TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-335-5p
miRNA Sequence: UCAAGAGCAAUAACGAAAAAUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52971 858 ------
NM_000037chr842390 355 240 186 12449 11909 --
NM_000038chr531325 778 117 1196 ----
NM_000044chrX1162 ------
NM_000051chr1163294 2510 2259 1371 1146 771 2874 441 ----
NM_000052chrX63386 2440 2362 614 587 107 23288 2946 --1393
NM_000053chr132737 208 11376 ----
NM_000055chr32322 66 ------
NM_000067chr8--1559 ----
NM_000084chrX126287 6157 5896 5881 5165 4272 2709 2684 2171 450 396 273 46024 5298 4329 690 22334 1893 12359
NM_000089chr72734 681 ----1328
NM_000090chr23628 200 58 --1863 --
NM_000093chr922253 962 12366 11928 --
NM_000097chr32998 991 ------
NM_000104chr272948 2666 1134 762 595 168 87 12063 ----
NM_000108chr72313 120 --21483 48 --
NM_000109chrX42511 2416 559 528 --21866 1831 --
NM_000110chr12768 86 ------
NM_000115chr1332096 1808 265 ------
NM_000125chr694219 4137 4045 2698 1218 541 489 277 159 33781 3250 3209 14079 --
NM_000127chr81336 ------
NM_000129chr64977 394 165 42 --183 --
NM_000133chrX2121 83 ------
NM_000138chr1512318 1244 1938 --
NM_000139chr1132690 364 213 12285 ----
NM_000141chr102581 532 ------
NM_000146chr191137 ------
NM_000158chr33589 88 51 --1699 --
NM_000161chr1451749 1492 1327 753 195 --12007 --
NM_000163chr532398 2005 333 11816 1363 --
NM_000165chr661698 1553 1355 1290 574 294 ------
NM_000167chrX51865 445 438 361 38 ------
NM_000176chr563952 3638 2937 2645 749 50 11008 ----
NM_000177chr9142 ------
NM_000189chr2----1102 1817
NM_000192chr1251360 1279 1178 326 203 ------
NM_000194chrX1104 ------
NM_000208chr1994307 4129 4025 3451 2987 1383 1211 803 725 --34610 4430 3139 --
NM_000212chr173917 608 332 ------
NM_000214chr2021665 52 1371 11472 --
NM_000217chr1274906 4841 4738 4686 4299 4095 1754 25157 4323 ----
NM_000222chr451943 1449 589 565 48 21980 1862 ----
NM_000232chr432264 2190 1275 22512 2104 ----
NM_000237chr841920 1223 511 446 ------
NM_000245chr71439 22055 341 193 --
NM_000248chr332923 2052 951 32896 85 46 --23056 843
NM_000252chrX21067 516 2951 133 ----
NM_000258chr31233 ------
NM_000259chr1596079 5450 5227 5190 4278 2108 694 183 38 ------
NM_000264chr953210 3006 2419 1160 602 12673 ----
NM_000266chrX2397 224 ------
NM_000267chr1743134 2138 214 45 22375 320 ----
NM_000278chr1062268 1858 1697 1589 1562 739 --11678 --
NM_000280chr111817 ------
NM_000284chrX61895 1683 1559 1496 466 105 ----11627
NM_000297chr421653 590 11633 ----
NM_000304chr1721062 233 --1817 --
NM_000314chr1043300 3116 2154 348 22694 1187 12255 --
NM_000319chr1231093 281 270 1952 ----
NM_000321chr1361719 1614 1385 619 354 117 --1380 --
NM_000329chr12898 295 ------
NM_000332chr6176942 6860 6378 5354 5027 2847 2841 2762 2732 2590 2360 1883 1751 960 738 458 177 14549 --14475
NM_000333chr31235 143 ----
NM_000337chr575280 5088 4818 4298 1939 1090 1019 26032 5182 11350 --
NM_000340chr34534 489 290 275 1496 ----
NM_000346chr1761939 1682 1592 1261 572 521 ------
NM_000353chr1631150 830 142 1278 ----
NM_000362chr2233334 362 104 --12750 13047
NM_000368chr984645 3708 3280 1097 950 902 600 527 1189 34672 3968 704 --
NM_000393chr222128 456 2747 96 11548 --
NM_000397chrX52407 2295 1763 630 265 --12416 --
NM_000399chr1021107 167 ------
NM_000408chr272749 2628 2267 2143 1336 805 207 23121 2129 11276 --
NM_000414chr51225 ------
NM_000421chr172285 58 ------
NM_000428chr1452636 2507 2477 2348 899 ------
NM_000430chr1731444 1087 417 ----12802
NM_000439chr552327 1762 437 279 250 12051 ----
NM_000441chr712206 ------
NM_000450chr151590 1166 637 384 98 ------
NM_000452chr1371822 1544 1515 1439 780 662 42 ------
NM_000461chr374271 3464 3232 3143 1571 895 70 13718 24581 3298 --
NM_000462chr1521393 336 1372 --1524
NM_000474chr71135 ------
NM_000476chr921399 187 ------
NM_000484chr2131112 434 340 1128 ----
NM_000486chr1262644 2457 1979 1190 1075 434 11040 13196 --
NM_000489chrX72737 2648 2426 1112 445 412 316 2499 464 12713 --
NM_000493chr631111 702 227 1199 ----
NM_000509chr41191 ------
NM_000522chr721227 215 ------
NM_000523chr221204 828 1751 1224 --
NM_000525chr1121462 1078 ------
NM_000539chr321037 295 ------
NM_000555chrX137831 7686 7057 6685 5502 5485 5145 3144 2748 1507 1424 1186 1026 26352 1399 17801 --
NM_000574chr121146 101 1208 ----
NM_000575chr22923 897 ------
NM_000594chr6--1641 ----
NM_000597chr22305 204 ------
NM_000599chr254604 3996 3929 1191 828 --13904 --
NM_000600chr71302 ------
NM_000610chr1182888 2639 2537 2520 1979 1922 701 158 11115 ----
NM_000611chr11136888 6740 6413 5939 5579 4782 2751 2260 1283 1196 1051 1013 59 22828 1216 1266 --
NM_000615chr1152905 2192 2158 890 146 11085 --1972
NM_000617chr1222273 725 1782 22221 2142 --
NM_000618chr1265698 4854 4471 4398 2644 2285 --25094 1494 --
NM_000618chr1265698 4854 4471 4398 2644 2285 --25094 1494 --
NM_000621chr131573 1878 ----
NM_000627chr21639 ------
NM_000633chr1865051 4886 4870 4774 3859 960 22096 1918 25013 4937 --
NM_000676chr171217 1118 ----
NM_000679chr51153 ------
NM_000680chr8174 1383 ----
NM_000682chr2160 1355 11832 --
NM_000684chr1031251 502 281 ------
NM_000685chr32178 167 --1312 --
NM_000685chr32178 167 --1312 --
NM_000686chrX1523 1365 ----
NM_000689chr9129 2360 98 ----
NM_000702chr132198 1655 494 ----11510
NM_000706chr123831 639 28 ------
NM_000719chr12102659 2524 2256 1955 1764 1687 887 859 702 25 25995 730 ----
NM_000720chr31125 ------
NM_000721chr182305 2230 2102 1840 907 450 396 30 ------
NM_000723chr171402 ------
NM_000724chr1041527 447 374 184 ------
NM_000739chr72648 526 1280 ----
NM_000756chr84405 387 358 86 ------
NM_000767chr1921314 1200 --1227 --
NM_000786chr721424 87 --1329 --
NM_000795chr111850 ------
NM_000800chr531342 415 267 11679 ----
NM_000801chr2041127 990 296 97 --135 --
NM_000806chr541632 1451 725 504 ------
NM_000809chr4169037 8696 8494 7057 6859 6604 6214 5742 3677 3441 3393 3212 2623 2247 1784 1167 38811 8565 5706 1770 --
NM_000811chr53769 549 277 --137 --
NM_000813chr574311 4199 1770 1725 1662 1175 530 35618 5549 1841 --1899
NM_000814chr1533718 3401 552 22929 697 ----
NM_000816chr5130 ------
NM_000817chr231030 982 182 ------
NM_000818chr101473 ------
NM_000824chr4--185 ----
NM_000826chr462632 2588 1688 1634 588 210 2462 186 ----
NM_000827chr592590 2522 2499 2450 2275 1978 1790 1654 196 --12556 --
NM_000829chr112735 589 --1349 11882
NM_000833chr1641205 1008 545 142 ------
NM_000834chr1231100 401 114 21140 934 ----
NM_000836chr192651 266 ------
NM_000838chr662756 2720 2515 1910 931 335 1219 ----
NM_000840chr7----124 --
NM_000844chr32807 285 ------
NM_000845chr72403 325 ------
NM_000855chr111311 1360 ----
NM_000859chr581599 1433 1291 1269 1113 222 166 145 1333 21562 1412 --
NM_000864chr13139 32 22 1458 ----
NM_000865chr6--182 ----
NM_000868chrX42229 709 462 309 ------
NM_000872chr104651 532 396 74 ------
