TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-331-5p
miRNA Sequence: CUAGGUAUGGUCCCAGGGAUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX113475 3258 3200 3078 2941 2876 2346 2278 1089 968 156 --22146 2121 --
NM_000076chr11------1186
NM_000081chr111797 31669 1236 719 11441 1559
NM_000084chrX136764 6350 6078 5789 5660 5588 2803 2499 2442 1839 1665 1438 1091 15283 22198 1687 --
NM_000089chr73761 507 334 ------
NM_000091chr242457 2270 904 858 12899 12095 12874
NM_000092chr234524 4018 506 1264 23228 732 13222
NM_000097chr31221 ----1758
NM_000115chr1352469 2060 1985 861 724 12492 1944 --
NM_000125chr663373 3359 3204 3028 1148 725 ------
NM_000138chr1562441 2357 1956 1018 508 412 ------
NM_000167chrX51508 1415 1320 673 395 21843 1381 1735 11172
NM_000176chr533774 790 352 22394 940 --12961
NM_000210chr232199 2081 1866 --2818 736 --
NM_000288chr62389 248 151 1308 --
NM_000314chr1053201 3014 2711 965 223 12106 11017 --
NM_000332chr676707 6063 5730 5224 5040 4839 2785 21656 1378 26459 5366 12100
NM_000337chr5106343 5604 4916 2492 1949 1848 1460 1403 1249 406 1798 15763 16555
NM_000408chr242137 1352 483 415 22296 870 23357 578 --
NM_000448chr1193234 3009 2305 2135 1291 778 660 532 479 --12385 --
NM_000449chr151505 230 154 148 49 --11454 11470
NM_000489chrX43010 442 310 197 1452 ----
NM_000495chrX21084 169 ----1760
NM_000533chrX61784 1674 1326 654 545 188 ----1242
NM_000599chr254182 3924 3235 955 620 14496 1121 --
NM_000602chr711502 ----11483
NM_000618chr12106593 6104 4977 4325 4150 2032 1313 1062 281 68 --11760 11882
NM_000619chr122475 379 --1147 1554
NM_000627chr2172 1828 1778 --
NM_000641chr19----1167 --
NM_000702chr122225 2084 21647 890 ----
NM_000756chr81158 --1478 --
NM_000809chr4219319 9058 8370 8357 8120 7988 7528 7478 7313 6960 5769 5606 3462 3189 3169 2736 2698 1769 782 575 535 36366 795 607 39206 6289 5961 37889 3385 1729
NM_000810chr15136 ------
NM_000813chr535195 1305 114 11405 23625 3416 1911
NM_000814chr1583935 3318 1665 1641 1193 1125 644 360 --178 --
NM_000829chr1122096 1513 12052 ----
NM_000833chr162553 25 --21460 279 1395
NM_000838chr632123 1977 1965 --22563 1039 --
NM_000875chr1596464 6260 4828 4356 2621 1454 1419 947 103 1583 ----
NM_000891chr1753481 3150 3018 2917 2586 23623 707 ----
NM_000901chr452509 2365 2176 659 638 12235 1270 1979
NM_000944chr462077 1875 1687 927 720 230 11983 1755 --
NM_000945chr241877 1604 390 309 --1633 --
NM_001001331chr332706 639 624 --12619 --
NM_001001396chr164041 3796 3314 3197 2709 319 21175 423 23749 2739 --
NM_001001419chr5114978 4192 4136 3660 3592 3480 3350 1872 1667 941 652 13472 15142 13415
NM_001001481chr822227 1024 1926 22678 617 --
NM_001001664chr274144 3735 3467 3446 1135 467 248 13923 22971 1553 13438
NM_001001890chr2153361 2809 1722 1521 827 --23560 3217 11103
NM_001001971chr102966 879 11249 ----
NM_001001992chr211257 1235 ----
NM_001001995chrX41857 1388 433 253 --11471 11462
NM_001002233chr842097 668 601 458 22079 400 22202 1655 --
NM_001002838chrX51895 1669 1399 742 248 21718 1594 ----
NM_001003652chr18128651 7515 6817 5997 3345 3306 2908 2780 2581 2219 1639 1345 46092 3491 2274 435 37705 2692 1175 --
NM_001003674chr1876978 6681 5694 5319 2633 2520 1046 16933 15118 --
NM_001003681chr2252124 1974 1801 1758 414 --1116 --
NM_001003712chr1253873 3437 3110 2958 1072 1308 1680 --
NM_001004317chr684243 3513 3419 3347 1713 660 645 511 11043 1783 14467
NM_001004360chr241833 1407 618 431 ----11445
NM_001005377chr19----1288 --
NM_001005463chr1042185 1767 1693 394 --1421 --
NM_001005473chr5126522 5605 5498 5440 5321 4514 4265 2596 1941 1870 1549 1278 ----16645
NM_001005474chr331354 1233 558 11486 --1177
NM_001005739chr25855 771 733 333 71 ----2693 657
NM_001005861chr3--181 1260 --
NM_001006600chr5----154 --
NM_001006636chr22895 803 178 ----
NM_001006945chr14469 215 195 49 ------
NM_001007094chr1054425 4123 2870 1615 1333 23591 3101 34412 785 719 23953 361
NM_001007553chr1174 --1108 --
NM_001008239chr1823381 3128 --21243 388 --
NM_001008392chr333498 2636 1061 --62446 2440 2434 2428 2422 137 --
NM_001008408chr744639 4371 2480 1730 12200 11280 14556
NM_001008491chr261994 1948 630 426 376 129 ----2640 305
NM_001008539chr855309 3869 3488 821 266 25157 1040 1132 14622
NM_001008541chr1041863 1763 1477 129 11507 1170 --
NM_001008738chr552850 1795 682 627 577 --12801 --
NM_001009554chr4124485 3969 3800 3555 3208 3145 2970 911 774 548 291 276 11450 34070 3186 591 --
NM_001009569chr1051626 1553 1290 415 75 ------
NM_001009894chr1251546 587 552 146 67 11733 --11391
NM_001009958chr7--1621 1555 --
NM_001009993chr253746 3211 3081 485 334 1799 23341 282 --
NM_001010000chr1832488 2404 669 ----1400
NM_001010853chr633126 2074 861 22973 116 11035 22841 165
NM_001010861chr142713 2499 2465 801 --1410 --
NM_001010888chrX74234 3794 3677 1862 1224 882 866 --24263 3319 --
NM_001010986chrX62215 2137 1600 559 446 51 --22244 211 --
NM_001011553chr75860 254 219 196 169 ------
NM_001011666chr796401 5585 4816 4615 4566 2405 1485 1035 497 12056 45654 375 202 163 15033
NM_001012398chr162915 216 1337 ----
NM_001012418chr642976 1378 446 89 14058 11124 13288
NM_001012756chr192990 574 33013 538 266 1859 2803 649
NM_001013031chr1063503 2782 2513 2226 1325 802 13493 22581 2334 --
NM_001013717chr511179 ----1464
NM_001014283chr13--1717 1551 --
NM_001014380chr13115082 4619 4610 3656 2174 1538 1423 1034 916 587 383 14210 34494 3841 3695 14643
NM_001014797chr1057505 2846 1962 1687 433 27865 6290 21651 658 1446
NM_001017371chr24490 347 145 80 --11259 --
NM_001017395chr363057 2852 2634 2413 777 74 11408 11088 1686
NM_001017424chr141224 694 596 245 2458 373 11517 --
NM_001017923chr1491610 1315 1107 530 419 322 280 247 78 ------
NM_001018008chr152461 428 --1226 --
NM_001018067chr184930 4321 1981 1602 1537 1452 808 273 25319 1847 25262 439 --
NM_001024647chr12157452 6853 5288 5154 3060 3002 2879 2748 2377 2107 1400 1224 984 503 22 26738 1651 27497 1490 --
NM_001024847chr361852 787 602 367 284 189 --1332 --
