TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-335-3p
miRNA Sequence: UUUUUCAUUAUUGCUCCUGACC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr581820 1439 790 710 678 536 469 75 193 21881 1709 --
NM_000052chrX53018 2862 885 410 362 12266 1378 22659 354
NM_000084chrX126876 6364 5712 5634 5509 5333 4976 2124 1309 510 326 165 15302 26853 2276 44837 4718 2031 235
NM_000091chr292783 2414 863 796 633 615 527 324 301 22146 1118 22669 2530 1938
NM_000092chr2144441 4387 4001 3853 3680 3542 3521 2887 2861 1769 1589 753 441 331 11462 --1770
NM_000108chr781828 1811 1518 1502 553 429 152 114 --21880 679 1284
NM_000112chr5135445 4889 4846 4303 4161 3377 1198 1145 1116 847 667 349 232 35089 4854 3794 24534 1294 24547 1510
NM_000138chr1562524 2436 2012 1628 725 247 32403 1751 1642 11031 12089
NM_000151chr1761852 1771 581 494 438 428 1449 ----
NM_000176chr5153812 3784 3475 3177 3161 3067 3023 2861 2757 1508 1487 1335 671 376 225 1457 33508 3496 448 23184 2574
NM_000208chr19104799 4526 4392 4244 3498 3270 1187 999 719 62 43867 3643 1695 73 24171 310 1959
NM_000216chrX73249 3014 1064 847 669 195 24 32684 1455 178 2707 520 3877 442 234
NM_000217chr12145277 4816 4457 4315 4217 3903 1800 1710 1420 1212 908 851 456 397 55138 4143 1621 1357 561 24877 1514 --
NM_000222chr442009 1865 516 417 52129 1750 1561 439 257 --1532
NM_000232chr473087 2835 2653 2095 1244 792 620 22949 2214 43038 2988 989 233 --
NM_000248chr383038 2185 1958 1906 805 361 165 106 32842 2316 386 42678 1948 1229 764 11061
NM_000259chr15146087 6074 5977 5951 4791 3966 2410 1787 1268 788 263 168 137 79 46024 5572 5419 1321 56385 6131 2000 429 122 25164 2562
NM_000264chr982899 2838 2570 2395 1018 483 78 41 --12632 2550 101
NM_000310chr141308 1120 1035 142 2969 455 11098 31194 940 861
NM_000314chr1092948 2482 2368 2333 2134 2095 1140 764 58 1193 22114 37 12375
NM_000332chr6196966 6822 6113 5843 5462 5438 5261 5079 4708 4654 4478 2123 1765 1694 1410 1301 1286 1092 579 25191 5088 ----
NM_000351chrX134201 3428 3331 3128 2746 2632 1751 1744 1529 1278 1123 928 883 44166 3377 2961 1096 33243 2672 258 1510
NM_000362chr2263245 2556 1317 734 453 86 41132 852 798 513 13292 1325
NM_000368chr9104337 4320 4211 3871 3595 3574 3179 3097 511 116 74660 4617 3983 3853 3533 2949 1319 33391 1517 498 14438
NM_000369chr1491941 1921 1859 1745 1550 544 537 493 231 1665 11244 1385
NM_000390chrX72234 837 670 540 530 357 36 22759 83 62894 1050 877 865 283 238 2664 656
NM_000408chr263351 3311 2208 1038 856 659 22923 355 11147 11180
NM_000411chr2182989 2082 1332 1169 836 745 176 52 13339 1304 42834 1154 511 368
NM_000439chr592424 2389 2240 1887 1647 744 479 362 27 --31997 1694 384 12448
NM_000461chr364384 3488 3432 1487 976 149 --23695 1555 13082
NM_000555chrX157760 7380 6947 6492 6464 5989 2911 1915 1632 1560 1312 1252 891 880 210 47364 1923 653 134 46777 6261 1521 286 11046
NM_000573chr1122298 2278 2211 2180 2051 1496 685 651 587 368 199 139 41774 700 395 23 --22327 414
NM_000599chr274545 4373 4238 2906 817 749 681 34417 1107 931 --14384
NM_000610chr11103017 2550 2329 1989 1104 1005 849 770 40 23 43031 2772 2580 1865 11147 11154
NM_000611chr1196605 5836 5161 2456 1748 1290 598 417 168 86274 5504 4609 2795 2682 1366 1230 656 45510 4911 4383 572 26225 1607
NM_000618chr12176557 6407 5263 4771 4384 4312 4296 2289 2089 1994 1699 1646 1192 1017 959 139 24 24362 1809 36252 6136 4262 44351 2303 1143 932
NM_000618chr12176557 6407 5263 4771 4384 4312 4296 2289 2089 1994 1699 1646 1192 1017 959 139 24 24362 1809 36252 6136 4262 44351 2303 1143 932
NM_000633chr18135007 4516 4419 4111 3925 3176 1940 1701 1519 1470 405 297 86 45254 5202 4779 572 14686 24170 421
NM_000651chr1122298 2278 2211 2180 2051 1496 685 651 587 368 199 139 41774 700 395 23 --22327 414
NM_000719chr12136286 6211 5540 5047 5016 4835 4609 4125 2567 2324 2306 2118 1322 35664 4498 1565 36139 5102 1046 --
NM_000791chr5152732 2680 2598 2480 2409 2200 2185 1918 1747 1739 598 534 442 361 163 42670 2644 435 47 22715 322 --
NM_000793chr14144997 4505 4193 3478 2046 1823 1780 1670 1659 1416 964 692 291 231 114690 3757 3723 2034 1813 1298 1161 916 732 435 105 13805 14580
NM_000809chr4278604 8540 8472 8463 8430 7523 7258 7189 6697 5640 3070 3058 3009 2761 2728 2314 2084 2012 1732 1462 1227 1211 1047 1028 501 315 249 79149 8940 5710 2392 1834 1775 169 68330 6194 2110 1345 1000 38 37183 7025 2350
NM_000813chr595497 4883 4695 1968 1756 1271 948 452 414 44671 3486 1434 77 44968 4808 1423 971 24993 3795
NM_000814chr15194196 3856 3702 3649 3605 3387 3118 2989 2967 2751 1466 848 700 471 379 366 332 233 47 ----14163
NM_000827chr572513 2104 1949 847 678 277 91 32385 160 152 22610 2296 1231
NM_000831chr1146279 4905 4673 4377 4323 4140 4091 1482 1475 1051 950 871 600 347 45467 4771 1467 1032 11599 15345
NM_000868chrX92612 2321 2092 1852 1842 914 889 824 687 32019 1889 109 21878 1780 11599
NM_000875chr15126720 6603 6518 5384 5084 4700 4387 2317 1707 1180 530 285 --56055 6034 5030 1316 492 26974 6889
NM_000899chr12124139 3626 3551 3519 3477 3312 2770 2735 1750 1033 190 72 2480 365 23411 1384 33450 2751 1526
NM_000912chr8113570 3335 3312 3303 3236 2985 1376 759 608 332 174 33085 2519 2508 195 --
NM_000959chr172877 2539 714 641 360 246 123 43456 2614 2455 96 24001 3149 --
NM_001001389chr11103017 2550 2329 1989 1104 1005 849 770 40 23 43031 2772 2580 1865 11147 11154
NM_001001390chr11103017 2550 2329 1989 1104 1005 849 770 40 23 43031 2772 2580 1865 11147 11154
NM_001001391chr11103017 2550 2329 1989 1104 1005 849 770 40 23 43031 2772 2580 1865 11147 11154
NM_001001392chr11103063 2596 2375 2035 1150 1051 895 816 86 69 43077 2818 2626 1911 21193 35 11200
NM_001001395chr12142696 2425 2417 2323 2062 1825 1726 1018 906 713 477 269 165 133 --11991 --
NM_001001396chr1124487 3934 3606 2936 2796 1604 1568 1178 1142 777 723 702 33642 3162 1450 2910 432 --
NM_001001419chr5155182 4807 4618 4480 4411 4211 4152 3549 3274 1908 1881 1397 374 319 92 44757 4530 1990 1850 55148 5026 4961 4374 1829 21836 338
NM_001001420chr5155182 4807 4618 4480 4411 4211 4152 3549 3274 1908 1881 1397 374 319 92 44757 4530 1990 1850 55148 5026 4961 4374 1829 21836 338
NM_001001481chr8123159 3037 2423 2341 2294 1321 1291 1267 955 694 641 430 32565 286 46 33313 3295 115 1585
NM_001001549chr782433 2402 2259 617 324 258 237 25 42536 788 77 54 12731 11740
NM_001001550chr782433 2402 2259 617 324 258 237 25 42536 788 77 54 12731 11740
NM_001001555chr782433 2402 2259 617 324 258 237 25 42536 788 77 54 12731 11740
NM_001001557chr871879 1623 1575 1477 1366 836 812 31778 422 239 --21358 858
NM_001001664chr2174094 3939 3817 3770 3692 3472 3418 3164 3157 3047 3023 2909 2822 2678 1640 676 337 41538 1072 126 24 13909 2989 704
NM_001001665chr282905 2666 1151 1113 1046 968 676 453 ----23051 1176
NM_001001668chr19113563 3529 2847 2774 1279 1073 960 951 663 531 524 64288 3801 3497 2990 437 226 22662 1635 13042
NM_001001709chr9162906 2759 2330 2174 2136 2008 1832 1091 1084 866 709 694 517 425 251 42 52635 2391 2198 340 272 62881 2626 2472 2375 919 115 2848 263
NM_001001890chr2174064 4011 3969 2776 2631 1068 294 33877 904 706 23309 611 13829
NM_001001928chr22167648 7429 7297 6304 6081 5994 5969 5548 2808 1963 1872 1648 1601 970 691 408 27173 6538 57662 7046 5231 2445 1821 --
NM_001001994chrX5474 391 211 183 43 2543 445 3534 378 372 --
NM_001001996chrX5474 391 211 183 43 2543 445 3534 378 372 --
NM_001002257chr2113233 2770 2340 2298 1052 814 531 514 230 45 24 11191 ----
NM_001002258chr261634 1564 1451 1323 1234 530 --31684 1467 138 1260
NM_001002926chr752051 1826 897 819 656 21889 856 32803 735 79 11120
NM_001003407chr10154941 4918 4881 4824 4085 3904 3844 3758 3371 3201 2037 1830 1509 1372 537 1581 34889 1344 708 14387
NM_001003408chr10154941 4918 4881 4824 4085 3904 3844 3758 3371 3201 2037 1830 1509 1372 537 1581 34889 1344 708 14387
NM_001003652chr18218678 7844 7754 7747 7291 7099 6822 6657 6453 6034 5788 3126 2959 2669 2647 2518 2467 2134 1880 1135 719 46963 6506 6386 3103 26755 27 26401 1528
NM_001003674chr18157022 6323 6186 5663 5504 5299 4265 2741 1501 1027 836 601 333 294 284 --36509 5279 4464 21618 924
NM_001003675chr18157022 6323 6186 5663 5504 5299 4265 2741 1501 1027 836 601 333 294 284 --36509 5279 4464 21618 924
NM_001003679chr171940 1477 1399 1376 621 456 447 21682 88 --11961
NM_001003712chr12143713 3587 3516 3377 3232 3030 2739 2614 1632 1422 1328 1261 468 241 43105 1576 758 460 42467 1499 1359 898 --
NM_001003760chr673105 2461 2366 2349 1461 727 435 42534 2406 1429 559 21471 470 12767
NM_001004065chr9103870 3619 3139 2971 2728 2643 1418 583 349 70 33683 926 676 53405 2993 1435 763 154 --
NM_001004317chr6134318 4079 4020 3943 3817 2803 1773 1609 1271 1099 972 798 385 13399 13334 11424
NM_001004328chr1272279 916 839 489 381 317 265 21861 245 11815 4763 753 642 529
NM_001004342chr1135910 5700 5574 4596 4143 3914 2398 2187 1852 1529 1300 1012 925 46059 4318 2154 494 22085 1124 --
NM_001004419chr12214565 4205 3857 3843 3723 3433 3374 3336 3156 3090 2915 2866 1849 1723 1615 1526 1341 1003 983 822 588 43468 1366 1126 1109 54542 1693 1075 695 179 21181 968
NM_001005386chr282472 2446 2423 2296 1928 1791 118 89 12493 --21951 831
NM_001005404chr1774145 3850 3811 3413 2770 1741 247 44518 4021 2755 904 24184 1662 14079
NM_001005463chr1052417 2331 597 456 376 31611 514 257 188 1389
NM_001005473chr5146638 6275 6123 5750 5258 4395 2355 2203 1912 1603 1372 1255 829 820 32654 2182 727 22123 614 34881 2526 872
NM_001005476chr27737 516 281 261 119 95 59 2529 272 2556 465 --
NM_001005502chr12104624 4487 3682 3557 3245 3165 1384 513 294 208 32097 1547 125 2363 179 --
NM_001007023chr14144997 4505 4193 3478 2046 1823 1780 1670 1659 1416 964 692 291 231 114690 3757 3723 2034 1813 1298 1161 916 732 435 105 13805 14580
NM_001007094chr1084041 3881 3805 2769 1416 364 316 289 4760 742 491 207 2137 68 23729 892
NM_001007097chr9174752 3989 3914 3759 3386 2023 1494 1460 1405 1312 986 929 860 425 331 301 164 12014 11715 1731
NM_001007237chr162902 2336 1753 488 125 108 --12482 32631 2445 2078
NM_001007278chr13125264 5165 4534 4184 4177 4041 3629 1622 1593 1495 304 167 44689 4351 4234 3964 34565 1747 1677 14946
NM_001007466chr6104270 4257 4158 3830 3692 3167 1701 1497 1114 865 64670 3566 1784 1389 1039 218 54147 3836 962 414 97 --
NM_001008408chr7106329 6141 5688 2415 2287 2084 1994 1485 1037 545 36308 4665 1153 --22467 1184
NM_001008539chr8114819 4476 4383 4194 4028 2094 1463 1285 1166 904 848 14826 24362 892 13319
NM_001008541chr10102336 2200 2077 2050 928 611 600 513 295 269 31853 559 231 1435 11920
NM_001008541chr10102336 2200 2077 2050 928 611 600 513 295 269 31853 559 231 1435 11920
NM_001008726chr1471270 1173 649 614 515 210 138 71635 1361 1283 1257 1132 542 126 21304 663 --
NM_001009554chr443000 1897 1690 1559 54592 3384 1473 916 726 44515 3536 1194 861 34599 3663 3095
NM_001009554chr443000 1897 1690 1559 54592 3384 1473 916 726 44515 3536 1194 861 34599 3663 3095
NM_001009555chr491690 1681 1626 1280 1230 1213 1188 560 140 197 1199 11552
NM_001009899chr396453 6309 6144 4764 1692 1261 1139 358 278 66089 6003 5036 4734 4362 384 46288 4740 1102 83 --
NM_001009909chr1193690 3163 2967 2401 1583 1507 1123 900 760 53944 3496 3156 3137 1368 4851 813 786 76 23927 3812
NM_001009959chr272346 2178 2163 771 339 321 147 --3957 951 416 12004
NM_001009960chr732636 1777 681 2353 236 --32681 606 181
NM_001009993chr294492 4422 3490 3402 1505 1173 1010 892 744 33952 905 855 21455 382 21076 721
NM_001010853chr693189 2801 2786 2552 2436 1204 421 172 69 22998 2454 --13276
NM_001010861chr192822 2538 2384 1990 1902 1097 1061 519 452 12749 32393 1996 366 32317 2302 1918
NM_001010891chr586532 6320 6222 5736 4374 2422 1653 1440 26617 1458 --26903 6330
NM_001010986chrX122316 2227 2004 1575 1014 955 851 681 577 451 303 199 1900 2323 192 --
NM_001011657chrX41192 1097 1027 831 41104 455 198 37 --2384 84
NM_001011666chr7116128 6057 5785 5361 4571 4218 2235 2141 1190 1163 1047 25155 2169 35908 882 145 15369
NM_001011708chr2102450 2232 1959 1879 1097 919 772 688 178 75 32872 2474 657 ----
NM_001012393chr11124518 4202 4140 3985 3602 3415 1526 1451 1083 722 666 388 54554 4066 3942 3724 1962 65063 4374 4287 3263 3139 1921 13740
NM_001012659chr3123932 3925 3684 3570 3402 3380 3341 3099 2667 1297 224 193 22632 2615 --11361
NM_001013031chr1092752 2700 2328 1365 1114 729 577 328 175 32258 1264 1181 22273 2243 22189 220
NM_001013620chr12198189 7863 7708 7636 7455 7232 7215 6668 6483 6087 3176 2553 2415 732 666 640 497 405 86 108271 6713 6698 6304 5649 5563 2633 2091 2080 79 36781 6426 1401 16145
NM_001013746chr7102233 2191 2059 1998 1676 1600 793 628 544 191 91984 888 870 482 402 234 199 133 65 22179 315 22144 2098
NM_001014380chr1395356 4688 4459 4128 3963 3805 3597 1186 1084 55573 5111 4908 1155 162 45556 4975 4057 698 14920
NM_001014797chr10217903 7360 7338 7284 6321 6164 5456 5325 5315 5175 3293 3203 2732 2106 1728 1609 1348 1333 744 224 120 58106 5068 3259 3033 314 87554 6966 5840 5495 5391 2712 1740 720 16909
NM_001015048chr1442916 2817 2272 1117 21208 565 32636 2408 645 1379
NM_001015049chr1442916 2817 2272 1117 21208 565 32636 2408 645 1379
NM_001017440chr7178121 7022 6897 6769 6275 6085 5914 5858 5670 5620 3145 2921 2907 2474 2258 1465 121 27009 5921 21673 1127 18032
NM_001018067chr1114731 4540 4426 4296 3729 3709 3600 2132 1151 972 791 14240 55271 5082 4546 3694 3626 --
NM_001018068chr1114731 4540 4426 4296 3729 3709 3600 2132 1151 972 791 14240 55271 5082 4546 3694 3626 --
NM_001018069chr1114731 4540 4426 4296 3729 3709 3600 2132 1151 972 791 14240 55271 5082 4546 3694 3626 --
NM_001018074chr5153812 3784 3475 3177 3161 3067 3023 2861 2757 1508 1487 1335 671 376 225 1457 33508 3496 448 23184 2574
NM_001018075chr5153812 3784 3475 3177 3161 3067 3023 2861 2757 1508 1487 1335 671 376 225 1457 33508 3496 448 23184 2574
NM_001018076chr5153812 3784 3475 3177 3161 3067 3023 2861 2757 1508 1487 1335 671 376 225 1457 33508 3496 448 23184 2574
NM_001018077chr5153812 3784 3475 3177 3161 3067 3023 2861 2757 1508 1487 1335 671 376 225 1457 33508 3496 448 23184 2574
NM_001018090chr15142608 2422 2322 2184 1989 1852 1771 1758 1745 622 497 436 367 177 11106 1299 --
NM_001018091chr15152718 2532 2432 2294 2099 1962 1881 1868 1855 732 607 546 477 287 113 --2409 82 --
NM_001018102chr15142608 2422 2322 2184 1989 1852 1771 1758 1745 622 497 436 367 177 11106 1299 --
NM_001024094chr5153812 3784 3475 3177 3161 3067 3023 2861 2757 1508 1487 1335 671 376 225 1457 33508 3496 448 23184 2574
NM_001024457chr261373 965 923 355 201 109 41362 1031 568 194 1445 21077 183
NM_001024647chr12127376 7014 6569 6562 6516 5403 2605 1552 1506 1471 1354 525 95892 5417 3066 2705 1696 1520 563 497 45 37678 5515 5494 22613 202
NM_001024855chr351769 1593 1346 1304 106 21724 1606 41194 688 190 176 31868 1240 91
NM_001024948chr1123509 3496 3067 2911 2785 2569 2528 1294 1029 843 748 379 21111 78 32407 401 57 --
NM_001025076chr10126259 5993 5975 5682 5243 4994 4614 4452 1138 1075 721 367 31419 478 250 35510 2312 1403 --
NM_001025077chr10197617 7351 7333 7040 6601 6352 5972 5810 4961 4743 4680 4583 2496 2433 2079 1725 898 746 350 54652 2777 1836 1608 768 36868 4853 2761 --
NM_001025079chr3123800 3648 3478 3407 3226 2999 2927 1291 1149 513 137 48 24046 3511 23194 405 1968
NM_001025105chr531514 618 227 1268 11211 31426 1043 571
NM_001025108chr2104138 3589 3574 3539 3468 3238 2662 1405 774 465 43527 3342 1524 1436 23489 565 --
NM_001025233chr12112575 2542 1702 959 671 482 372 364 293 121 80 42450 2052 989 798 32738 386 91 --
NM_001025252chr8102768 2437 2325 2307 1994 1113 1072 976 847 555 42979 2584 2112 2021 1159 22953 2227
NM_001025253chr8102768 2437 2325 2307 1994 1113 1072 976 847 555 42979 2584 2112 2021 1159 22953 2227
NM_001025780chr951257 438 262 179 149 1399 21463 649 11409
NM_001029839chr351436 1423 567 388 188 --1547 2605 72
NM_001029840chr351436 1423 567 388 188 --1547 2605 72
NM_001029858chr663070 2357 1068 498 256 146 31121 1008 927 62956 2493 2343 989 907 366 23280 3045
NM_001029863chr642971 2106 1177 412 43267 3223 2865 2816 3901 688 609 21086 121
NM_001029875chr572286 2248 2204 1030 738 169 28 53014 2886 1866 445 39 1625 1408
NM_001030055chr14154160 4134 4117 3865 3787 3777 3506 3495 3380 3340 3257 1245 922 726 359 24334 524 23295 2954 13264
NM_001031679chr1283352 1371 1345 775 531 493 474 228 53504 3251 2993 2903 1388 32172 345 21 --
NM_001031685chr13189 147 116 2852 157 --2126 32
NM_001031700chr451606 956 784 769 301 3746 206 190 42335 2171 1857 666 --
