1352 ----
NM_002577chr362973 2791 2482 1345 865 456 --21556 1350 13901
NM_002588chr521532 569 --21618 675 --
NM_002595chr1261811 1523 489 445 425 160 ----11655
NM_002599chr1121201 212 ------
NM_002607chr761214 1176 902 880 415 102 --21260 442 --
NM_002613chr1655349 1279 1194 497 221 --33627 1303 1091 --
NM_002618chr2----1122 --
NM_002633chr1----1514 --
NM_002641chrX61466 428 303 280 90 73 --11406 --
NM_002645chr1182303 1958 748 553 360 332 223 22 --12644 --
NM_002646chr122078 1888 ------
NM_002648chr61850 ----21224 865
NM_002655chr894158 4075 3806 3488 3379 1974 1145 168 105 14909 13754 --
NM_002664chr2--1643 --11610
NM_002699chr111015 --190 --
NM_002709chr2113611 3516 3226 3105 3016 2597 1223 963 687 596 406 --1392 --
NM_002710chr121955 --1204 1688
NM_002713chr121023 980 ------
NM_002715chr541033 1011 275 117 1458 ----
NM_002719chr1482383 2240 1782 1665 511 482 474 372 ------
NM_002729chr102820 751 --2604 52 1223
NM_002731chr163143 2969 2023 1159 482 389 12208 21068 1063 12686
NM_002737chr17126647 6598 6382 6115 4852 4314 4289 4277 1971 1427 1224 1111 --22044 1197 --
NM_002738chr164878 802 304 75 --31093 794 432 1925
NM_002745chr2274452 3341 3098 1689 292 276 166 23292 2994 54339 3583 3572 3242 3200 --
NM_002748chr1541086 1073 295 132 --148 --
NM_002755chr151215 1701 ----
NM_002756chr175979 888 690 672 635 --1878 --
NM_002757chr153299 288 97 --1359 --
NM_002779chr10----1215 --
NM_002787chr72213 122 --275 70 --
NM_002821chr63796 790 784 1220 1772 --
NM_002825chr73606 463 82 ------
NM_002830chr22154 41 ------
NM_002834chr1223298 796 --24031 3227 --
NM_002835chr73623 515 310 ------
NM_002836chr202192 103 1528 162 --
NM_002840chr161585 1435 1236 1015 660 649 --1443 --
NM_002843chr1133397 3102 81 --1117 --
NM_002844chr621187 1110 --11237 --
NM_002848chr123400 345 63 --21074 107 --
NM_002849chr121391 --1274 --
NM_002852chr31230 --1647 --
NM_002855chr114825 621 182 176 --12594 --
NM_002859chr121652 --11144 --
NM_002869chr1152128 1959 1913 756 388 --144 --
NM_002874chr941856 809 434 341 12158 22272 721 --
NM_002890chr52820 347 --1694 --
NM_002892chr1441737 1342 445 248 --11269 11143
NM_002893chrX2361 266 ------
NM_002897chr22106 85 ----1677
NM_002911chr1941601 1565 559 92 11708 1541 --
NM_002912chr66932 908 633 355 229 73 --1744 --
NM_002918chr1931111 910 392 ------
NM_002930chr181166 --1171 --
NM_002938chr431766 1497 1382 --21986 1855 --
NM_002941chr321560 1269 --11070 1268
NM_002942chr311190 ------
NM_002945chr171804 --1864 --
NM_002950chr32382 333 ------
NM_002951chr201252 --1280 --
NM_002956chr1231041 881 224 1414 ----
NM_002968chr16----2725 206 --
NM_002994chr431212 275 121 11863 11637 --
NM_002998chr871745 1625 1400 615 592 92 85 ------
NM_003010chr1762341 1564 1530 885 543 83 --1356 --
NM_003012chr893156 3071 3045 2799 2404 2323 937 480 448 13027 --13099
NM_003016chr1731683 729 254 ------
NM_003017chr65903 573 319 117 77 ----1258
NM_003022chrX41290 890 75 51 ------
NM_003026chr931170 410 212 --162 --
NM_003028chr953053 2773 2746 2678 1548 --12763 1454
NM_003030chr371804 1738 1732 1722 1609 598 255 1696 --1784
NM_003038chr242037 1712 1076 383 --22653 118 --
NM_003043chr344280 4236 4188 1173 --1189 1195
NM_003051chr11709 --2235 230 --
NM_003068chr8--11032 1381 --
NM_003069chrX2576 297 1263 --1544
NM_003071chr311782 --11839 --
NM_003074chr341746 1428 534 422 1821 2794 357 --
NM_003081chr202887 59 --1903 --
NM_003092chr201311 ----155
NM_003099chr1595072 4785 4753 4424 2313 1575 1528 515 213 11188 21741 915 --
NM_003100chr5------1383
NM_003108chr2126741 6643 6020 5564 5141 5107 4846 4739 1522 1066 1009 348 --14554 --
NM_003112chr783231 3092 3040 2348 1994 1124 1041 105 12017 33206 2205 2132 1960
NM_003113chr23739 132 112 --1733 --
NM_003133chr12889 175 --1999 --
NM_003137chr642228 1819 802 120 --1786 --
NM_003139chr112323 71 1292 ----
NM_003144chr622175 526 --1819 22145 825
NM_003152chr171411 --11251 --
NM_003161chr1763551 3480 2716 2643 1320 487 13204 ----
NM_003174chr102703 88 ------
NM_003178chr361904 668 487 316 208 133 --12141 --
NM_003182chr74461 371 358 175 --1441 --
NM_003184chr831001 976 60 --3782 734 195 --
NM_003188chr61855 1538 ----
NM_003194chr62434 367 --169 --
NM_003200chr192862 834 --22088 625 --
NM_003204chr1721719 1359 21185 695 ----
NM_003211chr1271634 1544 1413 1307 706 537 88 1604 21508 1195 11427
NM_003215chr4------1506
NM_003221chr6114219 3902 3635 3042 2892 1464 1449 1004 993 94 32 21558 1192 23510 1506 1396
NM_003223chr164866 701 694 320 --2708 657 --
NM_003243chr11973 --1322 1475
NM_003246chr1571988 1937 1739 1710 1407 1368 1323 --21911 242 --
NM_003247chr691862 1417 1409 1388 1382 1376 788 535 285 --21908 1661 --
NM_003253chr2141892 1509 618 118 --1569 --
NM_003255chr1762079 1933 1898 1877 909 461 --22633 1889 --
NM_003257chr151935 --1248 --
NM_003262chr3134717 3675 3459 3280 3228 1696 1405 1337 1153 967 899 833 207 --25257 1301 25263 1143
NM_003285chr11451 --194 --
NM_003286chr202389 249 ----1239
NM_003290chr191100 1161 ----
NM_003299chr12----181 --
NM_003305chr41156 125 ----
NM_003325chr22----1670 --
NM_003336chrX1917 --11043 --
NM_003338chr1051873 1659 1429 1347 327 ----1646
NM_003339chr541623 1151 603 86 ------
NM_003340chr44887 478 200 185 11126 11274 --
NM_003342chr1773049 2699 2475 567 338 230 67 12074 21325 682 1549
NM_003347chr2231490 1483 223 ------
NM_003350chr82362 168 ------
NM_003356chr11----1203 --
NM_003358chr9----1110 --
NM_003371chr921669 1627 --41858 1652 1641 1621 11874
NM_003372chrX191 --1934 --
NM_003373chr1041804 1700 694 540 ----1464
NM_003379chr651158 1092 886 733 178 ------
NM_003385chr2----1331 --
NM_003390chr1141110 1058 863 777 --1874 --
NM_003400chr25843 665 622 134 21 --1189 --
NM_003403chr142560 238 ----1140
NM_003404chr2031473 806 293 1220 11860 --
NM_003405chr221541 1602 2802 772 1194
NM_003406chr851908 1488 1372 670 204 ------
NM_003407chr19----1678 --
NM_003409chr1861290 1196 1155 962 575 565 ------
NM_003410chrX83073 2823 2390 2305 2197 1193 1161 568 ------
NM_003411chrY31750 1236 670 --1687 --
NM_003413chrX3728 690 148 --31649 801 201 1748
NM_003427chr6----1644 --
NM_003453chr132503 108 --3508 495 490 1102
NM_003458chr343809 3803 2517 188 1492 ----
NM_003463chr632957 2287 1101 --1874 --
NM_003468chr2113404 2739 1565 1467 1115 842 649 631 481 66 53 13393 23769 308 --
NM_003469chr21457 --1381 --
NM_003478chr112423 332 --1218 1723
NM_003482chr1262769 2743 1922 986 838 578 --22683 1929 21935 710
NM_003483chr1261935 1906 1879 1177 759 286 11151 --12943
NM_003487chr173283 72 61 --1255 --
NM_003489chr2183102 2324 2295 978 822 575 365 23 --23416 2300 13120
NM_003505chr731887 1681 1209 ------
NM_003506chr841194 1165 906 894 --21318 68 --
NM_003507chr261859 1770 1326 789 610 593 --22001 442 --
NM_003559chr1763996 3904 3128 1284 1073 349 11258 ----
NM_003565chr1221404 462 21104 1091 ----
NM_003574chr18135803 5670 5130 4574 4423 4184 4164 2290 1667 1646 1046 818 134 --14044 11509
NM_003590chr273685 3589 1548 1270 793 684 255 --52749 1188 1088 601 374 --
NM_003596chr71178 --1411 --
NM_003597chr232245 2171 1493 1138 41500 887 337 216 --
NM_003602chr73410 173 158 --1357 1384
NM_003603chr442065 1881 1385 844 1239 ----
NM_003615chr3123668 3604 3281 3200 3098 2976 2846 1613 1287 847 412 278 --23609 251 --
NM_003619chr42145 102 --1109 --
NM_003624chr1911355 --21407 38 --
NM_003624chr1911355 --21407 38 --
NM_003629chr173152 3021 2270 1125 988 465 235 22924 872 52324 423 418 270 98 12913
NM_003633chr542544 1638 1012 754 --1784 --
NM_003636chr121515 1390 ----173
NM_003651chr122530 405 ------
NM_003653chr171261 ------
NM_003659chr21133 --2301 152 --
NM_003664chr51141 --1195 --
NM_003670chr351448 1326 1179 1158 1089 1408 126 --
NM_003679chr142637 2323 2104 1186 ------
NM_003685chr194996 947 896 203 1820 179 --
NM_003705chr22787 222 --1263 --
NM_003712chr19----1292 --
NM_003716chr33980 876 738 ------
NM_003758chr1521348 1311 --1452 --
NM_003764chr6----1712 --
NM_003766chr17166 1218 150 --
NM_003787chr1861480 1281 1186 511 232 225 --11707 1576
NM_003791chr16----1609 --
NM_003794chr351063 975 915 427 205 ------
NM_003795chr64603 228 173 136 --2146 141 --
NM_003796chr192472 424 --1198 --
NM_003818chr203966 782 310 1212 1436 --
NM_003822chr143090 853 127 26 --1693 --
NM_003825chr157574 532 374 351 293 256 160 ----11284
NM_003831chr1861828 1574 1516 1375 385 122 --21752 403 --
NM_003870chr1571581 1434 851 754 627 550 325 ----11361
NM_003872chr222786 860 --21930 774 11995
NM_003873chr1092309 2224 2062 1785 1775 1602 944 601 516 --22342 2235 --
NM_003884chr341792 1713 1429 1316 --21581 591 1550
NM_003902chr13339 215 102 --2333 279 --
NM_003913chr6194123 4086 3751 3723 3679 3576 3522 3261 3229 2654 1374 1075 1005 987 971 652 612 563 210 13468 23596 177 --
NM_003916chrX31508 1271 1171 --1116 --
NM_003924chr421399 1252 ----11235
NM_003932chr2261722 1359 727 658 480 207 ----1122
NM_003934chr94898 463 326 310 --1109 --
NM_003939chr1043760 3712 1293 1287 1144 64134 1316 1311 1306 378 358 14051
NM_003958chr673829 2498 1398 1071 831 495 290 --21511 356 1322
NM_003966chr5127800 7363 6628 5670 5363 5221 5174 3110 3093 2662 544 280 17513 16894 --
NM_003972chr102387 364 11326 11265 --
NM_003981chr1521033 312 1205 ----
NM_003982chr141254 ------
NM_004004chr1311091 --1458 --
NM_004056chr81835 1148 ----
NM_004061chr51196 --3257 249 244 --
NM_004064chr121428 --11170 1357
NM_004093chr1373182 3146 2667 2519 2074 838 27 --32921 2605 1103 --
NM_004096chr1082142 1975 1893 1550 1401 771 545 306 --12060 22072 629
NM_004097chr22308 102 ----1294
NM_004098chr101497 --11221 --
NM_004114chrX2469 453 --1417 --
NM_004161chr251281 1042 1029 258 207 ----2648 308
NM_004162chr3------1152
NM_004175chr22----3217 169 164 --
NM_004183chr11----1505 --
NM_004185chr1----1580 --
NM_004200chr1153269 3077 1034 953 627 --1231 --
NM_004226chr2----1298 --
NM_004227chr722467 462 --32885 2150 1000 --
NM_004229chrX52207 1980 1643 319 272 21855 449 31369 362 330 --
NM_004232chr1873319 3272 3219 2770 2674 1041 897 --23811 2446 --
NM_004236chr151132 --1156 --
NM_004237chr56909 720 330 181 149 26 --1822 --
NM_004238chr21305 --1276 --
NM_004241chr102765 734 --1231 --
NM_004261chr13906 806 80 --1246 --
NM_004267chr3------1157
NM_004268chr1171237 1177 971 936 286 240 107 ----1179
NM_004272chr531871 1566 378 --1417 --
NM_004293chr952387 851 677 662 562 --1618 --
NM_004294chr13----1135 1474
NM_004326chr161123 1026 756 381 375 203 --1130 2291 65
NM_004331chr86961 918 793 586 450 113 11676 ----
NM_004342chr73878 737 382 --31933 633 74 --
NM_004344chrX----1484 --
NM_004352chr161459 --2481 476 --
NM_004359chr192121 86 --1499 --
NM_004364chr1931134 1057 937 --21051 1046 --
NM_004367chr641757 1751 1205 711 --21778 220 --
NM_004369chr21658 ----1116
NM_004370chr642127 1963 760 605 1292 1656 --
NM_004392chr1362544 2340 2262 2110 730 316 --22296 898 --
NM_004393chr342361 2328 397 372 12075 21724 559 --
NM_004395chr52735 672 ------
NM_004412chr1095701 5040 4435 4090 3758 2252 710 431 211 --64429 3788 3783 3778 3773 3768 175
NM_004414chr2121519 574 --21339 288 11399
