TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-330-5p
miRNA Sequence: UCUCUGGGCCUGUGUCUUAGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr8102258 2198 2048 2024 2003 1777 1563 957 870 615 --11630 22361 1578
NM_000084chrX146938 6567 6480 6413 6233 4863 4857 2641 1989 1929 1779 1612 1018 915 42476 2400 1009 461 11560 --
NM_000332chr6136645 6415 6336 6291 5804 4957 4780 2883 2570 1934 763 487 52 25527 2412 --11974
NM_000334chr1792007 1721 835 449 429 417 389 180 158 --2494 47 --
NM_000408chr232968 667 581 165 --12195
NM_000461chr353150 3070 2835 1602 1345 --13138 2806 705
NM_000474chr73437 232 43 385 61 37 ----
NM_000555chrX157694 7325 5737 5274 5004 4798 4751 3153 2967 2262 2250 2054 1833 1823 27 27715 250 121 15973
NM_000615chr1182812 2358 2327 2061 1991 1065 346 59 1412 1817 --
NM_000633chr1854799 4593 3868 1105 922 34209 3768 1052 1932 --
NM_000719chr12126541 6295 6257 5308 5186 4339 4324 2609 2510 2444 503 418 26584 6388 1412 24306 482
NM_000813chr574659 4566 4460 4223 3679 1057 1001 --22092 288 --
NM_000875chr15106655 5959 5107 4752 4320 4310 2741 2133 1380 644 45075 4956 2228 1014 22189 2034 --
NM_000961chr20123853 3785 3254 2831 2825 1452 1069 1015 750 676 150 135 13744 1346 --
NM_001001396chr163494 3327 2995 1372 983 678 23559 1122 13613 1272
NM_001001523chr151223 482 384 343 189 11181 1881 1463
NM_001001890chr2174240 4076 3480 1142 949 761 186 --2316 281 11201
NM_001002909chr1772144 1657 669 647 530 399 32 ----1711
NM_001004065chr9123504 3394 3354 2793 2759 2429 1386 1347 531 461 391 198 ------
NM_001004317chr633084 1576 706 44193 1339 1232 198 22940 523 --
NM_001004360chr231920 1435 85 ----1134
NM_001005473chr545989 2591 1147 702 26475 5816 ----
NM_001005609chrX143294 2835 2690 2612 2481 1139 1093 1023 768 370 336 178 152 62 33162 481 350 1218 13248
NM_001007097chr994910 4676 4491 4146 3699 3670 3559 1378 515 34570 3331 3137 14261 --
NM_001008392chr373534 3381 3263 3180 1069 457 376 11424 1358 --
NM_001008408chr7176208 5584 4632 4345 4120 3898 1672 1607 1505 1383 1256 728 682 552 162 132 86 24264 1749 ----
NM_001008701chr19102657 2507 2446 2332 2288 1109 1024 310 182 34 32231 1130 41 52651 2585 469 267 257 --
NM_001009899chr386315 4876 2319 2269 2013 1908 1369 327 14031 25475 5027 --
NM_001010862chrX62531 2414 1032 950 921 866 13189 1839 --
NM_001010888chrX124469 3570 1648 1418 1383 1362 1189 715 535 503 373 217 --33551 357 327 --
NM_001010891chr5126343 6310 6060 5763 5172 5122 4635 4552 2539 2333 883 782 16275 --16833
NM_001010898chr1143702 3647 3291 3276 3125 2992 2867 2680 1043 889 561 548 482 94 11362 43675 3377 2324 1350 --
NM_001012761chr542470 1048 941 776 11895 --1253
NM_001013693chr1102439 2336 2287 2226 1865 1159 538 526 457 323 32513 2171 2058 32560 975 604 11957
NM_001014797chr10157894 7842 7802 7700 6892 6613 6471 5810 5356 2928 2761 1715 627 138 22 57172 6900 6112 5203 111 57717 7045 5402 1423 1069 --
NM_001017523chr1261923 1510 1454 1346 1296 195 ----11762
NM_001018050chr22113360 3118 3091 2979 2480 2396 2386 1352 1270 965 954 --1997 --
NM_001018111chr773879 3457 1226 438 352 182 43 43352 2562 1088 936 1135 --
NM_001023587chr3------2877 435
NM_001024808chr12112615 2462 2167 1935 867 782 651 549 166 148 62 --12528 11064
NM_001024858chr14132980 2793 2733 2371 2295 2234 2214 1196 981 779 699 563 57 2462 219 12509 --
NM_001025079chr322686 664 --1845 1393
NM_001025108chr2103940 2931 2533 1370 1213 1004 285 271 252 22 13187 ----