NM_001024956chr1175263 5153 4765 4646 3676 3566 1823 24238 1491 24756 922 --
NM_001025068chr361714 1625 1461 541 264 188 1592 1472 11653
NM_001025076chr10106002 5254 4088 3950 2152 1965 1840 728 662 78 1868 12093 --
NM_001025077chr10117360 6612 5446 5308 4799 2086 2020 1436 1099 913 752 22226 936 15006 --
NM_001025079chr373891 3216 1332 1254 1076 367 301 --23675 399 13972
NM_001029863chr682857 2840 2455 807 785 646 457 102 12101 22579 603 --
NM_001029875chr552815 2332 2143 2042 664 --1364 --
NM_001030007chr1632521 1044 1004 ------
NM_001030051chr642300 2085 1817 539 1762 ----
NM_001030055chr1473447 2917 1734 1056 871 564 81 34438 3675 3337 11740 13784
NM_001031710chr711033 --1211 --
NM_001031855chrX188 ----174
NM_001032280chr621317 464 ----1489
NM_001032283chr12----1372 --
NM_001032394chr662744 2716 2656 800 508 224 12829 12858 --
NM_001032999chr2014738 25357 5280 11122 --
NM_001033045chr254375 3691 3401 2950 1369 --44206 3866 3078 729 1739
NM_001033117chr344230 4103 3168 1561 ----13081
NM_001033507chr1----1293 --
NM_001033551chr1733809 2884 1392 ----22775 2726
NM_001033576chr1752692 2538 2305 2288 787 --12484 --
NM_001034025chr124960 859 164 155 ----1309
NM_001034954chr1072756 2593 2528 2394 2374 332 233 ------
NM_001035003chr421301 480 ------
NM_001037132chr761878 1784 611 553 370 198 11672 21679 1389 --
NM_001039538chr272925 2840 2556 1401 839 826 814 ----11444
NM_001039618chr11155446 5309 4876 4814 4717 4519 3989 3798 2307 2239 1966 1810 792 531 477 15601 --11760
NM_001039762chr1032362 724 63 ------
NM_001039840chrX145768 5622 5252 5144 5058 4595 3823 3684 2159 1956 1741 1384 1029 32 13872 45994 4879 3784 3671 11571
NM_001039937chr1373687 3074 2906 2610 1597 793 750 --23861 944 --
NM_001040108chr1463172 2025 839 270 256 50 1383 1917 --
NM_001040110chr7--11600 1281 --
NM_001040142chr232064 1816 139 ----1127
NM_001040152chr7104740 4336 3724 3500 1468 1028 914 861 215 54 --31155 924 633 13929
NM_001040152chr7104740 4336 3724 3500 1468 1028 914 861 215 54 --31155 924 633 13929
NM_001040153chr133806 273 60 1267 1767 --
NM_001040214chr652409 2182 805 556 454 ------
NM_001040284chr1675078 3974 2090 2071 1438 1286 560 14401 34789 4284 1171 --
NM_001040402chr422897 387 22554 1148 --1548
NM_001040429chr1343056 2201 1432 406 23618 568 1764 --
NM_001040450chr1552665 2185 941 332 143 --32426 2239 678 --
NM_001040697chr113527 100 64 138 1219 --
NM_001040712chr973014 2829 2460 2261 678 258 116 11141 ----
NM_001040876chr441654 1294 538 371 11456 21776 1520 21863 127
NM_001042355chr1684055 3972 3722 3482 3447 3403 1710 136 --13468 2583 255
NM_001042403chr12145 ----1126
NM_001042404chr121963 32 --1666 --
NM_001042406chr61434 ----1339
NM_001042473chr1031371 469 204 1312 1798 --
NM_001042481chr1441968 1866 623 91 --32544 2463 1031 --
NM_001042494chr1583445 3361 3294 2857 1512 1115 642 152 --13258 --
NM_001042510chr831872 1816 1541 11588 169 --
NM_001042537chrX32478 1971 1872 2320 70 12486 --
NM_001042548chr22825 784 1335 ----
NM_001042599chr2187736 7569 7102 6709 6367 6137 5639 5116 4991 2654 2575 2294 2158 1568 1338 1058 990 290 21964 157 36253 2846 1858 11647
NM_001042604chr394685 4553 4031 3148 1927 1288 1239 1011 224 1870 165 --
NM_001042749chrX51633 1435 1408 1351 632 --11969 --
NM_001044305chr631497 1336 346 ----11247
NM_001046chr552536 749 663 197 47 --12949 12408
NM_001071775chr1321705 1532 ----11867
NM_001099678chr386230 5551 5535 4889 1796 1484 1000 286 65688 4588 4485 1968 1926 815 26307 2062 21154 31
NM_001106chr3137084 6389 6107 3003 2897 2154 2141 1476 1460 1004 833 457 420 38997 6483 2623 18856 12503
NM_001109977chr41117 1699 1752 --
NM_001116chr1642547 2517 2368 1885 11952 12981 --
NM_001121chr1021808 307 --1360 11741
NM_001148chr42604 395 --22156 541 --
NM_001167chrX66165 4985 4172 1483 1446 958 25917 1225 16382 --
NM_001177chr1221761 368 1478 --12367
NM_001186chr2153101 2519 2167 2087 735 23244 539 22408 2294 --
NM_001198chr652142 1704 1660 330 215 1511 1237 --
NM_001200chr201907 --1176 --
NM_001204chr2107591 7115 6263 5788 2128 1949 1633 1479 1415 614 36322 5559 667 35822 5204 1891 16886
NM_001241chr262359 1962 1832 1805 497 401 11730 ----
NM_001304chr1741385 847 817 584 22418 867 21009 950 --
NM_001310chr1251959 1138 744 617 98 12662 1649 12682
NM_001343chr5----11680 11595
NM_001351chr331814 1278 390 1533 11641 --
NM_001401chr941523 1336 1015 576 2583 119 2997 435 --
NM_001406chr1721471 1433 --1693 --
NM_001419chr1921036 1018 13967 24328 1627 --
NM_001429chr2221093 1037 ------
NM_001430chr241906 734 213 123 ----1778
NM_001438chr153643 3312 2425 2379 352 23028 1214 ----
NM_001455chr654419 4146 3770 3571 1456 34870 4199 3105 13172 --
NM_001498chr661306 953 530 385 330 55 ----1232
NM_001530chr1431060 919 842 2148 52 ----
NM_001554chr11213 1663 ----
NM_001584chr11182 --11205 --
NM_001616chr273147 3126 2864 2801 2348 1162 593 --22360 882 --
NM_001621chr772656 2332 945 710 627 567 370 22681 2443 12751 12859
NM_001627chr321510 698 --1918 12421
NM_001655chr111296 1313 1704 1855
NM_001663chr1421097 989 22557 1869 --22171 597
NM_001701chr91224 --11196 --
NM_001731chr121184 1756 --1288
NM_001743chr2--1400 --1237
NM_001744chr5------1212
NM_001753chr741641 1547 582 369 ----130
NM_001759chr1274917 3814 2054 1741 1258 318 198 2753 631 ----
NM_001795chr161407 --11376 11588
NM_001802chr1661019 890 794 289 39 32 ------
NM_001854chr151550 1297 572 144 42 11142 11423 --
NM_001858chr674445 4175 4104 3654 3386 1916 541 23869 1553 34295 1796 1657 11240
NM_001859chr953885 3717 2428 1091 529 --22939 2563 11448
NM_001873chr42217 34 1633 --193
NM_001879chr361808 1783 1713 1253 306 300 ------
NM_001918chr188887 8381 3572 2924 2204 1757 765 449 26509 681 22255 1425 --
NM_001938chr151763 1745 1545 1210 538 ------
NM_001939chrX73241 2914 1540 1449 604 579 260 21364 1139 31398 1385 705 12511
NM_001968chr43860 357 318 ------
NM_001987chr1254268 3643 3132 680 480 13138 1412 --
NM_002006chr485235 4266 3577 3549 2079 1076 720 238 24725 4240 23862 1937 --