NM_001031732chr473294 2734 2579 1406 1235 240 106 23302 175 --22656 613
NM_001031804chr16114323 4022 3311 3219 3148 2871 1744 1154 1044 686 393 43693 3394 1557 1277 --33740 953 606
NM_001032394chr662723 2421 1748 314 276 174 12299 11997 22837 2250
NM_001032395chr662590 2288 1014 181 143 41 12166 21864 1059 22704 2117
NM_001033087chr20112883 2834 2825 2485 2473 2380 2021 1299 601 540 107 22927 519 32562 2185 2060 1594
NM_001033117chr3114904 3443 3246 3192 2984 2964 1206 925 617 505 310 24118 1792 23710 1368 34012 3729 3534
NM_001033557chr261424 1315 926 424 355 185 11331 1478 11052
NM_001033925chr1052037 2021 771 391 64 11936 292 72 --
NM_001037132chr761925 1766 1717 1660 601 482 1764 42073 1417 355 129 1314
NM_001037133chr761925 1766 1717 1660 601 482 1764 42073 1417 355 129 1314
NM_001037174chr282292 1581 1442 560 160 149 60 40 11487 52237 2094 1529 738 437 --
NM_001037277chr141559 1254 1167 602 1191 41664 1440 1188 490 21524 1123
NM_001037278chr141559 1254 1167 602 1191 41664 1440 1188 490 21524 1123
NM_001037317chr192822 2538 2384 1990 1902 1097 1061 519 452 12749 32393 1996 366 32317 2302 1918
NM_001037553chr21104957 4672 4367 4089 3535 1789 1741 1033 721 711 34713 3265 2035 --24147 1530
NM_001037954chr116958 809 796 781 338 30 53062 2981 2530 2159 1139 33423 827 517 1581
NM_001039199chr20215000 4778 4638 4320 4096 3732 3566 3238 3179 1998 1828 1725 1583 1359 1118 870 552 523 410 396 189 35058 3760 3189 --1200
NM_001039547chr3198049 8013 7978 7900 7476 7351 7057 6456 5581 2374 2154 1980 1717 1571 1522 662 572 398 57 44930 909 672 468 17844 --
NM_001039577chr1114316 4014 3823 3662 3210 3177 1598 1124 934 320 313 1456 33576 1101 303 13322
NM_001039580chr484386 3625 3285 1917 1812 1773 422 161 34473 3341 1962 21068 755 23095 135
NM_001039585chr1113134 2796 2587 971 898 617 503 380 64 30 21 43713 2871 2712 353 24258 3406 --
NM_001039615chr862278 915 489 381 317 265 31860 839 245 11814 4762 752 641 529
NM_001039618chr11195905 4937 4901 4597 4196 3687 3600 2387 2171 1908 1869 1294 1059 888 871 811 648 629 440 34093 3806 2107 32120 1575 1071 15401
NM_001039840chrX175986 5654 5269 5187 5170 4519 4157 2164 2141 2128 2107 1813 1331 1106 1043 967 667 55953 5430 4696 1150 1086 34391 1347 73 1153
NM_001039937chr13104154 4013 3181 2822 1631 1507 1422 1353 592 195 43490 3398 624 476 33650 1455 1059 11440
NM_001040020chr741552 1165 576 355 2313 25 31583 556 345 --
NM_001040151chr1184608 4514 4183 1791 1776 1313 414 233 11673 13949 34019 3972 3956
NM_001040152chr7184965 4519 4512 4435 4175 3917 3390 3307 3252 3124 2034 1841 1824 1688 1287 791 780 183 24569 4219 ----
NM_001040157chr4112940 2577 2553 2289 2255 2111 1970 1840 1106 473 363 52857 2659 2422 2069 547 32822 2748 1047 21100 649
NM_001040159chr441398 952 574 370 2355 134 --21319 1097
NM_001040284chr16215873 5663 5438 5328 5094 4828 4726 4578 4098 3917 3722 2372 2176 1812 1660 1651 1520 1500 1413 1323 1027 55013 4820 4452 838 620 25793 158 11792
NM_001040429chr13103288 2938 2582 2368 2265 1330 935 493 484 341 23454 3039 13177 32493 281 97
NM_001040441chr1145504 5334 5110 4939 4556 4004 3996 3766 3540 1954 879 733 560 203 13562 11377 24413 4271
NM_001040450chr1562581 1792 1135 1028 977 215 22192 43 --42261 958 451 241
NM_001040453chr1562581 1792 1135 1028 977 215 22192 43 --42261 958 451 241
NM_001040665chr7154732 4637 4420 3935 3914 3829 3706 3591 1521 1470 633 551 537 392 120 --23165 570 24012 664
NM_001040712chr962282 1393 707 401 329 84 33415 794 202 33560 3502 211 --
NM_001040875chr852101 1828 381 250 242 32538 2487 1655 --11707
NM_001042355chr16135376 5362 3805 3661 3428 3272 1737 1573 1287 774 388 347 241 22110 1435 65267 4480 4404 4340 4190 4120 44730 1796 1663 799
NM_001042412chr16135376 5362 3805 3661 3428 3272 1737 1573 1287 774 388 347 241 22110 1435 65267 4480 4404 4340 4190 4120 44730 1796 1663 799
NM_001042413chr9144104 3790 3756 3726 3487 3364 3284 3178 2796 2662 1479 968 362 316 11008 2691 333 1660
NM_001042493chr651866 1851 1454 487 365 --31396 249 111 3600 496 59
NM_001042494chr1593856 3765 3695 3196 2558 1460 1048 1009 59 21159 330 1711 13068
NM_001042495chr1593856 3765 3695 3196 2558 1460 1048 1009 59 21159 330 1711 13068
NM_001042496chr1593856 3765 3695 3196 2558 1460 1048 1009 59 21159 330 1711 13068
NM_001042497chr1593856 3765 3695 3196 2558 1460 1048 1009 59 21159 330 1711 13068
NM_001042510chr871952 1794 828 780 743 711 203 1526 21749 211 --
NM_001042511chr871952 1794 828 780 743 711 203 1526 21749 211 --
NM_001042533chr343000 1104 508 123 1942 33247 2518 412 23320 177
NM_001042543chr441183 987 545 182 11372 1333 2175 137
NM_001042555chr1294787 3918 1444 1338 771 748 619 399 250 43453 1529 1471 1141 44721 4335 3632 53 23181 1637
NM_001042599chr2257890 7873 7810 7644 7511 7200 6984 5609 5053 4912 2016 1750 1652 1516 1410 1396 1382 1273 1218 1152 935 780 523 451 249 45372 2406 1639 186 56848 6200 6102 5745 1665 12582
NM_001042601chr353022 2380 2221 1190 940 63181 2720 2486 424 213 178 43056 2137 1110 80 12576
NM_001042603chr12165271 5226 5174 4945 4900 4881 4716 4643 4609 3776 3769 3696 1876 1841 1098 745 24991 3786 24243 4100 --
NM_001042604chr3164893 4825 4784 3728 3608 3416 3232 3204 1875 1774 1737 1312 882 809 567 422 24837 926 14284 13101
NM_001071775chr13101792 1768 1232 762 466 161 84 72 54 24 1675 1749 1556
NM_001100108chr1198307 7645 7608 6663 6154 5862 5512 5315 3284 2765 2593 1986 1875 1800 1465 882 665 645 239 57550 2840 2252 1406 252 17145 193
NM_001106chr3219539 9374 9081 8378 8303 8263 7792 6915 6623 3474 3455 2705 2490 1826 1819 1408 1319 885 436 293 77 39721 7490 44 69791 9528 8739 8324 6444 614 --
NM_001117chr1892247 2216 1954 1871 1569 943 445 316 118 11765 148 11778
NM_001146chr842359 750 441 76 52131 1768 421 371 65 31495 611 29 21646 389
NM_001148chr462088 1915 1875 1418 1361 808 --21623 466 22183 46
NM_001167chrX136611 5955 5028 4858 4549 2552 2173 1526 1149 1025 737 577 457 46687 5038 4832 429 25479 626 11066
NM_001173chr14154160 4134 4117 3865 3787 3777 3506 3495 3380 3340 3257 1245 922 726 359 24334 524 23295 2954 13264
NM_001200chr205932 456 283 162 130 --2444 116 1142
NM_001201chr473882 1503 1005 960 831 326 156 22793 437 63977 3953 2664 1553 1298 534 13706
NM_001204chr2105943 5724 5504 4923 2487 1245 1173 987 720 26 46800 6361 2816 2471 17609 --
NM_001206chr9103094 2872 2573 2103 1151 1143 725 652 219 75 32751 2678 2243 12619 --
NM_001256chr17102845 2815 2510 2219 1157 1123 904 807 472 284 22789 2734 32584 296 165 22985 340
NM_001259chr7106225 4877 4734 4215 4010 3850 2559 1943 1716 658 76074 5594 4403 4306 4255 810 248 15073 34487 2492 2186
NM_001289chrX21229 1068 11399 3589 246 124 2631 91
NM_001304chr1793789 3746 3721 3413 3405 1255 944 731 706 11209 23027 1333 13293
NM_001364chr11114198 4139 3855 1816 1275 843 769 282 209 160 152 2796 681 1699 1472
NM_001396chr2162823 2082 926 764 730 152 12039 42074 1852 1080 578 22580 2507
NM_001402chr661970 1614 679 613 380 369 21898 339 21831 235 1295
NM_001412chrX93719 3545 3526 2981 2821 1226 1005 947 38 41497 1048 464 323 73245 2801 2759 2442 1503 1355 756 11033
NM_001419chr19104896 4595 4322 3401 3375 1656 1594 1424 742 131 34526 3438 1410 24659 124 24668 3535
NM_001430chr241564 1486 800 621 21877 574 --21703 1591
NM_001432chr463707 3667 2956 2768 1162 259 43898 3435 700 131 31215 989 957 11149
NM_001490chr9153490 3449 3330 3316 3062 2922 2856 2713 2457 2406 2288 1093 379 266 96 43574 3498 2599 2509 1348 --
NM_001527chr6164488 3870 3588 1938 1929 1900 1554 1534 1061 748 596 570 375 185 74 52 44074 684 457 436 1669 1930
NM_001542chr162902 2336 1753 488 125 108 --12482 32631 2445 2078
NM_001609chr1064318 3420 3285 2867 1546 124 63335 2888 1261 871 835 617 43948 3221 824 781 44502 2965 2912 1530
NM_001616chr2112945 2888 2287 1139 977 929 807 627 313 200 114 43157 2461 243 144 --22484 257
NM_001621chr792890 2862 2633 2075 1937 1927 1894 1886 1158 42568 2395 979 815 --162
NM_001621chr792890 2862 2633 2075 1937 1927 1894 1886 1158 42568 2395 979 815 --162
NM_001650chr18134139 3704 3523 3348 3177 3110 3065 2861 2749 2730 2676 2573 661 13096 23883 3492 13641
NM_001684chr1124204 3651 3323 2653 1670 1321 1285 895 859 494 440 419 33359 2879 1167 2627 149 --
NM_001689chr261634 1564 1451 1323 1234 530 --31684 1467 138 1260
NM_001709chr1182674 2274 2023 1981 1806 678 268 124 32791 2229 1964 22144 1047 --
NM_001742chr751763 1417 1234 640 290 41710 570 149 113 --11618
NM_001753chr741622 736 294 122 ----21678 318
NM_001754chr2174064 4011 3969 2776 2631 1068 294 33877 904 706 23309 611 13829
NM_001777chr3123800 3648 3478 3407 3226 2999 2927 1291 1149 513 137 48 24046 3511 23194 405 1968
NM_001806chr1982635 2249 2016 1836 1829 1084 145 84 32132 2057 1850 22255 2164 --
NM_001830chrX93919 3607 3118 2589 2567 2559 531 146 126 33677 660 500 --33686 3575 85
NM_001854chr141447 1326 594 181 --3973 471 217 1513
NM_001858chr684251 4126 4006 3586 3272 1366 1207 257 34589 1516 1480 23732 727 24641 4522
NM_001859chr993665 3341 2848 1546 1313 780 254 60 52 22805 1035 21376 411 13986
NM_001874chr12104624 4487 3682 3557 3245 3165 1384 513 294 208 32097 1547 125 2363 179 --
NM_001892chr531514 618 227 1268 11211 31426 1043 571
NM_001918chr1229212 7641 7245 5997 3639 3617 3527 3492 3214 3151 2477 2459 1716 1360 1237 1072 856 748 694 665 397 169 49009 8228 7767 3345 59120 7595 7295 7289 1448 18462
NM_001924chr13437 411 189 --2494 180 1197
NM_001941chr1893926 3852 2811 2684 1147 843 619 568 537 3414 402 180 43192 2738 625 427 --
NM_001969chr1483960 3873 3770 2643 2551 1507 571 165 23722 237 23761 3291 13882
NM_001977chr431708 262 254 1654 21329 1313 1176
NM_001987chr1273822 3759 3614 3060 1447 927 895 41101 1000 559 103 43561 1008 591 402 12974
NM_002006chr4135553 5477 5384 5264 5043 4854 3986 3893 2010 1895 1521 1153 69 35134 4769 1637 21769 325 23968 38
NM_002009chr1531700 659 195 52789 789 508 129 118 32730 1712 566 1475
NM_002025chrX239033 8567 8408 7947 7650 7272 7126 7107 6705 6541 6121 6114 6035 5677 3380 3033 2707 2138 1960 1064 882 498 269 118361 8053 7494 6343 3664 3481 3168 1969 1336 803 356 89326 8854 8428 8018 7730 3240 1239 387 58745 8505 7368 2296 1629
NM_002035chr18103485 3245 3227 1581 1516 1278 1156 815 625 203 33033 2435 1497 33522 2636 257 11048
NM_002040chr2161129 797 441 380 341 325 12389 22080 926 23208 332
NM_002069chr761846 1756 1248 367 206 157 21462 739 11792 11694
NM_002092chr473747 3727 2021 1784 1358 433 205 21731 1653 43503 1572 1532 1340 1185
NM_002099chr482078 1970 1798 1269 652 389 272 29 2745 68 41860 1784 1729 368 --
NM_002128chr13102549 2204 2161 2094 2017 1879 978 902 776 725 12558 32337 987 250 --
NM_002158chr273339 3177 2489 1365 1252 931 248 22433 544 23560 907 33819 2834 1178
NM_002182chr352650 1810 634 562 440 31952 800 653 21112 873 11972
NM_002203chr574148 3707 3698 3646 3380 2669 307 21497 901 13502 44018 3678 3254 161
NM_002210chr2103536 3342 3000 2586 2534 2301 2177 1259 1022 806 52970 2687 2463 2193 1043 32248 608 139 --
NM_002214chr7115723 5086 4753 4522 4463 4237 3806 3634 2255 1554 289 55289 4610 4509 3608 2145 32104 1904 1026 25026 3457
NM_002223chr12123899 3839 3822 3600 3165 1276 919 562 498 476 292 102 33757 2664 878 21241 848 22827 2481
NM_002241chr1152964 2910 2893 2875 2601 2592 2556 2155 2146 1238 1146 900 863 834 363 33045 2405 523 22675 890 12565
NM_002264chr395031 4711 4278 3658 3509 3442 3136 1054 389 74742 4369 3542 3095 1145 667 166 13394 11391
NM_002268chr361276 664 545 453 227 163 1324 51315 1262 1251 696 250 --
NM_002270chr5165227 4423 4354 4030 3976 3878 1840 1793 1701 1556 1172 900 670 658 630 233 34814 1352 271 11739 1528
NM_002285chr2104138 3589 3574 3539 3468 3238 2662 1405 774 465 43527 3342 1524 1436 23489 565 --
NM_002296chr1101777 1763 1506 1458 1258 603 512 480 267 226 1303 21663 381 --
NM_002310chr5136360 6310 6259 5759 4323 4202 4165 2583 1697 1685 1419 647 143 56452 6082 5315 1579 1321 34776 2301 466 46607 2231 2046 1770
NM_002313chr10154941 4918 4881 4824 4085 3904 3844 3758 3371 3201 2037 1830 1509 1372 537 1581 34889 1344 708 14387
NM_002336chr12115066 4688 3841 3495 3445 3289 3113 1911 1534 815 649 35095 4375 4005 33153 1480 497 13396
NM_002351chrX71755 693 610 545 351 332 128 31703 1135 1109 21281 1174 --
NM_002430chr2252506 2218 1005 536 97 --42401 2279 1918 497 12299
NM_002460chr693388 3184 3171 2897 2586 2499 2454 445 247 63613 2956 2875 2339 1401 620 23653 3513 22625 345
NM_002481chr1167921 7601 7409 5709 5598 5241 3056 2148 1743 1336 1327 1300 1199 1173 1110 1055 36130 6085 6009 37277 6408 2924 11029
NM_002522chr1763872 3618 3600 3088 3053 1346 21452 406 21041 421 23741 3007
NM_002545chr11124518 4202 4140 3985 3602 3415 1526 1451 1083 722 666 388 54554 4066 3942 3724 1962 65063 4374 4287 3263 3139 1921 13740
NM_002577chr3103912 3398 3031 3011 3004 2864 1401 1148 920 141 33699 2451 650 32844 1273 65 21168 118
NM_002594chr2062353 2035 2024 1571 867 462 42012 1948 336 277 32391 1747 166 --
NM_002610chr292832 2807 2490 2353 2276 2241 688 282 175 22108 800 33116 2556 133 --
NM_002641chrX31789 1547 682 21946 1581 21877 1709 31991 1935 61
NM_002655chr845134 4286 1454 560 14740 34708 1725 1441 24863 2063
NM_002709chr2103405 3363 3250 3145 3035 2743 2468 1008 464 280 22764 2547 42215 1348 984 323 --
NM_002718chr362630 956 838 703 59 21 2730 432 --22508 1008
NM_002731chr1123131 3094 3011 2997 2926 2589 2514 2144 1017 694 508 432 22948 2543 1885 --
NM_002737chr17116272 5903 5237 5154 5023 4567 4328 1020 750 540 123 16439 42233 2111 995 520 --
NM_002740chr372247 2087 1870 1807 1018 694 265 12172 11879 21078 173
NM_002745chr2263985 3977 3295 2997 2803 526 44332 2811 1344 305 54357 3465 3394 1638 1444 11024
NM_002760chrY194946 4597 4211 4054 3958 3824 3744 3725 3686 2071 2055 1777 1755 1569 1041 1025 407 356 35 34786 1887 1277 25934 4368 13650
NM_002834chr12113728 3429 3203 2727 2640 2569 1436 1110 703 466 95 12858 2540 419 11355
NM_002837chr12144391 4096 3961 3786 3462 3068 1745 1691 1597 1537 1342 1308 1127 779 --34152 3864 1751 --
NM_002839chr962282 1393 707 401 329 84 33415 794 202 33560 3502 211 --
NM_002843chr1183428 2615 2557 937 833 807 143 123 1274 12828 33119 2405 441
NM_002886chr3165103 4628 4442 4252 4083 4057 3900 3709 2016 1747 1591 564 509 484 387 213 3845 761 340 24545 367 23676 3148
NM_002941chr351616 1051 664 35 23 41505 1423 1367 1037 ----
NM_002959chr193691 3565 2771 1726 1674 1617 1181 1045 311 23533 210 44344 1389 1328 462 --
NM_002977chr2103225 3093 2597 1387 1292 1215 980 436 401 37 43165 2575 815 763 23307 2936 --
NM_003030chr351976 1390 1279 1271 746 --22001 1827 3665 541 385
NM_003034chr12198078 7794 7784 6782 6300 6180 5897 5813 5546 3038 2825 2527 2504 2425 2274 2067 246 198 186 25780 111 65200 2908 2024 1188 899 132 12038
NM_003046chr8114819 4476 4383 4194 4028 2094 1463 1285 1166 904 848 14826 24362 892 13319
NM_003048chr2122830 2581 2235 1902 1885 1877 1839 1064 812 528 325 247 --32436 2002 1735 1369
NM_003071chr382009 1731 1305 771 514 178 129 81 1232 11943 2608 58
NM_003099chr15136506 6349 6216 5901 5336 5184 5114 5064 4341 4269 4198 1910 537 36402 2240 1450 35967 933 358 --
NM_003108chr2147247 7121 6976 6930 6799 6241 5630 5616 1730 1619 1349 1235 986 227 66846 5520 4890 1782 716 194 1205 26249 4751
NM_003112chr7102942 2467 1211 1190 872 362 244 199 64 56 1485 ----
NM_003144chr6112266 2129 2041 1954 1777 1701 717 667 642 635 158 11586 ----
NM_003155chr8102789 2711 2042 1110 983 869 749 440 342 142 11087 11814 1633
NM_003161chr1793207 2458 2419 2407 2385 1444 645 453 74 53416 968 896 611 350 --43186 3168 762 567
NM_003189chr183157 2939 2131 1276 1264 683 234 81 31350 735 573 12115 22859 2680
NM_003199chr18145596 5212 4890 4742 4536 4178 3851 3795 3610 2088 2049 1875 1511 870 62172 1396 1233 444 382 350 14786 21283 428
NM_003203chr2102492 2225 2111 2102 1831 1794 1618 590 582 63 1119 2411 174 32387 2278 1541
NM_003221chr643785 3708 1677 1182 1319 1557 23586 344
NM_003234chr382390 2183 2016 1706 1632 1513 445 222 3750 494 429 42238 638 294 27 --
NM_003236chr263553 3355 2155 795 717 571 53229 3190 2794 2172 1371 42656 2519 1096 487 --
NM_003253chr2171909 1767 1579 652 485 431 306 21873 1625 21337 739 11705
NM_003262chr375020 3248 1562 1200 1021 846 529 21397 1059 14918 22100 1107
NM_003274chr21103002 2614 2444 2423 2277 1992 1913 1148 902 619 32858 2393 631 42918 2759 2647 287 12340
NM_003292chr182261 2167 2036 1660 875 628 537 300 32198 1864 568 22205 1832 11826
NM_003298chr3206022 5987 5763 5327 5298 5141 4283 3856 2422 2389 2288 2090 1788 1533 1187 1078 881 856 525 214 26111 330 21992 630 1483