NM_001029864chr20132422 2137 1958 1882 1708 1585 1559 924 643 311 234 171 49 1741 11910 12200
NM_001029875chr552339 1880 1187 892 66 ------
NM_001031695chr22115099 3983 3648 3401 1950 1320 1223 1061 954 753 713 35161 3343 1679 35173 5135 4507 24161 915
NM_001033117chr3144662 4595 4541 4124 4078 3676 3598 1851 1348 1006 693 676 522 219 33800 1498 1247 74353 1653 1583 1278 821 754 54 1801
NM_001033566chr171223 --1877 1376
NM_001034841chr1674781 4463 4224 4058 3711 1571 201 2884 667 13638 --
NM_001037954chr1183439 2872 2731 2292 1104 989 523 412 ------
NM_001039360chr1831763 1733 1656 11620 21516 300 31506 1483 716
NM_001039538chr243587 3438 2764 556 13270 ----
NM_001039690chr16121816 1526 1520 753 733 694 671 619 451 434 373 367 --31479 513 416 125
NM_001039840chrX45804 4137 4122 808 15746 14042 --
NM_001040402chr412768 --11127 1310
NM_001042413chr963999 3594 2537 1635 1043 31 ----22856 951
NM_001043351chr131764 199 45 ----32181 479 182
NM_001095chr1221752 31 21401 421 31861 1589 1359 21845 1326
NM_001099678chr3105311 4940 4506 4019 2188 1798 1750 1170 737 381 12237 ----
NM_001106chr3157539 7364 7124 6928 6726 6687 6042 3227 2557 1464 1199 1147 465 358 26 --38168 1121 423 --
NM_001265chr137857 738 696 656 366 340 194 --1130 --
NM_001271chr1582970 2737 2549 2179 707 370 356 333 2881 751 --12263
NM_001364chr1184027 3463 1771 1692 1655 1289 1266 314 21255 1046 23965 3520 --
NM_001419chr19114615 4494 4479 3808 3618 1917 1879 1816 845 711 659 43314 3238 1850 630 33295 1689 1397 --
NM_001497chr982610 2324 1895 1871 665 623 606 143 22531 41 21746 260 12656
NM_001543chr5174417 4353 4337 4223 3474 2957 2950 1930 1704 1615 1349 1241 971 825 760 155 94 11138 24027 493 1898
NM_001609chr1083816 3085 3022 1472 585 473 313 307 13459 ----
NM_001991chr1761922 704 315 256 213 153 21881 654 21570 530 --
NM_002025chrX119001 8800 6776 5643 2867 2230 2183 1026 619 433 241 --13453 12267
NM_002055chr174657 496 453 94 1377 1642 11521
NM_002062chr631579 350 327 ----31604 1410 78
NM_002203chr593666 2970 2927 2880 1638 799 751 354 47 12722 1270 --
NM_002205chr128966 773 717 665 659 243 156 150 2251 106 --2850 131
NM_002336chr1234490 3550 1283 14504 1413 --
NM_002359chr1784007 3727 3474 3106 3098 1343 282 260 1309 3574 445 150 --
NM_002395chr621102 503 ----1466
NM_002401chr17122319 2231 2161 1950 1541 1000 649 535 512 434 365 88 --51782 1703 528 336 160 1950
NM_002507chr1761879 1555 1312 779 538 416 2355 214 31594 395 136 2605 388
NM_002655chr894701 4409 4317 4238 3477 1070 919 804 52 ------
NM_002718chr372454 2126 1994 898 450 379 219 11667 --1497
NM_002745chr2284236 4025 4014 3486 3471 3087 1776 41 2376 190 3904 510 24 --
NM_002834chr12114057 3741 2693 2678 2549 2482 1606 1271 1122 456 222 --22687 1067 --
NM_002892chr1431515 1468 527 ----11614
NM_002959chr194152 3933 3675 3583 3314 3186 2725 1594 878 21058 585 53381 3259 3238 900 372 --
NM_003099chr15196117 6077 5245 5105 4913 4886 4858 4637 4322 4221 1836 1398 1286 1178 1110 1100 1017 480 402 26501 4834 ----
NM_003108chr262803 2347 2110 1344 888 774 14630 22165 1255 --
NM_003139chr114694 687 620 318 ----1938
NM_003155chr882508 2103 2004 1987 1804 1020 888 775 1711 21056 672 --
NM_003173chrX61343 1100 449 442 328 93 --21259 426 --
NM_003326chr122777 1776 ----12702
NM_003458chr393189 2817 2752 2465 620 545 335 245 71 22546 269 41295 1230 1187 1100 --
NM_003466chr252135 2067 1983 688 623 --21753 816 4746 493 231 65