NM_002025chrX149090 7046 6602 5819 5782 3533 3486 3400 3215 1533 1519 1024 824 200 27913 3113 12331 36805 6577 3417
NM_002031chr61737 --1271 --
NM_002069chr751590 518 502 383 48 ------
NM_002107chr11425 1121 ----
NM_002126chr1763663 1210 1119 633 623 371 31067 797 722 ----
NM_002136chr12------1609
NM_002158chr273227 3116 3014 1081 430 179 108 33754 3194 2822 23740 3369 --
NM_002166chr21563 --1469 --
NM_002189chr102678 624 --1642 --
NM_002210chr243453 2593 2576 307 33432 3008 434 22862 1437 --
NM_002211chr101759 ----21172 1163
NM_002264chr3103988 3916 3736 1710 1328 1047 508 460 424 25 13244 34195 3647 834 --
NM_002267chr131106 32079 1667 803 --1706
NM_002268chr311519 --11701 11373
NM_002270chr5115410 4662 4548 4539 4266 4062 3960 1615 1109 967 812 25206 3973 34684 1185 370 --
NM_002310chr5106548 5277 5118 4737 4004 3986 2594 1377 598 371 26193 4834 31201 927 293 25787 4392
NM_002336chr12105009 3548 3431 3401 3143 1334 1304 696 353 284 24244 3668 --34631 4624 1895
NM_002395chr651463 1191 1056 462 233 ------
NM_002397chr5159 1759 1581 --
NM_002401chr1732507 2458 1537 ------
NM_002444chrX2809 461 ----11416
NM_002480chr123368 327 136 --11111 --
NM_002498chr13--1311 1362 1135
NM_002519chr1121199 619 11186 21009 1003 2517 134
NM_002522chr1753058 3043 2755 526 376 --13640 --
NM_002524chr12933 755 1904 1778 --
NM_002526chr611481 ----21313 571
NM_002544chr17------173
NM_002568chr8------155
NM_002577chr363962 2915 2597 2463 1267 355 13028 1473 --
NM_002581chr965661 5325 5086 2167 1654 802 14654 44899 4325 1453 314 14991
NM_002594chr20--12193 11919 --
NM_002607chr721255 1181 11246 1846 21269 327
NM_002645chr1193090 3039 3023 2851 2831 2000 1081 146 117 22761 795 --22250 816
NM_002655chr874310 3680 3362 3206 1667 198 76 35033 4056 1287 22038 1581 14819
NM_002709chr283266 2943 2482 826 529 518 429 48 22731 1258 13391 --
NM_002711chr73842 610 581 1304 1202 --
NM_002740chr372800 2316 2177 1722 611 448 122 12733 1747 --
NM_002745chr2243218 982 531 442 23505 789 11429 --
NM_002748chr153910 782 489 2842 833 ----
NM_002787chr7--149 194 1704
NM_002834chr1233366 1244 764 --1197 --
NM_002843chr1153370 3154 2355 412 97 ----1448
NM_002847chr721463 257 --11563 --
NM_002858chr1--1262 31352 53 23 --
NM_002869chr1141702 1694 695 435 11659 --11886
NM_002874chr952176 1848 560 389 97 --11589 --
NM_002912chr61708 ----1778
NM_002942chr311087 --11011 --
NM_002948chr3------131
NM_003013chr44860 743 588 538 1710 ----
NM_003030chr321665 1564 --1643 --
NM_003074chr331908 1865 1528 ----12059
NM_003099chr15126039 5577 5029 4599 4462 2614 2496 1876 1826 1628 573 95 22077 194 ----
NM_003108chr287041 6498 5735 5700 5654 5422 5360 861 36954 5753 4543 1310 --
NM_003155chr822645 2353 --22368 2341 --
NM_003161chr1742523 1206 396 388 --1746 --
NM_003234chr322073 1907 32231 1701 1527 ----
NM_003246chr1521969 1782 11610 ----
NM_003253chr2121608 39 1713 11361 --
NM_003298chr355865 5803 4463 3781 204 16228 --16088
NM_003338chr1051887 1780 1336 659 245 ------
NM_003339chr531038 255 160 1131 ----
NM_003413chrX71896 1379 1308 1297 1285 1265 1230 11277 11249 --
NM_003430chr19------11474
NM_003453chr13------1197
NM_003463chr662994 2491 1088 1056 371 195 --42847 2700 2338 926 12366
NM_003468chr254006 3946 2828 1207 1027 --2970 564 14193
NM_003478chr1122239 903 ----1884
NM_003489chr2172970 2620 1361 1300 1162 903 644 --12542 12364
NM_003566chr1232633 2170 689 22138 62 23223 2487 --
NM_003574chr1885050 4803 4709 4282 2208 2022 1210 68 24719 1377 34852 4510 1615 --
NM_003583chr1243890 1551 531 203 21574 961 12934 --
NM_003603chr442107 1936 485 93 --22014 1738 --
NM_003617chr174941 3928 3539 1166 667 236 80 1284 25033 171 --
NM_003626chr112248 109 ----2527 305
NM_003645chr15----1262 --
NM_003670chr321423 1140 ----11459
NM_003714chr553033 1141 753 256 54 --1746 --
NM_003749chr1351764 931 801 606 398 --11493 --
NM_003750chr104747 355 333 68 --1989 --
NM_003760chr1------1289
NM_003822chr132883 2013 473 --22589 1945 1169
NM_003829chr91430 --11160 1268
NM_003842chr8----12489 --
NM_003877chr123912 297 186 1194 1948 --
NM_003887chr222342 1542 --21990 1824 1625
NM_003895chr2162224 1912 534 364 256 111 ----1572
NM_003902chr15745 642 578 327 310 --1160 --
NM_003916chrX61476 1104 969 594 534 225 --1139 11115
NM_003927chr184986 970 416 144 --1174 --
NM_003941chr741719 679 322 153 1373 12283 22378 1601
NM_004093chr1373114 2687 2141 1272 164 56 21 --32298 2276 1138 --
NM_004096chr1041686 1330 708 43 ----11307
NM_004098chr1021257 1048 --11026 --
NM_004100chr642065 2027 964 72 32133 1941 415 ----
NM_004109chr113769 312 39 12253 ----
NM_004124chr1471323 1216 1139 1013 913 870 98 12881 22625 70 181
NM_004130chr32658 64 --157 --
NM_004180chr2168 ------
NM_004227chr773071 2578 2367 1919 865 578 545 --22870 2842 --
NM_004232chr1853690 3483 3204 877 579 --1452 12893
NM_004274chr1462926 2884 2820 2722 2611 1297 21129 493 ----
NM_004342chr742218 1544 886 356 ----1578
NM_004354chr43777 739 282 --1117 --
NM_004388chr12422 89 ------
NM_004423chr372532 2378 2197 2005 1692 687 601 195 12745 --
NM_004430chr842533 2468 2096 732 ------
NM_004432chr981766 1598 830 729 610 231 189 125 ----12142
NM_004438chr262494 2481 2074 1278 271 132 --23260 437 1983
NM_004447chr1211076 1445 --1947
NM_004457chr241297 593 413 58 --1557 --
NM_004458chrX42427 531 369 278 1610 22145 651 --
NM_004498chr15----194 --
NM_004504chr282877 2334 1918 1199 1162 1086 660 406 22099 1859 1559 1531
NM_004566chr1042532 2313 2189 2032 11903 12579 11916
NM_004586chrX115300 5212 5030 4210 3944 1395 1375 821 666 649 516 45317 5077 3958 1911 1900 --
NM_004663chr1531507 1112 521 --1110 --
NM_004673chr111451 ----1331
NM_004717chr751500 1491 1371 1266 101 21323 128 21566 208 --
NM_004722chr7------1241
NM_004736chr162116 861 745 519 365 79 11512 1308 --
NM_004745chr8106749 6307 5974 5662 2705 2577 2213 1508 1055 310 25263 1973 22550 1472 26550 1985
NM_004748chr1564059 2982 1485 1450 1302 702 21420 583 1450 1625
NM_004755chr142356 56 --21065 481 --
NM_004764chr122468 269 ------
NM_004774chr1733075 2439 248 12917 ----