NM_000875chr15117037 6759 5884 5588 4880 4726 4612 2350 2119 1778 203 ----35302 2586 1291
NM_000883chr72279 55 ------
NM_000883chr72279 55 ------
NM_000891chr1773421 2656 1276 1074 1067 903 442 ------
NM_000895chr121108 ------
NM_000899chr1253365 2967 1640 1389 1272 --23275 132 --
NM_000901chr4102416 2394 2296 2271 2190 1704 1698 762 697 445 ------
NM_000902chr353253 3101 2432 2262 687 11277 ----
NM_000908chr5----1313 193
NM_000909chr441336 240 138 128 --1149 --
NM_000912chr863463 3177 2480 2354 1357 31 22743 2474 ----
NM_000917chr101170 ------
NM_000921chr12----1491 --
NM_000922chr112394 312 ------
NM_000926chr11149455 8264 7983 7949 7426 7342 7272 6096 5802 2615 2236 567 314 92 49045 5968 2701 219 12376 18328
NM_000927chr72600 578 ------
NM_000934chr172678 138 ------
NM_000935chr311011 ------
NM_000937chr171383 --167 --
NM_000938chr42134 65 ------
NM_000944chr42510 221 --196 --
NM_000945chr261864 1802 1608 675 268 32 --1735 --
NM_000950chrX93032 3010 2847 2757 2706 2217 1219 1170 156 1548 23122 488 --
NM_000959chr1113987 3913 3701 3182 2920 2890 2603 2589 1313 764 598 --12624 --
NM_000962chr992337 2298 2003 1112 829 778 598 359 258 11246 11929 --
NM_000964chr17147 ------
NM_000965chr32388 357 1998 ----
NM_000966chr122999 426 --1856 --
NM_000983chr131592 1363 339 1494 --137
NM_000990chr1161063 1044 951 830 466 66 12687 ----
NM_001001132chr213538 361 266 21466 1005 ----
NM_001001323chr1253051 2536 1130 477 381 --11199 --
NM_001001330chr102897 380 --1914 --
NM_001001331chr332482 1845 1703 ------
NM_001001389chr1182888 2639 2537 2520 1979 1922 701 158 11115 ----
NM_001001390chr1182888 2639 2537 2520 1979 1922 701 158 11115 ----
NM_001001391chr1182888 2639 2537 2520 1979 1922 701 158 11115 ----
NM_001001392chr1182934 2685 2583 2566 2025 1968 747 204 11161 ----
NM_001001395chr1252340 2300 939 811 782 22246 1098 22189 618 --
NM_001001396chr1124448 4332 4051 3874 3521 1314 1110 1077 953 854 845 578 23158 1019 --13919
NM_001001419chr5164748 4566 4217 4117 4043 3876 3785 2093 2060 2033 1208 1138 999 656 622 277 11905 34547 1983 798 15179
NM_001001420chr5164748 4566 4217 4117 4043 3876 3785 2093 2060 2033 1208 1138 999 656 622 277 11905 34547 1983 798 15179
NM_001001433chr2053083 2858 2447 1068 565 ------
NM_001001436chr161559 1689 ----
NM_001001438chr21------1316
NM_001001481chr851370 1054 1039 993 200 12404 1281 --
NM_001001484chr103863 418 381 1363 11667 --
NM_001001549chr782882 2850 2780 2514 2141 735 626 334 ------
NM_001001550chr782882 2850 2780 2514 2141 735 626 334 ------
NM_001001555chr782882 2850 2780 2514 2141 735 626 334 ------
NM_001001557chr82777 263 ------
NM_001001560chr221529 ------
NM_001001664chr263506 2670 1388 1325 1310 861 12623 13976 22502 896
NM_001001668chr1963520 3160 1440 556 123 39 23319 3188 --13740
NM_001001701chr441563 1506 866 204 2659 71 --139
NM_001001740chr1--1280 1236 --
NM_001001740chr1--1280 1236 --
NM_001001787chr1175 --1473 --
NM_001001852chr222871 312 1151 ----
NM_001001890chr2193696 3466 2940 2754 1516 863 665 657 596 ----1870
NM_001001974chr1042211 1901 1818 1649 ------
NM_001001977chr201166 ------
NM_001001995chrX31259 1217 546 1743 ----
NM_001002032chr172197 76 145 ----
NM_001002033chr173297 176 85 1145 ----
NM_001002243chr22583 32 2912 314 ----
NM_001002255chr62131 38 ------
NM_001002257chr263171 2748 2581 1170 789 271 21145 878 --12295
NM_001002265chr101804 ----1525
NM_001002266chr101804 ----1525
NM_001002838chrX21355 82 ------
NM_001002843chr1531087 823 430 ------
NM_001002860chr1464354 4248 4127 3994 3353 3290 34602 3304 2927 ----
NM_001002909chr1791958 1644 1632 1493 1433 904 836 341 328 11899 ----
NM_001002914chr1731053 500 408 --21293 241 --
NM_001003407chr10144877 4856 4800 4713 4116 3575 3378 3239 1868 1698 1218 1134 947 248 44915 4132 3779 496 23746 2047 --
NM_001003408chr10144877 4856 4800 4713 4116 3575 3378 3239 1868 1698 1218 1134 947 248 44915 4132 3779 496 23746 2047 --
NM_001003652chr18218646 8365 7993 7877 7296 7121 6639 5986 5965 5900 5310 3240 3122 2749 2552 1594 1503 1362 1146 1092 573 2600 401 38297 7624 2289 --
NM_001003665chr142768 1085 165 87 12235 ----
NM_001003674chr18127044 6950 6347 5733 5341 5137 4947 4311 2382 1654 829 443 --21444 819 --
NM_001003675chr18127044 6950 6347 5733 5341 5137 4947 4311 2382 1654 829 443 --21444 819 --
NM_001003679chr152177 2124 1876 891 785 32194 1581 552 --1278
NM_001003681chr2232024 1896 181 ------
NM_001003688chr411134 ------
NM_001003696chr211102 ----1152
NM_001003697chr211102 ----1152
NM_001003698chr611628 11808 1378 --
NM_001003699chr611628 11808 1378 --
NM_001003701chr211102 ----1152
NM_001003703chr211102 ----1152
NM_001003712chr1241596 1526 789 607 --22784 235 --
NM_001003792chr32944 453 ------
NM_001003793chr32944 453 ------
NM_001003800chr953264 3138 1325 822 268 ------
NM_001003810chr41656 ------
NM_001003891chr221119 ------
NM_001003940chr1573818 3408 2983 2457 1362 859 558 13495 ----
NM_001003942chr1573818 3408 2983 2457 1362 859 558 13495 ----
NM_001003943chr1573822 3412 2987 2461 1366 863 562 13499 ----
NM_001004051chrX1132 ------
NM_001004065chr963794 3609 2955 2908 1041 633 --12806 13042
NM_001004196chr321081 498 ------
NM_001004303chr11575 ------
NM_001004303chr11575 ------
NM_001004304chr1243270 2165 1978 213 --1380 12264
NM_001004317chr664165 3310 852 679 492 22 44102 3230 597 439 ----
NM_001004342chr1116054 5791 5349 5271 4337 1030 911 904 601 513 153 16107 45880 1938 1721 1390 --
NM_001004360chr221889 749 ------
NM_001004419chr121849 13455 ----
NM_001004720chr22671 663 ------
NM_001004722chr22840 832 ------
NM_001005158chr32404 341 ------
NM_001005159chr32404 341 ------
NM_001005266chr152212 65 ------
NM_001005267chr152212 65 ------
NM_001005268chr152212 65 ------
NM_001005269chr152212 65 ------
NM_001005271chr1721067 419 ------
NM_001005273chr1721067 419 ------
NM_001005335chr191295 ------
NM_001005366chr121755 1944 2761 684 --
NM_001005372chr172347 50 1501 ----
NM_001005375chrY41609 1218 1158 254 ------
NM_001005377chr19----1216 --
NM_001005386chr231764 958 388 11788 --12216
NM_001005404chr1793975 3758 3429 3142 3009 1748 1685 1118 343 13252 ----
NM_001005463chr1052634 903 823 770 654 22191 844 ----
NM_001005473chr586601 5560 4959 4734 2346 1727 386 377 12584 --1865
NM_001005474chr31186 ----1281
NM_001005502chr1284734 4270 3452 3439 3296 2064 1157 1039 --1976 --
NM_001005505chr321222 244 ------
NM_001005527chr351267 922 404 337 53 1391 ----
NM_001005609chrX43057 600 558 418 --33860 3733 502 --
NM_001005732chr211124 ------
NM_001005733chr212225 124 ------
NM_001005739chr2--1862 ----
NM_001005743chr1421368 1192 21270 1227 ----
NM_001005744chr1421368 1192 21270 1227 ----
NM_001005745chr1421368 1192 21270 1227 ----
NM_001005753chr262253 2061 932 307 164 65 ------
NM_001005781chr22385 225 ------
NM_001005782chr23834 674 60 ------
NM_001005849chr172599 38 ------
NM_001006115chr382634 2577 1865 991 489 448 315 92 --2958 807 --