NM_003468chr263994 3981 3904 1698 555 166 130 24104 3282 --
NM_003583chr122871 78 23917 3244 23179 373 11226
NM_003590chr262785 2644 1416 1225 863 346 1704 ----
NM_003939chr10103924 3382 1218 1146 856 814 514 325 184 32 12959 13398 --
NM_003966chr5127327 6275 6050 5517 4886 1869 1744 1174 566 223 129 86 13081 ----
NM_004050chr1482773 2472 2318 2203 2008 689 662 244 --11687 12280
NM_004094chr1441138 341 297 65 32746 2512 237 1878 --
NM_004171chr11119304 8763 8461 8361 7729 7439 5910 2874 2471 980 805 37528 6811 368 28528 334 16163
NM_004200chr11113008 2936 2855 2763 2543 2525 2311 814 314 139 38 22973 128 43029 3021 465 23 --
NM_004430chr862315 2258 1003 785 294 191 ----11780
NM_004437chr1113609 3549 3535 3496 3474 2941 2927 2877 2602 2564 1082 1525 22593 493 11018
NM_004440chr631951 1412 1234 ----11482
NM_004554chr1481602 1459 619 589 549 424 365 283 1743 1515 --
NM_004586chrX64591 4166 4030 3816 3471 3415 --24520 3886 1743
NM_004612chr994883 3926 3469 3171 1712 436 219 169 152 --1418 --
NM_004709chrX51573 658 423 405 381 --11632 --
NM_004734chr1383177 2678 2452 1301 1192 830 772 558 12619 12630 --
NM_004745chr8146870 6279 5105 4391 2312 2305 1651 1410 1256 1105 651 643 133 45 --44611 1949 293 163 25914 5086
NM_004762chr1781827 1787 1631 1405 1324 701 687 222 --1312 1124
NM_004774chr1782926 2735 2697 2167 1931 758 164 33 22308 836 ----
NM_004788chr1142626 2550 1792 1748 --137 --
NM_004798chr20113253 3071 2927 2736 1281 1134 872 541 477 218 95 --123 --
NM_004822chr17133961 3776 3420 2480 1610 1338 1177 967 649 394 286 107 39 --23540 3263 53329 3308 1405 917 827
NM_004884chr1561532 1523 1354 669 589 22 --11601 --
NM_004947chr361683 949 644 385 371 357 32175 825 101 1633 193
NM_004992chrX217756 7355 7320 6849 6697 6455 6340 6299 6154 6102 5755 3022 2804 2611 2572 2144 1708 1700 1355 778 227 47216 6233 6095 1577 48100 7801 873 725 --
NM_005065chr14124741 4695 4586 4382 4084 1650 1453 1004 921 815 807 101 --25242 282 11047
NM_005109chr3102273 2248 2189 2096 1603 778 635 535 333 285 1963 22410 208 1460
NM_005116chr2093662 3369 2902 1696 1187 1181 573 366 359 33850 3679 3393 3524 331 116 13883
NM_005121chr1753391 3332 1424 1396 512 ------
NM_005156chr964606 4578 3962 1847 1019 331 14353 --1690
NM_005188chr11167991 7498 7250 7216 6532 6260 6105 5816 5800 5523 2108 1819 1603 934 290 69 26679 5228 36043 1866 1848 27757 5280
NM_005238chr1162850 2759 2687 2381 254 103 12677 --12811
NM_005359chr18146452 6371 5953 5663 5585 5114 4716 4137 4061 2556 2120 2035 1751 1725 16398 1212 --
NM_005399chr173486 3077 2844 1525 726 678 122 11412 1498 13369
NM_005475chr1293086 2400 2249 1324 1305 581 536 412 316 32938 1240 96 ----
NM_005504chr1276491 6243 5275 1644 993 304 229 31716 1327 161 24541 972 --
NM_005578chr354570 1278 1044 957 66 14152 13984 --
NM_005596chr9116205 6179 6016 5799 4586 4313 2468 2346 1629 1260 538 ------
NM_005725chr151881 645 554 392 314 1430 ----
NM_005786chr1821270 1123 --11138 1279
NM_005819chr1103463 3011 2959 2783 2547 2522 804 528 400 382 12447 32143 1314 818 --
NM_005828chr1753655 3425 958 927 346 --34605 1273 213 14035
NM_005899chr1751249 1226 1130 1020 1011 --1496 140
NM_005910chr1793732 3551 3485 2828 2797 2760 2585 2513 1448 --33924 3190 1609 --
NM_005937chr17124095 3493 3449 3065 2768 2547 1462 1341 1241 1198 976 90 33470 888 133 94001 3687 3260 1439 1296 1135 838 233 113 1301
NM_005941chr863952 3852 3533 2663 1041 886 13476 1138 11651