NM_004775chr1862335 1599 1514 825 670 417 31730 1498 235 11639 --
NM_004788chr1152373 1977 1678 824 533 --22214 218 --
NM_004824chr62556 505 --31275 1182 231 --
NM_004866chr5144913 4516 3965 3842 3742 3527 3487 3049 1948 1718 1635 1069 305 40 24735 172 --23106 1123
NM_004884chr1511295 --11336 --
NM_004921chr142020 1968 1716 820 --12057 11732
NM_004930chr11692 ----1708
NM_004932chr5------11631
NM_004984chr123234 182 154 --127 --
NM_004985chr1274255 4190 3183 3150 1452 372 223 23358 95 --22989 247
NM_004992chrX88475 6225 5489 2103 2026 2015 1781 1098 --35565 2767 1116 12080
NM_005065chr1474783 4282 3521 3316 1597 892 157 24353 188 21408 707 12022
NM_005116chr2044350 3474 663 468 --24306 93 11149
NM_005121chr1773795 2922 2834 2732 2561 427 411 ------
NM_005156chr995380 5339 4805 3934 3437 3338 1748 1103 841 24882 1039 34414 1013 634 --
NM_005180chr1031214 540 54 11139 --1604
NM_005224chr19----2675 667 --
NM_005238chr1173230 3104 2816 2325 1053 871 502 13008 ----
NM_005249chr141742 1242 1733 --
NM_005256chr113811 735 601 --1901 --
NM_005261chr821019 641 --1311 185
NM_005277chr441962 1541 1206 388 ------
NM_005318chr2241114 396 250 223 --11101 --
NM_005328chr81288 --1807 1631
NM_005342chrX22674 477 22573 765 2397 34 --
NM_005359chr18156479 5384 5074 4397 2553 2524 2235 1863 1835 1553 1391 1276 1146 740 451 1889 ----
NM_005375chr621151 254 1216 ----
NM_005378chr23874 737 596 --1633 --
NM_005385chr372660 2337 2164 553 268 40 25 --22754 658 --
NM_005436chr1073948 3931 3660 2743 652 358 118 22772 731 --12779
NM_005455chr131467 446 220 --1507 --
NM_005493chr61561 1284 ----
NM_005499chr19----1637 --
NM_005502chr953126 2907 2508 1191 249 --2786 255 --
NM_005509chr571593 1465 1251 1213 293 152 34 1195 ----
NM_005520chr5----1652 --
NM_005585chr152171 123 ------
NM_005587chr153999 774 195 ----160
NM_005596chr995495 5253 4584 2565 2157 1864 1675 789 428 16170 --1900
NM_005604chr632563 2475 2244 --22117 338 --
NM_005639chr122573 65 11260 1352 --
NM_005644chr1147 --1140 --
NM_005665chr184779 4616 3644 3280 1565 1527 1240 623 --21401 301 --
NM_005668chr564199 3181 3052 3022 1263 639 --23981 162 --
NM_005737chr222688 1929 1452 22388 1035 12469
NM_005739chr1541701 1496 704 470 1144 1564 12396
NM_005746chr732434 691 471 1976 1864 --
NM_005749chr173655 639 543 ------
NM_005813chr252472 1893 1880 1024 898 --22150 555 12214
NM_005899chr1721003 362 21374 1284 21018 143 1559
NM_005909chr562825 1703 1587 972 232 115 13070 --24185 1040
NM_005920chr123368 1058 --13378 1577
NM_005935chr475051 4342 3917 1855 1219 659 26 24357 3683 --24738 917
NM_005941chr864179 4128 4077 3574 1464 673 13620 ----
NM_006016chr642195 1881 1749 614 ----11642
NM_006033chr1811613 12321 ----
NM_006037chr254511 4303 3949 3756 738 34622 3916 1492 ----
NM_006079chr61824 --1248 --
NM_006080chr762911 2904 2678 2127 1203 44 22049 945 ----
NM_006086chr16------1267
NM_006089chrX--11806 2543 364 1316
NM_006136chr721156 917 ------
NM_006154chr1572191 1864 1105 864 589 552 467 32364 1897 237 ----
NM_006190chr2----1314 --
NM_006194chr1421130 994 1943 1428 --
NM_006241chr331754 320 197 --2960 797 1173
NM_006251chr543024 2236 1084 382 12956 21291 1238 12912
NM_006252chr1117394 7191 6940 5374 2190 1885 1415 559 230 205 161 21974 1362 14881 15704
NM_006267chr231536 1383 575 --2594 364 --
NM_006275chr2092443 2119 1859 1753 810 747 542 74 47 1575 22532 1592 21558 400
NM_006283chr863897 3868 3275 1542 1125 705 --23300 130 --
NM_006290chr641789 1617 1279 554 --11852 --
NM_006306chrX95802 2050 1948 1881 1850 1769 1154 1038 940 21702 512 ----
NM_006317chr53659 650 262 1336 --1255
NM_006325chr12196 ----1355
NM_006334chr9----1120 --
NM_006371chr374802 4112 3813 1102 1063 339 87 --11700 14468
NM_006375chrX21411 1345 --21836 1723 11708
NM_006379chr71247 --12147 --
NM_006380chr1744085 3784 2851 794 --13877 14224
NM_006420chr2033114 2749 2686 ----13257
NM_006449chr232122 809 142 --2779 557 --
NM_006451chr51847 1898 ----
NM_006460chr17------1609
NM_006467chr551812 1534 766 656 310 2506 274 ----
NM_006469chr11156 11562 2499 442 --
NM_006504chr1062729 2039 867 245 124 90 ------
NM_006526chr201323 11714 --22115 420
NM_006534chr20123067 2952 2931 2911 2706 2550 1198 1015 860 796 602 401 --1185 12152
NM_006544chr14115309 4979 4599 3941 3829 2160 1868 660 536 96 58 23893 1680 1154 35667 3783 1973
NM_006547chr762118 1919 819 628 174 113 21990 487 ----
NM_006575chr1421192 943 21285 510 ----
NM_006587chr421410 1160 --11678 11306
NM_006595chr112544 186 1641 1567 1103
NM_006599chr16107159 6766 6502 6462 6146 5997 5556 5516 2448 1385 27923 1223 25012 858 33003 2979 1934
NM_006609chr252362 2078 2028 519 31 ----1320
NM_006628chr15114661 4556 4280 4228 3235 3114 3094 1683 1000 649 61 24690 250 --1778
NM_006646chr1353029 2115 777 672 603 ----1177
NM_006717chr932543 1147 398 12101 1408 --
NM_006729chrX155649 5370 5333 5269 5076 5012 4493 4310 4101 3785 3496 1960 1622 1610 776 --31817 1181 760 23734 1288
NM_006749chr82342 261 --1276 --
NM_006750chr16108087 7660 7206 5753 5545 2638 2399 1795 1375 1258 17105 27706 3120 12736
NM_006754chr711264 --1409 1487
NM_006775chr672727 2516 998 931 857 698 54 --12344 --
NM_006777chrX52613 2485 2313 2163 675 --12413 --
NM_006827chr1463106 2640 529 511 273 34 13119 ----
NM_006838chr1251867 1508 1312 301 114 ----1292
NM_006851chr1282946 2902 2036 1887 1008 780 773 372 11142 11936 --
NM_006896chr74461 346 309 73 ------
NM_006902chr133291 3028 32 12924 ----
NM_006914chr931533 516 400 --1553 --
NM_006965chr181965 2467 286 1185 1230
NM_006988chr211356 --21158 367 --
NM_007005chr921300 277 11326 --1243
NM_007007chr1233844 704 572 11201 --23057 503
NM_007011chr1546063 4839 2158 1540 26911 4372 ----
NM_007013chr821000 378 --2854 267 --
NM_007017chr5----1668 --
NM_007038chr21105517 5345 5297 4489 4059 1594 1441 1008 933 678 2713 81 ----
NM_007067chr1731382 590 285 --11565 --
NM_007106chr1322321 420 42695 2556 2525 2458 22031 430 12238
NM_007111chr13----1814 --