NM_004426chr121694 1186 ----
NM_004427chr1----11211 --
NM_004429chrX71458 1362 467 419 378 369 113 --11427 --
NM_004430chr872785 2510 2240 1819 1099 1035 267 --21890 1885 11896
NM_004432chr952387 2265 1808 423 355 11556 --11900
NM_004437chr173004 1309 649 629 590 261 251 21193 927 13136 --
NM_004438chr213178 1302 ----
NM_004440chr661889 1722 1380 1263 475 454 --11606 1631
NM_004447chr12132 --155 1307
NM_004449chr2121162 1017 1393 1539 --
NM_004454chr362311 2134 1606 815 83 73 --4780 768 763 740 11598
NM_004456chr7----1191 --
NM_004457chr241628 1583 1576 563 11207 --11621
NM_004458chrX92647 2633 2256 1626 1063 683 283 254 179 --12502 --
NM_004459chr1772080 1998 1497 1460 1417 1332 81 ------
NM_004460chr21245 --1232 --
NM_004469chrX173 --152 --
NM_004472chr5----2549 77 --
NM_004481chr122391 2243 --12518 --
NM_004482chr21695 --1295 --
NM_004494chr121276 897 11058 ----
NM_004496chr1431216 1160 403 --1863 --
NM_004501chr1124084 3323 3276 3033 2942 2522 1631 1417 1146 761 133 63 --31643 1073 315 13819
NM_004503chr12------1107
NM_004504chr273030 2872 2810 2048 1168 1111 639 --1587 --
NM_004505chr1742024 1694 569 562 ------
NM_004506chr62694 140 --2101 96 --
NM_004529chr92964 39 ----11320
NM_004555chr162476 428 ----1386
NM_004575chr441626 1605 1512 354 --11215 --
NM_004576chr51270 --1306 --
NM_004586chrX115436 5311 4869 4230 4221 3810 3700 2142 497 458 149 13647 ----
NM_004588chr1134002 3864 3364 ----23821 3343
NM_004591chr2----2392 173 --
NM_004593chr32208 160 --2225 190 1935
NM_004595chrX3309 303 184 --2363 316 --
NM_004600chr151513 1456 614 377 276 1399 1281 --
NM_004612chr954733 4047 3852 3717 268 11308 23529 769 23765 2969
NM_004627chr21----4653 635 600 78 --
NM_004630chr11----2997 969 --
NM_004643chr144865 713 689 683 --3701 664 185 1559
NM_004654chrY21224 202 --11376 1378
NM_004655chr1771214 901 895 880 855 561 421 --1527 --
NM_004660chrY32091 529 244 22008 823 12103 1382
NM_004687chr1731850 1621 1480 ----21915 1436
NM_004689chr141304 ------
NM_004690chr6----1284 161
NM_004718chr2128 --3617 219 142 --
NM_004719chr12102677 2671 2610 2442 2419 2219 2181 2039 1833 641 21775 107 22692 143 --
NM_004723chr12722 689 --1674 --
NM_004730chr511814 --11739 --
NM_004734chr1383220 2703 2302 2154 2047 1054 383 240 --22686 1150 --
NM_004736chr172146 2028 1965 1553 843 794 250 1390 31976 1924 1919 --
NM_004737chr224885 342 110 97 1938 ----
NM_004739chr111656 --1247 --
NM_004748chr1573794 3086 3034 2570 1058 986 75 --43329 2718 2713 1669 --
NM_004759chr1----12151 --
NM_004774chr1763066 2897 949 620 366 310 21977 129 ----
NM_004788chr1162358 2338 2233 2220 867 390 --12159 --
NM_004789chr91325 188 ----
NM_004798chr2043379 3105 2571 988 --33384 2654 898 --
NM_004807chr222632 787 --32271 2065 647 --
NM_004815chr1104055 3940 3516 1482 1415 1212 1180 773 501 121 --31953 461 64 3904 177 80
NM_004822chr1723132 3056 --13758 --
NM_004824chr651072 380 347 337 299 11263 ----
NM_004842chr641801 1445 1398 716 ------
NM_004849chr631280 636 191 --1613 11694
NM_004850chr231424 1418 1367 ------
NM_004852chr182114027 14014 13568 13030 12108 9977 9931 9533 5549 5487 5178 4359 4353 3945 3337 1472 1140 1131 621 498 186 214161 11049 612849 12659 11969 9616 9211 2703 --
NM_004856chr151105 --1213 1544
NM_004859chr1761952 861 801 693 419 228 --1642 11913
NM_004866chr553734 3341 1794 1748 468 --1633 11336
NM_004874chr83427 378 182 --2492 487 --
NM_004884chr1531733 1517 415 --1440 --
NM_004906chr64202 142 129 111 ------
NM_004925chr91721 --2733 728 --
NM_004932chr541312 1300 390 314 ----11593
NM_004938chr921232 782 --1272 --
NM_004956chr763438 1505 587 577 525 80 1302 11512 --
NM_004973chr671555 1379 1139 544 474 232 145 1303 21519 479 --
NM_004975chr201746 --1995 --
NM_004985chr12154357 4320 4174 4139 3997 3814 3311 2860 2832 1404 1185 545 367 202 83 --12773 --
NM_004992chrX128347 7945 7495 7429 6635 6201 5760 5413 3272 1126 242 186 --58288 7454 5400 5373 1846 11409
NM_004995chr1421504 272 --11513 --
NM_004999chr6154467 4386 4147 3808 1746 1713 1625 1238 1188 1060 1033 995 966 764 654 1753 1450 --
NM_005022chr172206 41 ------
NM_005032chrX2795 396 --11005 --
NM_005045chr73860 844 831 --1639 --
NM_005065chr1465104 4126 3997 3720 1755 1444 --1506 43364 2054 1512 785
NM_005066chr11777 --135 --
NM_005095chr122088 360 ------
NM_005096chrX21123 339 ------
NM_005116chr2094471 4417 4371 4363 4010 3867 3273 1596 948 12781 42805 1830 1221 1107 --
NM_005117chr11----1999 --
NM_005121chr1763687 3379 3297 2532 598 536 ----1140
NM_005124chr63883 309 51 ------
NM_005154chr153577 534 496 ------
NM_005156chr9114931 4646 3697 3406 1441 1273 1141 866 769 582 317 --11157 --
NM_005168chr221613 393 1571 11581 11560
NM_005180chr1051574 1547 1190 417 111 --31490 1343 392 --
NM_005184chr1921604 1538 11399 11532 --
NM_005188chr11188247 7984 7607 7082 5999 5981 5943 5451 3279 2853 2829 2705 2657 2439 2080 1704 1341 187 --17186 22552 867
NM_005194chr20----3465 460 455 --
NM_005202chr132139 1699 143 12043 ----
NM_005204chr102917 830 ----1661
NM_005221chr7----146 --
NM_005222chr72952 695 ----1839
NM_005225chr2021063 484 --21205 1023 --
NM_005229chrX21223 206 --1483 --
NM_005233chr35667 658 554 354 219 --12377 --
NM_005244chr202628 570 --2667 493 --
NM_005256chr113916 838 358 --194 --
NM_005257chr1841299 1257 139 63 --11150 --
NM_005259chr231539 354 330 --21437 975 --
NM_005264chr102290 224 ------
NM_005277chr421268 551 1399 21864 1836 1365
NM_005284chr6----1489 --
NM_005296chrX----1158 --
NM_005302chr7------1165
NM_005316chr114786 350 329 26 ----1841
NM_005328chr83777 510 303 --1276 --
NM_005349chr4----1258 --
NM_005354chr192660 476 --3607 602 597 --
NM_005358chr133492 352 97 ----21182 332
NM_005375chr61962 --1938 1944
NM_005378chr2--1668 ----
NM_005381chr23385 334 300 1174 1324 --
NM_005385chr332602 2184 350 --1749 --
NM_005389chr61188 --3815 569 145 --
NM_005392chr971904 1811 1658 1516 1489 1358 1174 --11428 --
NM_005398chr1031211 1153 457 1201 11196 11188
NM_005399chr1114292 4257 3810 3778 3764 3273 2813 816 747 657 146 --21700 1673 23795 100
NM_005400chr262951 2834 2255 1970 1211 1105 1682 1596 --
NM_005402chr71533 ----11735
NM_005406chr1861537 1331 1197 616 443 132 --1147 --
NM_005417chr20----11876 --
NM_005433chr1852113 1893 1103 525 106 --12640 1816
NM_005436chr1063454 3442 3135 2805 1216 215 12975 21405 1234 13184
NM_005442chr3159 --1125 --
NM_005443chr41142 ----2400 167
NM_005445chr10------1246
NM_005458chr932469 1942 1701 11717 ----
NM_005461chr2061966 1866 1811 1569 1483 1235 --1389 --
NM_005465chr11196 ------
NM_005467chr111127 ----1115
NM_005479chr1021303 409 ----11511
NM_005491chrX22181 1701 --11418 11936
NM_005499chr191467 --1611 --
NM_005502chr943044 2797 2557 2015 --12725 1635
NM_005504chr1296480 6447 6055 2021 1461 1372 543 501 449 11801 ----
NM_005509chr561166 728 674 132 109 101 --21203 276 --
NM_005519chr101428 ----1166
NM_005552chr142530 222 ------
NM_005563chr12189 157 --1635 --
NM_005572chr1----194 --
NM_005574chr112615 514 ------
NM_005576chr15----1212 --
NM_005587chr151383 ------
NM_005595chr14954 945 865 205 1645 --1747
NM_005596chr9104948 4774 3996 1959 1939 1879 1860 1791 1768 1330 15458 11568 --
NM_005599chr111474 --11563 --
NM_005604chr642398 1909 1863 611 --32482 631 626 1218
NM_005607chr8----2733 193 --
NM_005618chr6----1611 --
NM_005632chr1611112 --11117 --
NM_005634chrX4450 161 142 90 ------
NM_005647chrX93244 3147 3139 1091 1076 923 696 430 154 --13126 --
NM_005650chr2221098 415 --21179 1174 --
NM_005662chr81392 --165 --
NM_005664chr155411 370 117 87 61 --21015 199 --
NM_005667chr2173 131 ----
NM_005668chr5114602 4564 4187 3878 3752 2916 1481 1423 1284 521 509 --11823 --
NM_005676chrX----1191 --
NM_005707chr151137 --11271 1274
NM_005717chr181267 1254 1197 1017 1004 501 123 111 --41290 1285 336 331 --
NM_005721chr22961 194 186 167 --
NM_005724chr152667 642 1579 ----
NM_005730chr1282802 2306 1323 1297 1235 1147 967 781 --23026 259 --
NM_005731chr23352 301 115 ------
NM_005737chr292856 2761 2751 2450 2423 2050 1811 763 749 --1724 --
NM_005744chr15----1135 --
NM_005751chr7174 1455 1376 --
NM_005752chr1631224 799 299 --11161 --
NM_005759chr284026 3608 3550 1897 1861 1787 1752 1492 11562 14060 24326 893
NM_005765chrX4668 562 153 76 --150 --
NM_005766chr1341440 1090 346 35 ------
NM_005777chr3143 ------
NM_005779chr543206 793 429 411 --42930 2886 2881 2873 1820
NM_005782chr17----1195 --
NM_005786chr1831264 986 814 ------
NM_005822chr651959 875 856 816 48 ----11688
NM_005828chr1774768 3763 3412 1933 1727 1595 935 24512 3350 24545 113 --
NM_005839chr14891 677 366 340 1351 1691 2916 899
NM_005859chr521508 1233 ------
NM_005862chr34885 338 268 110 ------
NM_005869chr5--1128 1148 --
NM_005871chr1041099 1068 683 676 --1713 1353
NM_005875chr3140 ----1247
NM_005880chr1671571 1071 558 550 474 380 305 ------
NM_005898chr1173018 2894 2210 1052 949 625 125 32137 677 568 ----
NM_005904chr1841470 1436 1377 88 --2417 167 11202
NM_005905chr131157 --1151 --
NM_005907chr671666 1659 1614 1066 659 376 230 --2392 127 --
NM_005909chr584227 3581 3426 3281 3052 2639 1504 1419 ------
NM_005911chr221048 965 --1202 1283
NM_005920chr193845 3789 3755 2834 2393 1339 676 536 200 ------
NM_005924chr751140 899 429 276 137 ----1220
NM_005926chr151422 --1159 --
NM_005933chr1142476 2301 2280 755 1628 ----
NM_005935chr4145083 4857 4808 4694 4235 3821 3645 3570 3334 1440 947 937 482 454 --74726 4512 3960 3668 3663 3658 3653 --
NM_005937chr1743315 1636 1176 221 11020 24179 285 --
NM_005941chr841346 800 533 453 --1565 --
NM_005955chr154916 4574 3929 1872 1025 --25042 832 --
NM_005964chr1721091 545 11204 ----
NM_005966chr221903 1670 1818 11690 --
NM_005996chr1251158 1045 1033 601 520 ----11403
NM_006009chr12251 28 1189 1150 --
NM_006015chr11396 --21106 1101 --
NM_006037chr2114756 4436 4005 3737 3588 3499 1914 1708 1577 1351 1078 1959 54787 4085 4080 4075 892 --
NM_006038chr2022150 287 --5310 302 297 292 194 --
NM_006047chr2083396 2989 2685 2612 2321 451 305 66 --52584 2368 619 577 433 --
NM_006080chr762875 1898 880 770 745 691 1618 ----
NM_006089chrX31890 186 160 --190 --
NM_006106chr11133366 3289 3249 2770 2674 1368 1344 1031 1001 779 738 729 536 --2855 713 12581
NM_006121chr122390 364 --2432 358 --
NM_006135chr111305 --11476 1508
NM_006136chr711233 11362 ----
NM_006148chr1742593 2189 1851 90 --12861 --
NM_006157chr11----197 --
NM_006159chr122570 111 ------
NM_006166chr1242645 2586 1804 1608 1715 1233 --
NM_006167chr832423 2166 1964 --11584 12445
NM_006178chr171591 --21568 1384 --
NM_006183chr122405 166 ------
NM_006194chr14----11053 --
NM_006206chr442917 2911 2402 1134 --32267 2014 1816 --
NM_006216chr22549 525 ------
NM_006226chr261259 922 380 193 80 63 --1519 --
NM_006237chr1332127 1907 501 --11622 --
NM_006243chr14942 378 48 40 1820 11027 --
NM_006251chr582976 2949 2457 2102 1280 505 416 114 1298 11269 --
NM_006252chr1157380 7343 7020 6435 6067 4619 2909 2245 2142 2117 2038 1861 1622 1321 1205 21144 1051 31245 1240 352 16960
NM_006256chr162693 2297 894 385 335 115 ------
NM_006272chr211172 --1133 --