NM_003338chr1051696 1257 291 188 104 31282 502 217 --21771 338
NM_003339chr561536 1161 1095 1007 489 441 2434 54 1421 --
NM_003387chr282787 2331 2094 1129 1043 799 642 460 12049 11053 12396
NM_003392chr3164373 4314 4112 3988 3975 3037 2983 2673 1695 1244 1128 1009 676 571 277 240 33955 1151 399 33026 2847 850 --
NM_003410chrX112991 2716 2468 2400 2377 1245 1201 1003 535 487 373 32555 1051 688 22462 959 1986
NM_003421chr1084041 3881 3805 2769 1416 364 316 289 4760 742 491 207 2137 68 23729 892
NM_003423chr1941696 1033 765 347 9940 642 528 496 483 329 210 183 119 --1726
NM_003431chr17632 580 493 479 203 195 118 1217 --2536 524
NM_003441chr451161 1068 1003 984 98 61371 1339 1149 924 192 107 1889 21087 71
NM_003463chr6123182 3089 3052 2989 2279 2183 2055 963 649 466 118 97 1757 23344 2163 --
NM_003468chr263813 3605 2984 1318 1174 345 33576 1716 1407 44282 2682 2663 1596 14300
NM_003478chr1183114 3098 2841 2672 2430 1272 712 525 62985 2575 1306 1082 727 404 32216 476 242 12305
NM_003483chr1252868 2585 2420 2174 601 32564 347 232 1897 11093
NM_003489chr2193382 2574 2231 1242 1128 1096 798 267 124 33109 2452 87 32981 2738 2350 33469 2791 1382
NM_003566chr1263430 2738 2203 1254 1078 262 23316 2549 12392 1333
NM_003574chr18185158 5123 5088 4975 4868 4846 4458 4009 3652 2137 2066 1868 1463 1380 1169 1089 738 256 64723 4662 4220 3857 1944 1715 35771 5269 848 11134
NM_003590chr2123991 3573 3467 3452 2878 2519 1339 1197 1092 1062 908 464 --1275 --
NM_003607chr1103329 2871 2858 2831 1628 1543 1451 1020 682 97 33522 1593 1305 14014 11636
NM_003615chr3103912 3553 3520 3337 3267 1502 1447 1399 1354 173 33088 2692 1093 23985 1492 --
NM_003617chr1114851 4840 4031 3559 3325 1826 1565 863 743 498 21 24696 4298 34321 3682 3227 --
NM_003628chr27737 516 281 261 119 95 59 2529 272 2556 465 --
NM_003644chr17145461 5388 5192 4751 4085 2591 2491 2423 1757 1462 719 687 632 228 36536 5607 1283 36225 1627 867 11871
NM_003671chr9163600 3553 3031 2474 2449 2393 2386 2285 1437 1111 956 859 828 590 75 46 1759 12263 --
NM_003679chr173213 2390 2377 1180 426 277 189 13000 52221 1342 1257 1029 476 161
NM_003759chr4144270 4248 4224 4104 3940 3895 3677 3613 3452 3084 1731 1136 452 96 2804 610 31460 1176 485 24263 1423
NM_003772chr1151085 490 361 301 105 1965 --31064 995 440
NM_003800chr692370 2298 1964 1861 1554 738 586 361 257 187 1290 1301
NM_003822chr173157 3108 2652 2341 2132 1144 1006 12287 22713 1117 1359
NM_003884chr391699 1625 1467 1384 1217 474 393 205 98 2564 133 --11529
NM_003909chr842870 2781 902 432 1716 32837 590 308 2936 347
NM_003913chr6194250 4235 4042 3886 3820 3662 3433 3389 3069 2835 1399 1385 1201 1124 960 930 896 291 191 24206 49 --13011
NM_003930chr782254 1880 1813 815 736 591 179 169 31605 467 281 21981 67 --
NM_003980chr671465 1348 1277 1009 967 127 58 1403 140 1958
NM_003994chr12124139 3626 3551 3519 3477 3312 2770 2735 1750 1033 190 72 2480 365 23411 1384 33450 2751 1526
NM_004028chr18134139 3704 3523 3348 3177 3110 3065 2861 2749 2730 2676 2573 661 13096 23883 3492 13641
NM_004035chr17115021 4429 4175 3388 3324 1809 1428 1337 1253 1225 1008 51828 1486 502 470 199 11274 24799 164
NM_004080chr781356 1235 923 576 327 111 67 52 1316 --2336 204
NM_004087chr321479 221 31726 782 323 --31904 1660 365
NM_004094chr1483052 2764 2172 2128 602 153 90 73 21221 644 --12778
NM_004100chr652650 2087 1818 974 109 22682 2587 1501 2722 142
NM_004133chr8102622 2571 1988 1838 1787 845 636 377 216 40 22461 2259 ----
NM_004136chr1583083 2583 2520 2217 2022 568 311 160 22691 1201 32861 2593 628 --
NM_004171chr11359608 9485 9288 9241 9204 9137 8924 8726 8400 8320 8106 8005 7533 7478 6347 6104 5815 3610 3401 3268 2728 2672 2642 2402 2300 1747 1595 1576 1310 1095 1061 1014 868 671 271 58281 6592 3567 3199 1524 28484 3559 28047 3619
NM_004232chr18163854 3762 3681 3572 3387 3353 3261 2945 2556 1489 1159 806 639 559 488 378 53652 3047 2886 2513 1191 2797 394 13607
NM_004272chr531851 495 367 21680 1622 31960 704 439 1211
NM_004274chr1473004 2650 2631 2035 1983 1962 810 52441 1068 934 482 43 127 1721
NM_004293chr9173866 3562 3533 3183 2642 2499 1081 1025 983 857 583 485 448 411 398 333 325 23485 3299 21162 213 --
NM_004319chr163179 2281 598 299 95 35 --2343 103 13075
NM_004331chr8162574 2531 2467 2290 2196 2140 1994 1898 1889 1870 1679 1003 786 665 206 23 11047 22524 2405 12150
NM_004338chr18157022 6323 6186 5663 5504 5299 4265 2741 1501 1027 836 601 333 294 284 --36509 5279 4464 21618 924
NM_004342chr782281 2260 2095 1886 915 471 432 241 1806 11670 21775 1472
NM_004392chr13122616 2569 2285 2223 2104 2094 988 645 623 356 332 209 31978 563 492 22450 879 --
NM_004397chr11134109 3634 3518 3504 3208 3051 1333 1117 1065 472 432 170 155 --32873 2692 113 --
NM_004412chr10176025 5906 5572 5560 4859 4834 4589 4197 2288 2235 2121 2002 1455 1236 582 236 91 75548 4867 2337 2220 1661 1146 535 22160 1009 25688 1532
NM_004438chr2113313 2990 2893 2741 2164 2078 2039 986 967 592 205 42761 2500 1028 67 1428 1118
NM_004440chr641647 563 376 120 2528 249 21395 1218 1747
NM_004459chr1731761 1649 834 2353 268 41725 1302 560 327 11734
NM_004501chr1164018 3551 3481 3338 2729 2721 2644 2617 2586 1398 1232 913 821 747 598 576 33465 2900 2568 --12599
NM_004504chr273055 2882 2799 2627 878 699 450 2608 357 --22451 895
NM_004525chr231511 1411 271 11527 1955 298 71
NM_004586chrX144713 4564 4422 4095 4087 3903 3759 3558 2156 2056 1584 1089 806 786 --65458 4660 4008 233 222 216 34158 1351 257
NM_004598chr583201 3153 2726 2571 2330 2049 1283 894 32164 909 447 12881 --
NM_004600chr171521 1390 1348 1093 455 448 351 2592 140 1123 --
NM_004612chr9164866 4849 4836 4691 4656 4315 4161 3257 3082 1577 1501 1056 864 818 694 365 34857 4682 1817 1675 --
NM_004685chr1382973 2660 2449 2401 2312 2276 1996 699 22567 916 --1470
NM_004719chr1272830 2811 2155 2078 872 729 74 32430 753 286 --1461
NM_004726chrX135753 5696 5438 5073 5027 4235 4021 1643 1635 1246 1233 892 862 45737 5708 3512 179 1882 11045
NM_004727chr1561867 1738 1594 296 165 100 11333 21859 1600 21625 81
NM_004730chr592100 1962 1677 1575 667 553 510 285 143 ----21329 312
NM_004736chr162224 2004 1451 674 635 531 11936 21610 1578 1321
NM_004744chr4133219 3212 3129 2903 2792 2550 2423 1292 799 588 555 351 228 33073 412 88 33852 3152 464 22832 265
NM_004745chr8156400 5981 5782 5415 5319 5286 5143 5133 5120 4978 4766 2640 2568 2162 1171 46817 5535 4499 1890 25839 598 --
NM_004748chr15193803 3559 3502 3358 3220 3128 2583 1659 1622 1318 1190 1032 975 843 794 665 574 290 145 53759 3663 1088 751 110 22808 273 13071
NM_004775chr1862267 2065 1980 1568 505 111 21858 1482 --32056 1692 457
NM_004795chr1321696 87 --1621 31423 486 275
NM_004808chr1093397 3221 2795 2664 815 498 447 279 104 32203 1326 704 21232 226 21258 1095
NM_004815chr154777 4299 1321 956 896 24193 71 34184 4178 1407 --
NM_004837chr141559 1254 1167 602 1191 41664 1440 1188 490 21524 1123
NM_004857chr14154549 4235 4000 3691 3445 2924 1927 1851 1448 1353 1092 1077 754 736 90 21895 1279 24677 1817 145
NM_004863chr14114643 3642 3422 2010 1617 1398 1349 955 797 581 284 33827 1223 107 24038 1500 22083 1486
NM_004866chr5114197 3977 3603 3370 1773 1546 1422 1339 677 494 289 43139 1935 425 382 1864 15045
NM_004873chr1442916 2817 2272 1117 21208 565 32636 2408 645 1379
NM_004898chr472802 1013 979 905 495 301 105 12046 42822 1882 614 430 22390 262
NM_004904chr7116128 6057 5785 5361 4571 4218 2235 2141 1190 1163 1047 25155 2169 35908 882 145 15369
NM_004936chr983056 2564 2281 2196 499 315 215 78 --12088 12540
NM_004948chr183348 83 57 --2934 923 31294 949 559
NM_004956chr774265 3598 3489 3422 1534 857 313 54557 4155 4102 1565 1471 44571 4305 2805 1291 33927 1771 1353
NM_004985chr12134185 3925 3762 3096 1492 1469 1300 982 914 802 733 339 326 43967 3901 1307 231 1644 1624
NM_004992chrX178398 8174 7564 7288 7136 6650 6147 5237 5160 2725 2264 2256 2123 2097 1462 1091 216 27877 5790 13320 --
NM_004992chrX178398 8174 7564 7288 7136 6650 6147 5237 5160 2725 2264 2256 2123 2097 1462 1091 216 27877 5790 13320 --
NM_004999chr6124491 3930 3718 3598 3390 3248 2990 1473 1277 560 498 459 33039 712 518 24403 3279 11785
NM_005010chr761925 1766 1717 1660 601 482 1764 42073 1417 355 129 1314
NM_005036chr22167648 7429 7297 6304 6081 5994 5969 5548 2808 1963 1872 1648 1601 970 691 408 27173 6538 57662 7046 5231 2445 1821 --
NM_005056chr12175515 5470 5418 5189 5144 5125 4960 4887 4853 4020 4013 3940 2120 2085 1342 989 120 25235 4030 34487 4344 126 --
NM_005057chr171563 1398 1277 712 240 166 76 21736 548 1230 1153
NM_005063chr10103691 3158 3106 2596 2387 1310 1288 1217 492 155 11154 13307 23236 499
NM_005065chr14195178 4151 4133 4021 3918 3563 3367 1717 1587 1571 1481 1296 1271 990 699 499 453 262 223 43739 2058 1940 526 53676 3301 1704 1082 653 14466
NM_005079chr8102768 2437 2325 2307 1994 1113 1072 976 847 555 42979 2584 2112 2021 1159 22953 2227
NM_005095chr141928 1893 478 368 41691 1448 192 73 22104 165 41855 1628 1540 122
NM_005121chr1793857 3841 3633 3496 3345 1084 781 757 282 42717 2463 1318 955 53784 2417 1071 886 385 --
NM_005135chr1593856 3765 3695 3196 2558 1460 1048 1009 59 21159 330 1711 13068
NM_005160chr22136394 6384 5843 5256 4881 4872 2175 2098 1101 693 525 496 320 76501 6205 5070 4369 2087 973 195 11202 --
NM_005164chr1272117 1873 1734 1052 861 339 71 52684 2486 2026 987 553 --22476 2011
NM_005188chr1187588 6954 6311 5680 2347 1689 319 161 47165 7012 6556 6474 37998 7242 167 12954
NM_005197chr14135928 5660 5522 5367 4347 4155 3763 2470 1723 1362 921 797 270 56234 2482 1839 1268 1019 ----
NM_005233chr3102581 2133 1972 1850 1680 1669 819 540 329 149 3627 274 157 12613 --
NM_005235chr2257890 7873 7810 7644 7511 7200 6984 5609 5053 4912 2016 1750 1652 1516 1410 1396 1382 1273 1218 1152 935 780 523 451 249 45372 2406 1639 186 56848 6200 6102 5745 1665 12582
NM_005238chr11103570 3334 3247 2793 2717 1299 491 483 455 384 43024 1405 1270 729 11333 43354 3263 700 327
NM_005278chrX5474 391 211 183 43 2543 445 3534 378 372 --
NM_005311chr782433 2402 2259 617 324 258 237 25 42536 788 77 54 12731 11740
NM_005339chr4204228 3968 3956 3707 3078 2876 2861 1403 1368 1274 1228 1153 929 915 794 542 524 509 484 266 1144 11048 1865
NM_005358chr1341698 1252 566 335 --11832 31916 642 461
NM_005359chr18206529 6445 6104 5994 5777 5765 5140 5043 4972 4636 4043 1595 956 733 662 580 267 220 123 76 34499 2579 2441 36271 4880 997 --
NM_005399chr1154383 4109 3906 3736 3609 3512 3195 3182 3148 1546 1506 1383 651 234 167 1967 21271 220 23247 345
NM_005400chr262737 2606 2088 1164 1157 842 32816 703 666 --22081 795
NM_005402chr761771 733 582 298 291 105 3691 617 402 1149 11177
NM_005426chr13189 147 116 2852 157 --2126 32
NM_005433chr18122217 2060 1875 1759 1723 1059 1035 718 697 654 619 270 22760 662 ----
NM_005436chr1073863 3281 2947 2900 1659 1369 479 13599 11299 11551
NM_005465chr1101944 1604 1389 1294 1253 808 768 376 205 50 --21775 160 31855 1369 1260
NM_005497chr17196175 5918 5651 5315 4651 4541 4488 4324 4080 2439 2348 2331 1474 1465 1150 1049 667 571 544 31357 821 619 34411 1437 336 --
NM_005502chr9113235 3131 3037 2714 2333 2057 770 557 275 262 30 42305 1997 1314 227 21002 163 12609
NM_005504chr12146539 6161 5902 5750 5631 5038 4917 4813 4678 2298 2216 959 797 384 76508 6405 6340 1868 1758 1267 397 86396 4517 4020 2141 1881 1860 1359 1195 35264 2135 27
NM_005542chr761577 1367 1345 1312 738 411 1134 41654 1613 1583 686 21633 1598
NM_005578chr3155011 4664 4218 4012 3884 3642 3533 1995 1985 1310 1107 964 473 145 31 45084 4073 975 654 --13492
NM_005596chr9165923 5461 5290 4904 4670 4619 4611 4271 4213 4063 2339 1315 780 614 488 365 44300 1290 1053 225 25393 1070 1724
NM_005604chr642391 1632 1598 1030 11612 22202 1783 11563
NM_005665chr1134643 4601 4391 3948 3815 3573 3245 3169 1879 1752 1311 871 70 24099 1867 33929 1577 850 41664 1637 1095 339
NM_005668chr5133842 3294 3210 3091 1624 1522 1224 438 420 156 111 62 42 34516 3505 1849 43356 3072 1417 1178 43918 3744 2886 136
NM_005669chr532346 2071 105 52305 2097 836 644 225 42366 1796 904 455 --
NM_005722chr282472 2446 2423 2296 1928 1791 118 89 12493 --21951 831
NM_005725chr1101994 1836 1740 971 930 676 446 408 350 252 11768 --1615
NM_005732chr54351 328 175 159 21530 428 --11486
NM_005746chr772560 1834 1687 731 716 560 476 32574 2134 283 22767 1111 11724
NM_005748chr1283322 2945 2765 2667 2356 1085 397 389 23033 1371 21025 226 12783
NM_005759chr2154477 4329 4119 4043 3841 3730 3498 1593 1520 848 831 721 653 646 96 33686 1621 1369 23121 465 14509
NM_005779chr5133415 3320 3119 3027 2890 1413 1074 713 698 283 207 142 46 33012 2842 1111 32379 685 215 --
NM_005795chr262543 1137 873 666 429 132 1918 22867 589 11932
NM_005798chr13125264 5165 4534 4184 4177 4041 3629 1622 1593 1495 304 167 44689 4351 4234 3964 34565 1747 1677 14946
NM_005813chr272594 2576 2484 2177 2117 2062 197 11648 --2367 109
NM_005840chrX77397 7325 6016 5837 5647 2389 1648 76702 6158 6073 5550 5410 1673 1537 47413 6941 4981 4751 11686
NM_005843chr291920 1821 1672 1543 718 415 314 71 26 31654 1379 485 11410 --
NM_005863chr1091376 1357 1288 1167 1155 1045 916 445 271 2889 498 --11227
NM_005868chr752495 1817 1609 816 118 22362 1754 41899 1797 859 781 12267
NM_005880chr1661436 1350 1210 1111 605 228 11189 --31449 513 462
NM_005898chr1152575 1035 965 750 179 2695 329 33241 909 435 12673
NM_005901chr18218678 7844 7754 7747 7291 7099 6822 6657 6453 6034 5788 3126 2959 2669 2647 2518 2467 2134 1880 1135 719 46963 6506 6386 3103 26755 27 26401 1528
NM_005903chr5155182 4807 4618 4480 4411 4211 4152 3549 3274 1908 1881 1397 374 319 92 44757 4530 1990 1850 55148 5026 4961 4374 1829 21836 338
NM_005909chr5104210 4072 4046 3879 3846 3783 3707 2812 1386 263 --13505 1398
NM_005935chr4145065 3888 3860 3576 3276 2071 1826 1417 1338 1054 709 539 366 338 25122 1202 24892 1628 --
NM_005941chr893730 3372 3364 3143 2928 2839 1020 518 166 11290 43561 3526 2657 1365 12957
NM_005955chr1115539 5493 5419 5332 5296 5134 4015 3705 3363 1668 286 55517 5412 4696 3910 186 21371 324 197
NM_005962chr10102336 2200 2077 2050 928 611 600 513 295 269 31853 559 231 1435 11920
NM_005962chr10102336 2200 2077 2050 928 611 600 513 295 269 31853 559 231 1435 11920
NM_005977chr1331019 958 814 1739 --2757 97
NM_005989chr741432 1180 109 78 31597 1515 1341 3633 125 85 --
NM_006007chr9134124 3478 3261 3229 2893 2742 1735 1196 1175 599 526 306 250 41805 1728 1682 218 34279 3105 231 1960
NM_006016chr691936 904 857 804 671 639 385 297 89 1159 31574 575 403 1307
NM_006047chr20163531 3326 3185 3150 3120 2972 2957 2863 2708 2596 2497 2483 2243 1334 938 381 --33103 3022 1282 21393 329
NM_006054chr1141568 1498 288 76 21253 1092 21074 626 31556 419 322
NM_006061chr651157 1070 330 285 275 21050 97 --21147 1032
NM_006079chr64767 122 114 105 1818 1748 --
NM_006080chr7102964 2485 2231 1926 1058 909 580 527 514 261 3894 301 60 11086 22546 667
NM_006095chr4114521 4109 3111 2992 1552 1346 1316 1096 1089 832 245 24277 1411 33677 3038 98 12909
NM_006139chr282468 2243 2180 920 705 523 269 182 22580 2378 22535 1008 22757 767
NM_006141chr16112625 2575 2539 2426 2016 1886 1109 1041 454 329 163 2550 291 12077 --
NM_006154chr1592451 2300 2293 2270 1935 881 577 416 389 4871 457 144 119 11130 32374 1995 442
NM_006203chr5145460 5050 4958 4875 4830 4549 4463 4241 3511 3385 2181 2144 2098 1368 45133 3614 2065 1589 44690 4568 4190 1978 --
NM_006206chr452601 2317 1964 1177 420 32851 2515 1824 22935 1129 21060 502
NM_006241chr352368 1629 1560 501 166 32090 1915 984 11544 11498
NM_006252chr1147619 7521 7264 7097 6652 5725 4963 2891 2469 1938 1446 1076 855 151 87199 4847 4783 2699 2621 1756 1555 104 75858 2774 2528 1521 889 254 38 27450 5829
NM_006275chr2082362 2290 2011 903 760 556 105 33 31635 1575 980 1182 1150
NM_006283chr8124779 3541 3187 3063 1798 1768 1444 1338 1240 1108 681 251 53767 3714 3152 1062 990 --13801
NM_006287chr282643 2565 2253 2235 2054 923 329 49 12495 22062 732 --
NM_006300chr19132187 2099 2071 2027 1984 1862 1822 1788 1528 696 324 151 31 21649 556 ----
NM_006306chrX225650 5581 5525 5508 5466 5416 5383 5350 5334 5170 4941 4767 3821 3788 3727 2370 2056 1858 1609 1473 713 214 14181 21873 145 13898
NM_006315chr4134066 4033 4016 3833 2963 2902 2887 1269 692 586 487 336 136 1434 32793 1277 190 23317 1551
NM_006330chr851671 1473 1246 318 236 11545 21434 340 1161
NM_006352chr191788 1753 1679 1360 778 616 582 448 99 21868 1345 21326 149 41647 1540 635 477