NM_007114chr3132832 2568 2484 2417 2081 1217 1066 869 713 678 668 449 350 --22891 2546 151
NM_007144chr1711323 --1177 --
NM_007173chr1172345 2307 2253 2199 615 231 139 ------
NM_007219chr202881 91 ------
NM_007249chr1388243 8066 6975 6478 6377 3373 531 332 28957 3089 36922 3776 1073 --
NM_007358chr152005 1882 1433 431 153 --21749 467 --
NM_007373chr103321 73 61 --11354 1708
NM_007375chr121779 1072 32731 2253 2240 ----
NM_012081chr573382 3273 3196 3048 2996 2735 1112 ------
NM_012092chr231260 778 630 --21600 722 --
NM_012110chr4------1216
NM_012158chr1351785 1646 1564 211 113 11818 --1477
NM_012175chr111271 --2349 295 --
NM_012199chr1134559 3950 3762 3679 3580 3309 3031 1456 1312 1065 821 401 121 11365 --1705
NM_012238chr1041702 1478 1277 635 ------
NM_012249chr253147 2874 2681 381 217 11353 --1512
NM_012259chr621385 1355 ----11148
NM_012262chr154671 1582 1321 886 691 14451 33323 1750 1313 24744 675
NM_012281chr722406 2381 ----12447
NM_012287chr354352 3521 838 583 167 34429 3021 94 13958 14527
NM_012290chr251719 674 608 583 27 --11415 1337
NM_012294chr774112 3172 3136 1356 929 780 400 13786 ----
NM_012297chr441973 761 254 243 ----1747
NM_012300chr542131 911 642 586 --1892 172
NM_012309chr1174812 4144 3290 3103 1428 1156 375 ------
NM_012330chr1041530 403 212 63 --11461 11433
NM_012338chr7--1506 --1778
NM_012417chr172600 458 --1423 --
NM_012465chr1033447 2827 2159 ----13304
NM_012471chrX31809 1591 1257 --1208 1704
NM_012473chr22------1458
NM_013233chr221130 427 --1486 --
NM_013261chr453529 3383 2827 2809 42 --189 --
NM_013316chr721034 245 2929 117 2751 289 --
NM_013354chr841296 1141 227 95 11109 11189 --
NM_013372chr1553266 2374 2355 1033 244 11144 32535 2433 1314 13150
NM_013390chr941671 1604 1272 387 11113 ----
NM_013396chr2141438 1140 605 436 ------
NM_014015chr161154 1744 1773 --
NM_014034chr611453 ----11238
NM_014057chr941584 1566 1515 1325 --11286 --
NM_014112chr843964 3792 1613 96 1435 11792 11186
NM_014141chr774609 4337 4287 3569 1710 1320 1230 11664 14708 35290 1926 1465
NM_014154chr341057 1030 559 307 --11508 --
NM_014253chrX32461 2079 867 32343 1675 913 ----
NM_014289chrX61347 1338 351 226 189 147 ------
NM_014296chr341532 1208 1135 307 1185 21039 34 1617
NM_014305chr132647 150 ----1482
NM_014423chr5125177 4965 4676 4130 2211 1978 1888 1387 1333 1110 426 365 31241 527 445 23983 3432 --
NM_014445chr331996 871 261 12046 ----
NM_014572chr1331722 1533 692 --21544 583 --
NM_014630chr1583483 3119 2563 2437 1609 1089 1016 490 23971 2882 13553 --
NM_014648chr3----11436 21055 560
NM_014667chr31455 22448 69 2941 885 --
NM_014670chr211159 --11653 --
NM_014679chr1131090 463 42 ------
NM_014701chr1522213 730 33298 295 177 21230 973 --
NM_014702chr643201 2147 1096 467 --2964 403 --
NM_014707chr722113 225 196 2196 118 11833
NM_014752chr1151929 1596 1574 479 292 ----11606
NM_014766chr743104 2514 980 505 --13762 --
NM_014810chr183672 3302 3066 2683 2663 1467 1300 111 12909 13641 --
NM_014827chr131690 1521 127 3396 386 78 --1631
NM_014829chr52757 26 --31937 790 693 --
NM_014830chr1273802 3361 3324 3031 1328 919 555 12379 22729 213 159
NM_014832chr131422 --1527 --
NM_014841chr631211 892 865 11312 1114 --
NM_014877chr17117799 7496 7330 7190 7049 6923 6521 5081 2406 2213 977 27296 2194 1693 17520
NM_014881chr101122 ----1406
NM_014906chr1753073 3061 2603 2564 2527 23469 399 22614 1403 --
NM_014912chr1063294 3097 2195 1035 585 257 22402 875 --22383 274
NM_014913chr1831487 1371 377 ------
NM_014939chr183957 123 105 ----2175 79
NM_014943chr821101 122 --1483 11044
NM_014950chr141462 11764 ----
NM_014953chr1353769 908 719 710 180 11647 --34139 4009 1657
NM_014982chr14145275 4974 4860 4761 4747 4586 4572 4332 3361 3351 1887 1582 301 83 24776 3833 14729 --
NM_014988chr462766 2627 2486 2008 643 580 1106 11127 --
NM_014991chr483187 3167 3124 2603 2511 858 771 515 33276 2236 1148 13308 --
NM_014999chr1221561 1069 1617 ----
NM_015017chr1----1205 --
NM_015051chr931165 566 443 12061 --1718
NM_015054chr12--1492 ----
NM_015071chr586232 5634 5378 5183 5125 4880 1425 122 26047 4836 36428 4468 2017 --
NM_015074chr144641 4558 1225 441 14938 23644 1613 --
NM_015076chr6114276 4236 3640 3589 3508 3482 1579 1336 628 560 416 23987 1272 13998 --
NM_015079chr1512619 --12691 195
NM_015090chr185216 5183 1590 1335 959 871 593 577 ----1784
NM_015092chr1664525 4403 4117 1176 1078 748 33299 2965 687 24676 4628 --
NM_015153chr6------1645
NM_015172chr161618 1111 1104 1085 1032 203 ------
NM_015199chr332832 1897 754 1515 ----
NM_015265chr242429 2019 1030 423 --12444 --
NM_015271chr444151 3043 726 411 13499 13287 --
NM_015272chr1652094 1432 388 241 159 --32159 427 260 --
NM_015278chr653455 2580 2465 2225 652 1623 ----
NM_015310chr8117575 7422 6119 3138 2884 2580 2205 2181 2062 1244 1100 22028 1992 36066 5451 2149 --
NM_015313chr11114767 4705 4526 4399 3812 3710 3522 3468 1716 1132 310 11051 34788 4736 4730 13778
NM_015317chr262892 2683 2550 2525 2037 255 --1696 --
NM_015328chr762672 2382 1918 1202 924 584 22053 888 22984 2976 --
NM_015344chr82556 227 11693 11540 21671 1381
NM_015347chr1252780 2695 2271 2073 985 ------
NM_015367chr2231591 1585 456 ------
NM_015384chr5------164
NM_015393chr433289 2695 668 43237 2778 569 79 13108 13400
NM_015435chr811021 175 2562 283 --
NM_015446chr161660 1549 1506 1108 304 260 --21225 70 --
NM_015508chr321033 1027 11047 11171 --
NM_015548chr62349 283 --1912 1856
NM_015564chr543585 3576 2542 1013 13205 21284 376 173
NM_015565chr211543 1169 11783 --
NM_015569chr194818 4702 3301 790 471 456 324 275 258 13784 23285 3128 --
NM_015570chr731392 1317 503 1534 --1682
NM_015578chr1922118 1468 11343 11833 --
NM_015635chr931820 861 469 ----11467
NM_015678chr1351546 1410 463 427 68 ----11580
NM_015726chr141739 1682 601 176 ------
NM_015885chr11----193 1629
NM_015898chr192995 104 --2124 118 --
NM_015906chr144043 356 337 106 13701 24441 619 --
NM_015986chr1721461 909 11176 11154 --
NM_016018chr852681 2162 2126 2067 1830 --1325 --
NM_016019chr7--1133 1410 1173
NM_016021chr631971 976 296 --2847 150 --