NM_006275chr2052512 1914 1646 351 278 21896 392 11855 1385
NM_006283chr8124318 3654 3215 1991 1975 1486 1408 1069 818 733 302 150 23710 1795 11968 --
NM_006287chr262381 2231 1862 897 161 89 --22603 2490 --
NM_006304chr71126 ----1152
NM_006306chrX105935 4598 2143 1813 1804 1679 1660 1574 1413 405 --25848 3631 --
NM_006307chrX1328 --1365 --
NM_006309chr31103 ------
NM_006313chr1221535 1218 --21592 1334 1280
NM_006315chr483189 2809 2779 1494 1305 1202 850 322 --23964 3853 23930 865
NM_006321chr392181 1639 1375 894 499 425 409 269 158 ------
NM_006325chr121759 --1214 --
NM_006330chr821648 1105 --2113 95 --
NM_006338chr11147 --1623 --
NM_006352chr1122040 1998 1919 1576 1553 1494 460 365 358 283 212 126 11981 11675 --
NM_006363chr203574 410 232 --1207 --
NM_006364chr144901 826 815 808 --11256 11083
NM_006375chrX41430 1419 746 290 11677 --1355
NM_006380chr1773828 3736 3687 3380 3308 3277 274 21674 1244 22996 79 --
NM_006387chr191830 --11238 --
NM_006393chr1073347 2898 2870 1734 1480 1251 425 34467 1022 947 24487 3867 11359
NM_006401chr92392 360 --1403 --
NM_006408chr71262 --21041 247 --
NM_006415chr931240 993 287 --11283 --
NM_006420chr20133238 3164 3097 3060 3045 2991 2616 2504 695 656 551 483 328 --2959 560 23461 2569
NM_006451chr53991 809 707 --1237 --
NM_006460chr1771593 622 284 218 209 169 132 ------
NM_006464chr2134669 4627 4527 4490 3652 3301 2914 1634 921 915 641 487 223 21412 71 1216 --
NM_006465chr152774 429 ------
NM_006469chr131577 561 474 11191 2305 201 --
NM_006479chr122316 243 ------
NM_006526chr2052144 1962 1649 1639 528 --22214 1561 --
NM_006534chr20113198 3157 3106 2680 2544 2198 1230 882 640 242 193 1115 13410 --
NM_006537chr152215 124 ----1204
NM_006538chr274037 3932 3071 2762 1282 308 238 --24095 1600 13502
NM_006540chr861599 1277 1211 1182 1170 488 --31385 1056 397 --
NM_006546chr17126034 5771 5565 5179 5117 4759 4423 2386 1909 1721 407 364 --36545 6039 535 14881
NM_006547chr752049 1668 1624 1504 360 ------
NM_006565chr1681117 1061 873 514 434 428 421 93 ------
NM_006572chr17113336 3202 2746 2735 1301 1190 1019 611 49 40 22 1215 3707 567 61 12283
NM_006582chr1------133
NM_006595chr1132048 498 285 1415 2627 264 --
NM_006599chr16158180 7929 6793 6313 6019 5727 3130 2968 1918 1752 1654 1358 1197 811 403 --36943 1689 1511 --
NM_006614chr3123286 3067 1392 1154 1102 1087 1013 941 837 751 693 212 --33470 2236 199 --
NM_006624chr1051966 1931 1693 588 453 1638 ----
NM_006628chr1563276 1167 1108 736 342 112 12843 54586 4581 4576 4563 310 --
NM_006644chr13------1490
NM_006667chrX41141 439 283 240 1103 11182 --
NM_006699chr132414 856 289 --137 21850 235
NM_006704chr134425 412 366 130 ------
NM_006716chr751332 1264 996 207 99 --1267 --
NM_006729chrX54264 2237 2118 1773 1030 --34739 4248 598 15490
NM_006732chr1911351 --1185 --
NM_006734chr63537 57 51 --1325 --
NM_006754chr741225 887 136 101 ------
NM_006762chr1159 --21316 68 --
NM_006763chr162090 1769 843 668 645 588 --2764 750 --
NM_006775chr622798 2151 22198 645 32904 2172 2135 --
NM_006777chrX22398 27 1174 2423 32 11890
NM_006786chr1----1150 --
NM_006788chr1832132 1357 330 --22124 1782 --
NM_006791chr156630 425 419 254 215 118 ----185
NM_006810chr3----152 --
NM_006811chr20----3666 636 106 --
NM_006813chr61227 --1272 --
NM_006815chr1251121 1064 944 541 307 --2996 550 --
NM_006823chr831292 1124 447 --1495 --
NM_006826chr231217 1034 145 --1328 --
NM_006827chr1483195 3077 3004 2971 1147 989 335 220 1574 ----
NM_006836chr12152 1570 ----
NM_006838chr125387 278 214 91 44 ----2343 284
NM_006842chr11----1122 --
NM_006851chr1232196 923 824 --12794 --
NM_006868chr1853040 2962 1950 478 121 --22272 1985 --
NM_006874chr421184 961 11015 11133 --
NM_006885chr16194031 3393 3109 2904 2898 2892 2773 2688 2682 2571 1540 1504 1494 1302 656 557 542 527 153 13839 22967 604 --
NM_006888chr1453195 2707 2649 2235 726 12412 1911 --
NM_006902chr143297 2365 1267 403 12521 1421 --
NM_006908chr771450 1291 1099 1065 963 188 53 --11490 --
NM_006912chr162453 2116 1755 1617 935 203 --1241 --
NM_006914chr92412 200 --21108 274 --
NM_006920chr231806 1606 109 --31690 691 677 --
NM_006927chr1611737 --1307 11661
NM_006939chr142757 323 --21162 1079 --
NM_006940chr1241333 1297 627 438 --3443 407 399 --
NM_006948chr2152497 2464 2346 1918 948 1988 22334 151 --
NM_006951chr102100 38 1583 2725 242 --
NM_006963chr1051081 979 774 478 92 --1307 2341 244
NM_006981chr962879 2431 1942 1898 338 210 --2873 375 --
NM_006994chr62796 209 ----136
NM_006999chr541399 467 428 221 ------
NM_007011chr15136037 5962 5187 5176 4665 4653 4439 1844 1759 1193 944 587 279 --46583 6578 5339 338 11185
NM_007014chr16----11739 --
NM_007019chr20----1115 --
NM_007026chr172387 115 ------
NM_007038chr21166091 5888 5256 5006 4849 4195 4049 2315 1853 1805 1786 1761 1683 1356 880 563 14570 35564 1088 1056 25725 5072
NM_007039chr1432094 938 663 --1899 --
NM_007040chr1941073 1006 771 434 --11058 --
NM_007050chr2098118 7898 5809 2496 1909 1515 1125 700 306 --27253 2428 --
NM_007054chr5103901 3719 3592 3561 3530 3455 2410 972 834 605 --43569 1507 560 383 --
NM_007065chr191344 ------
NM_007084chr1331330 389 365 1314 21226 289 --
NM_007085chr372616 2509 2353 2245 1000 721 211 --1143 --
NM_007106chr1332648 1712 223 --21904 1770 --
NM_007111chr134917 667 653 246 --1629 1194
NM_007125chrY41044 469 462 67 --1221 1481
NM_007129chr132763 755 ----11040
NM_007137chrX115461 5445 5308 4403 4384 4024 1606 1309 1260 1159 714 ------
NM_007144chr1721304 297 ------
NM_007146chr1762768 2484 2318 1960 887 466 --1757 --
NM_007170chr12807 696 ------
NM_007174chr1282028 1891 1740 1650 1480 839 663 626 --11546 --
NM_007191chr121713 --1218 --
NM_007204chr12563 505 ----1163
NM_007212chr1102099 1833 1810 1685 1524 1443 826 773 605 246 11418 11966 --
NM_007214chr61401 --157 --
NM_007235chr12----1127 1105
NM_007236chr1522421 482 --12138 --
NM_007246chr41276 --1802 --
NM_007249chr13109272 9233 8762 7939 7175 6207 3676 3417 664 251 --38173 687 671 --
NM_007260chr12758 215 ------
NM_007269chr11226 --2533 195 --
NM_007275chr33804 390 324 ------
NM_007276chr751019 971 733 441 373 ----1126
NM_007278chr17----1284 --
NM_007331chr472720 851 824 781 743 489 120 --12487 --
NM_007345chr1842253 2152 1759 48 22304 2187 22355 1587 --
NM_007347chr1552638 2629 647 431 131 --23103 484 --
NM_007349chr73407 108 97 --1372 --
NM_007358chr152000 1941 1481 1263 663 --21250 396 --
NM_007359chr1741702 1689 1395 1107 --1376 --
NM_007373chr1071590 1524 1491 1345 533 395 220 11621 --1520
NM_007375chr182754 2386 2033 972 922 628 383 193 --21838 472 --
NM_012081chr561273 1018 889 881 873 406 ----11416
NM_012083chr102850 841 --11372 --
NM_012089chr131520 1150 239 ----1148
NM_012090chr141050 977 817 335 --1516 --
NM_012092chr251713 1683 597 341 231 --1128 --
NM_012096chr353775 2927 1508 1311 378 --13500 22367 1016
NM_012098chr941003 478 179 132 --11503 --
NM_012115chr66622 583 529 390 209 69 --1411 --
NM_012120chr612745 --22637 176 --
NM_012153chr1122474 2196 --1369 --
NM_012156chr2023158 2658 ----1934
NM_012160chr65467 172 86 72 65 --2417 37 --
NM_012161chr431075 377 265 --2931 115 --
NM_012164chr9137359 7246 7104 6999 6239 5963 5846 5502 5457 5392 4857 181 53 --77072 6974 6065 4910 4697 1369 143 --
NM_012175chr113863 278 184 --2792 178 1329
NM_012199chr174662 3875 3785 3670 3278 590 544 1728 12915 14550
NM_012229chr1041315 595 565 169 --1163 --
NM_012232chr1762228 2005 1948 1925 1690 716 ------
NM_012234chr3103715 3560 3526 3344 2895 2515 2458 1205 331 213 2818 465 33597 2444 338 --
NM_012238chr1061754 1736 1622 1594 1361 142 --21677 323 --
NM_012249chr262973 2896 2556 609 550 422 23595 331 12489 --
NM_012259chr611179 ----11372
NM_012262chr1145257 4681 4504 4000 3789 3337 1707 1649 1542 1022 923 911 464 332 --14688 14942
NM_012287chr3114003 3635 3542 1480 1230 925 806 549 490 430 82 13257 24291 3514 13800
NM_012290chr241519 572 523 82 ------
NM_012294chr774073 3904 3883 3486 2902 1529 74 --21054 709 12944
NM_012297chr452410 2076 2062 1794 80 12023 ----
NM_012300chr5102398 2269 2049 1842 1776 1005 987 943 562 315 11937 1370 --
NM_012301chr741976 1824 1744 228 ------
NM_012302chr121173 882 ----1825
NM_012307chr182894 819 --1696 --
NM_012309chr1174858 3313 3231 1592 687 399 296 --14456 14746
NM_012321chr192211 202 --1123 --
NM_012322chr7----3453 322 35 1128
NM_012325chr2021082 569 --11271 --
NM_012329chr1731580 1268 1071 --11241 --
NM_012330chr1061811 1781 1574 1497 347 180 ----11392
NM_012347chr631966 1129 449 --12887 1246
NM_012384chr2032420 1547 702 --22437 2425 --
NM_012388chr1563164 2368 2047 2017 1019 21 12525 32701 2036 2031 12959
NM_012394chr1----1115 --
NM_012395chr7103412 2892 2606 1133 879 684 455 348 249 172 12214 22463 2175 11250
NM_012402chr112898 143 ------
NM_012408chr201217 1182 2818 382 --
NM_012410chr161509 1144 ----
NM_012417chr17153 --191 --
NM_012420chr1051898 1588 1573 285 63 1921 --1457
NM_012428chr1531023 679 238 --1973 --
NM_012433chr2------158
NM_012448chr1751017 966 521 495 65 --11552 --
NM_012464chr442932 2188 1833 91 ----11913
NM_012471chrX21493 170 11708 1296 --
NM_012479chr782594 2463 2049 2035 1830 702 441 402 --12424 --
NM_013230chrY31695 1144 599 21756 1659 --11199
NM_013243chr1541463 502 485 363 ----21003 270
NM_013255chr7128758 8582 7902 7821 5496 3151 2636 2481 2105 2058 1899 972 --26456 1981 --
NM_013261chr453189 1469 1350 638 260 ------
NM_013283chr52866 83 ------
NM_013293chr72278 158 --1258 --
NM_013302chr16134730 4508 4452 4062 3838 3643 3301 1242 1049 1014 933 652 266 13787 24549 739 21692 304
NM_013313chr2243146 2245 928 326 --22749 37 --
NM_013322chr731603 510 283 11616 11194 --
NM_013323chr1741211 905 327 234 ------
NM_013374chr372659 2626 2264 1233 788 623 583 --22737 501 --
NM_013382chr1432196 1794 434 12178 --12419
NM_013386chr11391 --1308 2729 206
NM_013390chr961753 1684 1656 1569 1557 293 ------
NM_013396chr212292 259 --11208 --
NM_013397chr611093 ------
NM_013401chr112971 772 ------
NM_013433chr1931842 1352 724 --21382 575 --
NM_013437chr851382 1231 387 346 255 --11014 --
NM_013438chr951697 1279 467 305 72 ------
NM_013446chr761070 982 536 481 284 182 --21282 366 11342
NM_013448chr143631 612 185 --1570 --
NM_014001chr171198 1111 11635 --
NM_014007chr93923 787 346 --1426 --
NM_014011chr262366 2324 2265 2224 696 449 ------
NM_014021chr193460 3302 3205 3029 2390 2341 966 463 186 --1491 11170
NM_014023chr1032832 2452 629 --32880 2875 117 --
NM_014038chr72151 93 --1162 --
NM_014048chr1675081 4789 4634 4345 4181 1629 1231 --24816 1553 --
NM_014071chr20----1426 --
NM_014079chr31315 1404 --1879
NM_014112chr875400 4745 3585 2066 1193 845 628 --32055 2042 1913 --
NM_014117chr1652491 2260 1824 530 351 --12002 --
NM_014154chr331073 167 114 --11464 1380
NM_014181chr28820 777 738 672 478 472 466 459 11986 1485 12028
NM_014213chr22226 59 ------
NM_014216chr1441292 515 486 116 11576 11667 --
NM_014248chr221110 --134 --
NM_014253chrX32303 888 43 --31704 835 596 1732
NM_014268chr18------1435
NM_014280chr12126 109 --2766 290 1945
NM_014283chr151348 1330 1247 333 239 --11008 1478