NM_001006600chr532331 1690 389 --2719 480 --
NM_001006610chr161246 --2904 852 --
NM_001006612chrX3386 129 49 ------
NM_001006613chrX3386 129 49 ------
NM_001006614chrX3386 129 49 ------
NM_001006623chr262498 514 370 315 303 160 42410 1836 544 476 12360 --
NM_001006624chr121978 361 11691 ----
NM_001006626chr72648 526 1280 ----
NM_001006627chr72648 526 1280 ----
NM_001006628chr72648 526 1280 ----
NM_001006629chr72648 526 1280 ----
NM_001006630chr72648 526 1280 ----
NM_001006631chr72648 526 1280 ----
NM_001006632chr72648 526 1280 ----
NM_001006684chrX1417 1546 ----
NM_001006946chr241438 1301 1187 534 1729 11193 --
NM_001007024chr17104321 4307 4180 3685 3580 3458 3287 2722 386 350 24241 24 1249 --
NM_001007025chr17104321 4307 4180 3685 3580 3458 3287 2722 386 350 24241 24 1249 --
NM_001007026chr121483 ------
NM_001007075chr4--1844 ----
NM_001007097chr974419 4080 3206 1908 974 908 341 --13632 --
NM_001007098chr13712 653 316 ------
NM_001007099chr1--124 1320 --
NM_001007100chr1--124 1320 --
NM_001007102chr651272 621 329 215 182 11322 ----
NM_001007156chr1541517 1495 746 328 --11590 --
NM_001007226chr1761377 1292 1143 1118 566 98 ------
NM_001007227chr1761377 1292 1143 1118 566 98 ------
NM_001007228chr1761377 1292 1143 1118 566 98 ------
NM_001007229chr1761377 1292 1143 1118 566 98 ------
NM_001007230chr1761377 1292 1143 1118 566 98 ------
NM_001007237chr142377 2091 840 235 ------
NM_001007246chr2151927 1377 626 458 266 ------
NM_001007257chr1------1457
NM_001007267chr21169 ------
NM_001007278chr13124960 4415 3676 3440 3327 2110 1897 1633 877 686 333 30 13298 13530 1216
NM_001007466chr674571 4030 1188 672 514 361 300 25168 4267 1553 --
NM_001007553chr111001 11014 ----
NM_001007559chr1811617 1198 11650 --
NM_001007565chr31332 ------
NM_001007794chr11765 ------
NM_001008220chr52544 53 ------
NM_001008222chrX61182 1056 238 166 154 23 --1452 --
NM_001008225chr73593 585 87 ------
NM_001008226chr1521779 196 ------
NM_001008239chr1893687 3504 3133 3019 2989 2716 2389 1410 1312 1572 ----
NM_001008392chr353229 3090 1337 1047 232 21283 408 ----
NM_001008408chr7135434 5277 5082 4818 4714 4111 4038 3963 1333 1067 606 299 224 --25962 487 22568 2284
NM_001008491chr251970 1377 740 649 511 11952 11622 --
NM_001008492chr251970 1377 740 649 511 11952 11622 --
NM_001008495chr882012 1852 1843 1653 848 721 636 420 11742 ----
NM_001008529chr176935 883 451 101 94 35 148 ----
NM_001008530chr14123 --1452 --
NM_001008540chr21366 ------
NM_001008541chr1021771 1440 32027 608 278 ----
NM_001008541chr1021771 1440 32027 608 278 ----
NM_001008564chr1342119 1877 835 176 1417 ----
NM_001008660chr1131603 1266 398 ------
NM_001008701chr1943127 2821 2153 1117 --1626 --
NM_001008708chr21240 1520 ----
NM_001008726chr1421195 55 11683 ----
NM_001008738chr5102880 2837 2670 2628 2180 1835 1159 805 190 170 --1937 --
NM_001008784chr32221 24 ------
NM_001008860chr152154 98 --1751 --
NM_001008892chr152154 98 --1751 --
NM_001008894chr152154 98 --1751 --
NM_001008895chr131209 11058 1310 --
NM_001008925chr413432 2808 349 --22316 535
NM_001008938chr112386 331 ------
NM_001009552chr82462 49 ------
NM_001009555chr431519 1313 1136 ------
NM_001009565chr21438 ------
NM_001009566chr141204 963 591 193 ------
NM_001009567chr101580 ------
NM_001009571chr731129 539 239 ------
NM_001009880chr2294173 4048 4009 3997 3558 3339 3264 1314 649 23981 3723 14250 1429
NM_001009881chr11420 ------
NM_001009882chr11420 ------
NM_001009899chr396438 4432 4019 2473 2390 1862 1124 909 627 24641 2082 24263 1769 --
NM_001009960chr752436 2273 1143 1118 1040 --22829 1131 --
NM_001009996chr31136 ------
NM_001010000chr1853194 2819 2737 1283 344 12349 22572 991 --
NM_001010854chr142499 184 ------
NM_001010862chrX83300 2776 2421 1265 737 541 471 167 ------
NM_001010867chr1106040 5801 5660 5477 5173 4885 2452 1962 1744 1462 --16231 --
NM_001010888chrX53477 2900 1795 1494 1246 13194 ----
NM_001010891chr5186471 6263 5633 5489 5080 4522 4486 4248 2530 2486 2128 1065 769 698 576 546 438 424 35095 4676 1437 --14261
NM_001010895chr941557 1449 543 98 1692 ----
NM_001010898chr1103752 3335 3071 2673 2646 2542 2468 2287 999 373 175 --12810
NM_001010908chr101513 ------
NM_001010924chr102857 781 ------
NM_001010984chr152396 2016 1958 996 908 1961 ----
NM_001010986chrX41662 931 545 257 1882 --11641
NM_001010989chr161492 --1132 --
NM_001010990chr161492 --1132 --
NM_001011513chr422509 1414 11334 24054 3533 --
NM_001011537chr362172 2080 1893 1693 594 208 21507 24 11455 --
NM_001011553chr7--1907 --1152
NM_001011645chrX1162 ------
NM_001011666chr7166441 6297 5404 5094 4690 4653 4503 4411 4349 1925 1664 807 581 354 230 108 1423 ----
NM_001011708chr262847 1190 1183 1080 251 212 ------
NM_001011713chr1461576 1548 1158 1142 211 111 1481 11061 --
NM_001011720chr81582 --11307 --
NM_001011885chr1531542 525 449 21695 1505 ----
NM_001012333chr111318 --1247 --
NM_001012334chr111318 --1247 --
NM_001012337chr3191 ------
NM_001012393chr1185013 4108 3372 1755 1605 1311 1259 157 14658 ----
NM_001012398chr161713 ------
NM_001012418chr623569 3382 14296 13660 --
NM_001012420chr1562889 2851 2315 623 454 328 ------
NM_001012423chr1562889 2851 2315 623 454 328 ------
NM_001012426chr633097 2572 1043 ------
NM_001012427chr633097 2572 1043 ------
NM_001012507chr6143 122 ----
NM_001012514chr22972 431 ------
NM_001012516chr22972 431 ------
NM_001012614chr4----1254 --
NM_001012732chr461188 1005 399 299 267 161 ------
NM_001012751chr1021946 1298 11219 ----
NM_001012755chrX44729 4630 4371 4098 --34653 1563 1214 11135
NM_001012756chr1923117 1201 22458 743 12368 --
NM_001012761chr582135 1928 1027 927 880 444 388 192 ----12409
NM_001012968chrX102662 2096 2023 964 890 713 560 552 512 458 1188 12777 --
NM_001012977chrX21427 469 ------
NM_001012979chrX156 ------
NM_001012989chrX2455 257 ------
NM_001013031chr1053281 3032 2477 1257 336 --13269 --
NM_001013399chr61313 1192 --1268
NM_001013406chr72407 85 21515 1102 ----
NM_001013415chr42542 373 1242 ----
NM_001013437chr18167 ------
NM_001013438chr31183 ------
NM_001013439chr3129 ------
NM_001013620chr12128426 8334 8014 5704 5312 3122 2790 2581 936 928 645 431 36694 1538 490 12856 --
NM_001013635chr1241095 1041 805 342 --1112 --
NM_001013699chr121412 ------
NM_001013703chr151483 ------
NM_001013746chr762033 1568 581 497 417 165 11980 ----
NM_001013839chr1742094 673 243 170 22470 2322 22479 1672 --
NM_001013843chr153718 219 141 ------
NM_001014380chr1395824 5732 4664 4634 2117 1913 1547 1454 1372 11004 ----
NM_001014442chr131109 ------
NM_001014449chr161243 ------
NM_001014451chr161243 ------
NM_001014797chr10148179 7318 7230 6866 5475 5056 2958 2796 2204 2175 2036 1074 828 708 18047 ----
NM_001014809chr43925 700 131 ------
NM_001014839chr11133 11023 ----
NM_001014841chr11133 11023 ----
NM_001015048chr1463038 2363 2319 2266 541 462 23239 23 32533 725 283 1149