NM_005955chr1105162 5067 4957 4106 3679 3523 1937 1693 787 153 1484 54909 3886 1434 911 840 --
NM_006047chr2053421 1174 761 402 59 ------
NM_006096chr861681 1644 1420 1157 554 27 ----1283
NM_006133chr11112364 2242 2219 1988 1945 1867 727 646 629 456 31 --52278 2090 376 179 103 --
NM_006145chr1971073 846 774 391 299 134 41 131 --1104
NM_006197chr81711 ----1384
NM_006201chrX71063 1009 389 370 359 352 327 1780 ----
NM_006279chr15904 776 212 140 32 --2666 111 2170 87
NM_006357chr21385 ----1490
NM_006371chr3115132 4878 3702 3261 2006 1017 757 711 671 252 75 24500 1097 24781 92 --
NM_006420chr204923 882 805 114 22537 989 11361 --
NM_006454chr4153022 2972 2936 2582 2436 2012 1973 1964 1081 677 389 369 294 277 240 ------
NM_006538chr253941 3340 3010 1418 767 --21054 416 11436
NM_006544chr1455207 2326 1525 1415 291 21814 1608 14621 --
NM_006546chr17106327 6256 6021 5306 5224 4538 4229 2671 2021 1957 --44289 1989 1974 1059 12356
NM_006599chr1698120 7579 6816 6408 6267 5569 5518 2522 1324 1657 16187 --
NM_006614chr332426 1026 117 ----22641 591
NM_006690chr20112232 2192 2128 1845 834 791 746 605 275 93 59 --52272 2177 2163 1613 191 --
NM_006738chr15204481 4173 3903 3686 3626 3386 3186 2865 2857 2848 1755 1138 1020 1002 955 901 781 224 191 135 --23529 531 23825 570
NM_006892chr204939 506 80 52 --31417 986 523 1325
NM_006930chr521946 1501 ----21305 293
NM_006943chr20113286 3244 3234 3033 2915 2562 2505 1065 340 149 143 12569 1492 --
NM_006981chr952595 1880 984 899 414 11035 --12483
NM_006990chr162180 2164 2115 1633 947 665 ----22403 896
NM_007010chr1731750 1237 28 1388 11473 --
NM_007107chr371920 1699 765 621 531 297 109 21501 695 2436 206 --
NM_007249chr13159419 9248 8379 7993 7142 7058 6808 6673 6176 1435 963 936 881 365 128 17257 49179 9095 8825 6039 29207 8808
NM_007365chr182075 1957 1702 1644 733 444 428 46 --31719 1636 67 --
NM_012104chr11123701 3667 3619 3370 3228 3036 2818 2420 1476 1203 709 98 1177 ----
NM_012156chr2063106 2935 2711 2227 2218 1055 147 12622 12208
NM_012193chr11134839 4732 4721 4425 3967 3581 2073 1430 1349 1118 842 317 300 33556 3294 1768 13787 1887
NM_012199chr183583 1562 1331 1105 880 517 74 52 23520 3182 --13141
NM_012234chr353449 1333 957 848 755 ------
NM_012249chr261068 956 441 132 74 43 22578 1101 ----
NM_012308chr11112460 2260 2091 1899 1591 1583 1005 875 718 511 502 --1891 2743 398
NM_012316chr1195563 5517 5237 4816 4365 3985 3951 3798 3762 3694 2209 1889 1701 1495 1403 721 664 465 283 13819 24584 292 14551
NM_012471chrX61901 1466 378 329 265 104 --162 11441
NM_013279chr116828 598 350 279 47 38 2213 32 2778 644 --
NM_013372chr153603 56 46 42100 1293 218 197 21014 95 --
NM_013374chr343141 2245 806 37 23036 367 ----
NM_014155chr11156881 6653 5419 5211 4844 2887 2748 1507 1476 1457 1288 1062 248 191 123 36385 590 229 ----
NM_014232chr1721669 365 ----21365 29
NM_014292chr22111912 1800 1586 1498 1371 1331 537 517 465 260 162 11841 --1136
NM_014326chr1551359 1010 980 522 482 31105 400 29 21404 263 --
NM_014331chr4117123 6709 6258 5847 5519 5498 5368 5103 2390 1840 1095 184 1557 --
NM_014591chr1051158 1061 431 151 83 1176 11136 31271 1115 395
NM_014613chr552875 2782 2739 1899 1118 ----1720
NM_014730chr12134871 4450 4147 4046 4026 3850 3665 3544 1892 1389 1006 690 188 14789 44902 3964 1230 327 23572 1118
NM_014732chr16165654 5633 5339 5262 5123 4620 4516 3663 3566 1907 1824 1209 926 708 657 131 34017 1504 1486 34493 2346 112 --