NM_014292chr2241949 1907 1858 1704 --1103 --
NM_014293chr2234115 4100 1074 --24012 2655 12537
NM_014294chr861005 985 538 452 254 45 ------
NM_014319chr1261505 1385 616 572 241 83 ------
NM_014325chr1261952 1805 914 438 391 242 --22151 1546 --
NM_014341chr61509 ------
NM_014344chr11------1789
NM_014345chr61764 1345 --1328
NM_014368chr951436 1371 1325 460 265 --22119 2093 --
NM_014372chr141837 1820 1321 774 151 ----
NM_014388chr176091 6043 2108 1239 593 586 467 36112 4537 1621 24097 3834 --
NM_014390chr72114 69 ------
NM_014400chr192161 110 ------
NM_014405chr1732346 462 149 --1602 1237
NM_014421chr422059 1414 ------
NM_014423chr575208 5097 3917 1899 1082 210 140 24978 4615 45598 5185 1883 1596 11637
NM_014437chr1----1953 --
NM_014445chr351954 1738 1663 1620 525 12432 ----
NM_014452chr62937 916 ------
NM_014456chr1061823 1743 339 294 187 169 --2439 104 --
NM_014458chr131392 233 65 2241 52 ----
NM_014491chr751083 942 785 287 187 --1880 --
NM_014494chr164905 858 771 130 22317 2254 1722 --
NM_014517chr391979 1937 1712 1702 1656 1638 1507 1222 695 11494 21991 689 --
NM_014548chr153318 300 190 1408 ----
NM_014572chr1341447 1124 562 504 --196 --
NM_014573chr1731576 1181 375 11809 31828 1449 344 --
NM_014591chr10----11307 1865
NM_014612chr931435 1269 1101 1451 ----
NM_014613chr553109 2529 2242 1102 365 --1534 --
NM_014614chr221089 1060 ------
NM_014615chr16102585 1375 1357 1013 964 914 896 825 817 414 --1926 --
NM_014635chr231302 1147 637 ----11615
NM_014647chr1642204 593 347 144 1169 22258 2176 --
NM_014666chr551192 1119 1113 950 142 1987 2980 975 --
NM_014667chr3112396 1726 1525 821 803 646 621 615 369 363 158 154 ----
NM_014669chr16----2105 100 --
NM_014671chr771606 1426 602 563 323 317 199 ------
NM_014674chr393716 3299 3007 2691 2439 1500 1298 1128 1009 --43864 2586 2574 999 --
NM_014679chr1121015 536 ------
NM_014682chr842158 820 773 236 --22136 2088 --
NM_014686chr1922260 2164 --21994 1965 --
NM_014702chr683447 3431 2820 2562 2329 942 727 137 1434 22775 2415 --
NM_014705chr761845 1769 1736 1720 1599 579 --21329 545 --
NM_014707chr711513 --22230 1810 --
NM_014711chr16112094 1988 1925 1898 1848 1800 1723 1498 1372 1366 821 ------
NM_014712chr161212 --1243 --
NM_014720chr1051739 1640 1385 135 122 --3719 150 145 21771 1580
NM_014723chr201104 --22097 1024 --
NM_014729chr85724 645 459 206 48 12163 21856 65 --
NM_014730chr12145293 5269 4627 3404 2022 1816 1755 1680 1666 1216 1020 766 611 64 35142 3372 3287 25287 3938 --
NM_014731chr2031794 1710 1376 ------
NM_014746chr294195 3661 3556 2852 1321 1108 777 632 452 --34275 1493 871 --
NM_014752chr1161914 604 557 319 259 241 1715 1120 --
NM_014755chr2134001 3890 3295 2767 2651 1523 1486 1449 1082 1071 821 709 588 13024 --1147
NM_014757chr522369 21 --22218 2103 --
NM_014761chr1671151 1073 986 899 744 174 45 ------
NM_014764chr1231106 308 71 ----11096
NM_014770chr121818 ------
NM_014772chr1893598 3281 2890 2836 2730 2438 952 702 321 ----1727
NM_014774chr1103235 3151 3118 2971 2956 2596 2557 2508 2502 2121 1503 ----
NM_014779chr361082 1003 940 821 437 295 --1101 --
NM_014782chrX182 ----1340
NM_014786chr1121187 1181 --11166 --
NM_014787chr142798 1907 1792 104 --12183 --
NM_014791chr91230 176 ----
NM_014795chr231287 1188 919 --11135 --
NM_014803chr1062965 2668 2637 2414 2041 1184 1200 ----
NM_014810chr122897 607 --1984 --
NM_014813chr12394 98 1485 ----
NM_014822chr41152 191 1578 --
NM_014824chr1151976 1561 1315 287 67 1164 --11382
NM_014830chr12103818 3306 3008 2686 1513 1284 1111 646 262 239 --1838 12771
NM_014832chr1331404 844 256 11531 1616 --
NM_014835chr2031841 1621 886 11600 ----
NM_014838chr2282720 2402 2301 2116 408 304 287 194 --11157 --
NM_014839chr162455 2335 868 789 667 259 --1573 --
NM_014841chr63997 352 281 --1950 --
NM_014844chr1431489 1141 465 ------
NM_014859chr1721329 189 11316 1960 --
NM_014877chr17237733 7634 7221 6751 6581 6272 6205 5903 5665 5181 5070 2591 2328 2205 1967 1948 1740 1134 757 730 662 103 33 --26888 135 11236
NM_014898chr1922409 2264 ------
NM_014901chr511555 --1764 --
NM_014903chr1242309 1565 668 35 ------
NM_014904chr1083713 3140 3020 2961 2928 2624 2616 539 --1902 13812
NM_014905chr241843 1531 763 641 --1297 --
NM_014906chr17113914 3822 3501 3424 3397 1237 1190 832 797 721 165 --12658 --
NM_014912chr1043250 2329 2167 2147 --22737 632 1380
NM_014917chr12973 962 --1846 --
NM_014918chr1571614 1455 1329 1248 1060 432 269 --51376 1123 582 577 409 --
NM_014920chr673756 3220 2390 2331 627 544 279 --13261 --
NM_014926chr331028 1006 28 1405 ----
NM_014932chr3--1146 11806 --
NM_014939chr18--3600 588 478 --1576
NM_014943chr83914 438 402 --11024 --
NM_014949chr12997 660 123 ----
NM_014959chr1943209 2595 1280 858 12619 ----
NM_014961chr452201 2172 1743 872 185 ------
NM_014969chr12987 177 --1950 --
NM_014978chr1031663 1458 147 11829 ----
NM_014982chr1495044 4349 3944 3494 2041 2033 1654 1124 307 --1386 --
NM_014988chr472556 2324 2182 1892 1782 520 167 --2351 184 11844
NM_014989chr612033 --5820 480 431 414 113 --
NM_014990chr141892 --1854 11171
NM_014991chr442904 2717 1192 563 --32859 2834 2405 --
NM_014994chr1512362 ----12274
NM_014996chr341011 701 664 82 ------
NM_015000chr1242952 2880 2535 415 1324 23130 1932 12115
NM_015001chr15980 964 763 325 207 --1985 --
NM_015002chr1222000 615 --12103 --
NM_015017chr121251 96 --21256 254 --
NM_015020chr1643777 3236 2710 2591 ----1121
NM_015023chr131644 1394 268 1483 2123 79 --
NM_015025chr292271 2242 966 602 550 353 337 153 51 22094 415 ----
NM_015032chr1382754 2024 1989 1124 1089 456 169 37 22352 1923 11064 11801
NM_015035chr20116310 5211 2427 1930 1839 1728 1611 1587 1227 746 711 24364 947 25959 628 16322
NM_015042chr1564312 3886 3792 3477 3185 563 13065 1499 11317
NM_015045chr1071994 1500 1403 484 478 303 295 --21884 1879 --
NM_015049chr262850 2443 2436 865 805 617 --23292 2574 11103
NM_015050chr631102 992 503 --1412 1528
NM_015061chr92215 88 1838 --1825
NM_015069chr162605 233 ----1523
NM_015074chr1114813 4274 1891 1656 1549 1502 1472 937 887 425 244 --11869 --
NM_015076chr6134455 3958 3724 3658 3384 1806 1499 1490 1370 1054 811 650 380 13494 14435 --
NM_015082chr541690 1048 504 114 ------
NM_015092chr16114680 4267 4011 3877 3728 3698 3363 3356 3136 1305 1163 --23582 3028 --
NM_015093chr681818 1776 1721 1619 1561 1196 660 376 ------
NM_015100chr172031 1961 1667 1597 1581 1461 408 ------
NM_015101chr112102 --32214 95 90 --
NM_015107chrX92381 2066 2060 2034 1681 1554 764 710 120 --11989 --
NM_015110chr952384 1909 951 766 120 --12514 1645
NM_015137chr8102544 2059 2037 1837 1038 491 411 314 289 158 --1254 2768 219
NM_015138chr1582804 2798 2650 2525 1934 1728 1055 280 --21034 1026 --
NM_015143chr451319 1301 324 284 235 --1100 1106
NM_015153chr63589 543 261 --1669 --
NM_015156chr14113875 3701 3307 3015 2741 2562 1580 1501 1475 895 716 --11560 --
NM_015161chr1641336 1272 354 272 --11547 1237
NM_015170chr852278 2055 1988 1868 1439 11709 12239 --
NM_015172chr161270 1181 1156 1142 1116 190 ------
NM_015176chr141715 1511 626 496 11326 --1241
NM_015180chr142739 563 --2791 786 --
NM_015184chr31677 --173 --
NM_015185chrX72671 717 706 435 353 324 206 --32841 2156 217 --
NM_015186chr92441 120 --149 --
NM_015191chr1132654 1062 952 --1507 11958
NM_015192chr2063009 2655 2607 2464 337 240 --22223 509 --
NM_015196chr4------148
NM_015198chr72535 93 --2491 222 --
NM_015205chr1325162 3996 15096 14499 --
NM_015206chr1513334 21103 193 1813 13016
NM_015213chr114710 682 642 184 --1791 --
NM_015215chr1143170 3159 2502 2470 2255 2113 1938 1134 979 585 149 64 52 40 12186 1186 13131
NM_015216chr531355 1085 94 ----1566
NM_015229chr1721151 178 --1450 --
NM_015245chr662731 2725 2584 859 530 272 ------
NM_015260chr19------11567
NM_015265chr282541 1712 1651 557 98 92 85 52 --1141 --
NM_015267chr1211435 --1689 1383
NM_015268chr31466 --1741 --
NM_015270chr1232291 2007 579 --11456 --
NM_015271chr484346 4233 4059 3880 3874 1380 844 830 --34005 3670 3277 --
NM_015272chr161152 11499 ----
NM_015275chr1272011 1587 1578 1369 666 520 143 1494 --1639
NM_015277chr1811299 --21241 673 11502
NM_015291chr163462 3456 3140 2735 1412 1183 --23445 3199 --
NM_015292chr122760 668 --1248 1550
NM_015296chr132951 182 --1158 --
NM_015305chr1431898 1285 346 ----11914
NM_015310chr8168302 8275 8111 7915 7513 7230 6439 6344 6188 5872 5248 5146 2020 1780 1415 313 ----1189
NM_015313chr11124712 4455 4242 4169 3897 3698 3366 3225 3118 1757 786 285 34519 3493 3210 1398 --
NM_015315chr5143459 3428 3388 3250 3052 2900 2466 2460 2454 2448 2237 959 722 693 --22907 885 --
NM_015317chr242864 1111 1000 886 --21793 836 --
NM_015318chr191118 1508 11459 1183
NM_015323chr641563 1397 1307 482 --11642 --
NM_015326chr141116 1079 1025 513 --22923 401 --
NM_015344chr861970 1600 872 672 276 238 --1628 --
NM_015349chr65962 921 702 670 464 --42943 2908 509 299 --
NM_015353chr1741927 717 672 227 ------
NM_015358chr2171217 1103 956 888 335 300 78 --1973 2236 179
NM_015374chr2211175 --11438 --
NM_015379chr72258 212 --199 --
NM_015393chr493183 3013 2934 2647 1157 995 965 135 129 --2333 113 --
NM_015396chr311230 --3214 209 120 --
NM_015397chr961906 1421 594 572 191 101 --21843 180 --
NM_015429chr31768 --1729 1307
NM_015435chr811108 --1245 --
NM_015443chr1731445 189 158 --21390 171 --
NM_015454chr4199 ----1253
NM_015455chr5144142 3221 2754 2747 2618 2545 2522 1574 1277 1056 715 634 350 193 ----12845
NM_015458chr8133709 3684 3503 3232 3225 1815 1719 1380 1112 942 930 534 434 23638 764 24972 1026 --
NM_015461chr182756 58 1632 ----
NM_015464chr73111 89 44 --1896 2728 120
NM_015470chr22261 244 ------
NM_015475chr24974 852 803 338 1354 21079 434 --
NM_015477chr152783 230 --1690 1836
NM_015484chr1----1228 --
NM_015493chr1911949 11960 21540 1444 11736
NM_015496chr8----1263 --
NM_015497chr1511088 --2820 775 --
NM_015508chr31147 163 2990 471 --
NM_015509chr1221085 254 11098 ----
NM_015530chr23990 915 645 ------
NM_015550chr773537 2922 2906 2431 1179 993 977 --21093 959 --
NM_015554chr1572686 2429 2423 2397 2372 1078 830 11940 11818 1704
NM_015557chr153661 3534 3192 3132 2763 --13647 --
NM_015565chr2131700 1387 375 --1184 --
NM_015568chr2064097 3605 2841 1004 780 115 ------
NM_015569chr154429 3957 3073 1907 1270 13357 54628 4573 952 637 302 --
NM_015570chr751623 1488 1278 742 729 --1164 --
NM_015576chr342665 2487 1808 30 ----136
NM_015578chr1961799 1358 1292 807 141 130 --11497 1390
NM_015627chr111835 11887 ----
NM_015635chr911493 --196 178
NM_015642chr32125 119 --196 --
NM_015651chr962224 1953 1589 1511 694 516 --11378 --
NM_015655chr202585 299 --154 1764
NM_015678chr1321667 171 1357 1243 --
NM_015686chrX22470 746 --12478 --
NM_015687chr61472 ----1170
NM_015850chr872060 2028 1852 1676 1629 830 792 --2527 371 12242
NM_015878chr842216 2201 681 571 1620 --2647 472
NM_015879chr18128644 8623 8461 7241 6727 5923 5810 5546 2981 2546 2267 573 --48649 8225 2769 395 --
NM_015904chr25829 813 569 268 146 --1532 --
NM_015906chr174675 3140 3107 1752 1030 537 460 --14827 13688
NM_015981chr573187 3173 3049 2396 739 708 628 ------
NM_016009chr184941 4608 3785 1783 1286 485 288 207 11806 14785 21642 562