NM_006371chr3145272 5254 4531 4358 3629 3444 2051 2020 1862 1715 1452 1386 728 118 74827 4564 3232 2116 1595 1002 876 24394 3239 --
NM_006380chr1794248 4180 4143 3129 3033 1735 1030 124 60 43339 3046 1728 306 43093 1187 1089 1051 1834
NM_006390chr1251818 1311 689 212 78 11451 11246 1219
NM_006393chr10114496 4341 3674 3494 2809 1740 1282 1088 906 462 171 64471 3182 1830 1170 1108 1058 11195 13364
NM_006420chr20103396 3119 3032 2754 2467 2399 848 608 351 126 13371 63333 2733 1313 1012 860 747 12799
NM_006464chr284195 3365 3193 1453 953 905 674 89 63891 3578 3260 3216 1356 25 34603 4124 324 21150 136
NM_006467chr572099 1860 1655 833 781 437 387 11992 --2738 553
NM_006496chr1131981 1922 1767 1428 1314 1285 1228 664 603 481 270 176 21 21802 1727 11521 --
NM_006520chrX31285 1194 487 --3421 260 99 11228
NM_006524chr741115 888 711 432 6974 813 393 234 141 57 --11058
NM_006544chr14176130 5856 5642 5632 5237 4948 4149 3869 1786 1505 1369 1162 1105 987 942 405 122 25915 1351 --35870 5110 4043
NM_006546chr1786476 6459 5677 4848 4628 4462 1649 80 46698 4517 2326 143 21810 1261 21529 628
NM_006561chr10126259 5993 5975 5682 5243 4994 4614 4452 1138 1075 721 367 31419 478 250 35510 2312 1403 --
NM_006572chr17123483 2906 2865 2753 2452 2431 2363 1157 784 727 169 128 23318 2667 43442 2420 2388 651 23263 2913
NM_006599chr16138297 7706 7309 5372 5325 3191 2866 2662 1957 1847 1450 736 233 37222 1027 427 35401 5308 68 35544 5031 1279
NM_006609chr262836 2800 2549 2435 1114 1054 13013 --2856 381
NM_006614chr3153663 3643 3436 3239 3188 3016 2890 2826 2335 1286 1062 729 499 392 145 1957 33511 1456 474 23272 2815
NM_006620chr6144778 4578 4153 4144 4028 3987 3838 684 591 553 311 293 114 39 11433 44530 4279 4248 4224 --
NM_006626chr982637 2486 2370 2089 2008 1896 819 727 32263 1845 737 12582 21738 744
NM_006628chr15114538 3827 3395 3166 3081 1471 1223 674 663 230 193 24453 485 11041 --
NM_006654chr1294787 3918 1444 1338 771 748 619 399 250 43453 1529 1471 1141 44721 4335 3632 53 23181 1637
NM_006682chr782881 2519 1138 1005 945 856 429 235 1158 22348 1022 --
NM_006699chr172279 1058 704 470 326 119 86 22020 2010 12319 21899 262
NM_006720chr10154941 4918 4881 4824 4085 3904 3844 3758 3371 3201 2037 1830 1509 1372 537 1581 34889 1344 708 14387
NM_006722chr383038 2185 1958 1906 805 361 165 106 32842 2316 386 42678 1948 1229 764 11061
NM_006729chrX175474 5017 4329 3471 2254 2162 2066 1708 1018 839 576 518 297 280 134 89 60 45536 5298 1078 797 125 --
NM_006731chr9175773 5501 5111 5049 4917 4787 4677 4312 4217 3787 1109 726 679 404 307 226 123 55531 5457 3688 804 39 35606 1617 1517 23921 872
NM_006750chr16156703 6124 5836 5137 2811 2657 2454 2384 1917 1866 1762 1240 908 704 219 36365 3244 1486 88044 6960 6760 6409 3145 3017 2663 809 16576
NM_006769chr12469 306 1630 --3697 611 241
NM_006775chr6102889 2454 2400 2091 1258 981 880 648 624 216 22848 2487 1746 12734
NM_006777chrX82821 2359 2308 1879 878 801 309 168 32208 588 473 62548 855 807 748 713 556 22671 2074
NM_006852chr17112709 2551 2341 2333 2305 961 637 456 377 317 101 22428 614 12294 1363
NM_006873chr273571 3283 1173 1156 1148 739 87 43384 2559 1207 997 11088 --
NM_006884chr351976 1390 1279 1271 746 --22001 1827 3665 541 385
NM_006885chr16104219 4129 4006 3931 3828 3629 2764 2604 1612 876 24145 3150 ----
NM_006888chr1453392 2871 1045 646 450 --13481 2374 367
NM_006895chr261615 1515 1486 796 753 122 31715 852 426 31875 1636 1606 --
NM_006902chr192713 2681 2613 2563 2467 2343 1330 1242 483 33021 751 666 22667 331 --
NM_006920chr23393 325 242 32009 1701 475 21576 1481 21552 599
NM_006924chr1783911 3550 3516 3412 2716 1661 516 377 13467 24374 920 14318
NM_006956chr762408 2326 1997 1739 340 143 51597 1454 885 600 389 1158 --
NM_006981chr982661 2416 2228 2094 834 797 447 76 22965 542 1671 22572 1951
NM_007006chr1643575 3434 2853 459 23218 1426 32484 2264 439 23133 163
NM_007007chr1274829 4206 4097 3155 3001 2928 1724 2910 305 34633 4411 1918 --
NM_007011chr15166902 6650 5898 5686 5483 5378 5276 5124 2566 2464 1405 774 744 479 453 363 11751 44303 2516 2510 2084 --
NM_007038chr21135747 4098 2409 2067 1658 1618 1536 1290 1150 845 655 542 282 105851 5834 5601 5508 5047 4574 4282 1986 1897 646 34400 2270 1410 34722 4533 4043
NM_007039chr14102087 1967 1815 930 815 728 673 576 564 178 2827 430 22330 1804 --
NM_007043chr1262137 1881 1513 1479 514 340 31437 177 85 --11366
NM_007073chr673126 2678 1673 1566 1073 153 45 33486 1245 57 14104 1447
NM_007106chr13102818 2753 2719 2425 2340 2301 2191 659 473 116 --1157 42682 2263 615 511
NM_007114chr3113255 2968 2947 2843 2182 1303 1151 1124 948 619 392 32674 2522 792 33300 3223 468 --
NM_007137chrX115125 5111 4831 4641 3404 2231 1717 1202 861 214 22 64730 4707 2033 1597 1289 920 31979 829 400 32072 1573 147
NM_007139chr73961 924 858 31135 838 225 --2248 162
NM_007157chrX82989 2862 2679 1915 1830 939 812 581 22773 311 12482 1601
NM_007203chr9103870 3619 3139 2971 2728 2643 1418 583 349 70 33683 926 676 53405 2993 1435 763 154 --
NM_007212chr141903 1876 1579 1571 1716 41466 883 686 472 11507
NM_007231chrX42484 2014 1937 632 1443 12463 42384 2172 859 644
NM_007249chr13349430 9396 9371 9363 9168 8668 8395 8260 7778 7600 7583 7381 7317 7264 7039 6823 6740 6588 6383 6015 5987 3489 3292 3161 2878 2861 2616 2610 2172 1911 1494 1310 1215 236 68545 8135 6365 3230 2434 622 79472 8404 6409 2828 980 957 493 --
NM_007292chr17115021 4429 4175 3388 3324 1809 1428 1337 1253 1225 1008 51828 1486 502 470 199 11274 24799 164
NM_007331chr482700 1837 1741 1728 349 325 151 34 22349 280 22185 1909 12752
NM_007347chr1572833 2791 2660 702 396 383 288 23199 1107 2835 98 --
NM_007350chr12164499 4415 4262 4050 3964 3594 3327 3299 3262 3088 1805 1437 1209 1107 239 146 33063 1159 1033 1647 12975
NM_012081chr5113569 2851 2602 2553 1385 1086 1039 799 400 105 89 12775 32430 2410 997 --
NM_012089chr181288 1209 1008 528 498 467 77 29 1109 21280 460 --
NM_012096chr3113461 3440 3346 3222 2588 2538 1152 875 859 828 55 23617 1145 --22916 1331
NM_012097chr282292 1581 1442 560 160 149 60 40 11487 52237 2094 1529 738 437 --
NM_012104chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_012104chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_012120chr682585 2431 2269 1954 1844 591 256 120 1798 32979 2610 1978 1189
NM_012141chr13104154 4013 3181 2822 1631 1507 1422 1353 592 195 43490 3398 624 476 33650 1455 1059 11440
NM_012164chr9167502 7262 6628 6266 5637 5463 5335 5092 4992 1861 1733 1588 1333 951 829 354 45035 4877 1837 1066 45189 4977 3005 995 36653 5858 2954
NM_012193chr11125109 5059 4914 4852 4446 4329 3734 2115 1586 1404 852 459 35130 1755 243 12061 1212
NM_012214chr2256455 6322 6094 6055 5900 5886 5558 5132 5035 4987 4699 4403 4279 2211 1884 1813 1767 1555 1359 1058 565 518 444 339 142 25661 312 25696 4157 36062 5158 2194
NM_012234chr383160 2707 2674 2533 776 641 43 22 12391 2918 606 --
NM_012249chr2123598 3508 3483 2676 1187 886 756 529 450 317 93 55 21203 112 2978 892 --
NM_012252chr7175399 4717 4602 4437 4227 2098 1895 1851 1720 1591 1543 1526 1025 568 544 257 32 54953 3901 3708 1352 1333 33946 1477 1386 65385 2027 1880 1397 875 127
NM_012262chr1125070 4795 3362 3261 2041 1694 1577 1378 1366 1354 485 222 11493 --24724 1857
NM_012281chr792305 2009 1984 1831 1681 1503 247 126 46 22422 2203 32075 1648 412 2429 358
NM_012287chr3114357 4252 3868 3736 3483 3473 3224 2801 1198 792 28 43340 3134 945 123 23918 2841 --
NM_012294chr794086 3844 3665 1332 958 701 654 375 303 2827 85 --23207 1066
NM_012334chr554523 4011 3302 943 537 34647 3663 794 13540 24262 1262
NM_012382chr5134023 3821 3535 3171 2806 1794 1679 1443 1133 952 868 538 526 43104 1715 398 296 53885 1367 1296 1104 683 1959
NM_012388chr1592546 2528 2347 2302 2091 2083 1083 369 260 32942 681 474 23157 2867 2693 660
NM_012395chr7143431 3327 2720 2625 2562 2484 2139 1367 1199 924 614 424 239 92 42643 2447 2076 707 22400 76 23380 1145
NM_012406chr1231275 1191 1021 --3916 170 32 145
NM_012416chr93941 919 330 1935 --21029 975
NM_012420chr1042224 2207 1762 1416 3674 520 226 --2863 691
NM_012431chr7133497 3355 2526 2314 1352 1315 1004 844 721 657 287 127 46 42613 1092 334 32 3987 945 550 --
NM_012463chr1261790 1367 1262 1204 515 313 --41241 1225 1183 1167 --
NM_012464chr4122723 2538 2441 2355 1937 1007 1000 979 546 484 230 73 52667 1858 1085 1064 400 12817 1814
NM_012465chr10113394 3286 2625 2148 976 794 743 599 511 78 32 --2421 158 12255
NM_012479chr7102716 2533 2195 2091 1986 1679 1076 844 467 181 --3739 733 313 --
NM_013231chr14114217 3574 3355 3284 3007 2684 903 637 629 558 48 44307 3247 1696 993 53668 2713 922 384 281 33743 3228 1505
NM_013255chr7308541 8411 8286 8094 7804 7634 7615 7527 7515 7132 7066 7053 6472 5727 5391 3421 3385 3375 3338 3214 2302 2257 1943 1636 1459 1371 1287 1036 649 216 35362 2787 2093 28524 2910 33305 2695 31
NM_013261chr483630 3598 2470 1510 1232 1011 798 203 1712 43723 3444 2911 441 12477
NM_013269chr12214492 4132 3784 3770 3650 3360 3301 3263 3083 3017 2842 2793 1776 1650 1542 1453 1268 930 910 749 515 43395 1293 1053 1036 54469 1620 1002 622 106 21108 895
NM_013281chr204495 464 379 331 31229 107 94 --11388
NM_013309chr1572506 2344 2072 2040 852 234 88 1385 1204 21909 82
NM_013341chr2102450 2232 1959 1879 1097 919 772 688 178 75 32872 2474 657 ----
NM_013372chr1593158 2422 2081 1162 872 810 724 594 382 42678 958 760 655 33287 3108 2731 1436
NM_013374chr392995 2467 2303 1181 1167 1090 902 282 257 23172 2766 --31196 1188 264
NM_013386chr161761 1408 1145 578 280 209 31744 1636 703 31644 1591 1320 --
NM_013447chr1993702 2959 954 565 393 346 276 142 130 33607 493 43 33468 3377 1081 --
NM_013943chr152601 2371 2287 981 119 22578 2396 63229 2458 2293 2224 2101 477 13152
NM_013989chr14144997 4505 4193 3478 2046 1823 1780 1670 1659 1416 964 692 291 231 114690 3757 3723 2034 1813 1298 1161 916 732 435 105 13805 14580
NM_014011chr242040 2017 1848 664 42194 2165 2149 325 12359 31771 1026 305
NM_014021chr173423 2932 2769 2499 687 674 476 32180 1072 1019 43051 2721 1153 256 12491
NM_014023chr1082886 2786 2723 2517 1969 264 155 107 32675 2637 2008 ----
NM_014048chr16134707 4259 3615 3533 3324 3303 1520 1014 980 724 547 222 161 24050 1209 2278 49 14972
NM_014112chr8185373 5277 4916 4665 4596 4536 4146 3982 3824 2154 1931 1727 1653 1211 454 355 209 124 24833 4562 65062 4277 3648 1778 1737 78 65181 4527 3451 1761 499 201
NM_014141chr7135213 5158 5046 5038 4830 4810 4409 3465 3317 2039 1976 145 135 24383 392 34174 2134 1612 45266 1918 1701 1106
NM_014155chr11227581 7526 6796 5883 5860 5405 4767 4568 2855 2686 2449 2411 1964 1796 1753 956 934 842 503 307 132 73 46286 5144 2571 2133 24952 1675 46399 5564 1746 640
NM_014296chr321188 101 21523 1076 41126 1107 626 604 2567 345
NM_014331chr4207815 7678 7621 7501 7268 7162 6444 5513 3132 2014 1875 1786 1769 1086 899 669 630 410 340 76 57191 6009 5887 1892 431 67830 7650 7409 3104 2612 1281 12298
NM_014333chr1192601 2271 2144 2122 1862 756 660 174 112 32552 2402 1808 1616 --
NM_014388chr1155967 5907 5851 5748 4905 4831 4759 4715 4297 1420 1203 410 241 218 169 25977 5067 11848 13989
NM_014398chr351459 1306 367 133 31 --21324 23 1203
NM_014423chr5135035 4904 4710 4148 4045 4004 3553 2250 1915 1469 1208 1176 658 44696 1641 915 195 55014 4955 4365 3546 1444 32160 629 610
NM_014552chr271524 1481 1405 988 949 480 261 21148 1060 --2605 204
NM_014616chr393492 3352 3255 2548 2417 1377 432 419 216 33023 2908 2708 ----
NM_014666chr551273 449 277 260 154 --21153 1107 270 32
NM_014674chr3113806 3390 3283 2707 1609 1423 1408 1206 602 542 221 12898 31218 233 82 --
NM_014701chr15103359 3214 3026 2791 2670 2458 2404 2255 650 310 42904 2862 2767 204 1451 13324
NM_014702chr683151 2527 2398 1265 1220 1082 794 437 43342 2924 2303 2257 22837 2385 32365 546 359
NM_014719chr761086 1066 732 422 206 118 31129 223 141 --2791 133
NM_014721chr6146036 5917 5650 4807 2536 2466 2219 2139 1467 493 398 381 65 23 46925 1997 1839 348 66379 6260 5831 4742 2243 1148 37201 5496 438
NM_014739chr6164207 4140 3972 3948 3712 3595 3547 3357 1667 1467 1366 1227 652 622 315 180 2633 159 --13440
NM_014746chr2104165 3845 3769 3643 2859 1760 1558 1266 517 265 11064 13831 14297
NM_014755chr2113928 3778 3737 3542 3003 2990 1580 1320 1190 620 253 24048 319 34252 3787 1092 22886 2715
NM_014765chr182586 2370 2271 2183 1935 442 414 180 32611 371 334 --12278
NM_014766chr773638 3311 3285 2903 2692 2530 336 22612 616 11495 23660 95
NM_014774chr152049 1123 1114 696 484 32787 2277 140 --21309 459
NM_014787chr1102750 2659 981 877 809 686 423 350 322 209 --1655 21980 301
NM_014803chr1092621 2257 1858 926 739 578 534 452 173 1204 11998 12814
NM_014810chr192350 2249 1183 1035 994 846 697 529 408 73325 3038 2951 2331 1311 1163 1062 1674 13487
NM_014819chr592397 2157 1632 887 742 645 554 415 21 32140 1987 497 ----
NM_014826chr1103329 2871 2858 2831 1628 1543 1451 1020 682 97 33522 1593 1305 14014 11636
NM_014832chr13101993 1755 1480 1355 489 480 386 364 314 101 2802 428 ----
NM_014839chr131734 707 511 --42402 1560 635 221 11665
NM_014850chr3114904 3443 3246 3192 2984 2964 1206 925 617 505 310 24118 1792 23710 1368 34012 3729 3534
NM_014864chr194197 3926 3511 3493 1143 1134 393 76 23 44391 2755 2664 687 14242 --
NM_014867chr8143848 3618 3438 3203 3033 2787 2749 2711 2667 2411 1512 1298 712 499 11476 13444 --
NM_014873chr1114526 4281 4043 3844 3479 3178 3116 2987 1758 1514 775 21924 465 13606 13143
NM_014877chr17156985 6786 6728 5790 5767 5758 5751 5414 5384 5193 5097 5064 4902 2759 2322 66510 3100 3051 1832 787 677 22138 2006 12040
NM_014888chr741552 1165 576 355 2313 25 31583 556 345 --
NM_014893chrY112172 2071 2036 2006 1979 1723 1523 850 471 214 207 2693 439 1386 --
NM_014899chr592873 2322 2184 1955 908 841 495 489 455 42657 2283 739 150 12440 2423 46
NM_014903chr12112303 2288 2214 2035 1805 1758 1658 1622 537 255 181 32127 974 792 11698 --
NM_014904chr1083894 3633 3063 1508 964 601 212 128 23869 82 43529 3101 2553 1416 22909 1038
NM_014906chr17133972 3828 3789 3758 3574 3284 3143 2694 1089 1055 1044 730 473 23713 414 23311 550 1984
NM_014912chr1083530 2594 2574 2336 1183 1151 1047 90 42664 2537 2433 2414 23503 543 12343
NM_014920chr6113490 3229 2853 2717 2640 1123 932 830 719 475 467 32493 2476 374 12668 1650
NM_014923chr1352327 2256 1500 706 445 41511 1474 942 382 --52174 2117 715 564 550
NM_014924chr1492971 2472 2465 2453 2270 1206 829 816 672 --2638 494 1445
NM_014932chr381984 1919 1717 1673 1428 278 259 58 21419 150 --11638
NM_014936chr632822 2446 2065 42317 603 290 100 2346 323 32842 576 85
NM_014942chr6111993 1871 1028 885 783 665 657 612 345 271 37 --52229 2140 535 175 25 2757 677
NM_014946chr2113125 2816 2106 2081 2054 1944 1032 886 827 523 141 --32493 2096 332 --
NM_014947chr192852 2665 2173 2128 894 495 423 384 132 22203 83 22922 2445 22076 644
NM_014962chr20102819 2797 2391 2327 2217 2206 1773 1029 314 115 4859 803 613 449 11825 --
NM_014982chr14135217 5150 5134 4979 4430 4154 3695 2113 1387 1217 401 246 122 53778 3335 1467 490 58 23452 1716 25353 3419
NM_015000chr1283048 2722 2191 1964 1249 871 232 97 12022 21031 519 12799
NM_015020chr16103540 2956 2731 2539 1478 1052 874 828 680 627 33608 1551 1064 33378 1348 1099 12659
NM_015026chr1284686 4005 3729 3489 3416 1371 73 22 33384 1907 1233 34034 3901 1134 --
NM_015032chr1392517 1871 1108 1052 636 368 210 115 31 31096 445 42 32577 2068 716 --
NM_015035chr20166482 6334 6263 5806 5587 5368 4954 4860 4792 4434 2542 2254 1337 1261 921 574 52578 2398 2186 2080 1311 --1892
NM_015040chr283296 2980 2974 2491 2324 908 839 152 1298 22705 229 23279 856
NM_015051chr973418 3200 3128 2574 796 621 58 22922 2767 53023 2101 641 516 278 12322
NM_015055chr1182232 2200 2129 2025 798 562 511 192 --22854 2144 12774
NM_015068chr7113817 3371 3364 3287 3027 2769 886 693 676 540 139 43421 3071 1199 1025 11356 11308
NM_015071chr586512 5916 5488 4517 2035 1822 1678 1376 66144 1783 1358 1256 401 93 35840 2527 529 --
NM_015090chr144516 1071 973 810 3663 440 426 26185 4897 25230 2449
NM_015092chr16134670 4589 4277 4214 3982 3392 3165 2912 1613 1250 1242 623 568 14614 23750 3641 24077 788
NM_015097chr332354 584 485 22013 1635 32108 863 68 22131 2081
NM_015100chr141688 695 476 464 21788 1636 1576 1583
NM_015110chr972328 1680 1663 702 568 535 112 42495 2445 1808 1651 2449 147 1921
NM_015137chr882560 1908 1024 868 811 687 114 103 ----11848
NM_015143chr451426 1166 1059 342 180 1172 2405 348 11001
NM_015144chr16124013 3776 3486 3469 3453 2721 2570 2523 2488 1549 558 70 21141 597 23508 1275 11486