NM_016037chr1------1218
NM_016078chr171801 ----1819
NM_016083chr683951 3762 3738 3393 2541 992 620 328 13104 13364 1727
NM_016106chr14------1154
NM_016120chrX11192 21123 91 1878 --
NM_016230chr6--141 --1538
NM_016257chr133201 1397 458 --32613 1071 785 11289
NM_016264chr193585 534 51 ----1486
NM_016275chr352427 785 674 465 140 1976 --1720
NM_016277chr62510 429 --11424 1319
NM_016289chr232324 911 705 22218 860 ----
NM_016319chr121822 --1779 --
NM_016338chr521262 846 --1906 1348
NM_016353chr872242 2096 1535 687 488 100 27 --1922 11666
NM_016356chr662515 2331 513 188 117 57 ------
NM_016357chr1231231 802 487 1208 1959 --
NM_016396chr1552334 1023 870 832 169 11079 --12683
NM_016436chr2031069 983 607 12473 12621 --
NM_016530chr1572915 2792 1659 1514 1351 1143 259 1674 12944 --
NM_016531chr494154 4068 3866 3753 3624 3564 3468 3373 1265 174 13426 --
NM_016544chr263053 2879 2861 1563 948 690 23142 2812 13127 --
NM_016617chr1311419 ----12198
NM_016620chr131451 1416 533 --1297 1154
NM_016626chr182535 29 11775 --1490
NM_016644chr51548 ------
NM_017415chr554462 3121 2916 1564 914 --1980 12847
NM_017416chrX------1135
NM_017420chr1453780 3054 2923 2512 1180 23446 1066 ----
NM_017423chr442193 773 632 30 --31398 885 805 --
NM_017426chr41559 1612 --1213
NM_017542chr131670 1380 546 11324 1579 11771
NM_017628chr474686 4417 3673 1898 1381 710 548 ----13721
NM_017629chr131467 511 144 --166 --
NM_017634chr871711 1419 1269 724 496 295 270 11633 21452 514 --
NM_017644chr375135 4777 1896 1164 300 245 82 15170 55109 4820 4803 4734 4702 13348
NM_017650chr795231 5047 3903 3672 2259 1197 1141 966 575 55797 3802 1659 871 458 16007 --
NM_017658chr1454523 3124 718 675 561 --14337 --
NM_017666chrX72027 1865 1840 1429 266 244 202 1612 1513 --
NM_017680chr9163 1677 1109 --
NM_017693chr13----11503 2396 332
NM_017694chr251935 700 594 442 85 ----1128
NM_017744chr121638 264 12262 1634 12292
NM_017747chr5--184 --1326
NM_017752chrX52107 1889 1611 590 266 3610 519 480 12171 --
NM_017754chr654715 4300 3497 3079 655 44726 4098 3333 1675 15009 --
NM_017761chr11970 11513 --21429 1409
NM_017811chr942478 2290 1983 744 11935 23146 1180 --
NM_017831chr1863095 1470 1428 1157 1081 231 --21320 1023 1905
NM_017902chr1085587 4495 4398 2206 1823 1736 1257 991 15620 25687 4304 --
NM_017925chr931490 1468 396 21660 373 --11881
NM_017945chr32854 230 --3915 520 127 --
NM_018010chr331642 1038 233 21192 474 ----
NM_018014chr261333 1309 978 939 494 313 ------
NM_018030chr183899 216 86 21101 909 --1312
NM_018061chr121443 1357 ----1689
NM_018078chr43672 377 46 --1924 1360
NM_018084chr253080 2961 2294 564 257 ----13198
NM_018133chr32873 355 21798 820 ----
NM_018200chr1562395 2242 1738 432 410 299 ----12326
NM_018247chr653164 2604 1103 757 79 ----1463
NM_018254chr142302 1859 1797 879 --11759 11809
NM_018287chr1021205 390 ------
NM_018362chr112946 740 33539 2615 604 1142 --
NM_018364chr173397 3006 2983 1272 1191 149 103 13863 33754 995 951 --
NM_018374chr754973 4855 1764 1146 269 21430 583 136 1625
NM_018403chr342919 2649 1485 708 23331 1603 ----
NM_018419chr20------1394
NM_018440chr8168592 8259 7413 6853 6735 6156 5716 5562 5435 2513 2333 2327 2114 1545 1310 89 28500 6517 16905 11096
NM_018465chr9------1233
NM_018489chr112061 1143 --22262 512
NM_018490chr1121528 409 2425 176 1317 --
NM_018557chr251714 1686 1512 1303 78 1341 ----
NM_018566chr1125021 4981 4695 4306 4067 3748 3731 3636 1728 1564 1534 218 24609 3238 --35122 3269 1846
NM_018638chr12135364 5324 5312 5269 4384 4138 4115 1960 1758 1548 1370 959 129 14832 1185 12200
NM_018650chr142069 1784 801 187 ----178
NM_018685chr73832 148 24 --11175 --
NM_018700chr551242 1151 1104 418 51 11180 --1278
NM_018715chr11230 --1673 --
NM_018898chr531962 1499 92 --31457 842 692 1675
NM_018952chr172580 479 ------
NM_018976chr1232527 2145 619 31968 717 355 --1456
NM_018992chr1631620 1612 1283 ----11662
NM_019050chr442137 1641 1567 270 --22226 745 1829
NM_019066chr151435 --2418 412 --
NM_019067chrX94706 3575 3249 3239 3077 3060 1795 751 626 --14719 --
NM_019083chr121162 82 11232 11294 --
NM_019091chr21150 --21016 886 --
NM_019556chrX21213 434 11098 2253 247 --
NM_019593chr2052567 2247 925 426 87 1864 1715 1405
NM_019885chr242433 2084 580 113 ------
NM_020122chr265198 4850 4015 2205 1898 236 --11122 14493
NM_020144chr752041 1946 1840 1465 263 22010 1665 11764 --
NM_020198chr1721598 982 --1180 --
NM_020205chr133281 3009 1203 11085 ----
NM_020231chr34698 497 99 90 --1119 --
NM_020338chr1063516 3376 3260 2902 2477 1248 13603 ----
NM_020342chr232001 714 111 --11845 12499
NM_020346chr1141125 1117 576 470 1679 ----
NM_020363chrY61835 1304 707 539 489 105 --11668 --
NM_020381chr621798 1459 ------
NM_020390chr364854 4707 4227 1899 1706 1664 --24497 2999 --
NM_020403chr1331298 569 425 --1115 11739
NM_020432chr762035 1603 835 655 260 222 --21804 1686 --
NM_020465chr1611573 --11583 --
NM_020640chr331526 1419 254 1635 21850 1842 --
NM_020649chr17------1237
NM_020651chr251832 1445 604 436 268 ----11408
NM_020718chr1695990 5900 5879 4600 4257 3993 2304 1650 1353 11680 ----
NM_020747chr53374 207 92 --1934 --
NM_020748chr172686 329 1819 ----
NM_020751chr132981 207 1409 1449 11273
NM_020752chr1072367 2307 1027 910 660 476 430 --1653 --
NM_020765chr11272 --1238 --
NM_020782chr1274702 3381 3243 3186 3082 1697 1606 24150 1800 54793 4636 4185 3161 1228 11554
NM_020783chr1842182 788 375 229 ----22122 1545
NM_020794chr151152 1101 583 526 380 --11309 --
NM_020803chr472084 1677 1564 857 413 196 35 22060 363 32335 492 254 1162
NM_020809chr1142162 1585 781 173 12135 2127 90 --
NM_020861chr621148 279 --1234 --
NM_020899chr171598 --21935 1916 2493 296
NM_021033chr1352809 2642 945 826 156 13023 12161 --
NM_021072chr522009 1831 1305 22377 1850 1181
NM_021097chr242426 2134 719 102 --21076 682 11996
NM_021101chr331011 918 379 --1582 1372
NM_021140chrX2720 244 --1937 --
NM_021183chrX82480 1645 900 831 573 513 385 375 ----21865 876
NM_021205chr162663 2430 1984 577 527 477 1400 1197 1281