NM_016018chr812594 11084 ----
NM_016019chr741069 735 357 157 ------
NM_016021chr642858 2593 340 254 --1235 22662 814
NM_016022chr11135 --1140 --
NM_016048chr53972 702 234 1964 1273 --
NM_016078chr173436 421 105 11100 123 --
NM_016087chr721514 1414 ------
NM_016107chr54509 403 395 57 ----11373
NM_016129chr41382 ------
NM_016131chr262249 2095 1522 782 697 678 ------
NM_016132chr15133367 3332 2976 2939 2636 2337 2281 1326 1131 929 366 267 237 1989 23357 38 --
NM_016133chr231440 1432 1341 ----3652 577 376
NM_016141chr33743 619 31 ------
NM_016162chr121636 --1324 --
NM_016179chr133222 198 192 --1181 --
NM_016201chr332200 2096 1424 --11750 --
NM_016206chr3148681 8411 8068 6712 6238 5965 5932 5560 3032 1040 986 657 577 261 1709 88472 8103 7398 7393 7388 7383 7370 599 38309 7404 778
NM_016221chr522170 446 --12355 --
NM_016224chr661608 1358 839 780 737 36 ----12158
NM_016231chr1741532 666 233 195 --1316 --
NM_016255chr673045 2927 2874 2291 1281 1231 799 21343 318 1390 --
NM_016257chr133503 1388 349 13456 ----
NM_016258chr13310 289 258 ------
NM_016269chr431184 1023 868 ------
NM_016281chr122779 348 ------
NM_016284chr161289 --1896 --
NM_016297chr233711 3433 2850 --12776 --
NM_016308chr161929 1894 1859 1844 1389 558 11736 11763 21971 48
NM_016322chr983118 2826 2301 1998 1254 1006 476 337 --43238 1280 488 483 13124
NM_016351chr71431 1520 1573 --
NM_016382chr11718 --146 1145
NM_016396chr1562931 2829 2816 2280 452 115 --22510 611 --
NM_016401chr11----1244 148
NM_016422chr1183108 2816 2709 2378 871 727 623 203 1761 2588 323 --
NM_016424chr174523 472 427 366 --1204 --
NM_016426chr2231680 772 379 --1576 --
NM_016436chr2022479 532 --1972 12673
NM_016441chr262361 2355 2138 2131 681 209 --21785 867 --
NM_016442chr552277 2182 752 624 249 ----22173 43
NM_016453chr31429 --177 1525
NM_016467chr22543 500 --11317 1149
NM_016472chr1441173 1134 106 100 1296 11379 --
NM_016519chr43357 173 50 ------
NM_016525chr91812 --1869 --
NM_016530chr1564074 1125 1100 622 602 251 --33002 1520 1258 13008
NM_016531chr453337 2667 1194 844 694 ------
NM_016559chr341264 1089 996 559 --11302 --
NM_016561chr16--153 3744 630 123 --
NM_016575chr12135304 5266 4517 4008 3820 3735 3521 2195 1727 1551 1277 1134 85 1538 53464 1261 1256 1155 1150 13935
NM_016588chr62744 178 ------
NM_016605chr532660 2226 672 ----12366
NM_016607chrX31672 1341 212 21382 100 11650 --
NM_016620chr151437 549 326 220 201 --21063 423 --
NM_016622chr21757 --12100 11729
NM_016626chr181465 1448 ----
NM_016628chr101561 128 1234 --
NM_016652chr2051464 1449 1279 629 208 --126 --
NM_016937chrX5978 953 626 345 221 ------
NM_016952chr11163921 3693 3487 3436 3374 3195 3092 3079 3024 2727 1330 1323 1008 450 283 191 24071 644 33351 1349 237 --
NM_017412chr83489 147 101 --1322 --
NM_017420chr14113806 3797 3282 3048 2418 2409 1095 966 736 396 105 11320 --13323
NM_017423chr462214 1537 511 283 245 202 --22052 2026 --
NM_017426chr41636 --1510 --
NM_017437chr14112303 2015 1999 1977 1772 1667 867 794 625 536 515 --41988 1682 86 81 --
NM_017443chr931092 577 415 11021 21551 200 --
NM_017482chr231539 1525 460 --1486 --
NM_017514chrX1929 --1178 --
NM_017515chr1121303 627 11609 ----
NM_017540chr533050 401 238 ------
NM_017542chr141374 751 687 512 --21521 283 --
NM_017548chr331453 1367 791 --1800 1834
NM_017551chr1032081 1033 755 1716 12608 --
NM_017572chr19183 --1238 --
NM_017580chr1061676 655 649 600 485 131 ----22346 638
NM_017583chr1131168 1128 343 11638 --1287
NM_017593chr41325 --2460 418 --
NM_017596chr123536 3413 --24582 1375 --
NM_017610chr1542114 2075 350 319 --11491 --
NM_017628chr4105072 4841 3833 3551 1651 1638 1627 1621 1026 191 --35114 4880 4850 --
NM_017629chr121792 783 ------
NM_017633chr693358 3301 3027 2508 1278 1155 1147 531 344 --2552 110 13754
NM_017634chr831563 308 44 ----1144
NM_017637chr9179274 8756 8460 8164 7881 6085 3658 3436 2513 2503 2465 2429 2028 759 715 222 191 31471 488 348 99263 9253 8339 7568 3052 1818 1676 1671 1565 13318
NM_017644chr3115024 4992 4710 4686 4443 4326 4075 3976 1668 1336 624 --55122 5067 3366 1085 841 --
NM_017650chr795985 5595 5564 2214 1836 1808 1701 1683 1345 11314 31918 300 253 15094
NM_017666chrX3699 337 252 12195 21779 329 --
NM_017672chr1541336 1119 373 28 ----1291
NM_017694chr231295 708 523 1721 11812 1785
NM_017700chr4198 --1125 --
NM_017709chr1134045 4017 3910 3653 2795 1634 1623 1163 1050 973 898 371 123 14290 33330 3213 1470 11461
NM_017736chr1693163 3135 2966 2948 2866 2747 2693 1081 487 ------
NM_017741chr432825 2001 1729 --11807 --
NM_017745chrX2255 163 --1240 --
NM_017752chrX3579 507 170 --1866 --
NM_017753chr93992 755 27 --2289 128 --
NM_017754chr6104441 3853 3720 3644 3249 1109 984 917 471 150 ------
NM_017758chr1781307 1198 373 147 116 109 102 74 --1351 166
NM_017769chr1483272 2518 2495 2429 2158 2121 540 324 ------
NM_017778chr84301 287 170 93 --21111 1088 --
NM_017798chr201360 --1962 --
NM_017799chr1441504 1495 686 555 ------
NM_017811chr962554 1009 999 946 699 332 --13025 --
NM_017824chr1092697 2503 1714 1068 557 375 334 263 192 ----160
NM_017845chr4--1588 1249 --
NM_017848chrX94410 4377 4268 3319 1553 576 548 459 356 --11658 --
NM_017851chr152945 853 ----1437
NM_017902chr1045447 4068 3533 2213 13503 14694 --
NM_017907chr11----1494 --
NM_017913chr9----3183 178 140 --
NM_017943chr142754 264 ----1379
NM_017944chr1162199 2095 1989 1932 565 36 22453 979 11190 1173
NM_017955chr1421192 1153 --1362 --
NM_017964chr21263 ------
NM_017994chr783006 2225 894 657 590 583 575 322 12773 31003 565 204 --
NM_018027chr1063235 2940 2195 2041 1053 206 ------
NM_018032chr162342 316 --2880 305 --
NM_018061chr161621 406 281 242 179 55 --1357 --
NM_018078chr44975 963 653 209 ----1846
NM_018084chr2103248 2835 2547 2497 2418 808 739 373 357 314 --1517 --
NM_018092chr1661637 1551 1246 1147 433 146 ------
NM_018094chrX----1141 --
NM_018098chr331127 1100 291 ------
NM_018120chr851413 1217 1178 430 230 --2454 204 --
NM_018121chr1083209 3057 2694 2670 2502 2469 1075 593 --12231 1695
NM_018124chr1652495 2488 2474 1802 774 --31963 721 603 22437 826
NM_018133chr362127 1815 1729 1643 1520 121 --31650 1469 311 11371
NM_018142chr8----1235 --
NM_018149chr17390 68 47 ------
NM_018157chr1273247 3152 2259 2208 2089 165 33 --198 --
NM_018159chrX41501 1465 639 239 --1603 --
NM_018169chr121446 --1364 --
NM_018179chr123236 204 56 1244 ----
NM_018181chr1851900 1254 1243 747 429 --41724 1297 1248 280 --
NM_018184chr341850 1549 754 658 --1719 --
NM_018201chr932468 1591 1008 1990 12487 --
NM_018202chr11336 --2880 358 --
NM_018211chr121617 601 --11658 12209
NM_018216chr1152 ------
NM_018243chr483837 3451 3262 1360 301 245 146 40 --23576 3378 --
NM_018247chr693077 2957 2009 1974 924 905 862 724 252 1574 11080 1947
NM_018254chr13862 569 185 --22136 298 11509
NM_018266chr341121 972 938 326 ----1119
NM_018270chr201681 --1739 --
NM_018287chr1011254 --21223 182 --
NM_018293chr372409 2266 2142 1189 1074 813 436 --21899 665 12365
NM_018312chr1151795 1351 821 811 585 --22000 778 --
NM_018318chr123946 907 89 ------
NM_018351chr1243254 691 333 174 --23161 139 14456
NM_018354chr203229 217 28 --1203 --
NM_018364chr194023 3956 3798 3618 3570 3430 1380 371 237 --13501 --
NM_018373chr1476397 4856 3972 2484 1986 1671 1663 --26191 6186 --
NM_018383chr241777 1672 1396 553 11318 1233 --
NM_018387chr9182 --1371 --
NM_018388chrX21427 381 --1516 --
NM_018394chr331347 1217 348 --11604 --
NM_018403chr3144065 3833 3720 3677 3490 3156 1490 1091 849 605 427 326 273 142 1448 13879 1209
NM_018409chr443121 697 419 165 --12728 13239
NM_018416chr1252631 2619 1641 436 207 --12563 1762
NM_018433chr21551 --1369 --
NM_018439chr1842188 1945 945 682 --12611 22340 2227
NM_018440chr8238524 8432 8360 8315 8125 7895 7342 7302 7018 6764 6472 5579 5389 3175 3143 3055 1903 1825 1081 736 555 525 102 --22177 2155 28438 2741
NM_018465chr9------1258
NM_018489chr162129 2034 1994 1741 767 694 ----12279
NM_018553chr1731558 1276 330 --11229 --
NM_018557chr231469 1336 131 --184 1531
NM_018566chr1114965 4957 4442 3970 3146 1934 1928 1580 1479 1077 823 --24977 1030 24090 3661
NM_018584chr1----11063 1406
NM_018590chr1051655 1614 1140 1107 600 --1191 1258
NM_018602chr152309 199 --11045 --
NM_018638chr12195372 4304 3911 3701 3620 3610 1930 1830 1718 1539 1393 1224 1040 1022 853 846 747 325 116 11327 35304 5216 4518 --
NM_018650chr151983 1788 1578 749 486 ----1339
NM_018672chr17----1159 --
NM_018704chr15844 538 525 505 380 ------
NM_018710chr8--11134 1182 --
NM_018715chr131654 1449 188 ------
NM_018717chr462439 2160 2149 406 92 85 1536 12154 --
NM_018718chr772244 2193 1896 1745 1554 1497 881 --42316 2133 359 311 1574
NM_018837chr202779 210 1830 1217 --
NM_018841chr183908 3666 3621 3234 2953 2933 1463 991 --13953 --
NM_018847chr941714 1212 682 192 --11932 --
NM_018898chr552285 1581 714 225 168 1374 11739 11840
NM_018945chr643657 2422 1235 1058 --33560 3475 616 --
NM_018970chr732815 2415 1959 --1449 --
NM_018976chr1242889 1854 496 84 --31132 165 160 --
NM_018977chrX2967 874 ------
NM_018979chr1282654 2589 2456 2085 571 371 249 137 2669 596 ----
NM_018993chr2021364 472 ------
NM_018999chr10114836 4705 4524 4445 4056 1914 1900 1893 1558 1405 1236 --21206 1051 --
NM_019003chrX----1140 --
NM_019006chr152460 137 --1131 1143
NM_019013chr172691 255 --1639 --
NM_019024chr2194 --1439 --
NM_019026chr12477 183 1117 2511 67 --
NM_019045chrX2692 239 --3817 812 224 --
NM_019063chr252203 680 527 349 128 ------
NM_019066chr153288 277 148 ------
NM_019080chr1351566 1508 1305 1091 610 11332 21571 205 --
NM_019083chr11622 11441 11628 --
NM_019084chr1062350 2321 1800 901 830 65 --22355 37 --
NM_019094chr1283312 2987 1267 1245 469 371 149 138 --12816 --
NM_019114chr942244 961 809 66 1384 ----
NM_019555chr331792 1575 319 ----11777
NM_019558chr21340 ----1146
NM_019594chr931533 1407 663 ------
NM_019610chr162114 1700 1545 1532 453 210 --22185 1585 --
NM_019849chr19177 --282 63 --
NM_019854chr122613 223 --1632 --
NM_019885chr242855 2778 2070 310 --12821 12827
NM_019896chr2121 175 ----
NM_020062chr203720 334 122 --11006 --
NM_020066chr12639 132 --1850 --
NM_020116chr441681 1409 260 144 --11274 11384
NM_020119chr723857 709 --23946 714 13818
NM_020122chr286035 5227 5033 4174 1951 1631 898 827 24412 988 21176 950 --
NM_020123chr1041582 1248 1136 188 --11286 --
NM_020135chr6135 --1409 --
NM_020144chr731962 1607 821 1854 12061 12105
NM_020156chr71238 ----1191
NM_020159chr461602 1316 1191 637 420 301 --11239 --
NM_020193chr1141015 893 433 294 11132 11064 --
NM_020194chr22606 268 --1249 --
NM_020199chr54974 968 959 253 --3485 443 129 --
NM_020200chr1031090 810 201 ----1293
NM_020228chr1192368 2277 1924 1871 773 634 464 454 126 ----12356
NM_020235chr32249 31 ------
NM_020309chr1921108 1026 1325 ----
NM_020310chr1732342 2117 1869 ------
NM_020311chr23568 200 39 --2636 602 1505
NM_020337chr4123113 3046 3027 2879 2720 2653 2273 2179 2160 2097 1200 631 --42825 2804 2291 217 --
NM_020342chr252566 950 409 165 50 --22511 740 1764
NM_020346chr111587 --11642 --
NM_020357chr321319 177 --21174 515 --