NM_015170chr8101890 1874 1498 793 632 600 585 476 384 158 --41526 459 276 66 --
NM_015176chr131611 482 277 21234 389 --21725 1095
NM_015192chr2052594 2506 299 287 190 62101 2013 627 390 320 215 --21972 156
NM_015199chr3142881 2597 2375 2248 1106 876 843 748 639 611 539 505 485 454 32018 1906 1038 ----
NM_015200chr492356 2216 993 573 524 404 133 99 29 31829 1648 659 2603 185 --
NM_015206chr15113659 2448 1329 1018 917 888 776 668 634 137 104 21555 171 23515 598 13600
NM_015208chr1893903 3350 3189 3168 2648 1583 1443 488 282 23023 2741 32778 972 163 33450 1227 1016
NM_015215chr173113 2857 2386 1269 1210 1058 647 33098 1047 299 31039 834 701 23203 3153
NM_015225chr932011 692 174 32770 1083 69 22347 1115 22300 2162
NM_015247chr16135376 5362 3805 3661 3428 3272 1737 1573 1287 774 388 347 241 22110 1435 65267 4480 4404 4340 4190 4120 44730 1796 1663 799
NM_015265chr2102519 1819 1755 1052 1018 987 750 494 383 374 --22192 363 12526
NM_015271chr4114247 3984 3848 3517 3403 2734 2691 1646 1049 877 732 42840 1491 1228 526 23768 3475 12713
NM_015272chr16122108 2085 2036 1367 1355 843 771 756 611 462 421 66 1277 3804 487 53 1379
NM_015278chr6153225 3015 2997 2990 2804 2784 2767 2456 2421 2382 2363 2302 2122 1177 138 12631 ----
NM_015291chr173367 2432 2175 2152 922 607 254 1497 32990 2520 203 23528 173
NM_015310chr8168033 7984 7949 7849 7449 6943 6421 2532 2480 1387 1105 1011 622 607 445 376 26702 1135 36845 6839 3196 --
NM_015314chr792584 2544 2237 1914 1708 1028 805 542 268 41939 909 441 116 22126 243 11983
NM_015317chr2122844 2769 2645 2626 1957 1897 1859 1055 940 820 467 42 32450 1777 1745 3926 767 605 22821 811
NM_015335chr12102638 2276 2241 1789 1739 1059 1044 869 394 210 22498 2140 11756 --
NM_015336chr1282614 2228 1801 1657 678 631 244 45 --21998 501 12177
NM_015349chr672710 2366 1200 1123 1052 382 328 42654 1887 909 612 42441 804 269 94 12744
NM_015355chr1751307 666 634 481 117 21897 1829 1234 1555
NM_015375chr1124922 4671 4217 3839 3070 3060 1595 1552 1241 792 666 168 11377 33319 456 286 13254
NM_015393chr472957 2595 1533 903 786 549 303 21452 1214 33763 3325 586 22914 580
NM_015394chr12102448 2351 1825 1742 867 614 361 321 271 92 --12244 1400
NM_015455chr593191 3081 1320 1039 671 511 487 294 48 --41469 1050 753 151 --
NM_015458chr8124557 4005 3735 3657 3243 1847 1702 1462 1451 732 255 162 23382 3351 13537 13316
NM_015532chr15142608 2422 2322 2184 1989 1852 1771 1758 1745 622 497 436 367 177 11106 1299 --
NM_015550chr793525 3353 2498 1378 1217 874 795 619 577 1526 --1255
NM_015553chr6154972 4850 4776 4598 4558 3965 3927 3357 3221 1990 1884 1634 934 524 227 35032 1125 290 41671 1482 368 147 35134 3739 553
NM_015564chr5113556 3236 3118 3075 2743 699 680 525 327 224 166 52961 2555 2486 1235 858 --11145
NM_015565chr21111977 1737 1683 1573 789 750 690 621 321 198 70 2864 126 --1290
NM_015569chr1124827 4765 4423 4155 3939 3857 3763 3034 1782 1451 1071 362 44776 4637 4031 912 --33924 3884 1838
NM_015571chr682573 2487 2379 2030 1939 693 448 104 11726 --11862
NM_015576chr342845 2586 1916 1023 32423 697 647 42947 1106 749 254 22815 950
NM_015640chr1114731 4540 4426 4296 3729 3709 3600 2132 1151 972 791 14240 55271 5082 4546 3694 3626 --
NM_015713chr853247 2716 2599 1357 703 53159 2814 1132 1081 657 11333 22243 1437
NM_015852chr773663 3239 2758 2631 2584 2547 1298 162464 1383 1316 1236 1155 1071 903 819 735 567 483 399 324 315 231 63 --11401
NM_015879chr18158377 8263 8229 8071 7924 7780 6887 6361 5794 5541 5277 1937 1325 1192 1023 58519 6482 5694 2505 419 37657 2380 425 36580 5284 1793
NM_015886chr8135469 3906 3772 3660 3563 2226 2027 2009 1522 1499 1071 564 526 21744 1039 54357 1477 1454 1108 972 11312
NM_015888chr1103373 3165 2071 1335 949 929 812 636 618 552 43285 3153 896 95 42623 845 754 425 13080
NM_015906chr194814 4412 4369 4307 3398 1914 1308 853 241 34858 4334 128 22947 799 --
NM_016009chr1164171 3800 3475 3253 1968 1908 1726 1682 1601 1396 986 971 923 644 463 110 34663 4239 1810 --14055
NM_016018chr8132845 2583 2503 2489 2472 2451 2328 2294 2272 1034 736 247 147 21845 1018 21864 220 2160 24
NM_016021chr6102845 2448 2279 2144 1098 791 613 581 542 433 32607 2481 1023 11181 --
NM_016023chr862052 2017 1704 1605 1544 496 2391 92 --11398
NM_016083chr6103349 2983 2972 2547 1032 811 692 500 359 253 21141 206 33144 517 115 23985 305
NM_016090chr1141095 792 762 411 41038 919 779 81 2205 66 --
NM_016096chr871952 1794 828 780 743 711 203 1526 21749 211 --
NM_016132chr15103435 3395 3286 3210 2992 2495 2132 1218 813 245 1993 1390 1494
NM_016206chr3198643 7000 6941 6900 6883 6793 6655 6616 6500 6441 6325 6026 5959 3556 2464 2194 1636 903 730 88281 6823 3312 3292 2611 2401 185 158 43543 2242 1457 847 58722 8449 8294 6754 6606
NM_016217chr6103661 2994 2755 2592 2468 1002 687 675 591 531 43471 1091 1055 408 12574 31136 1015 621
NM_016220chr7102233 2191 2059 1998 1676 1600 793 628 544 191 91984 888 870 482 402 234 199 133 65 22179 315 22144 2098
NM_016224chr641764 1440 240 221 22035 1954 21457 1393 2793 274
NM_016248chr1373503 3407 2692 2498 1615 1504 916 43095 2963 2680 1015 2968 678 --
NM_016255chr652977 2462 333 303 137 22580 2206 1468 3901 674 373
NM_016260chr2117481 6413 5690 5401 4638 4629 2409 572 490 362 32 46487 4650 438 294 57220 6464 2852 2442 1808 25996 53
NM_016271chr1882082 1975 841 598 554 462 135 66 2505 246 32170 2098 188 --
NM_016315chr261897 1851 1780 735 395 125 2685 256 31839 1284 692 --
NM_016340chr571334 948 860 831 145 33 23 1435 1995 --
NM_016356chr682861 2676 2593 2278 2237 1113 147 44 163 2920 751 1290
NM_016374chr111438 11503 --31561 408 164
NM_016374chr111438 11503 --31561 408 164
NM_016376chr17113887 3862 3802 3182 1462 1138 982 631 600 572 363 2609 314 ----
NM_016395chr1571481 1399 747 725 624 499 206 51936 1928 717 645 387 11683 --
NM_016422chr11113179 3000 2916 2727 2679 2350 2234 2221 890 721 426 12879 11284 --
NM_016448chr191838 1795 1729 1631 1346 1276 708 433 373 1419 11214 21659 78
NM_016507chr1792855 2786 2679 2614 2575 1259 1214 282 75 33206 882 26 33191 2441 1224 22720 2183
NM_016513chr6113490 3229 2853 2717 2640 1123 932 830 719 475 467 32493 2476 374 12668 1650
NM_016530chr15123987 3481 3462 3016 2682 1576 1363 1087 697 210 201 59 23613 2513 44151 3907 3889 2566 --
NM_016531chr4113975 3205 3166 2748 1633 1624 1426 1401 957 924 448 43135 3067 2591 1542 12730 11288
NM_016544chr293887 3813 3541 3482 1467 1388 408 193 62 33193 1087 173 12473 --
NM_016577chr3114048 3618 3593 3200 3142 1339 1320 1303 871 715 572 64504 2835 1741 1123 1071 335 --13115
NM_016599chr43962 502 417 11061 51351 1226 952 409 379 2483 279
NM_016603chr592259 1710 1703 1500 1422 675 534 436 325 3835 445 373 1629 --
NM_016831chr152124 647 638 504 90 1400 12242 22220 734
NM_016929chr683492 3375 1800 1561 1217 921 582 163 63735 1790 1684 1476 1315 1256 14526 1885
NM_016950chr441398 952 574 370 2355 134 --21319 1097
NM_016953chr2125834 5813 5681 5235 5058 3847 2176 2000 1673 1451 1442 258 55697 5385 5138 1968 1102 --14294
NM_017420chr1482845 2812 2403 1525 426 307 249 54 51542 1107 728 592 518 43126 3078 1241 149 12480
NM_017447chr21104343 4272 3539 3015 1491 1349 1336 914 424 364 54261 1604 933 76 66 33932 3303 784 --
NM_017519chr631090 177 34 1420 11206 21154 462
NM_017563chr3246336 6293 6133 6053 5795 5362 5030 4918 4427 4319 2383 2302 2139 2106 1979 1853 1767 1640 1430 1316 1172 588 216 123 31871 1331 410 12350 12364
NM_017583chr1181709 658 639 599 509 445 436 86 2546 24 --1646
NM_017594chr9113354 3144 3106 2731 2649 2383 2140 1080 1025 447 215 11095 12365 --
NM_017633chr6113482 3463 3423 3407 3248 2850 1227 1173 839 386 368 12460 23285 783 13848
NM_017634chr861981 1860 1834 1385 652 329 21750 460 4749 451 375 38 --
NM_017637chr9209399 8743 8561 8393 8343 7803 7674 7659 7043 7018 6466 3502 3027 2996 2775 2202 1515 1474 1196 256 68998 7458 6860 2551 1634 492 66939 5823 3709 2741 2571 1601 13244
NM_017643chr17103065 2975 2227 2141 1224 925 862 627 603 524 63011 2998 2952 1916 1015 235 13101 --
NM_017644chr385057 4531 4110 3551 1983 819 712 237 94869 3619 3299 1997 1873 1235 848 420 187 34636 3565 3359 --
NM_017645chr9153137 2902 2887 2846 2574 1263 1187 1073 1061 662 624 596 580 454 205 3922 534 483 --12786
NM_017650chr7175840 5757 5667 5537 5516 4866 4477 4471 4264 3845 2193 2174 1870 1794 1637 547 440 21318 663 13833 21941 84
NM_017651chr671447 1337 1214 583 431 64 46 31282 290 175 --1301
NM_017658chr1474065 3382 2899 986 157 122 36 13076 --24700 3586
NM_017662chr9112093 2085 1866 1751 1403 1311 775 742 699 584 521 21764 1643 12008 11289
NM_017709chr194140 2688 1448 1404 1224 982 720 625 352 34300 1387 220 42863 1599 1304 434 14113
NM_017736chr1692705 2187 2149 2065 1187 1097 1020 972 609 ----1625
NM_017754chr674192 3868 1913 1774 1745 1727 452 25051 1076 24950 4140 13360
NM_017770chr672897 2633 2617 2364 1986 1062 617 42867 2724 2476 2208 22552 2201 --
NM_017779chr1102554 2543 2080 1084 904 450 440 291 63 50 32665 2363 430 ----
NM_017811chr953135 2881 2456 644 620 32473 1102 347 --23047 445
NM_017813chr8165222 4683 4547 4381 3649 1871 1703 1694 1639 1364 1291 1283 1165 911 424 129 24691 1748 1464 --
NM_017845chr42726 303 3801 274 116 1635 2213 206
NM_017847chr1102240 1939 1676 1590 1470 741 626 460 231 151 62170 2012 1794 1765 1496 479 --22073 1526
NM_017848chrX124706 4570 4087 3593 2983 1698 1557 1446 1401 1352 477 251 13403 54652 4620 4592 1228 783 --
NM_017902chr10125681 5458 5345 5267 4998 4111 3668 1955 1813 1379 1223 453 33527 3496 595 --25420 5320
NM_017919chr984140 1625 1615 1060 333 276 269 239 65570 5554 5396 5103 4547 1325 24095 758 --
NM_017987chr1081770 1579 1560 1528 665 587 391 30 22247 873 2778 146 --
NM_018017chr1062926 2768 2315 750 197 186 12518 31827 532 379 22238 838
NM_018036chr14104415 3587 3432 2775 1236 782 708 510 402 25 64472 4225 1693 1326 560 469 14453 13865
NM_018084chr292686 2541 2371 2300 2144 2102 1166 641 69 32473 1313 629 12956 22733 1250
NM_018120chr861383 1263 477 470 441 374 --31030 214 101 21079 1054
NM_018121chr1042517 400 182 141 21168 623 32871 2145 414 1155
NM_018133chr382181 2064 1901 1783 714 515 459 229 21697 394 --1567
NM_018157chr12103075 2295 2269 2132 2004 1136 471 405 256 133 13085 32712 2431 2118 22407 1076
NM_018211chr152212 1627 1429 817 806 42091 1711 1377 637 --11453
NM_018225chr9155419 5005 4975 4736 4106 3537 2115 2087 2010 1250 1209 1086 258 137 48 15051 12159 13476
NM_018227chr4102601 2086 1148 868 651 509 468 406 343 45 32931 2830 155 32647 2543 1016 1335
NM_018243chr483822 3721 3697 2835 2674 2549 1289 1037 --33973 3236 349 43223 2962 942 682
NM_018247chr682801 2061 1942 1904 1264 980 909 355 12258 32793 2241 2053 1450
NM_018257chr2072616 2227 1771 1733 560 415 386 22010 782 22035 374 --
NM_018279chr1272594 2295 2009 1881 290 250 234 2888 190 23018 2858 2646 603
NM_018293chr321854 630 52819 2474 2209 1014 47 1789 22709 288
NM_018299chr8123159 3037 2423 2341 2294 1321 1291 1267 955 694 641 430 32565 286 46 33313 3295 115 1585
NM_018313chr371904 1836 1013 574 559 448 304 2938 916 --1399
NM_018323chr471625 1546 1483 1414 1285 586 334 --1659 21653 1472
NM_018340chr16104735 4615 4557 2010 1632 1610 1151 831 679 217 13730 32019 1924 1280 --
NM_018351chr12104548 3997 3548 3508 3194 2962 1375 1189 927 368 1518 22993 685 1461
NM_018361chr8163855 3529 3249 3214 3204 3099 2540 1625 1348 1214 895 796 743 469 278 121 --33629 3023 678 11537
NM_018362chr112432 115 53870 3014 1348 1256 1169 21071 647 13041
NM_018364chr174085 3886 3607 3058 1235 731 440 23220 3048 63306 3271 2739 1651 1402 284 --
NM_018374chr7104779 4007 3522 3390 838 685 636 412 396 326 34911 4408 358 35024 3334 64 15267
NM_018375chr1481923 1695 610 575 485 335 291 49 --31818 1280 350 1164
NM_018400chr1184608 4514 4183 1791 1776 1313 414 233 11673 13949 34019 3972 3956
NM_018403chr393639 3383 3317 2850 1073 927 789 583 93 --21221 65 1117
NM_018429chr592567 2289 2120 1782 851 482 436 429 400 72829 2598 2528 1997 979 929 164 --12422
NM_018440chr8167609 7451 7037 6482 6239 5522 3074 2971 2526 2494 1863 1427 1334 1175 782 115 68060 8034 7665 7138 6662 5381 42888 2035 1727 1406 37729 5874 325
NM_018444chr882322 2254 2040 2009 1994 1836 1766 1573 3632 366 282 52330 2015 1982 741 415 --
NM_018452chr6_random142979 2905 2835 2408 2389 2345 1545 1388 1319 1304 1246 1174 1142 705 --33429 3378 1413 --
NM_018489chr132361 955 627 21971 1701 --32380 1891 736
NM_018555chr1942030 1566 423 159 21955 1696 21533 416 199
NM_018557chr241749 1702 1408 494 --1565 2432 202
NM_018566chr1115162 4769 4485 4393 3928 3518 3377 3187 1888 1460 695 34896 4721 4372 1575 --
NM_018590chr10101682 1479 1305 1295 1163 592 340 212 197 154 31317 1175 474 31697 1547 1087 --
NM_018638chr12165654 5635 5553 5333 5256 5109 5001 4634 4599 4239 4207 4143 3927 3584 1773 553 45475 4766 1823 1483 45359 4245 1284 362 --
NM_018640chr12142696 2425 2417 2323 2062 1825 1726 1018 906 713 477 269 165 133 --11991 --
NM_018704chr141469 731 465 304 2685 632 12084 32159 1651 265
NM_018717chr4102827 2509 2046 1992 1932 1820 497 272 210 139 22914 56 11961 12027
NM_018718chr7112337 2035 1948 1704 912 870 614 582 461 433 267 ----21466 1429
NM_018841chr173819 3738 3194 2602 916 753 64 33882 965 804 33834 2892 508 --
NM_018847chr951769 1431 1354 648 171 11465 1734 1205
NM_018947chr7184766 4552 4489 4398 4232 3832 3587 1691 1538 1511 1441 1394 1331 1322 1297 1086 553 458 ----34439 1637 1270
NM_018970chr781926 1218 997 925 418 98 81 32 --1271 23048 326
NM_018972chr852101 1828 381 250 242 32538 2487 1655 --11707
NM_018976chr12102872 2761 2749 2724 2632 1946 840 581 360 68 32552 1011 377 11788 22063 662
NM_018999chr10124933 4695 4495 4090 3442 3312 3028 1679 1355 1168 829 512 33665 1826 1793 23590 1270 13970
NM_019001chr3164893 4825 4784 3728 3608 3416 3232 3204 1875 1774 1737 1312 882 809 567 422 24837 926 14284 13101
NM_019027chr492548 2101 1813 689 655 518 325 151 103 32052 439 110 --169
NM_019035chr482078 2055 1882 1767 1304 818 798 563 2584 77 31521 647 41 11487
NM_019044chr2114418 3947 3878 3536 3504 3109 1193 701 296 84 72 1374 11016 1231
NM_019063chr2102303 2250 2190 2046 1665 1587 823 320 290 198 1437 22225 1532 1499
NM_019072chr5114059 3430 3082 1258 1213 859 628 437 395 118 53 34314 4093 1310 22990 2632 13956
NM_019084chr10102577 2457 2440 2407 1807 862 739 441 414 47 --21793 840 11746
NM_019094chr1263103 2872 2426 987 954 759 --1745 23591 2892
NM_019117chrX73249 3089 1272 1190 1168 737 25 52953 2844 2668 1178 115 22166 296 --
NM_019593chr2072695 2585 2202 1208 776 122 111 32596 2390 213 32907 2575 831 1415
NM_020119chr7113671 3641 3308 2544 2534 1300 1166 917 813 598 210 2744 728 33338 3164 1155 --
NM_020122chr276023 4798 4687 4099 1748 305 281 55904 4416 3848 1980 1574 35708 2330 52 --
NM_020132chr21104957 4672 4367 4089 3535 1789 1741 1033 721 711 34713 3265 2035 --24147 1530
NM_020141chr192415 2350 1867 1775 674 657 588 487 401 1882 --2765 53
NM_020180chr182947 159 1897 1109 3286 276 264
NM_020198chr1781388 1267 989 541 347 261 184 174 2506 119 11303 2650 66
NM_020208chr3123430 3138 3123 3088 2784 2613 2336 2290 1222 747 365 221 1719 43202 3174 753 239 --
NM_020228chr1192461 2434 2123 1984 1847 1831 521 315 60 42342 2164 1824 722 ----
NM_020245chr694176 4163 4064 3736 3598 1607 1403 1020 771 64576 3472 1690 1295 945 124 44053 3742 868 320 --
NM_020337chr463180 3156 2621 2036 1987 290 22235 91 53004 2401 820 361 65 2576 108
NM_020348chr1072761 1887 882 810 677 495 34 2981 274 22800 662 1865
NM_020353chr371644 782 690 434 329 284 222 141 11489 148
NM_020390chr3104336 4134 4021 3747 3546 3335 1793 1355 1279 653 13907 34570 3447 765 13717
NM_020425chr651866 1851 1454 487 365 --31396 249 111 3600 496 59
NM_020432chr772309 1893 1701 311 243 233 66 32205 1945 1853 11932 11573
NM_020443chr1196909 6788 6384 5500 5272 4948 4795 4695 4460 4402 2221 1875 1827 1249 1069 1062 711 613 173 26062 2549 46827 6170 5613 1175 55392 4326 606 571 138
NM_020455chr662723 2421 1748 314 276 174 12299 11997 22837 2250
NM_020466chr6204670 4598 4462 4335 3966 3950 3761 1989 1619 1577 1421 1390 1316 1166 976 866 760 663 399 184 63833 3252 1686 1489 880 164 44625 3972 3600 1024 14532
NM_020473chrX31789 1547 682 21946 1581 21877 1709 31991 1935 61
NM_020474chr1872045 1754 1734 1514 1381 214 198 2708 246 51908 812 554 483 384 1292
NM_020640chr362275 2237 1947 1884 1701 94 1639 21558 606 21819 579
NM_020647chr8112180 2126 1976 1821 1714 1691 855 757 400 363 155 22240 164 --11748
NM_020673chr20137494 7451 6753 5854 4834 2523 2369 1518 1435 1139 252 49 33 77183 6983 6915 6307 5780 3046 798 37660 7295 518 --