NM_014747chr1255424 5084 5072 5038 4903 4747 4614 4550 4362 3742 3668 3641 2321 2304 2188 2054 1932 1818 1611 1449 1136 1116 1110 755 645 21974 344 34280 3993 672 --
NM_014755chr2104185 3433 3205 2905 1567 1501 1241 1098 913 33 1104 21292 41 1216
NM_014757chr572153 2079 2062 1566 775 737 55 ----11961
NM_014762chr1112309 2290 2065 1769 1606 827 753 596 157 110 80 12020 11673 --
NM_014767chr10113294 2855 2312 1446 1294 1196 927 814 805 626 82 2767 693 23267 1344 22948 1230
NM_014772chr18123245 3223 3203 2985 2939 2569 2360 2279 1442 1429 1132 794 --23516 1011 --
NM_014813chr12514 71 --165 1588
NM_014839chr132155 368 118 ----11792
NM_014897chr17103217 3138 3084 2226 810 401 331 271 203 91 2991 783 ----
NM_014901chr582282 585 424 355 312 137 124 92 --2913 481 2720 69
NM_014906chr1773861 3803 3691 3075 1505 584 56 --11078 --
NM_014909chr14103734 3421 3380 3304 3104 1173 982 806 712 21 11453 22573 194 2685 500
NM_014947chr172881 2803 2534 2491 2162 2117 953 --11171 11254
NM_014952chr15101986 1804 1563 715 558 536 523 475 189 167 ----1686
NM_014982chr1494926 4882 4677 4528 4377 4087 3852 904 599 25257 4108 2872 810 --
NM_015020chr1693876 3751 3706 3600 2800 1137 1122 743 62 --22785 547 11195
NM_015042chr15134091 3819 3753 3263 3205 2749 2678 1582 1291 1013 300 45 21 23044 392 1884 2744 322
NM_015051chr952940 1092 1049 983 225 11037 33115 2358 2227 --
NM_015064chr1283430 2934 2735 2628 1189 587 441 403 22355 785 1332 --
NM_015077chr17254426 4393 4362 3817 3182 1878 1794 1788 1695 1502 1472 1280 1274 1227 1171 1065 897 840 623 577 483 442 400 377 231 43589 3441 2861 455 24214 1421 --
NM_015094chr22164579 4474 4353 4087 3945 3845 3801 3396 3279 1665 1477 790 497 358 232 198 22857 1876 34242 2992 148 13539
NM_015107chrX7875 614 603 492 423 326 190 1781 32025 1576 569 --
NM_015120chr2----122 152
NM_015156chr1473432 3157 1304 1165 420 340 292 --1750 1199
NM_015193chr851136 1052 330 313 158 --4972 534 492 388 11507
NM_015288chr5193838 3821 3338 3026 3018 2700 2485 2411 1174 898 811 792 699 570 493 413 391 97 23 --33398 1212 1025 13146
NM_015299chr14123859 3485 3152 3146 3109 2724 2451 1347 1214 770 269 97 41330 733 400 286 33213 2976 1288 13456
NM_015315chr582859 2658 2319 2313 1100 499 165 77 --33116 2301 1344 1682
NM_015328chr7102513 2304 1933 1246 1086 1025 834 818 609 590 2933 346 1182 --
NM_015397chr91386 ----11666
NM_015458chr884575 4370 4232 3835 3727 1773 1122 343 43745 3651 1896 873 15275 --
NM_015460chr361935 1470 811 749 174 161 11356 2683 220 --
NM_015526chr1971390 1079 1006 911 269 202 105 1544 21381 257 1970
NM_015569chr173876 3436 1349 1155 722 562 188 --23997 1511 --
NM_015651chr9101958 1758 871 705 655 649 632 315 193 22 21927 1391 11876 1450
NM_015686chrX72123 2107 2008 1925 1733 182 57 21970 1554 11878 22056 332
NM_015695chr671937 1734 1508 710 672 425 299 1119 1433 1406
NM_015879chr18147754 7635 7512 6396 5708 5641 3433 2657 1171 1111 943 363 345 319 --15335 184
NM_015898chr1982426 1896 1855 1822 1692 1526 840 187 12433 11005 22456 796
NM_015995chr15185193 4770 4255 4088 3824 3742 3721 3615 1845 1797 1790 1533 1480 1467 1212 1190 992 463 24327 1636 11693 15014
NM_016089chr3111990 1756 1741 1707 800 548 464 380 272 141 44 22036 1948 11410 --
NM_016206chr3148242 7334 7190 6831 6126 5731 3162 2671 2550 2475 1853 1329 909 175 21524 1086 1859 22821 511
NM_016210chr341251 1057 298 145 --21584 570 1511
NM_016376chr1754341 3999 3435 3278 3206 --43649 2913 352 82 11389