NM_001015049chr1463038 2363 2319 2266 541 462 23239 23 32533 725 283 1149
NM_001015877chrX93092 2893 2627 2578 2014 1091 1027 929 543 2644 492 21008 629 --
NM_001015880chr1031710 1649 36 11462 ----
NM_001015881chrX154 ------
NM_001015885chr201349 ------
NM_001015887chr341720 1255 670 317 ------
NM_001017365chr1155 ------
NM_001017366chr1155 ------
NM_001017367chr1155 ------
NM_001017368chr1782747 2718 2324 2016 998 783 483 179 --22563 235 --
NM_001017369chr42957 301 1894 --11102
NM_001017371chr231410 212 72 1415 ----
NM_001017395chr362711 2692 2638 2548 1069 965 22660 579 12685 --
NM_001017396chr24451 438 406 264 22110 1880 ----
NM_001017405chr41107 ------
NM_001017415chr13307 296 240 193 ----
NM_001017416chr13307 296 240 193 ----
NM_001017423chr101534 --180 --
NM_001017424chr141829 1227 352 56 ------
NM_001017425chr141829 1227 352 56 ------
NM_001017440chr7117641 7377 7069 6746 6215 3108 2513 2341 2329 1549 609 28284 1489 --17272
NM_001017916chr1751788 1513 1371 681 41 --11600 --
NM_001017917chr1751788 1513 1371 681 41 --11600 --
NM_001017920chr2----1118 --
NM_001017922chr121494 121 1570 11721 --
NM_001017923chr1421344 63 ------
NM_001017926chr841781 1504 1440 709 --11271 --
NM_001017930chrX3385 317 102 ----1970
NM_001017961chr1--1137 ----
NM_001017962chr101170 ------
NM_001017967chr162925 798 ------
NM_001017969chr91186 ------
NM_001017975chr12199 67 1190 ----
NM_001017995chr584678 4008 3363 2949 1731 745 426 131 13250 13476 --
NM_001018004chr151528 1673 ----
NM_001018006chr151528 1673 ----
NM_001018007chr151528 1673 ----
NM_001018008chr152267 211 ----1485
NM_001018020chr151528 1673 ----
NM_001018037chr951460 1373 1083 1011 505 ------
NM_001018038chr92166 109 ------
NM_001018041chr62367 256 ------
NM_001018053chr181743 1632 1432 1341 1327 681 607 344 21567 699 11970 --
NM_001018056chr92180 168 ------
NM_001018064chr91560 1313 ----
NM_001018065chr986009 5587 4720 4640 4306 3877 3720 2348 1547 15410 --
NM_001018066chr986009 5587 4720 4640 4306 3877 3720 2348 1547 15410 --
NM_001018067chr124832 276 24892 1887 34872 4675 57 15308
NM_001018068chr124832 276 24892 1887 34872 4675 57 15308
NM_001018069chr124832 276 24892 1887 34872 4675 57 15308
NM_001018074chr563952 3638 2937 2645 749 50 11008 ----
NM_001018075chr563952 3638 2937 2645 749 50 11008 ----
NM_001018076chr563952 3638 2937 2645 749 50 11008 ----
NM_001018077chr563952 3638 2937 2645 749 50 11008 ----
NM_001018078chr92194 80 ------
NM_001018108chr1582141 1861 1736 1582 1561 1489 146 28 ----11853
NM_001018111chr763673 2651 1437 978 601 191 12886 23766 2457 --
NM_001018676chr82125 32 ------
NM_001018677chr82125 32 ------
NM_001020658chr141643 1417 1165 438 11149 ----
NM_001020658chr141643 1417 1165 438 11149 ----
NM_001020818chr1951904 1722 1616 201 46 --1171 --
NM_001020819chr1951904 1722 1616 201 46 --1171 --
NM_001020820chr1951904 1722 1616 201 46 --1171 --
NM_001020821chr1951904 1722 1616 201 46 --1171 --
NM_001020825chr541427 1113 412 120 ------
NM_001023560chr61103 ------
NM_001023567chr1542281 615 456 356 --12243 --
NM_001023587chr331127 820 201 --1301 --
NM_001024024chr142803 381 --11061 --
NM_001024070chr142799 377 --11057 --
NM_001024071chr142771 349 --11029 --
NM_001024094chr563952 3638 2937 2645 749 50 11008 ----
NM_001024218chr143593 281 234 ------
NM_001024226chr14997 235 163 30 ------
NM_001024227chr14997 235 163 30 ------
NM_001024228chr14997 235 163 30 ------
NM_001024372chr821966 1823 ------
NM_001024401chr1621899 1050 ------
NM_001024455chrX52620 2532 314 232 42 --31917 1696 732 11958
NM_001024463chr1511092 ------
NM_001024593chr101838 2849 601 171 --
NM_001024647chr12136679 6251 5756 5637 4755 2752 1853 1825 1637 1210 1030 1019 116 ------
NM_001024649chr552869 2111 2030 2024 703 12963 --12290
NM_001024666chrX3482 455 248 1664 1676 --
NM_001024668chr122290 205 1657 2888 332 --
NM_001024808chr124494 466 369 88 ------
NM_001024809chr17147 ------
NM_001024855chr3----1162 --
NM_001024934chr6--1138 ----
NM_001024935chr6--1138 ----
NM_001024936chr6--1138 ----
NM_001024937chr17----196 --
NM_001024947chr52169 148 ------
NM_001024948chr193233 3215 2755 1260 1229 757 730 626 226 --22502 1349 --
NM_001024956chr11105769 5706 5403 5123 4316 1974 1706 1560 1452 436 35136 1933 865 14735 --
NM_001025068chr351692 1618 1133 653 507 21444 98 ----
NM_001025069chr351692 1618 1133 653 507 21444 98 ----
NM_001025076chr10136173 5471 5021 4875 4864 4305 3795 2238 2066 1574 1132 833 678 34246 1877 1660 --11793
NM_001025077chr10157531 6829 6379 6233 6222 5663 5153 4951 2932 2490 2191 2036 1227 1007 307 45604 4958 3018 764 ----
NM_001025079chr3124155 3739 3731 3460 3145 2691 2652 2576 1470 1391 1363 607 ------
NM_001025081chr1811142 11218 2556 370 --
NM_001025090chr1811142 11218 2556 370 --
NM_001025092chr1811142 11218 2556 370 --
NM_001025101chr1811142 11218 2556 370 --
NM_001025105chr531056 512 342 11258 ----
NM_001025108chr293042 2545 1351 1272 981 627 478 213 141 ------
NM_001025201chr22709 524 191 ----
NM_001025233chr1232673 849 425 ------
NM_001025252chr863153 2936 2615 2273 179 103 11010 13202 --
NM_001025253chr863153 2936 2615 2273 179 103 11010 13202 --
NM_001025266chr3144562 4375 4274 4224 4035 3292 3256 1612 1367 919 909 881 386 205 14104 23436 46 --
NM_001025356chr1252888 2805 2790 1086 847 11829 ----
NM_001025366chr651359 1349 1308 277 248 ------
NM_001025366chr651359 1349 1308 277 248 ------
NM_001025367chr651359 1349 1308 277 248 ------
NM_001025367chr651359 1349 1308 277 248 ------
NM_001025368chr651359 1349 1308 277 248 ------
NM_001025368chr651359 1349 1308 277 248 ------
NM_001025369chr651375 1365 1324 293 264 ------
NM_001025369chr651375 1365 1324 293 264 ------
NM_001025370chr651359 1349 1308 277 248 ------
NM_001025370chr651359 1349 1308 277 248 ------
NM_001025579chr1721078 330 ------
NM_001025580chrX63859 3837 3094 3030 939 69 33883 1276 541 13972 12629
NM_001025595chr461481 1322 1098 645 239 115 21121 1088 ----
NM_001025777chr221615 377 21605 124 ----
NM_001025780chr9138 --1312 --
NM_001029858chr6--13122 1773 --
NM_001029860chr81315 1306 ----
NM_001029863chr672785 2633 2083 2039 2008 837 698 ------
NM_001029875chr562996 2868 2782 2133 1167 728 11027 1373 --
NM_001029882chr13586 558 547 ------
NM_001029882chr13586 558 547 ------
NM_001029884chr642597 2218 2186 149 21944 1845 12513 --
NM_001030006chr1792631 2490 2351 1985 1075 587 418 286 221 2699 303 --1528
NM_001030007chr1663999 2985 1543 1381 1353 758 23403 1074 1699 --
NM_001030055chr1484738 4715 4614 4128 3757 3748 838 373 --33069 1220 1151 14683
NM_001030272chr112315 100 ------
NM_001030273chr112315 100 ------
NM_001031623chr641348 1114 553 341 21247 61 11569 1312
NM_001031677chr51343 ------
NM_001031679chr1243425 3171 289 136 13500 12945 --
NM_001031690chr793071 2780 2634 2566 1893 1013 660 427 355 --22652 813 --
NM_001031692chr71308 ------