NM_020711chr272346 2178 2163 771 339 321 147 --3957 951 416 12004
NM_020717chrX124783 4483 4334 4096 4011 3437 3427 3406 3143 1960 1748 1376 21464 536 --13197
NM_020718chr16206440 6363 6260 6018 5953 5640 5629 5477 5323 5114 5083 4927 4746 4697 4534 4290 2531 2498 1807 696 46597 2073 928 899 15928 --
NM_020727chr21153931 3355 3116 3029 3014 2926 2786 2668 2627 2563 2520 1318 870 708 59 1587 2696 577 --
NM_020728chr782474 2098 1964 998 790 746 630 519 --12004 1571
NM_020732chr631090 177 34 1420 11206 21154 462
NM_020734chr12113228 3182 3083 3057 2692 2431 643 513 464 152 108 2869 769 32829 2505 649 --
NM_020739chr15193803 3559 3502 3358 3220 3128 2583 1659 1622 1318 1190 1032 975 843 794 665 574 290 145 53759 3663 1088 751 110 22808 273 13071
NM_020742chrX102241 2074 1789 1034 879 470 403 344 233 225 41747 1002 708 457 12485 22570 2520
NM_020755chr6101588 1536 1498 1483 1362 1047 664 647 275 50 1466 31155 281 21 --
NM_020766chrX144297 4018 3929 3840 3733 3700 3186 3119 2802 1147 1027 917 479 267 53479 3324 1222 376 48 24469 4359 14629
NM_020772chr17227534 7279 7200 7153 7087 6546 6478 5946 5872 5702 5420 3369 3319 2711 2617 2413 2041 1232 1223 1089 389 188 98639 7514 6770 3302 3102 2114 2084 836 770 47496 5651 3350 1057 36326 5695 1660
NM_020774chr18144734 4680 4421 4239 1698 1582 1517 1510 888 727 580 411 175 47 46129 6106 4768 2511 45800 5082 1837 834 --
NM_020782chr12124798 4464 4324 4117 4034 3749 3629 3547 2962 1919 1252 165 34028 3591 176 44254 3098 3014 1234 125
NM_020783chr18102140 2032 1946 1938 1828 1723 1712 796 639 387 32286 775 611 --11499
NM_020792chr3122799 2747 2525 971 823 671 640 597 546 298 121 59 12606 22337 1738 12492
NM_020801chr592227 2068 2011 1874 1771 951 319 201 136 42644 1912 1040 470 --1486
NM_020810chr14123562 3458 3429 3410 2336 1386 685 591 540 398 284 47 33659 3549 511 43625 2317 1207 1175 13176
NM_020830chr252762 1267 675 220 53 33292 2030 273 --32723 817 193
NM_020841chr12143713 3587 3516 3377 3232 3030 2739 2614 1632 1422 1328 1261 468 241 43105 1576 758 460 42467 1499 1359 898 --
NM_020844chr896366 6007 5987 2884 1947 1889 1807 1247 185 46460 6405 4842 237 32830 2636 1646 25974 1602
NM_020859chr4143880 3039 3017 2999 2907 2718 1430 1054 632 598 586 409 261 254 162 22662 123 1497
NM_020870chr491828 1703 1646 884 873 837 734 685 394 ----2753 169
NM_020872chr361742 1717 1610 1214 65 30 2514 343 2704 323 1449
NM_020917chr1983289 3223 3209 2924 2542 747 717 180 33792 1211 62 23229 2974 11558
NM_020918chr10173600 3565 3540 3490 2818 2530 2476 2456 2387 2248 1420 1357 884 628 259 38 29 23438 2868 12482 22541 1208
NM_020921chr1462919 2362 2287 1408 442 168 13059 2378 261 23005 2312
NM_020935chr2144658 4417 4280 3902 3433 2867 1559 1425 1352 1323 1074 542 444 406 43878 3856 1724 434 33364 2932 180 --
NM_020940chr10102746 2674 2515 2269 2162 1995 1937 811 289 166 --1480 1494
NM_020948chr161314 1250 969 779 523 106 33296 2455 683 11232 13281
NM_020964chr18104510 2938 1714 1660 1608 1261 999 965 916 877 44795 4470 461 23 14458 --
NM_020977chr462088 1915 1875 1418 1361 808 --21623 466 22183 46
NM_020980chr1571665 1321 1118 646 635 355 163 31364 432 140 21375 659 --
NM_021033chr13123318 2890 2625 2427 2208 1412 1263 1248 1098 887 603 272 12254 13098 12230
NM_021038chr383383 3226 2780 2738 2673 664 491 345 13057 22363 1195 13372
NM_021061chr8123825 3380 3272 3119 3085 2941 2841 2792 1201 582 528 428 34493 612 169 63607 3475 3442 3395 2872 1368 --
NM_021064chr641816 1623 677 164 2548 113 --31740 1531 411
NM_021072chr572536 2437 2168 999 846 761 140 11626 42081 361 341 107 --
NM_021083chrX103501 3150 3062 3050 2575 1350 1255 1240 1035 720 33303 1308 1194 1674 --
NM_021090chr22105060 4484 4319 3107 3099 1863 1752 1679 1407 268 24595 1039 44562 3732 3258 3231 15023
NM_021097chr2103032 2782 2599 2520 2277 1187 522 410 404 111 53089 2480 2384 2230 1098 22613 2243 11893
NM_021111chr961372 1198 961 491 466 315 21272 54 1217 1896
NM_021116chr7178730 8306 7891 6648 6340 5567 5541 5504 3637 3522 3259 3099 2852 2583 1253 990 619 38807 6920 3396 45717 3583 1170 1164 --
NM_021127chr1871267 509 258 246 202 145 133 177 11024 21368 495
NM_021205chr1112906 2882 2289 2249 1994 1928 926 321 245 191 39 22160 505 --1290
NM_021215chr2062105 2013 1522 1516 848 67 --41914 1531 378 313 --
NM_021255chr14104080 4049 3679 3471 1312 1059 384 144 118 47 13100 23886 1194 23803 3303
NM_021629chr3115081 4868 4411 3840 3746 3289 1817 1045 961 395 99 44189 2003 456 72 ----
NM_021638chr4104569 4507 4426 4264 4249 3557 985 951 582 262 14756 44884 642 373 250 1568
NM_021647chr443000 1897 1690 1559 54592 3384 1473 916 726 44515 3536 1194 861 34599 3663 3095
NM_021815chr263102 3041 2640 1247 932 878 31926 1204 330 32766 424 180 --
NM_021911chr595497 4883 4695 1968 1756 1271 948 452 414 44671 3486 1434 77 44968 4808 1423 971 24993 3795
NM_021912chr15194196 3856 3702 3649 3605 3387 3118 2989 2967 2751 1466 848 700 471 379 366 332 233 47 ----14163
NM_021925chr291810 1739 1537 1288 1190 455 385 114 86 --1528 31327 315 106
NM_021942chr45821 792 709 615 251 2875 720 1281 1224
NM_021960chr182372 2304 2016 978 317 295 281 190 32794 1983 206 11007 --
NM_021961chr11156719 6517 6453 6388 6254 6182 6137 5831 5734 5461 4740 2939 1651 646 571 26633 861 57506 7217 5993 5000 4915 37491 817 539
NM_021964chr3146430 5732 5434 5186 4838 4821 4235 2625 2454 2275 2045 1575 712 350 35953 1600 1430 35192 4892 1606 --
NM_021977chr673843 3586 3296 2638 1351 1178 456 23626 386 23594 497 13335
NM_022048chr15105902 5782 5340 4731 2505 2175 1247 1089 1067 905 32000 1278 1021 54103 2133 1554 1434 711 36093 6039 5620
NM_022058chr282083 1832 1544 552 469 434 364 35 31613 1419 652 21411 130 --
NM_022080chr20102553 2273 1905 1744 926 772 724 242 168 159 --22815 2212 11826
NM_022114chr1124778 4576 4432 4319 3799 3474 2897 1394 1231 835 424 220 34264 3941 1502 34606 3111 154 --
NM_022340chr3123378 3348 2765 2508 2450 2434 2293 1375 1106 874 591 102 12619 13562 13340
NM_022351chr8103063 2988 2948 2751 2473 2393 1308 930 352 315 52437 1219 850 738 283 23885 1102 23201 807
NM_022405chr3123430 3138 3123 3088 2784 2613 2336 2290 1222 747 365 221 1719 43202 3174 753 239 --
NM_022456chr12127376 7014 6569 6562 6516 5403 2605 1552 1506 1471 1354 525 95892 5417 3066 2705 1696 1520 563 497 45 37678 5515 5494 22613 202
NM_022459chr13216349 5929 5802 5785 5305 4906 4675 3929 3904 3846 1733 1446 1376 1342 1037 577 442 372 259 151 60 --35004 1348 1043 35813 4025 566
NM_022461chr391322 1047 1010 480 470 411 349 313 83 1939 11081 1184
NM_022465chr1243071 2331 2295 191 1647 --32773 1063 611
NM_022497chr363338 2732 1528 1512 262 111 13661 13155 23146 2363
NM_022574chr731659 851 319 2411 234 --2387 380
NM_022716chr1102557 2525 2457 2407 2311 2187 1268 1174 1086 327 32865 595 510 22511 175 --
NM_022771chr127778 737 421 397 298 70 63 2934 315 ----
NM_022781chr9113074 2971 2949 2865 1226 1070 1026 832 694 496 401 12858 13241 22099 701
NM_022841chr1582530 2480 2151 1799 1788 1122 559 66 21037 509 42178 2084 1869 841 1584
NM_022843chr1371251 1234 468 413 318 195 93 1573 11025 21183 424
NM_022894chr251234 598 422 105 95 --21700 1376 11692
NM_022898chr1454339 3268 1778 1764 1608 43260 3052 1243 481 33785 1667 167 11805
NM_023016chr2102903 2863 2662 2129 2055 1985 1776 452 427 305 12083 21978 1864 12625
NM_023929chr862740 2287 1025 724 363 124 2938 925 21062 298 32829 1871 711
NM_023934chrX41603 800 717 336 2555 363 2405 290 2881 439
NM_024007chr592998 2885 2718 2565 1956 878 856 679 411 22487 2448 22786 33 12892
NM_024090chr431854 1316 1259 --31611 713 593 3567 478 382
NM_024345chr9155529 5179 5077 4600 4172 2404 2204 1981 1955 1642 1406 1375 1150 661 68 53761 2422 1940 1502 476 65752 5595 4799 3784 1921 1125 --
NM_024408chr1123641 3201 2811 2602 2423 2285 1395 1359 1119 1058 228 65 21446 674 43538 3213 560 367 23095 89
NM_024423chr18114140 4066 3025 2898 2663 1361 1057 833 782 751 131 3628 616 394 53406 2952 839 641 45 --
NM_024511chr4102927 2903 2695 2612 2394 1250 1208 933 680 102 --12590 12703
NM_024548chr361775 1737 1669 654 416 229 1391 --2616 443
NM_024596chr8165411 5391 4515 4481 4174 4081 3777 1851 1843 1782 1557 1277 881 597 517 84 24599 3942 54750 4398 3963 733 569 23986 70
NM_024613chr871751 1740 1570 1313 1268 517 458 51760 1611 555 116 44 21480 1206 11403
NM_024624chr251571 1518 1377 1062 86 1161 11207 21621 110
NM_024639chr662662 2399 869 790 223 131 52957 713 686 518 465 42481 881 817 630 1140
NM_024641chr653038 3003 2194 1975 74 1400 31070 1064 781 42494 1141 796 182
NM_024646chr173616 3416 2834 1363 837 627 570 1480 11515 21074 556
NM_024665chr3113864 3407 3288 3219 2958 1592 970 674 597 509 170 14715 21288 685 1271
NM_024713chr1591627 1213 641 480 471 228 156 144 86 2351 189 1242 1496
NM_024721chr862659 2575 2313 2136 1940 920 22285 781 22319 1045 21667 231
NM_024740chr11114056 3794 3609 3514 2542 1333 916 760 495 402 343 14174 11320 --
NM_024744chr282649 2277 2082 689 573 523 315 103 4848 807 462 431 2897 118 12446
NM_024761chr9105104 4972 4711 4350 4192 3561 2069 1931 1528 1278 54925 4000 3823 956 227 24411 4036 --
NM_024770chr2186350 6118 5882 5819 5786 5038 4928 4635 4519 4309 4145 4089 2276 2013 1189 1087 1028 200 66233 5523 4426 2556 1151 310 --25072 89
NM_024818chr3101515 1482 1457 1372 1343 1157 561 531 253 136 1589 11032 --
NM_024837chr1551926 1752 1432 717 396 1571 --21387 178
NM_024900chr421503 454 ----32223 1800 1492
NM_024900chr421503 454 ----32223 1800 1492
NM_024913chr751082 615 592 555 401 2343 231 11372 1517
NM_024920chr4111345 1270 1235 498 429 406 337 186 175 101 80 ----1261
NM_024930chr5112436 2197 2040 2012 1987 911 793 522 421 412 300 1289 12107 2816 341
NM_024947chr3279538 9227 9150 8782 8430 7827 6167 6096 5946 5930 3751 3485 3405 3312 3043 2373 2149 1705 1473 967 944 621 572 473 439 425 225 67626 6151 5793 3690 881 235 18012 --
NM_024949chr4114578 4545 4449 3687 3176 1832 1644 1538 1517 295 65 63595 3303 1800 1444 342 126 11869 --
NM_024953chr1282609 2280 2169 2122 1748 921 551 121 22419 1863 --12544
NM_024989chr2207644 7518 6879 6081 5888 5681 5526 5467 5044 4973 2916 2776 1687 994 892 631 458 317 231 130 57089 7037 6550 2809 222 45648 3262 567 25 26704 5124
NM_025054chr894121 4066 3051 2598 1458 1067 561 369 344 42797 2774 2648 1231 43590 2698 311 288 12630
NM_025073chr184201 3776 3664 3056 3005 1679 1670 607 13423 33235 1885 1037 --
NM_025134chr1652564 2046 1855 898 886 12322 51783 987 480 436 271 --
NM_025160chr1144124 3940 3905 3412 3162 2682 2645 1356 967 872 810 428 355 189 53206 1542 926 376 249 11507 34101 1337 118
NM_025179chr1134907 4663 4571 3999 3861 3795 3660 1189 1073 756 697 222 69 34171 4061 3120 44591 937 352 319 --
NM_025191chr173277 2513 1249 1177 830 526 506 22830 744 1210 23362 3144
NM_025208chr1172025 1935 1752 1541 965 926 393 2910 35 1602 22483 1735
NM_030621chr1493843 3302 3188 3098 3090 2995 1186 843 674 33004 2729 1282 23723 958 12661
NM_030627chr5113762 3582 3323 3291 3278 1549 1465 1396 320 251 225 34068 3424 896 32530 565 134 22516 1178
NM_030647chr7186298 6283 6010 5659 5608 5598 5495 4472 4437 3957 3892 2456 2292 2231 1924 1785 1773 244 26323 3820 21862 598 1804
NM_030648chr4134990 4178 4128 4093 4008 3919 2225 1811 1785 1520 1472 811 775 25265 4909 25559 1603 15430
NM_030650chr294276 3611 3360 2733 1678 1123 619 609 392 43806 1185 1108 916 31283 834 506 --
NM_030674chr12195535 4867 4660 4362 4316 4041 3843 2053 1752 1415 1212 827 751 721 682 528 322 213 128 65187 4182 1541 1448 1425 1174 45449 5376 4147 1824 --
NM_030755chr1473082 2414 1211 964 721 297 132 42161 939 402 228 --12176
NM_030775chr122680 266 --3134 128 120 --
NM_030806chr1169352 8301 8266 8184 8032 6665 5722 2953 2777 2770 2512 2123 1629 1159 920 693 49364 7554 6754 6173 47341 3755 2592 1235 23091 2714
NM_030816chr193632 3425 2859 2552 2501 2435 1417 1393 145 33346 2418 96 22787 1219 22593 2236
NM_030918chr1125334 4667 4069 3905 3755 3592 3527 3485 3462 1418 1408 564 24351 402 2637 431 --
NM_031296chr4102761 2709 2679 2615 2566 2282 1903 286 259 206 22600 324 1276 --
NM_031362chr292709 2340 789 722 559 541 453 250 227 22072 1044 22595 2456 1864
NM_031365chr292845 2476 925 858 695 677 589 386 363 32208 1794 1180 22731 2592 21000 52
NM_031366chr292845 2476 925 858 695 677 589 386 363 32208 1794 1180 22731 2592 21000 52
NM_031371chr111438 11503 --31561 408 164
NM_031371chr111438 11503 --31561 408 164
NM_031418chr1182799 2734 2616 1835 597 419 127 74 32642 2282 334 22199 1087 --
NM_031427chr14135342 5106 5036 4871 4555 4446 4234 2352 1625 1046 972 942 387 45836 1366 544 530 --24618 2392
NM_031435chr1263436 1044 593 246 178 129 22549 460 33264 3055 165 --
NM_031438chr5101972 1895 1653 1537 1282 1258 1214 799 655 309 1390 --21629 372
NM_031442chrX83195 2490 2320 1119 1086 1034 313 268 43211 1996 479 298 12435 22134 2058
NM_031453chr1071779 1714 956 795 606 278 198 22445 2024 11856 11664
NM_031468chr7178121 7022 6897 6769 6275 6085 5914 5858 5670 5620 3145 2921 2907 2474 2258 1465 121 27009 5921 21673 1127 18032
NM_031469chr684136 3881 3553 3010 2950 2779 477 247 61451 925 745 543 290 145 33114 577 162 11155
NM_031844chr1164018 3551 3481 3338 2729 2721 2644 2617 2586 1398 1232 913 821 747 598 576 33465 2900 2568 --12599
NM_031911chr482549 2107 2095 2044 1865 1126 221 149 21888 874 22185 929 32801 1833 743
NM_032012chr9155269 5116 4899 4890 4744 4398 4200 3646 3301 3251 1898 1766 1751 703 253 24363 791 24415 1282 --
NM_032047chr382123 2052 2024 1954 1899 956 236 117 32447 1976 342 1909 155
NM_032102chr1162678 2118 901 524 107 71 42875 1100 844 706 11048 22767 2470
NM_032105chr1168054 7734 7542 5842 5731 5374 3189 2281 1876 1469 1460 1433 1332 1306 1243 1188 46263 6218 6142 87 47410 6541 3057 93 11162
NM_032116chr1395356 4688 4459 4128 3963 3805 3597 1186 1084 55573 5111 4908 1155 162 45556 4975 4057 698 14920
NM_032121chrX92694 2669 2439 2099 532 243 200 70 39 32123 2017 47 42451 2071 1073 970 --
NM_032160chr18124311 4300 3032 2938 1596 1562 1071 991 537 446 265 222 22813 1004 43068 1263 1234 584 --
NM_032228chr11123368 2767 2755 2642 2541 971 956 948 850 719 678 389 33263 2198 1047 --23289 548
NM_032291chr171892 1845 1838 1603 1575 1362 123 1572 185 158
NM_032321chr283292 3260 2938 2633 2552 2501 1164 151 22534 79 52387 1291 923 550 401 12294
NM_032373chr10195816 5360 5151 5096 4772 4411 3992 3630 2246 2225 2159 2152 1958 1868 1398 1345 817 670 456 65632 4662 1820 1711 1419 520 45179 3605 1292 1153 24654 3733
NM_032435chr132359 2117 866 22375 2276 31907 1612 253 21894 1601
NM_032441chrX41192 1097 1027 831 41104 455 198 37 --2384 84
NM_032446chr573127 2548 1359 866 837 274 141 33234 1027 340 53534 3254 2616 1282 427 21186 632
NM_032457chr473852 2956 1579 1490 1016 877 514 43478 2609 2435 901 32913 1031 42 23434 1437
NM_032505chr362672 2635 2494 1995 1925 684 22453 694 12614 22221 114
NM_032509chr8112605 2592 2152 1945 1717 977 948 899 661 359 277 22570 178 12562 22506 1993
NM_032547chr441287 1132 243 28 1342 51234 939 893 190 113 --
NM_032581chr771784 1728 769 523 509 144 42 1616 41253 560 546 66 21538 1192
NM_032642chr122680 266 --3134 128 120 --
NM_032682chr363582 3519 3345 1286 876 79 53188 2894 1116 210 40 132 12697
NM_032778chr343000 1104 508 123 1942 33247 2518 412 23320 177
NM_032810chr1041464 1453 975 65 1320 --21503 1474
NM_032828chr1994921 4616 4520 4473 3479 1561 1328 1050 630 34717 4353 103 --13618
NM_032833chr1122487 2188 2121 2113 1975 1025 832 743 591 398 279 194 32145 1999 333 11938 --
NM_032834chr124497 405 86 26 3213 183 79 --21319 220
NM_032859chr13153647 3509 3445 2992 2740 2731 1184 1099 1026 872 585 443 329 117 97 22578 167 13395 13746
NM_032869chr851811 1582 231 183 141 2216 35 --21510 293
NM_032873chr11204386 4013 3774 3474 3388 3123 2790 2782 1391 1035 914 790 676 571 526 500 414 396 163 149 33729 3095 1800 34251 3973 1564 14210
NM_032968chrX64114 4051 4010 3621 2675 1302 43417 1705 1480 1116 33527 2920 367 14286
NM_032969chrX64114 4051 4010 3621 2675 1302 43417 1705 1480 1116 33527 2920 367 14286
NM_032973chrY74106 4043 4002 3613 2670 2573 1302 43413 1699 1480 1116 33523 2915 367 --
NM_033020chr194814 4412 4369 4307 3398 1914 1308 853 241 34858 4334 128 22947 799 --
NM_033083chr383350 3240 3009 2808 2702 1048 842 397 43115 2877 1315 975 --22815 278
NM_033132chr1392322 2188 1970 1919 1877 1770 822 143 28 11674 --11728
NM_033135chr1172025 1935 1752 1541 965 926 393 2910 35 1602 22483 1735
NM_033138chr782281 2260 2095 1886 915 471 432 241 1806 11670 21775 1472