NM_016530chr1543505 3387 627 80 --23200 35 --
NM_016531chr433819 381 353 1401 1816 12815
NM_016605chr552523 2419 1835 516 372 31820 1811 1698 52401 2072 1941 1737 221 1400
NM_016946chr141361 455 436 421 1646 22728 734 --
NM_017628chr444236 1725 1413 1388 14157 --1554
NM_017644chr365041 3706 3281 3139 934 494 44301 3959 1691 1385 ----
NM_017744chr151741 1579 1551 455 257 --11560 21646 507
NM_017770chr661975 990 556 486 218 131 12251 ----
NM_017799chr1421591 117 ----1707
NM_017847chr162066 1863 1722 1557 563 206 2848 35 ----
NM_017848chrX124463 4165 3894 3063 2850 1749 1605 1490 1271 1134 99 75 --11114 --
NM_018013chr682583 2560 2240 2166 1205 1193 920 540 32687 2392 745 2259 152 1188
NM_018028chr1981192 1148 921 846 449 399 320 181 --11094 21076 365
NM_018084chr232031 1224 528 --12505 11109
NM_018184chr371871 731 183 119 102 78 45 --11434 --
NM_018362chr1143981 3204 2710 1466 2169 44 --1889
NM_018440chr8108564 7985 7826 6747 6559 6504 5478 1312 848 458 --36964 3445 1598 11323
NM_018482chr832425 1942 986 --12344 --
NM_018667chr16132763 2748 2396 2254 2232 2098 2004 1947 1826 1819 1103 346 203 --2606 594 --
NM_018689chr1562136 2030 1892 1061 869 645 32711 2161 155 12359 --
NM_018958chr1573481 2882 2643 1012 703 536 125 23265 3008 1962 --
NM_018979chr1262204 1738 956 528 160 126 --12354 --
NM_019067chrX83901 3476 3111 1489 1354 1299 1290 422 --14722 --
NM_019116chr1693234 3142 3119 2582 1109 989 150 85 24 32684 2651 1117 22727 862 --
NM_019594chr9101564 1170 1077 1022 417 383 317 150 90 81 --3299 212 58 --
NM_020310chr17132607 2484 2360 2091 1124 885 571 485 436 416 396 121 97 --52533 2512 2200 1799 1729 --
NM_020336chr20123825 3790 3383 2815 2800 1475 1378 1189 671 559 416 194 12980 --1999
NM_020338chr10172577 2532 2510 2339 1433 1293 1220 1147 786 775 645 590 421 349 154 106 90 --22438 1154 12934
NM_020348chr1092180 1976 1939 1876 917 443 396 186 41 32316 805 703 42258 2201 1854 531 --
NM_020443chr1196898 6310 5825 5775 5558 5332 4921 4626 4542 2776 2447 1229 1081 954 511 436 107 86 28 15252 --1494
NM_020717chrX94551 4386 3712 3090 3034 1352 1266 953 565 --51366 1077 757 414 380 --
NM_020718chr1695978 5754 5593 5540 5399 5385 4237 1205 267 1306 16384 --
NM_020781chr762793 2445 2207 1143 985 203 31078 805 145 --32481 814 326
NM_020801chr53550 116 92 --1240 --
NM_020805chr1831282 335 189 21854 1342 --1326
NM_020830chr232800 414 393 1486 11041 13226
NM_020839chr341226 1150 1009 598 ----21547 205
NM_020850chr1693068 2973 2797 2594 2456 2315 2077 1073 1030 31288 1169 781 32645 801 46 --
NM_020888chr161465 742 437 431 387 39 --41886 1620 1286 177 --
NM_020956chr19274707 3965 3800 3773 3527 3328 3293 3265 1903 1888 1839 1825 1761 1747 1683 1669 1590 1375 1361 1088 956 934 850 596 587 403 339 84538 4419 1865 1811 1733 1709 1655 1631 84473 4448 4006 3720 3706 1879 1606 135 11145
NM_021117chr11122030 1883 1749 1502 834 803 596 535 516 469 376 253 11647 1824 --
NM_021202chr2062799 2779 2544 2528 2392 810 --12464 1790
NM_021813chr6115420 5350 5301 4876 4205 4199 1413 1399 1252 1131 213 13611 11807 21739 1281
NM_021945chr6113176 2628 1284 1023 802 517 418 407 355 84 29 21037 66 23194 2529 --
NM_021961chr11165230 4630 4556 3005 2979 2627 2432 2330 2242 2202 2147 2028 1892 1506 1494 1103 --12754 --
NM_022048chr15155234 5222 4499 4385 4290 2052 1590 1314 1081 1035 928 887 502 166 142 44485 1534 1188 872 56064 5476 5084 4137 221 11137