NM_001031694chr12715 221 ------
NM_001031694chr12715 221 ------
NM_001031695chr22125383 5321 4879 4745 4624 4210 3572 3317 1054 627 215 171 --12183 23806 1747
NM_001031702chr32345 30 ------
NM_001031711chr541820 1370 1242 637 ------
NM_001031716chr22372 122 11145 ----
NM_001031717chr33856 399 37 ------
NM_001031723chr41371 ------
NM_001031732chr493611 2988 2796 1140 886 853 787 484 285 11259 12567 --
NM_001031801chr222452 171 ------
NM_001031804chr1693716 3355 3335 2854 2787 1084 1035 646 384 --11433 13623
NM_001031812chr532179 2129 308 --1676 --
NM_001031855chrX161 1207 ----
NM_001032221chr91164 --1452 --
NM_001032280chr611636 --11427 --
NM_001032282chr841305 1075 326 234 1885 ----
NM_001032288chr20--11452 11088 --
NM_001032296chr1382922 2705 2686 2197 2014 1996 729 247 --22756 2359 --
NM_001032363chr12892 164 --21713 1422 --
NM_001032363chr12892 164 --21713 1422 --
NM_001032367chr153445 142 90 ------
NM_001032380chr1031488 495 138 ------
NM_001032393chrX2571 136 ------
NM_001032394chr632591 2532 937 --1271 12155
NM_001032395chr632458 2399 804 --1138 12022
NM_001032999chr2054441 4357 3575 1169 852 23769 2135 14714 --
NM_001033025chr151548 597 578 528 365 1166 ----
NM_001033044chr151398 615 514 229 40 --21362 1209 --
NM_001033045chr244354 3987 3762 1138 11104 ----
NM_001033047chr431740 1622 955 11866 1160 --
NM_001033049chr2162167 2143 2025 1977 1923 1509 1367 ----
NM_001033056chr151398 615 514 229 40 --21362 1209 --
NM_001033057chr341881 1855 1838 1590 ------
NM_001033059chr631496 819 233 ------
NM_001033081chr141804 1761 1545 167 ------
NM_001033082chr141804 1761 1545 167 ------
NM_001033087chr2053175 2965 2690 2307 345 13060 1999 --
NM_001033112chr52721 87 ------
NM_001033117chr364038 3540 3427 3293 1589 1427 13590 ----
NM_001033503chr5192 ------
NM_001033507chr131486 720 712 --21812 334 --
NM_001033518chr782209 1953 1776 769 659 611 222 195 ------
NM_001033519chr782209 1953 1776 769 659 611 222 195 ------
NM_001033520chr782209 1953 1776 769 659 611 222 195 ------
NM_001033554chr17----137 --
NM_001033557chr231156 69 29 11327 ----
NM_001033561chr171787 1148 ----
NM_001033578chr842284 2251 1937 205 --1406 --
NM_001033602chr1322271 830 ----1258
NM_001033756chr651293 1283 1242 211 182 ------
NM_001033756chr651293 1283 1242 211 182 ------
NM_001033910chr132116 1398 32 31509 258 239 ----
NM_001033925chr1021903 763 ------
NM_001034837chr5199 1213 ----
NM_001034838chr5199 1213 ----
NM_001034841chr1665523 5466 4478 3738 1163 300 11646 14404 35203 4838 1861
NM_001034852chr142567 371 ------
NM_001034853chrX1955 1927 ----
NM_001034954chr1052660 2495 1156 792 281 12271 ----
NM_001034955chr1052660 2495 1156 792 281 12271 ----
NM_001034956chr1052660 2495 1156 792 281 12271 ----
NM_001034957chr1052660 2495 1156 792 281 12271 ----
NM_001034996chr3131 ------
NM_001035chr141276 1079 172 74 ------
NM_001035511chr152106 2070 2037 1993 560 --2464 207 1480
NM_001035512chr162213 2177 2144 2100 667 116 --2571 314 1587
NM_001035513chr162213 2177 2144 2100 667 116 --2571 314 1587
NM_001037131chr211007 ----11296
NM_001037132chr732147 1514 617 21922 223 ----
NM_001037133chr732147 1514 617 21922 223 ----
NM_001037164chr741679 1668 1492 220 ------
NM_001037165chr788880 8128 8106 6225 6052 2386 1900 975 --28338 1503 --
NM_001037174chr261894 1756 1407 845 777 358 ------
NM_001037331chr18------1186
NM_001037332chr521011 248 11840 ----
NM_001037333chr521011 248 11840 ----
NM_001037334chr184786 559 316 250 --1388 1772
NM_001037339chr141306 1299 584 550 --11183 --
NM_001037340chr141306 1299 584 550 --11183 --
NM_001037341chr141306 1299 584 550 --11183 --
NM_001037341chr141306 1299 584 550 --11183 --
NM_001037553chr2145188 4450 3966 1008 --14659 --
NM_001037582chr421704 72 ------
NM_001037637chr52248 72 ------
NM_001037872chr21479 ------
NM_001037954chr1173121 2994 2154 2140 773 680 456 1540 --11321
NM_001038493chr251592 1426 573 542 202 ------
NM_001038640chr152693 266 1873 ----
NM_001038707chr162225 2194 1925 1710 1440 780 ------
NM_001038707chr162225 2194 1925 1710 1440 780 ------
NM_001039350chr731228 547 33 11387 ----
NM_001039395chr952334 2289 2273 209 151 --12407 --
NM_001039465chr14199 1204 1333 --
NM_001039479chr1482230 2190 2080 1824 1558 806 684 227 1690 ----
NM_001039538chr232640 2625 2561 --22463 49 --
NM_001039547chr3127833 7268 7020 6475 5210 3101 2010 1302 1133 868 821 140 --12557 --
NM_001039570chr2284507 3528 3371 1731 1111 486 395 76 --14061 --
NM_001039571chr2284507 3528 3371 1731 1111 486 395 76 --14061 --
NM_001039574chr11248 ------
NM_001039577chr142872 1683 1331 165 31770 754 387 ----
NM_001039585chr1114244 4170 3958 3439 3177 3147 2860 2846 1570 1021 855 --12881 --
NM_001039590chrX2750 338 1294 13057 --
NM_001039591chrX2750 338 1294 13057 --
NM_001039618chr1175767 5715 5086 4239 4035 1927 538 54594 3905 3893 3877 2384 11592 --
NM_001039690chr164767 648 353 171 21874 1728 21884 1622 --
NM_001039693chr264109 4090 3945 3449 2792 988 13401 11203 --
NM_001039709chr2054441 4357 3575 1169 852 23769 2135 14714 --
NM_001039711chr11378 ------
NM_001039712chr11378 ------
NM_001039775chr1----137 --
NM_001039802chr111333 ------
NM_001039840chrX95543 4959 2346 1983 1473 463 448 425 133 11040 1416 --
NM_001039888chr15725 643 562 315 98 ------
NM_001039916chr123447 436 67 ------
NM_001039917chr123447 436 67 ------
NM_001039918chr123447 436 67 ------
NM_001039919chr123447 436 67 ------
NM_001039920chr123447 436 67 ------
NM_001039937chr1371567 1372 611 531 497 273 256 13044 12637 --
NM_001040001chr651873 1539 1428 650 481 ------
NM_001040002chr1731300 307 126 --11090 --
NM_001040020chr731595 1433 985 1132 ----
NM_001040057chr741502 991 485 103 1287 1974 --
NM_001040059chr171597 1115 ----
NM_001040110chr731618 1607 1570 1180 11340 --
NM_001040134chr192981 254 ----11476
NM_001040142chr252006 1864 1728 1588 622 --12216 --
NM_001040143chr252006 1864 1728 1588 622 --12216 --
NM_001040144chr164767 648 353 171 21874 1728 21884 1622 --
NM_001040146chr164767 648 353 171 21874 1728 21884 1622 --
NM_001040152chr774999 4582 4524 4340 1868 1607 695 ------
NM_001040158chr52416 399 ------
NM_001040167chr731209 1189 1092 --1845 --
NM_001040202chr432377 793 552 ------
NM_001040214chr621827 957 --12261 --
NM_001040260chr431049 790 742 11185 ----
NM_001040261chr431049 790 742 11185 ----
NM_001040272chr921764 548 ------
NM_001040284chr1685174 5119 4593 3687 1622 1526 1290 822 15325 21931 1209 --
NM_001040402chr463009 2034 1043 795 181 99 21269 975 --12827
NM_001040409chr21912 1385 1746 --
NM_001040427chr16141 ------
NM_001040429chr1393585 2870 2842 2311 1385 1249 156 122 35 22262 310 ----
NM_001040437chr6163 ------
NM_001040438chr6163 ------
NM_001040441chr121564 1088 --13690 --
NM_001040446chr542684 1823 772 330 1990 ----
NM_001040633chr71841 ------
NM_001040665chr7114737 4669 4594 4274 3989 3064 1897 1322 1203 910 356 24729 4252 14210 --