NM_033139chr782281 2260 2095 1886 915 471 432 241 1806 11670 21775 1472
NM_033140chr782281 2260 2095 1886 915 471 432 241 1806 11670 21775 1472
NM_033157chr782281 2260 2095 1886 915 471 432 241 1806 11670 21775 1472
NM_033181chr6103349 2983 2972 2547 1032 811 692 500 359 253 21141 206 33144 517 115 23985 305
NM_033224chr7197786 7389 6150 6128 5819 5633 5609 5389 5176 3226 2758 2254 1347 1129 1055 963 670 509 499 36456 5647 184 12311 15654
NM_033225chr882485 2471 2331 2130 1224 907 851 245 21189 465 --32934 2457 921
NM_033281chr52845 121 ----4632 366 114 77
NM_033285chr8164211 4143 3938 3838 3796 3302 3289 3203 3074 2860 1022 626 512 232 148 75 43728 936 747 538 ----
NM_033290chrX123593 3199 2860 2792 2367 2302 1408 885 755 742 662 96 31191 1077 70 1587 13668
NM_033331chr9163600 3553 3031 2474 2449 2393 2386 2285 1437 1111 956 859 828 590 75 46 1759 12263 --
NM_033360chr12134306 4046 3883 3217 1613 1590 1421 1103 1035 923 854 460 447 44088 4022 1428 352 1765 1745
NM_033389chr17104325 4208 3957 3361 1753 1725 1455 869 848 680 21276 331 54243 4169 3845 3444 1297 14599
NM_033394chr291629 1572 1396 1323 424 416 269 209 34 --21244 554 --
NM_033425chr116958 809 796 781 338 30 53062 2981 2530 2159 1139 33423 827 517 1581
NM_033426chr14112932 2909 2715 2607 2571 2156 2143 1177 1029 692 587 42901 2178 1902 754 12267 --
NM_033430chr4114104 3801 3782 3416 3180 2970 777 717 666 566 216 53701 3564 1084 804 466 22959 555 --
NM_033437chr4114104 3801 3782 3416 3180 2970 777 717 666 566 216 53701 3564 1084 804 466 22959 555 --
NM_033505chr2146712 6679 4725 2265 2180 2061 1859 1686 1620 1268 659 651 597 527 26324 1035 22385 1286 22150 1631
NM_033512chr892954 2933 2720 2656 2524 2009 844 623 457 12075 22859 2081 13081
NM_033656chr21175982 5664 5579 5426 5241 5152 5112 4489 4437 3996 2288 2013 1837 1292 1192 858 55 25043 3911 45911 5603 3694 121 15822
NM_052811chr13125264 5165 4534 4184 4177 4041 3629 1622 1593 1495 304 167 44689 4351 4234 3964 34565 1747 1677 14946
NM_052832chr862333 690 559 516 154 48 22400 339 43026 2686 2110 792 32661 822 552
NM_052879chr1273188 3173 1591 1295 758 589 383 43664 1329 461 402 12796 21316 847
NM_052885chr1294271 3937 3570 3403 3364 3258 1707 1215 745 --44967 4163 3138 656 14366
NM_052907chr12154233 4165 4103 4005 3983 3124 3090 3045 2912 2796 2753 2670 1483 890 183 43924 3334 1336 843 24316 537 1426
NM_052917chr273402 3119 2441 2083 893 379 91 43202 2107 1207 342 43390 1200 430 26 --
NM_052918chr1092951 2899 2527 1313 928 776 527 374 159 42457 2307 1463 1380 22472 2442 22388 419
NM_052927chr572029 1832 1615 826 556 229 70 21600 1499 21892 477 1291
NM_052932chr1182290 2274 2053 2007 1892 828 97 25 31752 331 315 12365 --
NM_052937chr862334 2001 1084 963 574 50 52726 2300 1877 210 116 22174 404 32421 2279 2168
NM_053016chr9187748 6504 6242 6081 6032 6009 2915 2718 2622 2287 2199 1982 1901 1588 1426 923 758 609 56493 6113 5913 5334 1549 15001 37931 7381 1093
NM_053042chr493007 2589 2352 2310 2297 904 354 250 101 22214 1995 22001 467 12178
NM_053043chr7106329 6141 5688 2415 2287 2084 1994 1485 1037 545 36308 4665 1153 --22467 1184
NM_053064chr14103096 2823 2307 2235 2018 888 843 121 97 22 42833 2418 1959 320 52534 2085 1944 777 165 --
NM_058170chr161315 1060 1044 1020 625 178 31522 1258 478 21408 229 11220
NM_078487chr993359 2867 2584 2499 2100 802 618 518 381 --12391 12843
NM_080629chr141447 1326 594 181 --3973 471 217 1513
NM_080630chr141447 1326 594 181 --3973 471 217 1513
NM_080664chr1451782 1318 835 231 41 11720 --21941 643
NM_080666chr1471270 1173 649 614 515 210 138 71635 1361 1283 1257 1132 542 126 21304 663 --
NM_080676chr20112883 2834 2825 2485 2473 2380 2021 1299 601 540 107 22927 519 32562 2185 2060 1594
NM_080743chr682482 2417 1763 1672 1031 873 615 125 62508 1934 1693 896 764 664 12460 12085
NM_080759chr13122616 2569 2285 2223 2104 2094 988 645 623 356 332 209 31978 563 492 22450 879 --
NM_080760chr13122616 2569 2285 2223 2104 2094 988 645 623 356 332 209 31978 563 492 22450 879 --
NM_080764chr22113249 2988 2865 2476 1109 1008 831 820 633 486 107 22340 853 13069 12980
NM_080867chr1463546 3131 2011 1884 1712 813 21938 1476 31578 669 658 --
NM_080872chr874085 3965 3817 2893 2867 2612 472 43764 3463 2832 138 --13265
NM_080927chr383302 3183 3154 2969 2402 2395 950 820 22773 427 22239 891 --
NM_130391chr962282 1393 707 401 329 84 33415 794 202 33560 3502 211 --
NM_130392chr962282 1393 707 401 329 84 33415 794 202 33560 3502 211 --
NM_130393chr962282 1393 707 401 329 84 33415 794 202 33560 3502 211 --
NM_130436chr2162823 2082 926 764 730 152 12039 42074 1852 1080 578 22580 2507
NM_130438chr2173400 2659 2206 2156 1341 1307 729 12616 32651 2429 1155 23157 3084
NM_130439chr10102336 2200 2077 2050 928 611 600 513 295 269 31853 559 231 1435 11920
NM_130439chr10102336 2200 2077 2050 928 611 600 513 295 269 31853 559 231 1435 11920
NM_130847chr1175517 5211 4860 1636 774 506 178 --1536 24897 4824
NM_133334chr4136365 5907 5765 5628 5488 2181 2068 1881 1441 1428 1123 261 86 35754 1899 376 25353 1085 21300 138
NM_133367chr6113259 3200 2971 2856 2279 1183 432 364 290 254 141 22932 488 22913 2225 --
NM_133370chr473294 2734 2579 1406 1235 240 106 23302 175 --22656 613
NM_133468chr752500 1791 1657 830 68 42308 2036 1011 806 32190 931 542 1794
NM_133474chr451365 1257 1242 319 177 61291 1089 516 482 307 169 2234 148 21451 1404
NM_133482chr54351 328 175 159 21530 428 --11486
NM_133496chr194496 4361 3944 3507 3382 3242 2922 488 425 34569 4194 1617 34346 1784 1682 23666 1353
NM_133631chr351616 1051 664 35 23 41505 1423 1367 1037 ----
NM_133646chr2195423 4845 4546 4514 4502 4465 4326 3888 3600 3540 2105 2015 1976 1939 1832 1470 1286 920 784 43470 1949 1592 41 --35035 4766 1701
NM_133647chr1593856 3765 3695 3196 2558 1460 1048 1009 59 21159 330 1711 13068
NM_134470chr3160 --3731 652 136 2264 128
NM_138348chr5136250 6203 6184 6120 5763 4735 1734 1520 707 594 465 149 102 36335 5329 4906 14509 --
NM_138426chr742217 2170 924 182 11630 11970 21867 371
NM_138444chr13164822 4599 4557 4190 3877 3734 3703 3455 1676 1566 1551 1442 1434 1071 621 554 24779 4066 ----
NM_138459chr673077 3001 2748 1452 738 485 83 42265 1427 868 750 33695 885 210 23146 2311
NM_138468chr2215890 5875 5416 5380 4827 4622 4359 4283 2287 2040 1933 1885 1458 1185 850 558 538 451 375 344 67 3483 239 215 15408 25071 3839
NM_138473chr12104643 3917 3782 2068 1209 1005 214 123 99 84 34271 1902 1683 --23839 831
NM_138494chr732636 1777 681 2353 236 --32681 606 181
NM_138576chr1454339 3268 1778 1764 1608 43260 3052 1243 481 33785 1667 167 11805
NM_138635chr7132908 2700 2607 2251 1255 1236 1179 848 460 375 362 353 319 --23211 2242 --
NM_138713chr16138297 7706 7309 5372 5325 3191 2866 2662 1957 1847 1450 736 233 37222 1027 427 35401 5308 68 35544 5031 1279
NM_138714chr16138297 7706 7309 5372 5325 3191 2866 2662 1957 1847 1450 736 233 37222 1027 427 35401 5308 68 35544 5031 1279
NM_138731chr14104064 3894 3682 3643 3401 2744 1138 1023 781 471 23693 1640 23080 1454 --
NM_138771chr751571 1398 1023 517 144 51469 985 450 386 322 21111 312 11415
NM_138799chr2111949 1570 1495 1459 1336 715 603 446 314 163 153 2323 90 --1792
NM_138959chr1146702 6654 6359 5937 5889 5401 5325 5144 4656 4600 4135 2704 1810 1706 76825 4670 4357 2281 2126 1666 189 24645 474 --
NM_138971chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_138971chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_138972chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_138972chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_138973chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_138973chr1152977 2764 1413 820 586 33272 2563 2505 --33044 2920 1300
NM_139169chr1062085 1423 719 566 242 215 1310 21503 1398 22097 118
NM_139279chr2113584 3285 3117 2842 2562 2314 1308 446 417 365 147 13537 13291 1167
NM_139319chr1251852 1801 1592 1389 652 11301 21263 645 --
NM_139321chr20113939 3854 3774 3610 3016 1515 1008 980 824 540 114 34201 2883 319 11404 32730 1453 1416
NM_144571chr4116511 5899 5666 4278 2799 2293 2064 1505 1254 1085 784 1569 25156 4462 12082
NM_144578chr14155544 5532 5193 5076 4886 4337 4061 3947 3912 3450 2087 1931 1269 759 300 11242 35506 662 242 45254 3760 1722 110
NM_144599chr15165298 5280 5142 5002 4825 4711 4671 4282 4252 4065 3607 2182 1933 1683 392 233 54983 4782 1764 1482 836 14890 --
NM_144684chr1952820 2716 2497 2353 1024 42018 1032 372 195 22930 1120 32301 2216 641
NM_144718chr392561 2377 2330 2077 1678 618 510 212 130 42495 2350 1866 371 ----
NM_144775chr17134963 4575 4356 4168 4051 3976 3897 3530 3463 3056 1864 1362 234 2558 446 24799 1097 --
NM_144949chr242040 2017 1848 664 42194 2165 2149 325 12359 31771 1026 305
NM_144963chr872664 2045 1987 997 926 427 412 12401 2643 313 22201 740
NM_144973chr12125079 4746 4479 4377 3785 1732 1519 1420 1201 1032 979 667 75250 4231 3751 3707 1233 691 591 23996 1932 14010
NM_145165chr14102825 2818 2430 2230 1051 1012 912 475 401 90 12372 32909 2311 682 11140
NM_145176chr6102746 2687 2542 2461 1226 990 647 319 119 106 42269 1299 1270 677 --12311
NM_145259chr2147047 6811 6746 6535 6219 4777 2724 2104 1501 1147 1122 1111 1010 220 35213 2502 685 55840 4374 1772 385 144 26650 4568
NM_145303chr64449 116 85 47 2164 125 2566 134 --
NM_145307chr10134710 4645 3708 3619 3234 3208 3114 1562 828 704 667 404 387 13026 23911 1616 24564 156
NM_145313chr1041634 1461 1258 277 ----31444 324 127
NM_145320chr793525 3353 2498 1378 1217 874 795 619 577 1526 --1255
NM_145321chr793525 3353 2498 1378 1217 874 795 619 577 1526 --1255
NM_145322chr793525 3353 2498 1378 1217 874 795 619 577 1526 --1255
NM_145753chr381700 1282 1208 1129 1044 347 306 59 ----2223 83
NM_147147chr673126 2678 1673 1566 1073 153 45 33486 1245 57 14104 1447
NM_147150chr9103870 3619 3139 2971 2728 2643 1418 583 349 70 33683 926 676 53405 2993 1435 763 154 --
NM_147175chrX142192 1945 1934 1899 1777 1753 1543 730 457 426 317 233 197 48 11962 173 --
NM_148955chr15136506 6349 6216 5901 5336 5184 5114 5064 4341 4269 4198 1910 537 36402 2240 1450 35967 933 358 --
NM_148957chr13112463 2229 2111 2050 1030 974 593 503 438 388 312 --52169 1938 1805 798 253 --
NM_152277chr5121728 1538 1427 1418 1383 793 758 500 336 320 233 82 31877 1476 145 1493 11434
NM_152305chr3102248 2111 1988 1785 1589 752 427 331 193 62 1160 --1492
NM_152352chr1883106 2499 2333 2325 2299 2086 2068 51 ----32934 606 544
NM_152380chr141443 630 623 278 21116 95 1339 21597 1559
NM_152400chr472085 1856 1775 1722 1667 393 326 155 22063 555 --
NM_152414chr891317 1108 652 499 463 456 335 322 97 --11452 1612
NM_152450chr1561518 1414 762 257 189 165 1348 62110 636 588 328 288 234 --
NM_152536chr35834 781 423 307 179 1985 3429 317 299 --
NM_152542chr461912 1757 681 549 268 261 32025 1973 1729 3501 237 224 --
NM_152556chr772520 1954 1929 847 286 89 63 --31939 1918 1592 2955 356
NM_152581chrX61153 1065 949 524 342 157 2469 51 1923 31475 1343 1129
NM_152605chr1941395 1058 942 200 31083 533 451 1954 21153 368
NM_152622chr573354 3027 2775 2176 796 640 185 12602 43177 1210 674 576 --
NM_152624chr5227382 7310 6952 6804 6622 5788 5524 5404 5220 5022 4864 4834 4819 4717 2845 2815 1838 1784 907 819 545 123 47262 2867 2376 2339 35763 2475 1524 26723 858
NM_152626chr73961 924 858 31135 838 225 --2248 162
NM_152629chr9144104 3790 3756 3726 3487 3364 3284 3178 2796 2662 1479 968 362 316 11008 2691 333 1660
NM_152636chr1182773 2694 2630 2206 1984 905 583 162 22026 685 2357 306 12879
NM_152641chr12112933 2882 2855 2536 2454 1086 934 666 362 333 87 62682 2233 1998 1870 926 67 22587 285 --
NM_152695chrX1508 1633 31536 1464 852 21939 250
NM_152699chr372441 1472 1288 1275 570 418 284 53770 2610 1428 1181 657 1835 11346
NM_152729chr64595 351 29 23 11080 11357 11601
NM_152734chr695483 4535 4341 4105 3616 1597 1398 81 53 25452 527 11688 11291
NM_152754chr743810 2941 425 369 11053 33657 3350 899 22969 2623
NM_152756chr5103995 3609 3567 3541 1738 1698 1573 1556 1017 429 34016 3909 1004 11287 --
NM_152758chr8102587 2505 2281 2132 2010 1002 874 565 199 54 32156 708 504 12943 --
NM_152774chr762616 2532 615 498 359 52 22050 411 41991 1971 1711 979 --
NM_152793chr7154875 4804 3955 3668 1947 1857 1613 1368 1231 1166 811 783 452 135 21 2728 710 1835 13364
NM_152826chr15136506 6349 6216 5901 5336 5184 5114 5064 4341 4269 4198 1910 537 36402 2240 1450 35967 933 358 --
NM_152835chr1122652 2537 2344 2087 2066 1790 1132 957 909 683 586 295 32490 992 76 22837 2376 22886 466
NM_152838chr20163531 3326 3185 3150 3120 2972 2957 2863 2708 2596 2497 2483 2243 1334 938 381 --33103 3022 1282 21393 329
NM_152873chr1071656 1593 574 500 432 225 210 1458 21257 301 --
NM_152877chr1071656 1593 574 500 432 225 210 1458 21257 301 --
NM_152903chr1372475 2344 2116 1906 957 626 391 170 22366 2360 22742 513
NM_152919chr1993702 2959 954 565 393 346 276 142 130 33607 493 43 33468 3377 1081 --
NM_152924chr15166902 6650 5898 5686 5483 5378 5276 5124 2566 2464 1405 774 744 479 453 363 11751 44303 2516 2510 2084 --
NM_152999chr7154732 4637 4420 3935 3914 3829 3706 3591 1521 1470 633 551 537 392 120 --23165 570 24012 664
NM_153035chr1152948 2808 2769 2746 2724 1066 1006 926 910 892 875 759 697 344 276 --43183 2982 2358 2134 12435
NM_153050chr22105060 4484 4319 3107 3099 1863 1752 1679 1407 268 24595 1039 44562 3732 3258 3231 15023
NM_153051chr22105060 4484 4319 3107 3099 1863 1752 1679 1407 268 24595 1039 44562 3732 3258 3231 15023
NM_153182chr343000 1104 508 123 1942 33247 2518 412 23320 177
NM_153188chr5165227 4423 4354 4030 3976 3878 1840 1793 1701 1556 1172 900 670 658 630 233 34814 1352 271 11739 1528
NM_153207chr12113547 3387 3230 3161 3078 1465 950 653 372 232 176 43830 2958 2753 774 53856 3485 1161 1023 485 13737
NM_153234chr562745 2472 2431 2331 1807 151 2868 259 42185 1952 590 234 --
NM_153262chr1102345 2143 1986 1155 1123 1111 897 874 770 515 52876 2187 2010 214 101 32789 1059 144 51975 927 453 320 173
NM_153332chr883301 3011 2853 2600 2096 1238 796 385 22455 2158 32212 626 46 --
NM_153456chr13176295 6099 5801 5750 5579 5164 5068 4974 4581 4471 4348 3956 3945 1936 1500 1364 1104 55613 5012 4219 2466 721 45115 1830 420 355 14399
NM_153607chr5123112 3044 3018 2775 2352 2315 2284 2141 1968 1255 300 228 --1651 3998 687 664
NM_153646chr145996 862 721 694 679 32621 2312 582 2740 598 --
NM_153647chr145996 862 721 694 679 32621 2312 582 2740 598 --
NM_153648chr145996 862 721 694 679 32621 2312 582 2740 598 --
NM_153689chr262331 2149 2137 541 401 327 22307 888 22174 278 21964 1590
NM_153712chr2173321 3302 3137 3062 3024 2916 2840 2518 1455 1447 1296 1276 748 688 226 124 61 129 --22611 1469
NM_153810chr10185121 5001 4896 4888 4554 4494 4115 3871 3306 3284 3170 1858 1785 1217 1034 294 122 33 14599 --24823 4233
NM_170710chr473108 2861 2802 2763 2728 2552 2513 22654 664 31276 1172 712 22462 2251
NM_170731chr1182674 2274 2023 1981 1806 678 268 124 32791 2229 1964 22144 1047 --
NM_170732chr1182674 2274 2023 1981 1806 678 268 124 32791 2229 1964 22144 1047 --
NM_170733chr1182674 2274 2023 1981 1806 678 268 124 32791 2229 1964 22144 1047 --
NM_170734chr1182674 2274 2023 1981 1806 678 268 124 32791 2229 1964 22144 1047 --
NM_170735chr1182674 2274 2023 1981 1806 678 268 124 32791 2229 1964 22144 1047 --
NM_171998chrX92489 2307 2053 2027 1790 854 670 465 46 12498 52527 1782 1008 594 86 --
NM_172071chr1177323 7006 6933 6910 6864 6656 6633 5867 5808 5054 4740 4693 1892 1180 880 837 365 37136 4852 511 37444 2923 1171 26264 5847
NM_172103chr652650 2087 1818 974 109 22682 2587 1501 2722 142
NM_172105chr652650 2087 1818 974 109 22682 2587 1501 2722 142
NM_172373chr1311144 --1230 21252 527
NM_172375chr143923 316 274 --1387 2394 381
NM_173075chr451587 1335 1220 649 37 21323 641 31760 1638 183 1668
NM_173198chr982661 2416 2228 2094 834 797 447 76 22965 542 1671 22572 1951
NM_173200chr982661 2416 2228 2094 834 797 447 76 22965 542 1671 22572 1951
NM_173214chr16138297 7706 7309 5372 5325 3191 2866 2662 1957 1847 1450 736 233 37222 1027 427 35401 5308 68 35544 5031 1279
NM_173362chr56805 752 664 639 85 43 ----124
NM_173463chr4114181 4123 3550 3459 3446 1134 1128 960 866 496 474 31629 1347 950 21154 1025 13775
NM_173468chr4175841 5749 5711 5673 5605 4739 4642 4432 3949 1939 1270 1113 978 877 355 156 38 55049 4956 2311 2035 554 55639 4095 2353 1067 1002 44725 4155 4040 1309
NM_173510chr22102732 2555 2055 2018 1819 1809 1165 98 88 60 11988 32916 2155 604 12679
NM_173531chr19103726 3618 2640 1210 1185 1119 1084 1015 537 191 103040 998 708 679 550 422 393 250 232 88 22555 1198 33024 1286 1168