NM_022166chr16106104 3991 3891 2359 2267 1021 798 540 305 54 25191 2246 45672 5381 1778 472 --
NM_022351chr822606 1045 ----12929
NM_022459chr13136234 5714 4395 4200 2150 2121 1909 1769 1211 963 664 505 478 11241 --25964 4628
NM_022473chr1574171 3558 1789 1748 1268 925 280 11581 24281 1607 23105 1065
NM_022719chr22133423 3328 3094 2882 2554 1305 1244 1219 893 778 556 366 92 11425 43281 2707 1280 194 11466
NM_022735chr141536 571 535 203 ----1669
NM_022912chr272532 2264 2035 1979 1223 629 560 2878 619 12904 --
NM_024076chr1982118 1703 1486 711 525 498 232 79 11603 31880 576 50 --
NM_024103chr19131653 1541 1533 1240 716 591 577 522 243 184 170 126 112 21672 1486 21413 1180 --
NM_024742chr1681929 1911 1689 1556 1373 1239 446 240 166 51904 1481 1471 582 550 11887
NM_024770chr2136699 6530 6377 6261 5301 4948 2532 1811 1456 1056 992 530 32 25378 444 36706 6310 5088 --
NM_024811chr1131476 207 126 11460 31229 637 439 21795 136
NM_024900chr451941 1713 288 282 76 1392 22157 44 12303
NM_024949chr4144625 4584 4342 4214 4130 4113 4092 4047 3989 3758 3653 3086 1588 1244 ----14200
NM_025179chr1114676 3136 1941 1835 1613 1522 963 818 705 687 64 33446 515 231 198 --
NM_030647chr775240 5149 4547 4299 4247 4221 1804 --14342 13920
NM_030648chr475278 4415 3749 3475 1946 1629 713 34765 84 25 24602 1714 --
NM_030751chr101219 ----1302
NM_030806chr1309187 9097 9005 8590 8228 8140 8063 7843 7760 7726 7615 7570 7327 7061 6873 6783 6773 6497 5715 3353 3224 3109 3019 2581 2356 2094 2079 682 544 367 33367 3084 460 17149 27655 7335
NM_031453chr102490 445 2541 245 21994 366 --
NM_031469chr6123755 3691 3594 3519 3221 2992 2656 1364 1169 1139 1086 615 22840 313 ----
NM_031911chr452156 2056 203 97 52 2882 724 11737 12739
NM_032042chr532326 956 442 --32303 118 111 --
NM_032160chr1873651 3298 3052 2704 1407 1355 1093 1352 23075 1647 --
NM_032174chr181143 1093 1005 985 453 149 114 82 1515 41459 1247 1061 378 --
NM_032538chr6102573 2481 2313 2301 2097 2039 1970 1785 783 497 32633 565 478 11907 1604
NM_032689chr1951506 1310 1195 601 204 1212 11065 --
NM_032737chr1972407 2379 1958 1920 1702 987 587 22627 98 4555 275 262 39 1205
NM_032818chr992567 2422 2060 1654 978 927 248 147 21 ----11714
NM_032826chr752077 1982 1794 1439 156 55181 4963 4584 4344 4328 22175 1845 --
NM_032932chr17176361 6258 6053 6047 5719 5535 4824 4798 4377 3966 2581 2371 2337 2138 2092 1622 1086 25091 1946 55874 5318 5253 2394 1888 26324 522
NM_033133chr1762502 1449 891 671 402 29 1268 32329 378 351 --
NM_033224chr7117847 7808 7186 7138 5469 5279 1563 1278 1207 367 341 36420 2688 55 16141 --
NM_033389chr17124609 3406 3104 3026 1891 1884 1591 1485 759 573 480 438 1259 44276 4143 3341 1541 11414
NM_033449chr5112130 1977 1745 1708 1576 1500 1463 490 361 161 79 11651 11622 --
NM_033505chr2106392 6344 5851 5267 5080 4596 4437 2542 2330 362 34565 4112 1694 15441 --
NM_033542chr2051334 488 86 70 61 12029 --1700
NM_033656chr2185488 5358 5338 4902 4511 1773 734 723 --15742 --
NM_052896chr162169 2016 1881 1755 868 555 --163 11629
NM_052906chr22154589 4568 4509 4477 4460 4206 3100 1566 1213 942 734 612 107 76 36 11715 53922 1981 1406 759 556 2535 278
NM_058237chr141356 ----1676
NM_078476chr661391 1382 479 259 228 181 61288 1267 1237 268 120 78 1165 1326
NM_080836chr20134458 4441 4014 3960 3597 3331 3053 3028 974 722 653 621 80 14118 33412 3209 1241 22943 462
NM_130830chr3143790 3663 2904 2735 2667 2653 2626 2567 2511 2479 1175 1031 330 119 23743 3579 43596 1075 1038 905 11462