NM_020362chr12276 120 --1320 --
NM_020363chrY31608 1179 522 1131 ----
NM_020382chr1241571 553 236 119 ------
NM_020403chr133610 371 152 --11763 --
NM_020416chr442489 2202 1640 556 --21650 1645 --
NM_020429chr752950 2578 2169 691 266 ----12912
NM_020432chr761983 1773 1758 1724 1713 1557 ------
NM_020433chr2041687 1673 1346 1340 --21143 359 --
NM_020436chr20----3184 64 59 --
NM_020440chr183357 3316 2156 1166 662 607 539 233 --32968 1338 1252 --
NM_020443chr1176714 6559 6485 6479 6471 6138 5927 5766 5727 5195 5156 5065 5016 4250 2768 947 843 --15747 --
NM_020456chr134753 706 558 351 --2570 181 22179 323
NM_020457chr161438 --1594 --
NM_020463chr231456 1024 429 --11325 --
NM_020546chr562817 2787 2436 734 586 84 --11013 1610
NM_020640chr361995 1766 1594 817 652 429 12154 31868 876 510 21940 868
NM_020644chr112367 68 1909 1383 --
NM_020647chr82585 213 --31972 1634 205 11786
NM_020651chr241565 1377 659 283 1224 21715 317 --
NM_020655chr162449 182 --11381 --
NM_020666chr5----1135 --
NM_020672chr1----1592 --
NM_020699chr154809 4028 1494 963 338 1572 13304 12158
NM_020717chrX74193 3390 3084 1976 1290 499 53 --1310 1886
NM_020718chr16146476 5907 5729 5702 5492 4703 4670 4434 1474 1322 1223 507 84 23 1341 66294 5714 5709 4552 4408 91 --
NM_020734chr12123355 3316 2809 1325 1288 1226 791 753 556 355 333 327 --21129 949 --
NM_020742chrX72669 1988 730 696 262 190 116 11696 1583 1998
NM_020752chr1032621 2543 744 --1852 --
NM_020754chr32500 449 ------
NM_020761chr171703 ----11738
NM_020768chr542945 1206 1090 955 --1799 --
NM_020772chr17238566 7841 7682 7600 7093 6801 5966 5663 5571 5448 5433 3246 2921 2508 2213 2134 2126 1122 1076 963 954 898 291 11586 28394 1619 47197 6766 5764 3391
NM_020774chr18165515 5249 4947 4176 3983 2209 2003 1744 1611 1598 931 815 622 197 191 184 13879 15327 --
NM_020783chr1852442 2151 2021 1610 1529 --12342 --
NM_020791chr1731308 938 205 --1154 --
NM_020796chr5112822 2468 2364 2330 2176 2143 2106 1993 1966 1105 890 12220 ----
NM_020800chr3----172 --
NM_020801chr552586 2501 1673 896 155 1466 42671 2656 884 658 --
NM_020804chr6----22598 2444 --
NM_020808chr141127 1082 104 84 1874 ----
NM_020809chr1142129 675 650 424 --1698 12145
NM_020815chr41378 --1364 --
NM_020824chr101548 --1793 --
NM_020825chr1683829 3634 3040 1375 731 720 621 434 --33763 2865 2782 --
NM_020834chr1431392 305 116 ------
NM_020843chr151340 --1310 --
NM_020850chr1653186 1114 1060 545 277 ----1283
NM_020856chr191465 --21298 139 138
NM_020858chr1552318 2226 1958 1883 1511 1733 ----
NM_020859chr483317 1558 1257 1067 993 975 964 574 --33104 2963 542 --
NM_020860chr421017 465 --21078 274 --
NM_020861chr631122 876 164 ------
NM_020866chr132689 292 --2713 250 --
NM_020889chr17----1290 --
NM_020899chr1732321 922 520 --1152 --
NM_020918chr1093659 3361 2776 2470 2294 2269 818 612 535 11125 ----
NM_020919chr23959 841 824 --21244 1009 11078
NM_020921chr14123657 3567 3357 3351 3043 2841 2792 2721 1401 673 460 309 21433 290 13176 13204
NM_020924chr9------1201
NM_020926chrX------1286
NM_020935chr2104612 4568 3907 3725 3573 2987 1832 1450 1133 761 --44540 1855 714 628 13962
NM_020940chr1082702 2395 2079 1837 994 860 847 185 --12929 --
NM_020951chr1942399 2102 182 111 --3470 465 257 --
NM_020960chr9104861 4616 4377 3970 3518 1887 1446 863 576 412 14727 13672 --
NM_021033chr1363314 3143 3124 2999 1030 554 --43424 3110 3105 697 22899 1260
NM_021038chr343324 3017 2535 717 --52625 1280 1275 1270 1078 --
NM_021083chrX63387 3068 2728 2609 2512 450 --12767 13059
NM_021090chr2245031 4492 4386 769 11255 21361 1339 --
NM_021097chr263075 3038 2802 434 392 298 1277 3362 357 286 13085
NM_021101chr392556 2295 2016 1862 1852 1794 980 500 314 --1642 1834
NM_021111chr92974 949 --2416 173 --
NM_021116chr788468 8452 7862 7024 6594 3529 2371 1718 17084 ----
NM_021131chr931087 1045 390 1325 11473 --
NM_021132chr1041036 998 839 344 --11311 --
NM_021133chr151672 1651 1506 1274 1096 ------
NM_021140chrX1330 --1235 --
NM_021144chr91482 ----1380
NM_021145chr7----21088 792 --
NM_021148chr762311 2127 1738 844 815 809 12022 12242 11762
NM_021165chr12834 268 ------
NM_021183chrX21961 1953 --2622 71 --
NM_021188chr141122 ----1451
NM_021189chr11161 --1149 --
NM_021190chr13259 107 101 ------
NM_021192chr2----1357 --
NM_021194chr1135 --1219 --
NM_021202chr2042685 2450 1893 564 --12929 12440
NM_021205chr172842 2834 2596 2489 872 794 752 1456 ----
NM_021215chr2082348 2334 2250 2242 2111 1949 1833 1784 --11802 12100
NM_021222chr131305 469 165 --11423 162
NM_021224chr92450 114 ------
NM_021229chr1231243 1027 220 --11231 --
NM_021238chr1241379 1289 654 103 1361 12048 1607
NM_021239chr1441381 1153 1118 235 --1575 --
NM_021240chr91672 149 ----
NM_021637chrX61364 1322 1226 1204 1070 75 --11246 --
NM_021639chr11189 --1156 --
NM_021643chr241894 1598 1502 1380 --41871 1485 686 637 --
NM_021783chrX42298 2088 1886 1725 ------
NM_021785chrX------1308
NM_021807chr71148 --1195 11223
NM_021813chr6195518 4286 4280 4274 4267 3745 3703 2234 2063 1621 941 870 817 811 805 799 791 770 728 14784 ----
NM_021814chr621433 594 1609 ----
NM_021818chr14127 --1239 --
NM_021914chr1482116 2054 1647 1520 871 656 557 79 ----1793
NM_021943chr621587 401 ------
NM_021945chr623063 736 12413 13346 --
NM_021954chr1363280 2771 2384 2358 1206 852 ----1787
NM_021961chr1177390 7156 7046 6096 1781 1611 433 --37260 6129 4775 21772 1538
NM_021964chr3176501 6332 5625 5585 4607 4508 4447 4188 2517 2319 2197 1864 1801 1395 1342 575 230 34211 1463 796 45876 5426 4164 2120 14540
NM_021965chr93177 171 122 --11186 --
NM_021973chr42734 657 1710 1571 --
NM_021998chrX41321 1291 1104 504 --1366 --
NM_022041chr1662600 2379 2324 438 380 106 --22064 1901 --
NM_022049chr131335 337 242 --11678 --
NM_022051chr12720 642 --1597 --
NM_022058chr252056 1739 1696 796 773 --11760 1162
NM_022059chr175929 914 899 588 228 --5960 293 288 283 278 1299
NM_022085chr621535 148 ------
NM_022114chr154805 4221 1874 1657 537 --34231 4226 3901 1563
NM_022123chr141229 ------
NM_022130chr551204 1148 924 194 115 --1261 --
NM_022133chr821274 184 --21211 294 --
NM_022138chr621030 156 --1506 --
NM_022170chr751586 560 367 275 183 ------
NM_022340chr332481 1174 229 --1143 12290
NM_022343chr9----11097 --
NM_022367chr1----1689 --
NM_022374chr21339 --1350 --
NM_022458chr782937 2778 2379 2191 1932 1037 942 309 --13109 --
NM_022459chr13166031 5690 5595 4384 4241 2432 2422 1825 933 783 725 716 708 692 599 593 21698 554 43913 2487 1898 1879 36043 5371 4859
NM_022465chr1253053 2652 435 212 88 1475 193 --
NM_022469chr133139 2863 1291 --12382 1885
NM_022482chr2021818 1672 --11804 --
NM_022484chr71396 --11075 11420
NM_022490chr92411 28 ----184
NM_022491chr1263465 2787 2729 2622 303 233 13014 2555 58 1418
NM_022495chr143529 509 39 ------
NM_022552chr271132 870 492 485 473 337 169 ------
NM_022574chr721341 341 --1658 --
NM_022648chr254242 1725 1712 1286 904 --44615 4288 3930 406 --
NM_022658chr1231054 433 96 ----11032
NM_022726chr621376 174 --11670 --
NM_022728chr71740 --1685 --
NM_022739chr1731114 791 753 --1207 --
NM_022753chr172777 2588 2305 1875 1857 1835 253 --287 80 --
NM_022763chr3123210 3058 2995 2566 2095 779 751 594 299 264 111 90 --32888 2234 146 --
NM_022776chr321428 1326 ------
NM_022781chr963257 3091 2762 2733 1170 329 --12390 11331
NM_022818chr1631553 231 196 ------
NM_022824chr511648 ----11258
NM_022835chr1932482 1239 425 --1199 --
NM_022841chr1552778 2767 2598 2545 806 --22676 371 12435
NM_022893chr273132 3024 2780 2640 1110 347 190 --22744 996 --
NM_022894chr251122 529 370 255 66 --21225 357 --
NM_022898chr1474561 3247 1865 608 440 339 243 --34142 3440 3432 --
NM_022912chr262720 2550 1953 1179 1039 357 --13052 1162
NM_022913chr5----1329 --
NM_023016chr232492 1102 318 --12898 --
NM_023076chr1692147 2066 1980 1943 1831 846 668 442 435 ------
NM_023079chr1741888 1879 1224 550 --11916 --
NM_023926chr19136 --1698 --
NM_023940chr41763 --1977 --
NM_024017chr1721617 211 --21694 1549 --
NM_024019chr43766 251 173 --1722 --
NM_024087chrX----2440 83 --
NM_024090chr431871 1384 512 ----11779
NM_024312chr1221131 405 --2646 136 --
NM_024408chr173163 2672 1409 860 538 481 473 --22926 2745 --
NM_024496chr142730 711 --5701 653 578 565 560 --
NM_024511chr483183 3110 3013 2631 2515 1163 775 179 12727 11234 1891
NM_024522chr141950 1840 271 256 ----11827
NM_024523chr731017 294 173 --21247 310 --
NM_024524chr362059 1072 901 860 485 138 --12527 --
NM_024529chr121186 1136 --1116 --
NM_024563chr521488 550 --21786 1741 --
NM_024573chr64786 745 335 281 --2956 187 1922
NM_024574chr41412 ------
NM_024594chr52375 180 ----1386
NM_024595chr1----1492 --
NM_024604chr122186 28 --168 --
NM_024612chr171316 --11114 --
NM_024613chr881865 1677 1654 1425 1347 717 316 288 --190 --
NM_024630chr62515 252 --1558 1222
NM_024631chr11----1562 --
NM_024665chr3164337 4149 4059 3832 3819 3300 3188 3162 1252 1142 988 796 753 471 260 183 11765 51789 1018 1013 927 766 14686
NM_024674chr193100 3041 2984 1169 983 860 735 444 319 145 ----
NM_024692chr261912 1834 1333 1158 443 373 --31847 1521 311 --
NM_024700chr17791 459 415 400 301 269 233 ------
NM_024704chr2011097 --1937 --
NM_024721chr872484 2326 2169 2047 1769 1686 133 22572 801 ----
NM_024749chr151628 718 712 612 492 ----1307
NM_024785chr221247 1108 ----11221
NM_024811chr1131285 595 30 --21819 300 --
NM_024814chr71305 169 2325 77 --
NM_024824chr1461662 1353 1088 508 199 109 --21582 206 --
NM_024835chr17----1131 --
NM_024837chr151486 11422 11944 --
NM_024852chr11218 --1256 --
NM_024884chr1444417 3667 1294 1116 ----13441
NM_024908chr151121 1599 ----
NM_024911chr1--1611 1550 --
NM_024913chr731616 666 495 --11142 --
NM_024920chr431404 976 370 ------
NM_024940chr821708 577 --1387 --
NM_024945chr921135 386 --1370 11174
NM_024947chr3198912 8708 8520 8042 7674 6466 6216 6123 5814 3779 3322 3157 2897 2713 2513 1856 1738 914 516 35927 3023 685 48057 6312 1830 1523 18067
NM_024953chr1252429 2351 2317 946 869 --12343 1487
NM_024969chr21139 ----1218
NM_024989chr2168168 8073 7538 6476 5913 5736 5259 3180 3024 2190 2167 1658 598 288 181 146 21649 578 1186 25147 5014
NM_025027chr1921119 961 --1394 --
NM_025040chr1972475 2356 2221 2016 1884 940 691 --1945 1282
NM_025074chr452778 2710 2669 862 563 1108 12832 --
NM_025076chr21139 --1613 --
NM_025090chr1731411 1297 1208 --11436 --
NM_025107chr612088 --12284 --
NM_025113chr1351270 1180 920 203 82 --1223 --
NM_025126chr12----1699 --
NM_025133chr27831 805 744 392 357 295 204 ------
NM_025134chr1682484 975 948 703 641 536 467 140 --12465 --
NM_025147chr22112 77 ------
NM_025160chr173460 2955 2780 1403 1307 890 619 ----1869
NM_025164chr115873 766 322 178 125 --42086 307 302 283 --
NM_025179chr184794 4787 3576 1999 1886 1229 846 833 --2854 311 14167
NM_025182chr9----1768 --
NM_025191chr162431 1144 1138 1060 547 407 --12450 --
NM_025208chr1172496 2400 1791 820 696 674 296 --21919 149 --
NM_025224chr2042140 2017 1586 576 ------
NM_025230chr143756 691 293 ------
NM_025232chr8------1446
NM_025235chr1092133 2070 1985 1900 1687 847 465 199 181 --1448 --