NM_001040697chr112464 229 1139 --1211
NM_001040708chr81974 ------
NM_001040709chr142148 835 229 193 11611 ----
NM_001040712chr983569 3512 3384 3258 2927 2709 2202 986 ------
NM_001040875chr842671 2282 1958 1885 12333 ----
NM_001040876chr431438 604 208 ------
NM_001042355chr1665239 3352 1859 753 708 402 34674 4518 3632 1160 --
NM_001042357chr1041298 462 387 114 ------
NM_001042358chr1041298 462 387 114 ------
NM_001042360chr1041298 462 387 114 ------
NM_001042363chr1041298 462 387 114 ------
NM_001042388chr182848 792 1901 ----
NM_001042389chr1041298 462 387 114 ------
NM_001042390chr1041298 462 387 114 ------
NM_001042392chr1041298 462 387 114 ------
NM_001042395chr1041298 462 387 114 ------
NM_001042404chr121848 240 ------
NM_001042406chr61253 ------
NM_001042412chr1665239 3352 1859 753 708 402 34674 4518 3632 1160 --
NM_001042413chr944135 3517 133 57 ------
NM_001042424chr453287 827 780 512 367 ------
NM_001042425chr611636 --11427 --
NM_001042453chrX4636 403 258 101 --1376 --
NM_001042473chr1051764 1622 555 344 109 1573 12060 --
NM_001042476chr1652015 1984 1533 598 511 --11547 --
NM_001042481chr1482314 2245 2084 1855 662 317 114 68 ------
NM_001042486chr2031391 251 159 ------
NM_001042492chr1743134 2138 214 45 22375 320 ----
NM_001042494chr1553809 3580 3017 1183 897 23266 131 12538 23787 3284
NM_001042495chr1553809 3580 3017 1183 897 23266 131 12538 23787 3284
NM_001042496chr1553809 3580 3017 1183 897 23266 131 12538 23787 3284
NM_001042497chr1553809 3580 3017 1183 897 23266 131 12538 23787 3284
NM_001042506chrX31388 579 469 11435 ----
NM_001042510chr841595 842 149 80 1835 11763 --
NM_001042511chr841595 842 149 80 1835 11763 --
NM_001042517chr133250 159 81 1725 1679 --
NM_001042537chrX42245 1735 967 450 --12159 --
NM_001042543chr421505 1388 --11294 --
NM_001042555chr12114756 4450 4390 4366 4244 3576 3523 1850 1466 484 336 23275 360 ----
NM_001042599chr2117713 7686 7283 7065 6604 6542 6143 5242 5138 2118 1110 36820 2916 1563 17720 --
NM_001042601chr342881 2470 1000 625 33204 2983 839 --13177
NM_001042603chr12135137 5041 5025 4705 4288 4126 3873 1568 1506 1496 1302 962 881 24262 3901 21406 344 14713
NM_001042604chr384419 4394 3535 3192 3036 915 855 506 --14000 --
NM_001042616chr41170 --144 --
NM_001042646chr35616 531 350 217 52 1321 ----
NM_001042663chr121063 417 --1411 --
NM_001042664chr121063 417 --1411 --
NM_001042665chr121063 417 --1411 --
NM_001042681chr142245 2231 1935 525 --143 --
NM_001042682chr142245 2231 1935 525 --143 --
NM_001042682chr142245 2231 1935 525 --143 --
NM_001042683chr621436 1139 --11355 --
NM_001042728chr122999 426 --1856 --
NM_001042749chrX31921 1755 282 11725 --21380 262
NM_001042750chrX31921 1755 282 11725 --21380 262
NM_001042751chrX31921 1755 282 11725 --21380 262
NM_001042762chr731029 882 230 11095 ----
NM_001043318chr14114136 4051 4003 3920 3622 2694 2559 1621 1262 947 612 14128 11167 11248
NM_001043351chr121427 383 ----12070
NM_001044305chr641567 1530 623 480 --11608 --
NM_001044385chr232676 1166 844 23358 886 ----
NM_001044722chr532179 2129 308 --1676 --
NM_001044723chr532179 2129 308 --1676 --
NM_001046chr532965 2463 1151 11893 --11181
NM_001049chr1432447 1511 611 ------
NM_001068chr33288 74 52 ------
NM_001071775chr1331679 1201 565 1579 ----
NM_001078chr11711 ------
NM_001083620chr462630 2586 1687 1633 587 209 2461 186 ----
NM_001083621chr194733 4248 2953 1765 1383 1051 783 747 655 ----11801
NM_001092chr1761573 832 487 426 339 155 --12352 --
NM_001094chr174769 720 660 301 ------
NM_001100108chr1148190 7626 6987 6048 5989 5947 5747 2493 2326 2222 1806 1201 816 804 37538 6838 1024 21501 75 15085
NM_001105518chr12897 78 1247 1803 --
NM_001106chr3249126 8428 7669 7599 7255 7034 6842 6740 6222 6126 3792 3673 3216 3183 3116 3076 2939 2699 2680 2444 1841 1717 1017 1007 17402 11549 --
NM_001113490chrX43360 2476 647 43 --22423 72 12968
NM_001116chr1673047 2417 1994 1889 1227 997 373 ------
NM_001117chr1832403 2312 2168 ------
NM_001119chr411411 ------
NM_001121chr1041895 1799 1711 1600 11276 ----
NM_001122679chr52971 858 ------
NM_001126chr11350 1942 ----
NM_001128chr1663999 2985 1543 1381 1353 758 23403 1074 1699 --
NM_001135chr15295 87 ------
NM_001146chr842318 1997 1906 866 ----1148
NM_001148chr421943 441 ------
NM_001149chr101425 ------
NM_001152chrX--171 ----
NM_001157chr102635 227 ------
NM_001160chr1282760 2742 2308 1096 1049 404 164 94 1796 --11727
NM_001167chrX94724 4601 2627 2456 2234 1522 1460 885 34 24855 170 ----
NM_001173chr1484738 4715 4614 4128 3757 3748 838 373 --33069 1220 1151 14683
NM_001178chr112315 100 ------
NM_001191chr2021430 1106 1520 ----
NM_001198chr662341 2219 2181 2169 2064 886 12146 ----
NM_001200chr2031079 971 794 ------
NM_001201chr483846 3723 3536 2837 877 853 486 320 13017 11102 1478
NM_001204chr2187736 7582 7434 7416 7399 7345 7289 7070 6931 6919 6614 5366 4726 2115 1353 543 493 214 35814 2674 618 17493 --
NM_001206chr942970 2056 1050 125 32869 561 544 22285 271 11100
NM_001207chr52248 72 ------
NM_001219chr721556 339 32207 1585 866 --11827
NM_001227chr102415 157 21275 1267 --174
NM_001238chr19187 ------
NM_001241chr232037 1593 484 21552 921 11509 1460
NM_001241chr232037 1593 484 21552 921 11509 1460
NM_001251chr171597 1115 ----
NM_001256chr1792725 2518 2415 625 441 372 363 202 57 187 12180 --
NM_001257chr1651505 1265 1186 1056 544 ------
NM_001259chr7125585 5247 5014 4965 4892 4749 2292 1712 1596 1330 826 805 45951 5755 4302 397 11950 12464
NM_001262chr12277 259 --1337 --
NM_001265chr132329 220 ------
NM_001270chr51413 ------
NM_001271chr1543258 2297 2007 350 23252 2229 1564 --
NM_001273chr12157 1560 ----
NM_001275chr142400 321 ------
NM_001278chr1021184 365 1484 ----
NM_001280chr192676 446 ----1590
NM_001282chr1792631 2490 2351 1985 1075 587 418 286 221 2699 303 --1528
NM_001284chr51103 --2177 109 --
NM_001290chr44904 871 434 207 ------
NM_001299chr19----152 --
NM_001300chr10--1145 ----
NM_001304chr1783585 3035 1453 1343 1184 1113 92 58 ------
NM_001310chr1242019 1229 907 81 22289 1964 ----
NM_001313chr43925 700 131 ------
NM_001315chr662140 1696 1473 1451 264 90 21547 847 22129 370 1881
NM_001316chr203402 367 335 197 ----
NM_001319chr1911105 ------
NM_001326chr11146 --2385 95 1142
NM_001328chr4----1254 --
NM_001329chr101286 --11283 --
NM_001331chr11112305 2093 1966 1892 1878 1863 1786 823 498 318 284 11854 11936 --
NM_001332chr551533 1142 983 479 472 1611 11586 --
NM_001343chr541102 652 287 167 11337 11358 --
NM_001344chr141242 ------
NM_001346chr342637 2205 621 542 ------
NM_001351chr321128 159 ------
NM_001356chrX31955 1649 517 --12546 --
NM_001358chr42116 78 ------
NM_001364chr11114228 4208 3809 2952 2910 2898 1444 1040 860 348 80 1449 11585 --
NM_001365chr171618 1787 ----
NM_001380chr104852 776 678 127 ------
NM_001383chr172275 183 2657 172 ----
NM_001385chr81325 ------