NM_021229chr1241023 346 308 215 2363 140 ----
NM_021238chr122817 42 --22073 324 --
NM_021620chr62504 237 ----1634
NM_021629chr3124884 4707 4696 4013 3899 3653 3497 1316 1050 479 119 36 ----14433
NM_021785chrX------1323
NM_021813chr675529 5474 5337 4527 4105 650 498 --15453 --
NM_021947chr1721177 503 ----1167
NM_021960chr142163 614 558 514 --1550 --
NM_021961chr1197423 7147 5877 5095 4670 2438 1414 1303 28 12997 14965 --
NM_021964chr376620 4958 1848 1058 753 659 418 14147 24309 2467 --
NM_021998chrX2471 295 1185 11400 2610 263
NM_021999chr132611 331 ------
NM_022037chr231023 814 152 171 ----
NM_022058chr241996 439 402 227 ----1613
NM_022080chr2032392 2355 672 1912 179 --
NM_022130chr571025 1003 436 429 376 294 256 --1479 1521
NM_022140chr552366 2280 2178 1966 761 ------
NM_022373chr73898 693 177 1768 ----
NM_022458chr753146 2810 2611 2043 661 1367 --12537
NM_022474chr1422150 503 21862 689 11850 --
NM_022495chr142500 113 ----1368
NM_022658chr1241109 1011 145 135 1872 11251 --
NM_022725chr1142089 2044 643 80 --11828 --
NM_022726chr631779 1580 405 11757 ----
NM_022735chr121262 179 --11394 11411
NM_022753chr172666 2494 2154 1131 876 741 366 --1505 --
NM_022755chr911701 ----12508
NM_022763chr332024 1019 426 ----13162
NM_022826chr241028 448 397 142 --1300 2290 91
NM_022828chr521450 715 11612 41790 1688 1500 38 --
NM_022838chrX1258 --189 --
NM_022893chr232848 2347 2091 22168 867 ----
NM_022912chr243063 2016 488 35 --1426 11925
NM_024007chr532100 2031 214 1794 1996 1589
NM_024019chr4--11132 --1307
NM_024052chr1742461 2246 1989 73 1997 22729 920 --
NM_024312chr12------1557
NM_024336chr161341 ----1117
NM_024345chr9115699 5019 4975 4743 4675 4410 1945 1561 851 537 506 12002 24546 2455 --
NM_024524chr342612 2166 2040 216 1912 --22868 2372
NM_024548chr34692 197 111 49 --11283 11253
NM_024563chr531217 674 160 --11833 --
NM_024576chr6------1176
NM_024586chr12556 469 1602 --2438 27
NM_024607chr853578 1600 1372 1320 969 12800 --14369
NM_024613chr841735 1552 620 463 --1482 --
NM_024615chr5------1166
NM_024639chr632047 1999 376 1990 22409 697 12445
NM_024745chr161454 ----11144
NM_024751chr422036 1820 11512 2584 375 --
NM_024818chr321179 128 1116 --11170
NM_024824chr1431634 1624 133 ------
NM_024837chr1551829 1802 1245 754 455 --31682 525 405 --
NM_024852chr11487 --1505 --
NM_024854chr123433 312 196 --11346 --
NM_024947chr3149483 8508 8206 7857 6543 3428 3327 2385 2366 2281 1809 1130 931 521 46932 6794 6242 2817 48018 3659 3394 1174 27093 6633
NM_024953chr1262724 2696 2145 1982 937 447 11974 22558 855 --
NM_025009chr441577 1460 419 247 1239 41530 1323 403 185 --
NM_025047chr31477 --1157 --
NM_025054chr8104040 3993 3966 3945 3826 3120 2611 1262 555 121 1324 14150 23739 3317
NM_025134chr164920 636 582 326 --1789 --
NM_025146chr33623 577 159 11975 12270 32675 2553 953
NM_025179chr144892 1184 815 770 --1498 11456
NM_025191chr132803 2729 2367 1731 ----
NM_025194chr19----11186 --
NM_030623chr261715 1666 1445 1417 1288 611 21727 1183 --1471
NM_030627chr563210 3079 2906 1024 814 382 11590 13406 --
NM_030647chr795238 5127 4935 4394 1732 1081 1071 896 418 11258 --11098
NM_030648chr474876 4548 3868 3754 1131 829 756 14152 35388 5140 5065 --
NM_030650chr2114161 3956 3085 3037 2895 2793 2713 1662 1424 254 131 21675 912 33794 1317 869 --
NM_030762chr1231987 1541 1340 11744 11869 --
NM_030791chr1441629 1464 1360 314 ----1346
NM_030816chr163650 3497 3301 3283 1282 663 1713 3357 351 345 1364
NM_030920chr122094 1399 11460 11818 --
NM_030954chr83585 315 34 --1160 --
NM_030979chr13------155
NM_031442chrX72984 2950 2917 2801 994 877 670 23063 1054 22591 969 22939 1249
NM_031461chr852066 2044 1987 1819 902 22186 2117 ----
NM_031469chr693966 3704 3572 2845 2707 2588 1502 1100 729 31611 1374 73 11236 --
NM_031483chr2033446 3179 2566 --22497 759 --
NM_031890chr2232883 398 262 12280 1569 --
NM_032042chr532761 2191 2152 ----12596
NM_032144chr251558 1125 547 439 284 11515 --11742
NM_032160chr1874282 3993 3256 2805 1524 652 348 13914 21687 39 13592
NM_032182chr1061652 1523 1196 525 384 103 ------
NM_032199chr1073796 3603 3567 1005 996 557 157 ------
NM_032256chr122874 188 1368 --1676
NM_032303chr911278 --21784 435 --
NM_032329chr234313 4126 1520 --1103 --
NM_032352chr1441403 1180 523 361 122 ----
NM_032373chr10105861 5007 3910 3624 2067 1837 1727 1521 789 436 24791 4726 1382 --
NM_032445chr1532604 2552 523 --21662 784 --
NM_032457chr433857 3639 1479 --12679 --
NM_032471chr6------1946
NM_032557chr451001 729 394 261 111 1661 181 --
NM_032727chr1021583 1091 1219 1143 1396
NM_032784chr62928 196 --2983 817 --
NM_032828chr1984501 4484 3940 1941 1929 1525 1440 878 --34566 1791 1072 --
NM_032859chr1393960 3593 2914 1556 1292 973 885 233 88 11328 22985 544 1985
NM_032869chr842002 369 107 51 --21959 252 --
NM_032873chr1174420 4119 3928 3408 3239 3162 214 --11225 --
NM_033143chr484326 4218 2989 1848 1323 943 771 158 13898 2437 45 --
NM_033211chr562081 2055 1881 1560 371 326 --11680 --
NM_033224chr7157655 7619 7236 7196 6968 6017 5709 5228 2836 2462 2183 2123 1710 1267 1062 ----16076
NM_033225chr852494 336 302 227 39 11003 --12227
NM_033389chr1723651 1027 ----14526
NM_033427chr73834 318 75 1707 ----
NM_033656chr21105687 4369 4179 3775 2394 1853 1615 1235 1011 499 ------
NM_052840chr1521157 1006 --1383 --
NM_052851chr1332349 826 365 2281 248 22038 1669 3560 318 119
NM_052864chr431981 1854 672 ------
NM_052879chr123929 697 604 12551 22909 2561 --
NM_052886chr811324 11567 31986 805 788 11681
NM_052918chr1063702 2981 2712 2425 1001 186 13692 22780 2533 --
NM_052927chr51864 11413 11475 1398
NM_052937chr852198 1833 1747 1033 635 1418 125 1698
NM_053024chr33540 423 344 ----1305
NM_057175chr441026 988 378 246 --143 1175
NM_080546chr931652 303 181 1373 11840 --
NM_080617chr2021044 788 --2917 224 11028
NM_080743chr642587 1899 909 333 --22528 815 --
NM_080927chr363228 2635 2414 2277 1272 1258 12855 22197 1308 1396
NM_130386chr18------1461
NM_130768chr7--1250 --1279
NM_133171chr2031160 788 447 --11123 --