NM_025248chr1753150 2521 956 184 176 ------
NM_030576chr1722297 953 ------
NM_030621chr14114218 4125 3624 3131 2918 2824 1683 723 344 313 269 --23317 248 12986
NM_030625chr1052608 1992 1818 529 291 ----11687
NM_030627chr573680 3608 3596 3449 3193 1368 452 21393 634 31215 244 160 13320
NM_030636chr752122 2088 2004 1856 491 --12108 1497
NM_030637chr142593 565 ----2607 485
NM_030647chr786096 5804 5791 5072 2058 2019 1288 628 ----16239
NM_030648chr4125287 4620 3888 3762 1976 1596 1361 1324 1259 763 512 369 --33694 3689 1733 --
NM_030665chr171342 --11467 --
NM_030756chr10287 40 --292 28 --
NM_030758chr2231472 1280 463 1530 11429 --
NM_030762chr1221979 508 --1189 --
NM_030766chr122283 131 194 ----
NM_030791chr1451820 552 353 254 175 ----1672
NM_030805chr21437 2373 139 1926 --
NM_030806chr1108915 6984 6731 5855 3474 2438 806 764 676 500 22167 1351 26226 3412 13591
NM_030816chr173329 1294 920 706 473 294 86 --13417 --
NM_030885chr382247 2234 1883 1527 521 442 309 97 --12138 2865 821
NM_030912chr102162 156 --1150 --
NM_030915chr262404 760 567 440 288 58 --31920 1835 127 --
NM_030920chr161946 1746 1616 1297 742 509 ----22113 1481
NM_030923chr22598 515 ------
NM_030934chr13381 192 169 ------
NM_030938chr1741119 1084 1009 216 --31145 825 386 --
NM_030939chr631089 798 61 --6931 818 813 808 803 223 --
NM_030949chr62536 111 ------
NM_030979chr132448 388 ------
NM_031206chrX1157 --1164 1170
NM_031216chr18102136 1878 1871 1855 1569 1555 1503 1457 510 396 --31588 1576 33 1476
NM_031272chr172268 262 1226 ----
NM_031296chr4102373 2352 2016 1985 1086 651 603 585 566 433 --12595 --
NM_031372chr431217 285 172 --11468 --
NM_031426chr952694 2156 2149 752 125 ------
NM_031439chr821639 1450 --11673 --
NM_031442chrX3809 739 700 --1580 --
NM_031445chr263202 2973 2830 2769 2645 455 --12453 11337
NM_031453chr1052546 2404 2377 2302 756 11049 --22310 728
NM_031459chr131682 1637 416 ------
NM_031461chr81180 --1311 --
NM_031469chr6103833 2905 2827 2722 2687 2611 2593 566 177 138 --1523 --
NM_031476chr1662733 2671 2591 986 753 52 --12743 --
NM_031483chr20113515 3453 3387 3350 2599 1067 986 719 589 513 325 ------
NM_031882chr51344 ----138
NM_031890chr2282956 2679 2608 2259 1033 792 497 26 --21928 277 --
NM_031922chr6246 34 --1122 --
NM_031935chr1----2681 129 --
NM_031953chr41307 --1410 --
NM_032017chr13514 255 240 ------
NM_032023chr101479 1928 11316 1914
NM_032042chr572730 1969 1104 908 616 148 101 --12688 12803
NM_032102chr11113104 2995 2986 1180 1172 1060 1000 664 569 187 151 11921 22490 300 --
NM_032109chr511408 --21359 1168 --
NM_032121chrX82824 2562 2274 2023 815 652 638 301 --21883 645 --
NM_032124chr18--11206 ----
NM_032145chr6101905 1862 1727 1710 1697 1647 787 591 464 340 --21488 1427 1129
NM_032192chr171599 --182 1607
NM_032199chr10123806 3782 2727 2630 2502 2411 1481 1436 1307 768 688 666 --2952 695 1958
NM_032208chr293654 2914 2730 2696 2600 1006 999 911 785 ----12225
NM_032233chr143197 124 115 --1658 --
NM_032246chr1511012 ----1852
NM_032268chr1632135 810 350 --12333 1982
NM_032287chr2283694 3682 3653 3641 3634 2660 210 88 22672 1574 ----
NM_032299chr11------1218
NM_032379chr111742 --1796 1664
NM_032410chr86936 846 449 439 309 165 ------
NM_032433chr1921294 1288 ----11590
NM_032440chr1052281 353 332 313 305 --32916 2629 1903 --
NM_032446chr543785 2979 1371 170 --11161 --
NM_032457chr463877 3076 2602 1448 1123 119 ------
NM_032458chrX113264 3222 2497 2376 1376 1301 957 486 402 211 167 --22804 1315 12480
NM_032466chr831537 1245 315 ----1137
NM_032505chr372560 2440 1930 1859 1798 1077 500 --21816 1788 --
NM_032521chr2052730 2239 1199 789 236 12229 1246 --
NM_032523chr21119 --1196 --
NM_032539chrX5579 335 313 160 85 1588 ----
NM_032547chr42261 22 --11422 --
NM_032569chr1621488 804 --11907 --
NM_032578chr1041402 1000 969 476 11026 1271 21036 135
NM_032582chr1731702 584 577 ------
NM_032595chr1721546 1279 ----11024
NM_032632chr1471922 1841 1634 1422 1258 822 682 1631 21963 1722 --
NM_032682chr3153549 3442 3392 3323 3256 3183 3152 3137 2437 2337 2300 1232 832 724 599 1127 ----
NM_032689chr191271 21041 101 ----
NM_032728chr94932 874 749 665 ------
NM_032777chr851584 1563 1530 1403 536 ------
NM_032784chr64893 671 350 336 ------
NM_032826chr775170 3471 1396 674 630 545 285 --25491 253 12057
NM_032833chr152450 2420 928 457 249 --11876 --
NM_032839chr31124 ------
NM_032842chr721498 1290 --11121 --
NM_032846chr141996 --2117 81 --
NM_032859chr1393931 3759 3047 2948 2822 1406 697 674 570 1761 ----
NM_032900chr1072492 2422 542 491 477 455 399 22580 1308 33936 3826 810 1431
NM_032902chr8----1211 --
NM_032932chr1775373 5352 4654 4175 1835 1343 855 ------
NM_032936chr7----1237 --
NM_032968chrX74252 3853 3095 2862 586 493 296 --14150 --
NM_032973chrY74244 3845 3427 3090 2857 586 296 --14142 --
NM_032982chr792339 2178 1783 1606 1599 1047 995 722 369 --12352 --
NM_033030chr241343 525 273 180 --3509 501 336 11595
NM_033055chr141068 1037 398 249 ------
NM_033089chr2041488 1422 1404 526 --21441 279 --
NM_033116chr142234 91 --1201 --
NM_033132chr1342119 879 861 490 --11506 --
NM_033133chr1753675 2992 1326 1197 519 1489 21172 75 --
NM_033143chr46926 758 744 574 490 326 13964 ----
NM_033161chr941917 1400 652 259 21988 499 --1134
NM_033211chr551851 1317 519 435 273 ------
NM_033222chr981431 1285 1259 965 438 378 245 141 11325 --21175 120
NM_033224chr7107408 7144 6987 3140 2677 2393 2156 2105 711 663 --1951 12193
NM_033274chr523090 762 --52252 1410 1017 841 222 12383
NM_033285chr8144346 4301 4274 4070 4049 4000 3919 3886 3613 2780 1620 1568 1464 1121 --23896 3824 --
NM_033296chr43293 195 94 --2615 324 --
NM_033316chr32546 530 ------
NM_033389chr1794824 4670 4009 3539 1771 1633 543 289 145 --44575 4570 3932 3003 --
NM_033502chr61182 --184 --
NM_033505chr286553 5547 4608 4361 2504 1835 1799 379 16320 54239 2248 2069 1443 310 --
NM_033512chr8132916 2686 2638 2631 2348 2340 2238 2212 2136 754 551 538 173 ------
NM_033631chr183426 3387 3109 3102 3039 1516 1247 785 --13412 --
NM_044472chr12586 207 --1515 --
NM_052840chr152363 165 --11146 --
NM_052854chr113632 509 481 ------
NM_052857chr173434 196 179 ----1321
NM_052875chr1152176 2138 1927 1457 133 ----11888
NM_052879chr1254075 3840 3429 1451 270 12997 33962 3169 74 1957
NM_052897chr121864 --1835 --
NM_052898chr831414 1193 667 ------
NM_052900chr861836 1329 505 322 241 144 --11534 --
NM_052904chr6197 --11220 11048
NM_052910chr1321508 853 --1825 --
NM_052911chr18----2855 175 --
NM_052927chr552108 2085 1734 1486 410 11571 22161 1994 --
NM_052937chr882107 1959 1917 1866 1022 784 600 220 --22448 438 11081
NM_052948chr19----175 --
NM_052950chr133818 518 52 --1337 1266
NM_052954chr2122152 1753 12202 1571 11613
NM_053001chr8----3326 317 309 --
NM_053024chr3----1206 --
NM_053056chr1162935 2599 2063 1053 513 139 --22647 2269 --
NM_053064chr1463085 2338 1066 816 809 737 1695 22944 2273 --
NM_053281chrX3265 106 88 ------
NM_054027chr51849 --31847 108 103 --
NM_057175chr452546 1824 400 277 133 --11815 --
NM_058172chr42424 138 --1155 11436
NM_080546chr952340 2322 2226 481 262 ------
NM_080607chr2021020 720 --2335 330 --
NM_080621chr20----11331 11086
NM_080742chr62227 99 --1204 --
NM_080743chr622388 146 ------
NM_080764chr2263107 3010 2658 2482 1048 748 --33316 3154 604 --
NM_080818chr13------1810
NM_080836chr2064739 4100 1600 694 388 188 --13072 --
NM_080867chr1444623 1532 1088 226 23296 810 ----
NM_080872chr873975 3609 3603 3010 1227 758 52 --14021 1349
NM_080927chr3133324 3099 3048 2983 2370 2271 2114 2081 2046 1264 589 509 166 --23115 3110 --
NM_130809chr543123 2386 997 540 --22453 402 13161
NM_133265chrX73301 2965 1454 725 536 113 42 --42403 1039 631 430 21005 78
NM_133329chr281849 1646 1238 585 413 377 333 247 ------
NM_133334chr4105567 5504 4697 4508 4267 2532 2301 888 307 106 24239 518 25445 1076 --
NM_133445chr973452 2924 1520 1133 727 587 206 --53715 2754 2725 2388 1525 --
NM_133452chr19176 --270 65 --
NM_133477chr443097 2157 2093 1254 ----12684
NM_133494chr1------1114
NM_133638chr53978 414 72 --1160 --
NM_133645chr61159 ----1568
NM_133646chr2135570 5334 5241 5075 4933 4917 4532 1771 1257 1230 1223 1067 964 25609 5306 ----
NM_134428chr9----1269 --
NM_138316chr104533 525 476 80 1172 21004 504 --
NM_138357chr1031268 715 375 --1720 --
NM_138426chr742298 2202 2157 2096 12271 32481 359 282 --
NM_138444chr13114906 4421 4171 3998 3990 3380 3029 1884 1850 490 271 1618 11796 24375 1209
NM_138459chr683706 3233 3015 2982 2899 2333 1333 286 11423 22663 2405 --
NM_138473chr12124958 4491 3911 3860 3659 3354 1822 1500 1468 1356 653 625 34041 1178 237 25105 758 14916
NM_138479chr131542 1419 379 --21374 315 --
NM_138731chr1464150 3762 3635 2902 974 655 --33752 3625 2824 --
NM_138771chr751560 1554 1548 273 188 ----1528
NM_138782chr561989 1931 1732 629 589 455 --11916 --
NM_138793chr172701 197 --31806 80 75 --
NM_138927chr2131068 326 30 1284 ----
NM_138962chr17----2261 256 --
NM_138969chr841312 953 308 195 --1962 --
NM_139072chr23828 581 200 ------
NM_139281chr593429 3405 2900 2809 2752 1436 1366 732 564 13233 31184 1040 1035 1335
NM_139283chr1262351 2227 1996 997 686 650 1576 ----
NM_144571chr4206733 6659 6572 6450 6411 6388 6321 6255 5925 5518 4788 2746 2132 1635 1386 1363 1291 1135 318 228 16157 34484 2587 2152 12713
NM_144578chr1485478 5430 4867 4794 4412 3444 678 30 --33554 1528 775 1817
NM_144600chr163569 229 209 --11183 --
NM_144605chr16199 ----1120
NM_144632chr261915 1710 1702 1490 946 593 ------
NM_144635chr331271 1166 416 --1146 --
NM_144642chr31889 ------
NM_144643chr4------1137
NM_144664chr11112612 2366 2355 2130 1903 742 700 544 508 465 366 --31044 646 356 12287
NM_144676chr163100 59 31 ------
NM_144703chr201275 1357 3920 191 144 --
NM_144710chr22308 94 ----175
NM_144720chr41213 --1190 --
NM_144721chr452510 1960 478 381 211 --2825 105 --
NM_144775chr1723957 3171 --14945 23930 3135
NM_144778chr1352312 1943 1929 1793 780 --32720 2453 1096 --
NM_144973chr1295176 3980 3715 3639 3591 2058 1025 549 269 --15347 --
NM_144979chr42633 74 --1627 --
NM_144982chr12----2759 297 --
NM_145049chr53996 382 57 --2978 376 --
NM_145117chr1172107 2033 1023 1002 633 619 611 --2546 244 12977
NM_145174chr221595 --21384 48 --
NM_145203chr131808 ----1362
NM_145206chr1031278 590 526 11341 32784 2215 1147 --
NM_145251chr1451480 1394 1321 1286 241 --11564 --
NM_145257chr164161 3241 1450 462 269 149 21555 1495 33641 3548 1207 14050
NM_145263chr482396 2363 2106 1870 788 611 459 48 1735 1152 --
NM_145268chr7----1397 --
NM_145279chr111751 ----11545
NM_145284chrX72504 2484 2439 1954 591 473 200 ----22245 1612
NM_145305chrX----31045 481 476 --
NM_145307chr1054573 3756 2957 1761 1113 --14703 11832
NM_145313chr1011663 --31606 1422 214 --
NM_145731chr22----1230 --
NM_145735chr1362809 2199 1906 258 64 51 12146 12591 12259
NM_145800chrX3899 879 45 2738 695 ----
NM_145808chr7103126 3118 2815 2474 2415 2375 2070 1932 1146 701 --43002 2902 2011 172 11920
NM_145891chr1621631 1518 --11472 --
NM_147128chr761672 1520 1389 1383 425 125 --1398 1389
NM_147189chr871616 827 707 592 311 241 121 12244 12311 --