NM_001386chr841910 1730 1709 791 ------
NM_001389chr213545 481 172 ------
NM_001390chr1853166 2780 2693 1213 982 13334 13202 23011 2299
NM_001391chr1821028 281 --147 --
NM_001396chr2162666 1123 1109 975 891 28 11828 1903 --
NM_001399chrX43057 600 558 418 --33860 3733 502 --
NM_001400chr161323 1116 930 865 492 34 11014 ----
NM_001401chr93536 474 38 --31567 1368 244 --
NM_001402chr611492 31868 392 377 ----
NM_001406chr1751238 477 434 346 41 ------
NM_001407chr351467 1067 491 484 268 ----11572
NM_001408chr141468 1327 1164 1054 ------
NM_001412chrX93402 3329 3219 2947 2889 2448 536 285 206 1371 ----
NM_001416chr17----1191 --
NM_001417chr1261630 1387 1358 464 233 21 --1681 --
NM_001419chr19124817 4601 4448 4346 4154 3910 3508 1380 1172 1139 1025 64 14319 1991 --
NM_001420chr1932569 2108 2081 1650 12417 12472
NM_001427chr721753 1469 12103 ----
NM_001429chr22--1774 ----
NM_001430chr23640 359 228 ------
NM_001431chr64958 912 318 246 ------
NM_001432chr473886 3485 3346 1444 1356 1167 849 13431 ----
NM_001438chr123111 798 23688 497 ----
NM_001439chr151548 597 578 528 365 1166 ----
NM_001448chrX31295 385 85 ------
NM_001449chrX41223 1020 519 48 ------
NM_001451chr1621278 520 ------
NM_001453chr661527 1475 1301 605 375 330 ------
NM_001457chr321302 255 1167 245 33 --
NM_001458chr71682 ------
NM_001460chr133544 3033 151 ------
NM_001463chr23709 259 154 ------
NM_001465chr52822 520 --11344 --
NM_001483chr71409 ------
NM_001491chr652735 1807 1095 882 75 31885 1040 236 ----
NM_001493chrX3582 300 175 ------
NM_001494chr102653 230 --190 --
NM_001497chr942172 1887 831 583 1236 ----
NM_001498chr62544 371 ------
NM_001514chr11204 128 --1433
NM_001518chr73843 414 48 ------
NM_001530chr1431102 180 165 ------
NM_001533chr191295 ------
NM_001542chr142377 2091 840 235 ------
NM_001543chr564623 4598 4535 3751 962 467 ------
NM_001546chr631438 1219 227 ------
NM_001553chr4----166 --
NM_001554chr1--1135 1550 --
NM_001560chrX22284 335 12019 22392 1632 --
NM_001565chr42261 109 ------
NM_001584chr112446 104 ------
NM_001604chr111817 ------
NM_001609chr1074177 4158 4109 3683 3669 3437 1193 ------
NM_001616chr283364 2783 2382 1385 983 763 287 110 22284 239 12732 --
NM_001617chr231230 1113 1019 11293 ----
NM_001620chr111540 --1308 --
NM_001621chr772964 2577 1867 1037 496 461 158 ------
NM_001621chr772964 2577 1867 1037 496 461 158 ------
NM_001622chr3----1317 --
NM_001634chr631496 819 233 ------
NM_001635chr73258 89 76 ------
NM_001642chr1121138 431 ------
NM_001650chr1893549 2975 2893 2546 1341 1013 870 476 227 14104 --13611
NM_001655chr1122096 1646 21554 866 ----
NM_001658chr14997 235 163 30 ------
NM_001659chr1242461 1739 1023 344 ------
NM_001660chr3----2683 266 --
NM_001663chr1462731 2426 1790 967 393 168 1103 2321 278 --
NM_001664chr33916 312 276 1200 ----
NM_001665chr11----1398 --
NM_001668chr161934 1922 1823 1786 476 210 --32209 1735 858 --
NM_001677chr11713 --11111 --
NM_001679chr32766 514 ------
NM_001682chr1262765 2250 1128 844 191 95 --1913 --
NM_001683chr332482 1845 1703 ------
NM_001684chr1124165 4049 3768 3591 3238 1031 827 794 670 571 562 295 22875 736 --13636
NM_001685chr211102 ----1152
NM_001693chr851179 1111 955 439 64 --130 --
NM_001699chr1911440 ------
NM_001701chr931567 1475 564 ------
NM_001704chr61609 ------
NM_001706chr31371 ------
NM_001709chr1132652 2471 459 12356 32566 1959 431 1821
NM_001714chr121578 ------
NM_001717chr1521377 36 11022 ----
NM_001718chr641246 1100 388 273 11297 ----
NM_001730chr1321393 605 1628 ----
NM_001730chr1321393 605 1628 ----
NM_001740chr161511 ------
NM_001743chr22507 31 ------
NM_001745chr55465 365 316 296 234 --1767 --
NM_001746chr552869 2111 2030 2024 703 12963 --12290
NM_001753chr711399 1594 ----
NM_001754chr2193696 3466 2940 2754 1516 863 665 657 596 ----1870
NM_001755chr1641994 1832 805 526 --12257 --
NM_001759chr12144961 4830 4601 3758 3582 3413 3395 3333 3273 1851 1108 1049 607 75 14771 12040 14527
NM_001768chr21446 2868 50 ----
NM_001773chr111287 --1506 --
NM_001777chr3124155 3739 3731 3460 3145 2691 2652 2576 1470 1391 1363 607 ------
NM_001788chr7--1907 --1152
NM_001789chr321484 565 ------
NM_001791chr111333 ------
NM_001792chr1831078 948 402 --1383 --
NM_001797chr162675 548 1520 ----
NM_001798chr121965 --11099 1437
NM_001799chr5--1227 ----
NM_001800chr193491 196 80 ------
NM_001806chr19112890 2714 2526 2484 2359 2350 2260 2127 1994 931 280 11131 1365 --
NM_001822chr22709 524 191 ----
NM_001826chr1190 1161 ----
NM_001827chr92251 195 ------
NM_001829chr41678 ------
NM_001830chrX83493 3409 3285 3259 3009 1577 577 119 --1835 1440
NM_001833chr9292 60 ------
NM_001839chr13659 282 268 ------
NM_001842chr91108 ------
NM_001845chr1321312 359 1232 ----
NM_001854chr1--1233 --11032
NM_001858chr694210 3520 3495 1925 1785 1414 1075 286 94 --24081 1464 --
NM_001859chr951583 948 457 319 90 11310 32890 819 300 --
NM_001873chr43653 578 474 ------
NM_001874chr1284734 4270 3452 3439 3296 2064 1157 1039 --1976 --
NM_001880chr21209 ------
NM_001892chr531056 512 342 11258 ----
NM_001894chr2221132 201 ------
NM_001895chr2031152 902 422 ------
NM_001902chr12380 284 ------
NM_001903chr52615 181 ------
NM_001904chr3----1247 --
NM_001915chr1751788 1513 1371 681 41 --11600 --
NM_001920chr121307 1208 ----
NM_001921chr461188 1005 399 299 267 161 ------
NM_001923chr112590 84 ------
NM_001931chr1131225 435 85 ------
NM_001935chr21738 ------
NM_001936chr731228 547 33 11387 ----
NM_001938chr121900 1716 ------
NM_001939chrX31479 1195 670 22873 1454 12342 --
NM_001940chr121483 ------
NM_001945chr5----11245 --
NM_001946chr123359 331 56 ------
NM_001949chr653152 2801 2086 790 528 --12815 --
NM_001951chr81126 ------
NM_001964chr54778 746 434 245 1446 ----
NM_001965chr22437 76 ------
NM_001967chr3----1165 --
NM_001969chr14103921 3316 3310 2687 1389 1040 1019 969 395 306 --1887 --
NM_001975chr122789 162 ------
NM_001977chr42590 113 2685 381 ----
NM_001980chr1262166 1739 1730 1499 673 362 1881 ----
NM_001981chr151940 1783 915 891 391 11474 1264 --
NM_001982chr1241072 1008 348 146 ----1328
NM_001987chr12114189 3687 3549 2965 1707 1376 702 627 617 572 139 34096 4025 3536 ----
NM_001992chr52503 133 ------
NM_001993chr13782 366 251 2357 131 ----
NM_001995chr431072 577 138 ------
NM_001999chr541524 508 314 107 ------
NM_002006chr4115833 5791 4034 3553 1584 1396 1122 1114 1102 523 286 11194 11743 11034
NM_002009chr1582782 2716 2149 1819 1012 888 867 855 ------
NM_002010chr132384 69 ------
NM_002015chr1363328 2935 2306 630 464 107 --23181 1341 --
NM_002017chr114341 165 132 100 ------
NM_002024chrX21830 219 --11671 --
NM_002025chrX118941 8885 8442 6985 6820 6251 6231 1788 629 466 129 48357 2215 1179 799 16966 --
NM_002026chr22991 91 ------
NM_002027chr82125 32 ------
NM_002028chr1441281 136 125 24 ------
NM_002039chr41758 162 2885 351 --
NM_002040chr2153037 3016 2215 148 62 --11970 --
NM_002045chr31290 ------