NM_133265chrX63651 3211 3006 2704 1205 199 13272 ----
NM_133367chr673465 3246 3080 2924 2417 672 285 23041 872 12849 --
NM_133646chr285403 5204 4804 1823 1022 564 435 317 ----1774
NM_138288chr1452252 2202 1711 1381 558 1507 ----
NM_138316chr1011344 --21020 995 --
NM_138335chr42649 165 1563 1719 --
NM_138348chr554911 4057 1764 277 257 --12530 24875 2429
NM_138357chr1041839 1187 635 542 --11859 --
NM_138459chr632568 2508 1124 --21367 561 11078
NM_138473chr12114661 4500 4472 3628 3527 3465 1940 1923 505 387 357 14817 ----
NM_138492chr551394 1259 1017 1004 34 21180 467 1994 --
NM_139207chr1251617 1369 314 161 68 --12078 --
NM_139283chr1241782 1713 954 192 ------
NM_139319chr1211339 --158 --
NM_144571chr4176344 6189 6070 5661 5604 5253 4800 2254 2009 1911 1831 1236 1206 778 594 427 334 36268 2048 506 14241 14691
NM_144578chr1485397 5071 5037 4837 4384 3819 3717 449 24680 4310 14882 --
NM_144642chr331364 251 231 --21412 171 --
NM_144712chr2----1282 --
NM_144778chr1321699 807 41911 1819 1735 233 1562 --
NM_144963chr842092 969 382 265 1444 ----
NM_144969chrX1157 1603 1475 --
NM_145037chr31606 21493 1090 1178 --
NM_145049chr531095 870 118 --1907 136
NM_145207chr4114368 4337 3916 3491 3384 1284 1223 1064 578 210 180 24227 3978 1988 11671
NM_145305chrX31281 1262 1107 ----11308
NM_145307chr10104385 4248 3377 3137 3092 3051 2857 1875 1579 1075 --1810 --
NM_145808chr7113048 2968 2737 2582 2530 1925 991 959 879 515 106 ----12438
NM_147156chr1071488 1252 1048 488 388 379 136 21086 457 --11536
NM_152261chr1262493 2304 1601 864 599 404 41886 942 850 417 --1195
NM_152265chr151452 984 635 604 555 ----11467
NM_152317chr12186 ----141
NM_152400chr412052 21847 789 11735 --
NM_152407chr52806 406 22196 2178 12707 --
NM_152409chr553191 2979 2745 2514 2224 1675 32759 1316 342 1615
NM_152556chr731885 1846 261 21027 741 --12517
NM_152581chrX21054 296 --1482 --
NM_152594chr1532156 1677 722 --1598 1166
NM_152608chr152383 2163 2131 2097 1622 --12451 --
NM_152622chr552752 2614 2337 275 139 --13489 11028
NM_152624chr577128 6829 6505 6245 1906 1342 351 12680 25732 2288 --
NM_152641chr1262745 2180 944 795 641 387 --1502 --
NM_152678chr322039 190 --22670 2453 --
NM_152688chr61763 ----2860 792
NM_152739chr74911 767 449 314 ------
NM_152754chr763618 2731 2691 2576 743 37 12958 --12488
NM_152756chr573840 3152 3018 2809 1525 896 405 14374 23941 282 --
NM_152758chr842844 1096 996 780 22632 1037 --161
NM_152787chrX103920 3538 2566 2524 1241 736 677 641 411 226 11514 13420 --
NM_152793chr784624 3840 1432 1288 1199 605 162 140 --24410 486 --
NM_152835chr142636 2232 2077 936 11151 22350 1981 --
NM_152890chr141290 1258 1226 1215 11056 1916 --
NM_152896chr91849 ----1191
NM_152994chr2----1635 --
NM_153207chr1283914 3809 3756 3206 2979 2593 1305 743 23449 3368 ----
NM_153234chr522868 2365 1105 2820 416 --
NM_153235chr632163 540 471 --12440 1292
NM_153260chr1551464 1286 1071 117 98 --1608 --
NM_153262chr122396 187 ----1487
NM_153607chr5102736 2642 2620 2525 2436 2148 2036 1084 879 166 12557 ----
NM_153619chr1543585 3023 1311 941 12515 --1952
NM_153634chr1261618 1342 1323 498 411 152 ----11453
NM_153687chr123661 550 406 ----1248
NM_153695chr9------150
NM_153834chrX3265 150 76 --144 --
NM_170710chr483171 2605 2450 2384 2375 2009 579 414 21978 389 --12161
NM_172037chr831075 997 944 11360 ----
NM_172069chr232152 2039 780 ----11534
NM_172070chr252137 1833 1656 1486 190 --1329 --
NM_173075chr4--31856 271 34 --11240
NM_173359chr321374 389 --11554 1564
NM_173468chr475255 4527 1779 1542 1209 1019 686 1520 1496 15349
NM_173495chrX31670 696 534 --1885 11763
NM_173519chr8----11823 --
NM_173595chr1275072 4525 1778 1766 1463 637 267 ----142
NM_173647chr231111 200 118 ------
NM_173808chr184306 4188 4002 3566 3432 1402 952 156 --33225 1709 510 --
NM_173825chr353024 2821 2541 1208 317 ----1537
NM_175056chr332141 1754 581 ----1489
NM_175061chr761959 855 816 784 461 435 11386 21778 775 --
NM_175767chr571856 1721 1678 1645 468 292 118 ----11635
NM_175871chr19----155 --
NM_175876chr172683 2677 2636 2294 2060 1901 922 --1588 --
NM_176806chr52736 392 --1208 --
NM_176824chr4----21193 1036 1114
NM_177967chr131211 --11069 --
NM_178011chr1042838 2292 573 279 11040 13173 --
NM_178135chr42218 156 ----1253
NM_178313chr231811 1721 829 197 31801 1425 193 --
NM_178526chr19------11949
NM_178566chr961893 1647 1638 1557 1356 650 --11477 --
NM_178815chr1042003 1109 512 63 42410 1860 1027 645 22539 1953 --
NM_180989chr1322268 313 ----3935 391 198
NM_181504chr563149 2723 2674 1655 1222 855 --13949 --
NM_181571chr104752 719 394 257 1424 1435 --
NM_181672chrX51789 1632 1495 99 77 ----21767 36
NM_181782chr662160 1814 1784 865 696 350 11624 1689 --
NM_181836chr511984 --32093 1820 267 --
NM_182758chr1552797 1083 952 234 131 31226 1044 974 43546 1213 1027 397 --
NM_182830chr1442281 2247 1949 1465 11450 ----
NM_183416chr142060 1857 1475 563 1263 2330 275 --
NM_194314chr1125535 5515 5449 4735 2118 1886 1812 1802 1239 1055 671 514 34728 4326 1015 24483 1748 --
NM_198243chr15------148
NM_198270chrX73486 2978 2641 2592 1138 522 327 11194 ----
NM_198273chr573005 2792 2776 2749 2704 888 870 22472 252 ----
NM_198503chr152303 1763 957 834 168 --3900 760 737 1779
NM_198511chrX1522 11649 31578 1554 694 --
NM_198859chr364774 4758 4729 4104 3673 1142 1871 --11946
NM_198904chr51423 12118 12060 11399
NM_198920chr61480 ------
NM_199000chr761898 1884 1825 1745 915 504 1932 11738 22296 1427
NM_199320chr462716 2518 2155 2149 1967 736 1363 1846 --
NM_199351chr12480 388 --2403 368 --
NM_201613chr12------1652
NM_203301chr1421198 660 ----1531
NM_203364chr1151211 1187 1128 483 293 --1382 --
NM_203394chr1282646 2451 2440 1948 1803 898 638 575 ------
NM_203459chr162585 2515 1031 487 441 62 ------
NM_206853chr674063 3903 3859 3440 1346 1242 922 --43146 2796 2563 280 --
NM_207015chr322114 246 12352 21821 194 12259
NM_207303chr1021212 359 33706 849 688 12743 --
NM_207321chr1041071 710 245 183 ------
NM_207361chr1396056 6037 5771 5220 5108 2016 1000 770 70 --22449 1486 --