NM_148571chr1721389 1326 ----11895
NM_148894chr451139 998 984 936 147 --11123 --
NM_152247chr22----1760 1869
NM_152253chr2233886 3772 309 11115 14146 14255
NM_152261chr1222147 2129 --31990 774 90 --
NM_152265chr131587 989 264 --1237 11206
NM_152267chr2232260 1542 151 ------
NM_152277chr542155 1896 605 594 1201 8482 477 472 467 462 457 452 447 12022
NM_152280chr1102525 2262 1392 1347 1318 1181 1115 814 530 186 --42209 693 535 199 --
NM_152327chr14184 ----174
NM_152342chr16----1591 --
NM_152344chr1731398 489 352 ------
NM_152375chr112611 --12639 --
NM_152387chr21791 1731 1957 11076
NM_152400chr431675 1610 1601 12027 1123 --
NM_152405chr5------1384
NM_152407chr5103076 3015 2761 2531 2458 2408 2336 2278 2092 1166 --2494 109 --
NM_152409chr583407 3304 2380 1302 551 311 138 114 --1504 --
NM_152417chr831035 464 168 --21011 1006 --
NM_152424chrX84141 3886 3797 3428 3090 2892 948 243 13894 24171 3880 --
NM_152470chr1853794 731 713 707 656 --33985 3886 533 --
NM_152493chr121386 292 11166 2327 204 --
NM_152520chr21961 ------
NM_152522chr22903 169 --149 --
NM_152525chr2------1170
NM_152551chr663030 2335 1083 263 206 94 1953 2877 254 --
NM_152556chr731866 791 311 11000 1442 11926
NM_152557chr72266 259 --21363 248 --
NM_152581chrX21280 388 --1361 --
NM_152594chr1572255 2023 1824 931 903 651 471 --1195 --
NM_152609chr13939 806 388 ----11202
NM_152622chr563215 2673 1317 819 785 408 --11394 --
NM_152624chr5227091 6547 6202 6191 5839 5144 5137 4548 2721 2671 2626 2504 2490 2268 2088 1881 1859 1645 1473 960 236 91 12957 46847 4592 1709 1219 16221
NM_152641chr1252920 2664 2548 1898 834 --1522 --
NM_152653chr31285 ------
NM_152678chr332703 2649 2616 --1349 --
NM_152723chr11----1803 --
NM_152737chr662083 1854 815 703 592 466 --21936 1803 --
NM_152739chr72850 463 1196 ----
NM_152744chr753066 2374 2209 963 525 ------
NM_152754chr7133480 3213 3116 2706 2498 1499 1398 874 694 340 274 259 104 --33155 2353 60 1268
NM_152756chr554282 4245 3781 1073 646 23992 1406 11080 --
NM_152758chr862837 2825 2442 2194 1912 1056 ------
NM_152765chr872422 2119 1921 1803 1623 702 628 --2868 671 --
NM_152780chrX21229 1053 ----11130
NM_152787chrX72517 1437 860 778 598 548 132 --13162 12912
NM_152793chr7124997 4950 4936 4699 4614 3858 3802 3768 3601 544 459 175 21375 360 34713 4708 587 --
NM_152890chr141307 975 885 795 --21023 1005 --
NM_152896chr94723 647 567 554 1762 ----
NM_152903chr1372824 2522 2015 1915 1817 500 55 --42316 1980 1085 65 1388
NM_152996chr112094 11500 11761 --
NM_153000chr182425 60 ----1189
NM_153029chr1682845 1645 1635 1411 1234 965 384 299 14005 23557 140 --
NM_153035chr163029 2835 1226 1172 808 781 --12796 1884
NM_153184chr341408 1306 746 474 --1507 --
NM_153207chr12124085 3613 3581 3535 3362 2598 1637 1146 869 324 314 299 ------
NM_153208chr16------1729
NM_153211chr182453 443 ----1426
NM_153261chr1611074 --21561 180 1567
NM_153332chr843297 2463 2124 940 --12979 1783
NM_153347chr1121884 948 --31905 1900 1895 12476
NM_153367chr1063511 3085 3072 2928 1195 736 --12941 --
NM_153371chr1321910 333 ----11938
NM_153607chr5113012 2796 2542 2339 962 900 708 409 394 125 41 --176 --
NM_153619chr1593556 3464 3196 3121 2749 2621 2578 159 31 --2980 38 --
NM_153689chr272206 1636 895 487 447 352 106 --1883 --
NM_153757chr43485 257 53 11202 ----
NM_153810chr10134696 4249 4093 3877 3840 3098 2018 1927 1168 610 552 429 21 --1368 13934
NM_153812chr132231 1859 303 --1715 11869
NM_170606chr781846 1773 1552 498 284 248 104 97 11198 31443 324 292 --
NM_170662chr31196 ----1533
NM_170665chr1243531 2968 1354 1289 --41121 780 512 139 --
NM_170721chr171343 1395 41196 1191 1176 928 --
NM_171998chrX32504 1752 1552 11692 1225 --
NM_172070chr241851 862 578 382 ------
NM_172071chr1197469 7079 6750 6481 6471 5718 5683 5457 5369 5160 2997 2990 2028 1999 1818 958 896 680 251 16321 21400 1022 --
NM_172127chr471899 1486 1323 810 749 646 546 --2723 442 11298
NM_172193chr1421331 33 ------
NM_172373chr1331286 1150 1058 --2911 442 --
NM_173075chr431476 498 425 --1103 --
NM_173078chrX----2329 293 --
NM_173156chr162230 2191 2180 2132 2045 1739 --22166 422 --
NM_173354chr2162188 1992 1983 1935 465 148 --22018 125 --
NM_173468chr4216042 5969 5538 5335 5248 5018 4910 4615 4229 4070 3886 2129 2084 1477 1280 970 376 245 231 93 78 --35400 2393 1634 1550
NM_173469chr15138 21186 75 11489 --
NM_173470chrX32886 2755 973 --21015 392 1273
NM_173491chr511127 --11196 --
NM_173500chr1541396 1296 1151 1128 --21316 986 --
NM_173511chr2143430 3321 3252 3236 2826 1301 816 750 699 548 540 527 278 204 --1722 --
NM_173536chr4113912 3584 1737 1180 1094 1078 1007 862 441 431 305 24377 1965 1361 25098 1839
NM_173550chr9------156
NM_173557chr18----1609 --
NM_173576chr1062143 1860 1602 1437 511 46 --12272 11868
NM_173582chr11146176 5969 5486 4184 2460 2244 2235 2203 2170 2159 1624 1114 683 574 ----14301
NM_173595chr1245299 4380 3538 1649 13261 25267 1863 --
NM_173602chr1273434 3248 2533 2526 2492 720 550 --13626 23449 218
NM_173626chr172533 508 ------
NM_173642chr1139222 8827 8809 7581 7575 3599 3522 3328 1430 1152 822 536 165 157 47616 7568 659 631 --
NM_173653chr321345 1198 --11259 --
NM_173654chr332365 2039 1964 11889 12353 --
NM_173683chr821172 267 --1231 --
NM_173807chr11374 ----1116
NM_173808chr133459 3410 3114 --1665 --
NM_173814chr151523 ----1129
NM_173829chr595380 4966 4301 3965 2321 1684 783 671 42 --55751 4164 1754 420 89 --
NM_173851chr813010 --23730 876 --
NM_174887chr172389 362 ------
NM_174890chr101232 --1261 --
NM_174909chr51794 --2909 871 --
NM_174911chr863632 3549 3468 2681 1440 1080 --43677 3350 2977 476 --
NM_174921chr43396 129 93 ------
NM_174934chr1153619 3594 3375 3312 2201 ------
NM_175061chr762126 2057 1929 598 589 122 --12080 11409
NM_175607chr371277 1180 1171 606 295 180 125 --11149 161
NM_175607chr371277 1180 1171 606 295 180 125 --11149 161
NM_175624chr12147578 6806 6286 6221 4786 4743 4723 2853 2726 1919 1124 1005 759 556 --36908 6256 28 --
NM_175630chr23211 143 122 --1784 --
NM_175709chr2252884 2810 2207 440 31 32618 1004 466 12037 --
NM_175733chr1142108 2092 2041 672 ------
NM_175747chr62984 401 1966 1245 --
NM_175767chr521557 168 --1246 --
NM_175854chr13142763 2655 2592 2402 2385 2311 2247 2007 1970 1859 1038 922 272 266 --32053 583 578 --
NM_175873chr581390 1346 1281 449 438 424 132 114 ----11483
NM_175876chr132367 2158 914 --22578 2239 --
NM_175884chr711192 1570 ----
NM_175907chr1822342 726 1361 22807 387 22217 599
NM_176814chr751506 1183 405 313 148 --11324 --
NM_177401chr1941576 1502 681 207 --21622 1507 --
NM_177424chr141966 1454 1431 33 --1790 1305
NM_177531chr81206 1425 --1185
NM_177968chr271503 852 799 353 167 112 25 ----1731
NM_178011chr1042023 487 463 172 --21153 477 12930
NM_178123chr23762 688 249 1303 ----
NM_178313chr262143 1966 1648 1401 868 800 152 11558 11893
NM_178423chr73468 433 262 --11084 --
NM_178450chr51181 --1583 --
NM_178493chr17----1411 --
NM_178496chr33408 306 80 11101 21289 584 --
NM_178565chr841482 596 485 38 ----1175
NM_178812chr851590 1476 1328 1035 422 ----1445
NM_180989chr1362443 2148 2136 1580 454 445 ----1187
NM_181054chr1421212 131 --11287 --
NM_181358chr1123972 3661 3532 2919 2713 2676 1241 1226 1014 950 576 360 --33615 1551 993 13886
NM_181457chr221079 899 ------
NM_181489chr396758 6241 4818 4809 4511 4359 4138 1918 1682 --24659 112 --
NM_181504chr5114169 4159 3984 3473 3319 3257 1518 1199 1126 561 349 --63379 3188 3183 1092 782 777 14213
NM_181532chrX--185 1232 --
NM_181552chr74954 885 391 294 ------
NM_181571chr1021111 43 ------
NM_181670chr1231360 918 401 11429 1308 --
NM_181672chrX72013 1992 1900 751 480 322 195 --21371 608 --
NM_181712chr131846 560 407 --1171 --
NM_181726chr4168 --1192 --
NM_181782chr6----1599 --
NM_181783chr1241535 604 192 61 176 ----
NM_181784chr242613 2295 2067 394 --1940 --
NM_181825chr221771 ----1159
NM_181844chr1711268 --1188 --
NM_182485chr483556 3195 2456 1471 598 235 168 105 --53149 2541 2536 2500 296 --
NM_182487chr9114344 4237 4182 3635 3495 3488 3181 1779 1381 572 50 --24417 4250 --
NM_182488chr131651 ----1322
NM_182503chr6125535 5518 5452 3867 3742 2052 1626 1543 1329 1026 543 102 --11898 11220
NM_182511chr183579 168 162 --11292 --
NM_182526chr1442454 1925 699 408 ------
NM_182540chrX1102 --3706 210 205 --
NM_182557chr1132241 1891 331 ----1635
NM_182616chr152756 431 1853 1878 --
NM_182691chr731155 332 155 --31447 562 322 1129
NM_182705chr1732987 511 217 --43145 2735 2405 829 --
NM_182717chr1031516 448 250 --1229 --
NM_182767chr12------12094
NM_182944chr14----1390 --
NM_182970chr2073486 3475 3461 2628 1675 564 473 ------
NM_183376chr1572512 2471 1842 1671 917 752 716 --22478 2435 --
NM_194071chr7115452 5397 5253 4604 3414 1502 1415 1301 1045 897 348 --34570 4565 879 --
NM_194247chr294352 3629 3045 1564 1158 937 878 651 289 --34477 3514 1468 --
NM_194250chr2----1391 --
NM_194272chr153985 961 358 ----1970
NM_194282chr422394 110 --12026 12550
NM_194285chr1163411 3355 3170 2520 2208 1375 --13065 12332
NM_194286chr1284690 4663 4574 4366 4326 2274 2171 289 --14718 --
NM_194291chr872532 2006 1906 1862 1189 1131 220 22588 727 12237 --
NM_194292chr141733 1424 644 142 --21658 1469 --
NM_194298chr10----22006 243 --
NM_194314chr1145434 5408 5396 4760 4721 4107 4057 3736 3588 2178 1434 1414 778 94 --24867 3907 25356 4679
NM_194356chr1252137 874 659 516 468 --181 --
NM_194439chr481425 1305 1079 1065 1018 221 201 180 11148 1288 --
NM_194449chr181200 --1623 --
NM_197941chr522918 1871 1521 ----
NM_198243chr154757 619 597 257 1844 ----
NM_198446chr1----1173 152
NM_198467chr72501 124 ------
NM_198485chr31488 12659 22078 1733 --
NM_198504chr34739 326 93 75 2649 177 1894 --
NM_198513chr851971 1404 711 620 417 11315 11527 --
NM_198560chr323715 2972 1143 1874 --
NM_198581chr2107151 6058 5139 4845 2361 1180 1053 907 796 766 --161 --
NM_198859chr395131 4942 3408 3356 1923 1846 1395 1001 69 --24927 4138 24580 949
NM_198904chr511732 ----11883
NM_198935chr2053239 3086 2281 666 295 1823 12631 --
NM_199072chr712829 --12669 --
NM_199129chr20----1845 --
NM_199131chr1053628 2836 1397 1324 908 ------
NM_199320chr452473 2363 2159 2133 280 ------
NM_201280chr61655 ------
NM_201439chr122390 377 ------
NM_203301chr1441466 1398 1181 59 --11524 --
NM_203349chr1521549 1542 --12224 --
NM_203434chr91145 --1232 --
NM_203458chr1113586 2901 2761 1290 1268 757 585 121 99 93 39 ----13645
NM_203463chr2114780 4309 3524 3112 1795 1120 1064 893 744 620 467 --13790 1636
NM_206827chr13----1181 --
NM_206853chr694094 3671 3121 2640 1214 716 695 328 247 23820 3399 1995 --
NM_206854chr6125355 4932 4382 3901 3754 3603 1977 1956 1589 1508 378 89 25081 4660 1981 13735
NM_207325chr1951734 813 662 554 481 ------
NM_207371chr1021585 1377 ------
NM_207645chr1121130 58 --1947 --
NM_212554chr1031398 1287 44 --1515 --
NM_212558chr993682 3512 3271 3199 3095 3020 1207 829 398 --21437 279 13190
NM_213589chr2155567 5552 5448 5434 5285 5135 5012 4579 4520 3812 1900 1418 973 838 522 12129 --13579
NM_213606chr1031665 413 347 11726 1126 --
NM_213609chr34993 872 406 185 --4434 429 424 415 --