NM_173536chr4134849 4291 4104 3862 3162 1956 1842 1587 1398 682 570 315 188 44607 4004 3191 1687 64961 4078 4033 1448 869 580 24547 717
NM_173552chr3112249 2196 2167 2157 1897 1823 1697 743 485 294 84 22093 78 ----
NM_173562chr6103184 2538 2265 2134 797 724 666 649 524 419 32788 2776 236 42905 2095 1149 482 1182
NM_173576chr1082217 1674 887 699 529 495 461 398 --41784 1550 871 85 --
NM_173582chr11166304 6251 5802 5704 5363 4870 4818 4602 2496 2369 1559 1337 1095 1044 182 41 24031 967 14551 32438 2316 470
NM_173602chr1293151 2821 1433 1298 1159 1061 853 440 89 32897 598 38 2500 350 21416 187
NM_173642chr1208990 8554 7958 7604 7458 7249 6740 6500 6347 6266 6253 3672 3087 1590 1250 1182 1000 745 370 228 88538 8009 7778 7316 3529 3031 1984 443 28343 7447 13608
NM_173654chr372258 2248 2199 2167 2151 2126 220 32080 2067 1459 22013 1452 --
NM_173694chrX112382 2293 2070 1641 1021 917 747 643 517 369 265 1966 2389 258 184
NM_173808chr1174476 4264 4223 4085 3968 3779 2924 2877 2868 1584 1562 1153 828 793 686 230 41 54434 3607 3332 3250 3191 44340 2830 2804 1397 --
NM_173825chr373090 2649 2308 2280 755 369 251 32794 2095 694 1148 1141
NM_173829chr5144954 3958 2339 2233 2101 2007 1778 1617 1435 1099 905 638 486 398 36031 1902 931 45001 1171 1151 606 15179
NM_173851chr8133621 3378 3335 3274 3252 3122 2909 2602 1007 984 531 325 157 23068 1387 --12773
NM_174911chr8123875 3832 3626 3606 3510 3494 2852 2725 2641 1476 1452 143 23193 131 33389 3088 869 33710 3308 2539
NM_174916chr1542317 2123 2001 295 12144 21594 842 3849 606 69
NM_175052chr54850 781 652 375 5988 834 631 189 61 --1960
NM_175623chr12127376 7014 6569 6562 6516 5403 2605 1552 1506 1471 1354 525 95892 5417 3066 2705 1696 1520 563 497 45 37678 5515 5494 22613 202
NM_175624chr12127471 7109 6664 6657 6611 5498 2700 1647 1601 1566 1449 620 95987 5512 2800 1791 1615 658 592 140 49 37773 5610 5589 22708 297
NM_175625chr12127471 7109 6664 6657 6611 5498 2700 1647 1601 1566 1449 620 95987 5512 2800 1791 1615 658 592 140 49 37773 5610 5589 22708 297
NM_175861chr12135740 5680 5515 5362 3899 1088 908 693 404 375 99 61 48 65496 4499 1970 1450 928 449 45422 2022 1739 1036 43786 2048 998 185
NM_175863chr631090 177 34 1420 11206 21154 462
NM_175907chr1892518 2291 2026 1081 1018 730 700 655 364 32729 2432 603 1661 32372 2159 1926
NM_175921chr574275 4164 3776 3068 2843 187 49 12815 31509 672 99 43288 517 468 56
NM_176081chr10176025 5906 5572 5560 4859 4834 4589 4197 2288 2235 2121 2002 1455 1236 582 236 91 75548 4867 2337 2220 1661 1146 535 22160 1009 25688 1532
NM_176083chr10176025 5906 5572 5560 4859 4834 4589 4197 2288 2235 2121 2002 1455 1236 582 236 91 75548 4867 2337 2220 1661 1146 535 22160 1009 25688 1532
NM_176815chr3142944 2744 2612 2526 2417 2188 2173 1907 935 600 593 536 444 168 52658 2516 793 437 47 22727 323 --
NM_176824chr441176 927 455 283 1298 --2957 49
NM_177438chr1493843 3302 3188 3098 3090 2995 1186 843 674 33004 2729 1282 23723 958 12661
NM_177452chr14102239 2148 2030 1782 731 670 605 364 330 153 21798 1647 32224 2204 202 --
NM_177538chr2148880 8780 6612 3151 3090 3002 2957 1950 1782 1604 894 758 621 485 32646 913 317 13202 26881 3158
NM_177925chr1282807 2757 2712 1119 869 727 693 160 ----22395 1991
NM_177966chr361823 1548 1456 1443 149 31 --11699 11224
NM_177985chr282292 1581 1442 560 160 149 60 40 11487 52237 2094 1529 738 437 --
NM_178011chr1041122 866 749 150 32855 2659 242 22992 2861 23162 673
NM_178039chr1292717 2413 2383 2096 1223 1189 1130 889 565 52873 811 794 251 130 1359 12990
NM_178040chr1292717 2413 2383 2096 1223 1189 1130 889 565 52873 811 794 251 130 1359 12990
NM_178151chrX157760 7380 6947 6492 6464 5989 2911 1915 1632 1560 1312 1252 891 880 210 47364 1923 653 134 46777 6261 1521 286 11046
NM_178152chrX157760 7380 6947 6492 6464 5989 2911 1915 1632 1560 1312 1252 891 880 210 47364 1923 653 134 46777 6261 1521 286 11046
NM_178153chrX157760 7380 6947 6492 6464 5989 2911 1915 1632 1560 1312 1252 891 880 210 47364 1923 653 134 46777 6261 1521 286 11046
NM_178313chr251925 658 515 282 272 --11869 2496 300
NM_178509chr17114091 3855 3710 1613 1591 1552 1093 981 383 120 73 34108 3888 364 23952 1045 11387
NM_178539chr12122047 1993 1902 1811 1720 1670 1465 1453 1297 466 278 87 21886 107 31478 580 200 --
NM_180989chr1372451 1881 1836 1809 409 257 179 52164 968 270 216 162 21710 96 1654
NM_181265chr473108 2861 2802 2763 2728 2552 2513 22654 664 31276 1172 712 22462 2251
NM_181332chrX102241 2074 1789 1034 879 470 403 344 233 225 41747 1002 708 457 12485 22570 2520
NM_181443chr20102819 2797 2391 2327 2217 2206 1773 1029 314 115 4859 803 613 449 11825 --
NM_181481chr18157022 6323 6186 5663 5504 5299 4265 2741 1501 1027 836 601 333 294 284 --36509 5279 4464 21618 924
NM_181482chr18157022 6323 6186 5663 5504 5299 4265 2741 1501 1027 836 601 333 294 284 --36509 5279 4464 21618 924
NM_181483chr18157022 6323 6186 5663 5504 5299 4265 2741 1501 1027 836 601 333 294 284 --36509 5279 4464 21618 924
NM_181504chr5123716 3701 3679 3309 3227 3204 2969 1007 896 424 371 56 21650 674 --11152
NM_181521chr16117278 6699 6131 5866 5104 5088 1981 1167 1001 363 355 55874 4431 2671 2062 610 12441 21257 790
NM_181523chr5123716 3701 3679 3309 3227 3204 2969 1007 896 424 371 56 21650 674 --11152
NM_181524chr5123716 3701 3679 3309 3227 3204 2969 1007 896 424 371 56 21650 674 --11152
NM_181704chr2181241 1049 564 554 445 421 257 51 4872 501 470 163 1508 11312
NM_181705chr5225308 4856 4644 4366 4345 4177 4004 3776 2109 1828 1537 1372 784 743 636 594 366 323 232 166 106 72 22200 419 44281 3547 1081 570 24810 3646
NM_181782chr631751 1411 221 61854 1712 889 323 193 72 11657 22132 411
NM_181836chr592641 2468 2452 2337 1942 1725 963 742 156 2188 74 12291 --
NM_181838chr561536 1161 1095 1007 489 441 2434 54 1421 --
NM_181897chr362630 956 838 703 59 21 2730 432 --22508 1008
NM_182481chr2171146 834 349 339 230 206 42 2286 255 1293 11217
NM_182482chr2171146 834 349 339 230 206 42 2286 255 1293 11217
NM_182484chr2181241 1049 564 554 445 421 257 51 4872 501 470 163 1508 11312
NM_182485chr4133685 3288 2393 2351 2287 1490 1479 1464 1442 1363 650 419 66 1731 1289 12819
NM_182493chr16105363 4668 4601 4547 4180 4054 1217 521 221 60 34248 3696 747 2996 158 35411 2082 712
NM_182501chr243352 3194 2613 1279 1642 1468 22125 133
NM_182503chr6145469 4991 4665 4357 2131 1823 1706 1383 1255 971 856 652 385 63 55103 4067 3872 3785 870 34406 4252 3622 --
NM_182515chr19146520 6512 5960 4962 4647 4267 4100 2328 2061 1660 1590 1119 895 407 126186 5589 1570 1284 1254 1104 686 513 495 345 262 181 24970 2096 36733 2185 1699
NM_182551chr2113233 2770 2340 2298 1052 814 531 514 230 45 24 11191 ----
NM_182641chr1731761 1649 834 2353 268 41725 1302 560 327 11734
NM_182646chr4133685 3288 2393 2351 2287 1490 1479 1464 1442 1363 650 419 66 1731 1289 12819
NM_182691chr731375 1108 231 21121 939 --3919 349 301
NM_182692chr731375 1108 231 21121 939 --3919 349 301
NM_182758chr1573766 3730 2802 2423 1574 537 197 21172 1075 13320 11557
NM_182762chr7126235 6017 5660 5520 5437 5317 4758 2380 2079 1707 1573 1533 56286 5881 4921 789 650 46266 5478 4676 220 --
NM_182763chr182361 2293 2005 967 306 284 270 179 32783 1972 195 1996 --
NM_182830chr1482131 2051 1893 1532 831 543 452 176 21724 292 31524 812 403 3777 310 51
NM_182898chr7116128 6057 5785 5361 4571 4218 2235 2141 1190 1163 1047 25155 2169 35908 882 145 15369
NM_182899chr7116128 6057 5785 5361 4571 4218 2235 2141 1190 1163 1047 25155 2169 35908 882 145 15369
NM_182948chr1123131 3094 3011 2997 2926 2589 2514 2144 1017 694 508 432 22948 2543 1885 --
NM_183004chr1483960 3873 3770 2643 2551 1507 571 165 23722 237 23761 3291 13882
NM_183043chr1331019 958 814 1739 --2757 97
NM_183044chr1331019 958 814 1739 --2757 97
NM_183050chr672297 2255 2069 1842 1752 1639 1628 42375 2150 1508 29 22202 910 --
NM_183238chr12163800 3065 1455 1377 1362 1323 1255 1057 1046 972 805 584 560 421 393 244 23169 112 13895 --
NM_183376chr15172422 2244 2150 2139 2126 1038 996 706 665 643 572 393 357 330 283 256 98 32367 529 149 32532 2303 229 12007
NM_194247chr2114418 3974 3931 3706 3036 2864 1786 1407 1192 979 920 12848 11694 23747 724
NM_194283chr574066 3920 3304 2937 1414 1162 1050 23477 408 54180 3755 3736 3100 2865 1879
NM_194285chr11143405 3136 2665 2466 2364 1272 1131 1068 503 495 335 229 185 23 32257 822 71 13155 2641 433
NM_194286chr1275230 5034 4981 4843 3811 734 295 55992 5092 4539 1584 470 46073 5025 4020 232 --
NM_194291chr8112914 2772 2713 2025 1107 1018 948 919 842 660 533 42259 2112 939 880 1347 1133
NM_194314chr1185597 4576 3836 3627 2250 2110 1792 1640 1321 1171 1148 1045 1004 889 760 737 317 291 24921 1489 15128 24832 1947
NM_194328chr9113074 2971 2949 2865 1226 1070 1026 832 694 496 401 12858 13241 22099 701
NM_194329chr9113074 2971 2949 2865 1226 1070 1026 832 694 496 401 12858 13241 22099 701
NM_194330chr9113074 2971 2949 2865 1226 1070 1026 832 694 496 401 12858 13241 22099 701
NM_194332chr9113074 2971 2949 2865 1226 1070 1026 832 694 496 401 12858 13241 22099 701
NM_194434chr18185158 5123 5088 4975 4868 4846 4458 4009 3652 2137 2066 1868 1463 1380 1169 1089 738 256 64723 4662 4220 3857 1944 1715 35771 5269 848 11134
NM_194442chr1101777 1763 1506 1458 1258 603 512 480 267 226 1303 21663 381 --
NM_197941chr573027 2432 2354 2249 2100 1116 420 3738 428 116 32993 563 45 13000
NM_198066chr1473014 2935 2733 1160 909 855 621 2988 114 1573 12025
NM_198128chr1882082 1975 841 598 554 462 135 66 2505 246 32170 2098 188 --
NM_198158chr383038 2185 1958 1906 805 361 165 106 32842 2316 386 42678 1948 1229 764 11061
NM_198159chr383038 2185 1958 1906 805 361 165 106 32842 2316 386 42678 1948 1229 764 11061
NM_198177chr383038 2185 1958 1906 805 361 165 106 32842 2316 386 42678 1948 1229 764 11061
NM_198178chr383038 2185 1958 1906 805 361 165 106 32842 2316 386 42678 1948 1229 764 11061
NM_198181chr1552760 2370 827 575 266 52968 2944 1928 880 23 42642 2011 851 777 22915 2327
NM_198182chr271524 1481 1405 988 949 480 261 21148 1060 --2605 204
NM_198270chrX52765 2280 1180 374 264 42903 2741 2435 1235 1824 13190
NM_198273chr592837 2807 2800 2725 2518 1231 755 646 145 33153 1048 380 1510 1782
NM_198281chr4143421 2856 2771 2746 2686 2317 2237 1397 1380 900 830 579 396 254 1195 2696 513 33119 1230 505
NM_198320chr12104624 4487 3682 3557 3245 3165 1384 513 294 208 32097 1547 125 2363 179 --
NM_198329chr3101515 1482 1457 1372 1343 1157 561 531 253 136 1589 11032 --
NM_198336chr761489 1279 1257 1224 650 323 146 41566 1525 1495 598 21545 1510
NM_198391chr204495 464 379 331 31229 107 94 --11388
NM_198400chr1592451 2300 2293 2270 1935 881 577 416 389 4871 457 144 119 11130 32374 1995 442
NM_198465chrX52961 2564 2554 1945 1158 12993 12448 2982 157
NM_198468chr6103560 1825 1662 1494 1437 1160 1137 797 569 235 23777 987 43681 3526 1848 1575 --
NM_198484chr3156306 5985 5837 5674 5663 5041 4791 4630 4518 4503 2444 2395 1370 832 800 86440 6091 4039 2267 1308 820 596 74 45969 4193 2065 489 --
NM_198485chr382623 2286 2215 2064 1055 1001 818 52 12522 31982 1716 1007 --
NM_198503chr1102276 1869 1813 1611 1566 1468 974 321 221 209 2820 631 42314 650 290 87 --
NM_198506chr461397 944 295 166 151 118 1202 1106 11328
NM_198549chr193154 3000 2718 2691 2281 2231 893 239 38 22657 1296 1757 12147
NM_198569chr662590 2288 1014 181 143 41 12166 21864 1059 22704 2117
NM_198581chr2206213 6202 6186 4733 4643 2841 2800 2588 2493 2401 1846 1733 1370 1337 1325 1296 1082 712 569 139 36750 663 387 32528 2172 1355 11119
NM_198595chr4104569 4507 4426 4264 4249 3557 985 951 582 262 14756 44884 642 373 250 1568
NM_198793chr3123796 3644 3474 3403 3222 2995 2923 1287 1145 509 133 44 24042 3507 23190 401 1964
NM_198990chr7113114 3041 2758 2371 2048 2021 900 765 469 169 37 32889 2386 24 33323 3083 831 13263
NM_199000chr762084 382 255 241 203 140 2800 672 --1276
NM_199040chr1263103 2872 2426 987 954 759 --1745 23591 2892
NM_199053chr45843 814 731 637 273 2897 742 1303 1246
NM_199072chr7153215 2935 2799 2741 2625 2336 2310 2017 939 522 404 182 140 100 90 22875 1260 22447 1984 12993
NM_199188chr1273188 3173 1591 1295 758 589 383 43664 1329 461 402 12796 21316 847
NM_199190chr1273188 3173 1591 1295 758 589 383 43664 1329 461 402 12796 21316 847
NM_199324chr4103513 3121 2538 2530 2323 1315 902 816 729 362 12573 --13462
NM_199355chr1651289 641 420 209 124 21608 1223 2665 496 11657
NM_199421chr1463546 3131 2011 1884 1712 813 21938 1476 31578 669 658 --
NM_199436chr2113125 2816 2106 2081 2054 1944 1032 886 827 523 141 --32493 2096 332 --
NM_199437chr1192461 2434 2123 1984 1847 1831 521 315 60 42342 2164 1824 722 ----
NM_199438chr1192461 2434 2123 1984 1847 1831 521 315 60 42342 2164 1824 722 ----
NM_199439chr1192461 2434 2123 1984 1847 1831 521 315 60 42342 2164 1824 722 ----
NM_199454chr1124778 4576 4432 4319 3799 3474 2897 1394 1231 835 424 220 34264 3941 1502 34606 3111 154 --
NM_199461chr10113500 3393 3367 3291 1430 1378 1334 787 447 339 140 --32985 2646 565 --
NM_199462chr1124922 4671 4217 3839 3070 3060 1595 1552 1241 792 666 168 11377 33319 456 286 13254
NM_201428chr1141568 1498 288 76 21253 1092 21074 626 31556 419 322
NM_201429chr1141568 1498 288 76 21253 1092 21074 626 31556 419 322
NM_201430chr1131494 1424 214 21179 1018 21000 552 31482 345 248
NM_201432chr17145461 5388 5192 4751 4085 2591 2491 2423 1757 1462 719 687 632 228 36536 5607 1283 36225 1627 867 11871
NM_201433chr17145461 5388 5192 4751 4085 2591 2491 2423 1757 1462 719 687 632 228 36536 5607 1283 36225 1627 867 11871
NM_203282chr1941687 1382 1284 302 5626 468 169 160 142 21218 487 1710
NM_203329chr1196605 5836 5161 2456 1748 1290 598 417 168 86274 5504 4609 2795 2682 1366 1230 656 45510 4911 4383 572 26225 1607
NM_203330chr1196605 5836 5161 2456 1748 1290 598 417 168 86274 5504 4609 2795 2682 1366 1230 656 45510 4911 4383 572 26225 1607
NM_203331chr1196605 5836 5161 2456 1748 1290 598 417 168 86274 5504 4609 2795 2682 1366 1230 656 45510 4911 4383 572 26225 1607
NM_203406chr5102796 2758 2664 2567 1992 792 777 474 129 88 --3911 702 585 11794
NM_203458chr143797 1167 511 315 11507 43508 2885 2557 924 --
NM_203463chr2124952 4842 4439 4240 4080 3962 3694 3541 1966 1957 1739 1498 84888 4753 4005 3870 1773 1588 1290 1234 34802 4033 3906 21242 169
NM_205768chr1102106 1788 1753 1679 1360 778 616 582 448 99 21868 1345 21326 149 41647 1540 635 477
NM_205848chr1112603 2528 2460 2076 984 882 763 585 460 414 125 32696 1898 518 22654 1103 --
NM_205860chr173157 3108 2652 2341 2132 1144 1006 12287 22713 1117 1359
NM_206853chr6124009 3782 3657 3408 3340 3269 2685 1538 1377 1270 1221 493 24146 1583 --1905
NM_206854chr6125270 5043 4918 4669 4601 4530 3946 3434 3290 1754 441 227 35407 3689 841 --22166 949
NM_206855chr6166235 6008 5883 5634 5566 5495 4911 4399 4255 4116 1406 1192 979 783 751 391 46372 4654 1806 370 --11914
NM_206876chr2103405 3363 3250 3145 3035 2743 2468 1008 464 280 22764 2547 42215 1348 984 323 --
NM_206909chr8168033 7984 7949 7849 7449 6943 6421 2532 2480 1387 1105 1011 622 607 445 376 26702 1135 36845 6839 3196 --
NM_207015chr372193 2069 1968 1775 807 571 519 --1835 31707 599 455
NM_207171chr141688 695 476 464 21788 1636 1576 1583
NM_207292chr383383 3226 2780 2738 2673 664 491 345 13057 22363 1195 13372
NM_207293chr383383 3226 2780 2738 2673 664 491 345 13057 22363 1195 13372
NM_207294chr383383 3226 2780 2738 2673 664 491 345 13057 22363 1195 13372
NM_207295chr383383 3226 2780 2738 2673 664 491 345 13057 22363 1195 13372
NM_207296chr383383 3226 2780 2738 2673 664 491 345 13057 22363 1195 13372
NM_207297chr383408 3251 2805 2763 2698 689 516 370 13082 22388 1220 13397
NM_207303chr1073697 3571 2571 2556 1391 783 560 63013 2726 2606 1109 340 260 43606 2801 371 286 32650 719 293
NM_207372chr1082409 2196 1980 1803 1795 1640 1533 495 12424 22044 230 12062
NM_207406chr4176030 5875 5864 5048 5017 4069 2492 2247 2135 1775 1672 1556 1361 1167 1148 1013 844 45114 4694 1639 267 35581 1040 811 --
NM_207491chr4101461 1181 1137 1090 1019 996 559 127 78 25 --21284 84 21524 1407
NM_212558chr9133938 3805 3773 3403 3193 3051 1591 1325 1058 979 929 657 418 21279 493 14253 --
NM_213589chr2105403 5257 4659 1918 1447 1118 1016 844 579 266 23544 475 44533 4493 2161 1580 25183 1056
NM_213590chr13125264 5165 4534 4184 4177 4041 3629 1622 1593 1495 304 167 44689 4351 4234 3964 34565 1747 1677 14946
NM_213606chr1072706 2098 1872 730 665 473 466 32507 1080 943 2648 395 12285
NM_213651chr161761 1408 1145 578 280 209 31744 1636 703 31644 1591 1320 --