NM_138473chr12104939 4240 4090 3899 3789 3240 1942 1435 1090 847 123 24748 4664 14537
NM_144578chr1444980 1497 1113 1010 --23774 907 1133
NM_144590chr1042543 2075 739 352 22716 802 --12606
NM_144628chr20153022 3011 2892 2742 2623 2391 2068 1900 1098 895 657 651 596 158 103 22721 547 12521 --
NM_144775chr17124773 4459 3812 3730 3633 3357 3144 3080 1712 906 485 287 ------
NM_152253chr22154339 4185 4117 4055 3715 3538 2736 2632 1690 1640 1519 986 892 424 82 --43735 1047 625 304 23868 1027
NM_152380chr161211 1198 1036 483 264 232 --147 11262
NM_152437chr1252131 1947 817 564 357 11902 12319 --
NM_152470chr18143709 3222 3077 3017 2926 2892 2590 2577 1465 897 424 294 278 193 1956 23276 904 11255
NM_152622chr553504 2163 809 712 601 --13148 --
NM_152636chr1162763 2673 2472 677 224 171 --22711 435 --
NM_152744chr763132 2924 865 826 297 49 22268 432 22565 387 33119 2953 1282
NM_152753chr662102 1418 346 228 79 40 11714 31395 483 57 --
NM_152756chr574025 3655 3354 3145 3021 554 71 ------
NM_152787chrX41425 1244 663 496 13653 1399 --
NM_152857chr62218 97 ----1393
NM_152914chr17104287 3552 3483 3080 1217 1104 497 406 284 145 11764 53388 2823 1585 1498 105 --
NM_153335chr1751152 1097 1088 532 91 31438 1175 902 31008 552 493 --
NM_153367chr10103570 3462 1421 1091 1069 631 568 461 423 395 31371 981 205 124 --
NM_153487chr6124600 4517 4292 3806 3798 3704 3633 3411 3018 650 612 520 1118 64481 3999 3470 1074 835 97 34353 3335 331
NM_153619chr1583344 1097 989 830 720 644 394 316 --1928 --
NM_153620chr761470 595 421 409 369 218 1565 --1320
NM_172069chr252018 1944 907 706 525 ----11988
NM_172071chr176097 5462 2827 2235 1084 303 127 2491 106 25790 568 15526
NM_173065chr1143241 2765 2692 2678 2287 1428 1194 1010 992 943 505 459 208 35 --52650 2225 1154 651 248 12755
NM_173595chr12145067 4991 4107 3830 3688 3450 3437 3409 3369 1794 1472 1152 525 206 --25084 224 54184 3968 3949 1741 1191
NM_173681chr7131935 1847 1393 658 545 520 396 354 345 326 127 91 69 --2728 369 --
NM_175733chr1181957 1821 1369 865 524 494 152 93 1703 --21974 1837
NM_175736chr12217627 6966 6950 6300 5891 5634 5608 5522 3122 2988 2982 2937 2894 2643 1969 1577 1302 1273 1245 849 316 46769 2554 2131 1440 76291 5205 2684 2590 2509 323 37 25180 3008
NM_176871chr892924 2739 2333 2289 1265 1236 1186 709 167 1469 53226 2942 1060 493 429 23064 2638
NM_181358chr163564 3485 3441 3422 3322 494 13091 --11398
NM_181521chr16156487 6376 6258 5520 5372 5310 5064 5019 4782 1655 1532 654 492 484 233 24945 2173 --34969 2789 561
NM_181581chr72834 191 ----2683 159
NM_181705chr554935 3761 2279 2045 1336 ----11071
NM_181809chr1153721 3466 3136 3114 2951 2582 2489 1480 636 586 562 484 397 358 314 --1238 11416
NM_181847chr1241144 1105 377 259 ----11456
NM_182970chr20154217 2988 2860 2854 2696 2616 1693 1470 1401 1278 972 803 486 370 67 23211 264 84067 3952 3685 3664 507 499 359 74 33873 819 457
NM_194313chr941281 420 383 349 11994 1376 1270
NM_197941chr572401 2388 2276 2155 1952 1946 1072 11913 173 12648
NM_198490chr3133483 3283 3130 2707 2489 2434 2329 1225 1125 944 770 445 75 32863 488 380 21285 1099 --
NM_198560chr3113061 2917 2832 2733 2597 2521 993 816 439 346 103 12749 53088 2804 1162 933 653 1317
NM_198859chr364999 4340 3802 1770 1340 1323 35076 4719 1977 --11283
NM_201634chr591864 1347 1253 445 428 399 378 208 126 1639 1242 2305 55
NM_206853chr633507 3024 3011 --1291 --