TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-331-3p
miRNA Sequence: GCCCCUGGGCCUAUCCUAGAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000330chrX41754 842 271 202 3603 328 59 130 --
NM_000530chr151023 931 230 37 30 21055 23 1422 --
NM_001001890chr2133921 1318 1200 11279 --23755 283
NM_001003794chr372618 2535 2181 1039 613 493 479 149 1693 --
NM_001007226chr171177 ----21452 1037
NM_001008220chr5103557 3418 3135 2869 913 428 422 248 242 178 22981 466 2580 134 12747
NM_001008701chr1972230 2031 1092 743 558 182 40 22065 153 32447 854 21 1269
NM_001010888chrX63570 3340 2883 1837 503 217 --1328 21650 1385
NM_001010898chr1103528 3203 3078 2992 2489 1361 1320 1014 555 548 ----13677
NM_001012426chr683369 2926 2913 2514 388 193 169 120 12951 --1835
NM_001013690chr1262094 1860 1844 673 291 94 22269 1712 32324 681 631 1923
NM_001013693chr192722 2703 2512 2170 2057 1845 1116 975 809 --72668 2561 2227 2037 1160 605 539 --
NM_001018050chr22103410 3112 3055 2854 2580 1243 876 868 803 484 1981 32980 2387 1271 --
NM_001018111chr783914 3554 1149 1060 935 837 455 135 21462 781 ----
NM_001031690chr792509 2344 1097 1024 921 794 643 495 319 1527 --12209
NM_001039937chr1313376 ----23518 1482
NM_001042599chr286755 6488 5347 2520 2498 2474 1261 996 --15089 --
NM_001987chr1244278 3712 3388 40 --13178 1373
NM_002270chr54373 101 79 36 ----14216
NM_002359chr1744145 3245 1448 260 --2575 151 34009 2772 447
NM_002522chr1792897 2858 2598 2558 1482 1219 1213 718 581 --21172 575 --
NM_002537chr1561082 966 842 331 118 96 --1450 1291
NM_003043chr3134217 3732 3372 2927 2839 2746 2697 2679 2653 1730 1577 1478 968 --1574 11096
NM_003108chr2147240 5230 4724 2818 2792 2725 2677 2501 2456 2323 2277 1926 1717 523 32379 1789 415 16995 --
NM_003149chr311602 --11126 11149
NM_003458chr353258 2497 1295 1100 1069 11244 1621 22819 247
NM_003768chr151210 584 422 391 219 ----1228
NM_003872chr232902 2272 2067 32808 985 183 12324 22609 652
NM_004050chr1472574 2304 2294 1906 413 244 219 --21792 576 --
NM_004643chr143677 220 207 1197 1823 --
NM_004776chr2051286 1088 1081 1074 136 --13213 --
NM_004852chr18814295 12681 12673 11275 4380 3209 2417 2410 311135 3167 2387 ----
NM_005937chr17173965 3624 3433 3219 3017 2687 2630 1445 1439 1296 1135 1070 1027 838 531 329 132 --24002 3494 11243
NM_005955chr1105232 4214 3886 3442 2142 1725 1646 1172 787 579 --14910 --
NM_006546chr1755630 4717 4366 1066 852 12599 --14540
NM_012164chr986298 6147 6074 5125 1609 1393 156 41 13017 1150 --
NM_012316chr185483 4998 3818 3749 2219 1432 1063 960 1791 1293 --
NM_014952chr1571443 1340 790 189 142 87 55 ----1169
NM_015077chr1794309 3588 3372 1794 1782 861 840 623 454 24064 1390 --11880
NM_015288chr573838 3338 1225 1212 1025 1018 391 2777 732 --1572
NM_015299chr1483237 2976 1347 1329 896 600 323 127 ----13111
NM_017744chr182087 1969 1645 1560 589 415 270 257 ------
NM_018660chr842660 1181 1020 979 --12941 21191 314
NM_021116chr7116984 6609 6032 5871 3298 2279 2161 1677 712 360 120 38141 6717 1329 37703 5934 52 --
NM_021238chr1212094 1549 --1538
NM_022166chr1685672 4191 2359 2254 2245 1789 472 380 --1799 16210
NM_030648chr494602 4564 4035 2080 2067 1946 1758 713 83 --15279 --
NM_031445chr233274 1158 961 22461 1016 --11320
NM_031918chr19141815 1798 1574 1516 1304 1238 609 583 506 439 371 326 269 204 21954 1612 21873 51 --
NM_033449chr581650 1413 562 545 520 490 361 245 21696 643 11887 --
NM_138473chr1294939 4748 4671 4536 4442 3577 3146 1061 464 24400 3282 ----
NM_145185chr1981907 1693 1584 1542 650 295 196 29 --31592 308 37 189
NM_145912chr22164429 4264 4012 3966 3902 3333 1858 1833 1781 1581 1404 604 537 418 100 48 ----24548 4148
NM_153456chr1325057 3872 24501 702 --16233
NM_153487chr6114530 4352 4051 3999 3633 3266 3134 3121 3080 330 117 1300 33190 1075 98 13020
NM_173468chr435494 466 116 ----22247 177
NM_173595chr12105084 5023 4714 4434 4183 3450 1740 515 224 179 44659 4644 4453 888 11473 --
NM_182970chr2064067 4041 3872 3706 3210 2860 --63048 1409 973 674 500 75 12618
NM_194286chr1296183 5816 4294 3858 2463 1862 1848 1569 781 11158 --22043 131