NM_002048chr92839 214 ------
NM_002049chrX149 --1120 --
NM_002056chr22872 58 ------
NM_002061chr131522 1216 609 ------
NM_002062chr62423 296 --11471 --
NM_002063chrX5361 352 333 256 30 ------
NM_002065chr151398 615 514 229 40 --21362 1209 --
NM_002067chr192271 222 ------
NM_002068chr191666 ------
NM_002069chr72614 583 11373 ----
NM_002072chr941014 951 933 903 1761 ----
NM_002074chr121670 1098 ------
NM_002076chr1263023 2985 2238 2180 1114 308 32564 789 391 --43119 904 700 296
NM_002077chr952149 814 761 498 471 12094 ----
NM_002081chr211385 11755 ----
NM_002086chr1732007 1569 436 ------
NM_002087chr171241 ------
NM_002092chr4103927 3283 1878 1798 1622 1207 890 739 351 63 ------
NM_002095chr8197 --154 --
NM_002114chr6125 1130 ----
NM_002126chr1764029 3262 2664 2580 1446 1276 11047 2455 220 11262
NM_002128chr1332344 522 30 22048 504 3597 528 267 --
NM_002130chr531598 1549 1410 ------
NM_002133chr222577 76 ------
NM_002137chr721849 266 1803 11993 12076
NM_002138chr41656 ------
NM_002139chrX1205 --1153 --
NM_002141chr7143 ------
NM_002143chr12748 53 ------
NM_002146chr1741387 1370 944 171 11440 ----
NM_002148chr21112 ------
NM_002151chr192260 92 ------
NM_002158chr223171 572 12729 ----
NM_002166chr21511 ------
NM_002182chr362738 2205 2197 2177 1995 232 --11021 --
NM_002193chr221452 524 ------
NM_002196chr2041020 336 329 193 2871 184 ----
NM_002196chr2041020 336 329 193 2871 184 ----
NM_002198chr52287 194 --1658 --
NM_002199chr45963 890 781 361 37 ------
NM_002202chr5----1869 --
NM_002211chr1021088 218 1791 ----
NM_002214chr7105238 4334 4092 3639 3520 1194 1153 1095 1069 566 25277 1616 ----
NM_002222chr311066 11087 ----
NM_002223chr1222938 1087 --21444 608 --
NM_002227chr12903 382 ------
NM_002229chr192494 455 ------
NM_002230chr173445 171 40 1748 1946 --
NM_002240chr21295 85 ------
NM_002242chr231564 1294 495 11385 ----
NM_002245chr1--1632 ----
NM_002247chr1042357 2104 675 645 1843 ----
NM_002249chr12456 414 ------
NM_002253chr42988 73 ------
NM_002254chr242177 2065 570 159 ------
NM_002264chr394522 4240 1703 1016 775 517 483 318 59 11051 1757 13091
NM_002265chr172339 329 158 ----
NM_002267chr1322390 1815 12025 1693 --
NM_002268chr31534 ------
NM_002269chr61350 ------
NM_002270chr564845 3956 3797 2165 1595 451 25488 3733 1593 --
NM_002271chr1352254 2155 1642 883 531 --12162 --
NM_002274chr171251 ------
NM_002285chr293042 2545 1351 1272 981 627 478 213 141 ------
NM_002293chr162469 2407 1048 876 577 394 2784 129 --12065
NM_002310chr5136447 5659 5441 4866 2266 2181 1809 734 691 229 158 81 44 36132 4162 4147 11316 --
NM_002312chr131684 ------
NM_002313chr10144877 4856 4800 4713 4116 3575 3378 3239 1868 1698 1218 1134 947 248 44915 4132 3779 496 23746 2047 --
NM_002317chr5--1305 ----
NM_002336chr12114969 4868 4051 3723 3594 3372 1669 1544 1391 1264 879 --14525 14093
NM_002351chrX51711 556 465 294 165 11493 ----
NM_002355chr1231418 1058 478 1268 2255 114 1133
NM_002356chr642748 2698 2515 1952 12291 ----
NM_002359chr1764157 1240 1144 1092 936 252 --33764 3199 1285 --
NM_002360chr732509 2252 980 --22635 2106 --
NM_002372chr5251 39 1569 ----
NM_002373chr1511269 --1991 --
NM_002374chr232640 2625 2561 --22463 49 --
NM_002382chr141277 --1157 --
NM_002385chr1811142 11218 2556 370 --
NM_002387chr554622 4292 4043 3226 207 1736 14742 --
NM_002389chr131965 1628 30 21997 152 1588 --
NM_002391chr111318 --1247 --
NM_002395chr641417 604 517 431 --1984 --
NM_002397chr551943 1825 1430 745 36 ------
NM_002398chr22403 267 ------
NM_002399chr151446 ------
NM_002403chr1174 ------
NM_002408chr142729 590 ------
NM_002430chr2221765 277 12040 ----
NM_002438chr101580 ------
NM_002442chr121255 --1355 --
NM_002449chr52357 196 1976 ----
NM_002451chr963247 3237 2906 1307 1268 1245 --13035 1944
NM_002467chr81402 ------
NM_002473chr2241002 384 288 92 ------
NM_002478chr111454 1115 ----
NM_002480chr1271359 1340 1034 572 545 470 371 ------
NM_002482chr1164 --1461 --
NM_002486chr932307 2277 88 --12539 --
NM_002487chr153562 251 134 --1237 --
NM_002498chr13------1147
NM_002499chr1552445 2010 1810 1543 648 --11536 --
NM_002500chr21212 ------
NM_002501chr1911314 11578 ----
NM_002507chr1731935 1849 492 ------
NM_002515chr1421702 1644 1196 ----
NM_002518chr231196 997 205 --2220 103 1387
NM_002523chr73922 780 84 ------
NM_002524chr12261 228 ------
NM_002526chr61639 21467 520 ----
NM_002537chr1541022 870 796 684 --1757 --
NM_002538chr51477 --1228 1170
NM_002540chr92628 438 1664 1695 --
NM_002545chr1185013 4108 3372 1755 1605 1311 1259 157 14658 ----
NM_002547chrX53576 2968 1367 1170 963 22962 1381 14056 13652
NM_002553chr72495 92 ------
NM_002556chr1151634 814 626 293 287 21316 115 ----
NM_002568chr81419 ------
NM_002569chr1521482 1296 --1346 --
NM_002572chr112342 294 ------
NM_002574chr11252 ------
NM_002575chr181111 ------
NM_002577chr384053 3895 3886 2974 2884 1063 964 423 21297 448 21562 458 --
NM_002578chrX2372 106 ------
NM_002579chr192981 254 ----11476
NM_002581chr985398 5060 4863 4155 4128 3906 1471 1197 --24110 2017 --
NM_002583chr122545 470 ------
NM_002586chr611019 ------
NM_002588chr531762 1533 475 ------
NM_002592chr20137 ------
NM_002595chr1271960 1943 1770 1715 1580 1524 82 ------
NM_002600chr141306 1299 584 550 --11183 --
NM_002601chr21175 ------
NM_002607chr721286 416 ------
NM_002610chr263135 2719 2454 2393 1174 813 12829 2795 39 12687
NM_002613chr1695066 4252 3994 3549 2114 1632 1084 539 429 --11878 --
NM_002628chr32861 390 ------
NM_002629chr102775 617 ------
NM_002633chr12468 389 ------
NM_002635chr121128 ------
NM_002636chr61460 ------
NM_002641chrX1192 11965 175 --
NM_002643chr21133 ------
NM_002645chr1132633 1959 554 12906 --12043
NM_002648chr641331 1003 859 31 ------
NM_002651chr12833 345 ------
NM_002653chr51176 ------
NM_002655chr845252 1487 1127 155 24301 362 24677 107 --
NM_002656chr631078 950 886 1994 ----
NM_002657chr2073772 3694 3324 1527 1439 1420 338 1983 ----
NM_002660chr20169 ------
NM_002666chr1541069 1008 917 189 ------
NM_002668chrX1142 ------
NM_002670chr331613 601 581 1556 11507 --
NM_002677chr842800 2524 1900 29 12156 1104 --
NM_002687chr142450 157 151 1360 --
NM_002689chr111325 ------
NM_002693chr153323 313 86 ------
NM_002698chr1942365 2249 2205 884 180 ----
NM_002701chr6196 ----1192
NM_002702chr122943 796 --1378 1385
NM_002706chr2--1610 ----
NM_002709chr273563 3101 2844 2390 2289 1429 862 22998 2543 ----
NM_002710chr122739 228 --1404 --
NM_002711chr74736 730 333 318 1109 ----
NM_002713chr141079 1036 881 249 --1905 --
NM_002714chr6154 ------
NM_002715chr561243 1185 912 468 271 162 ------
NM_002716chr1193276 3142 1415 989 916 854 221 65 38 1379 ----
NM_002717chr81244 ------
NM_002718chr352644 1881 281 85 53 1262 ----
NM_002719chr1482016 1783 1598 926 620 505 107 40 11765 --1846
NM_002721chr94379 362 117 58 ------
NM_002727chr10------1202
NM_002731chr172901 2890 2749 2575 1950 560 494 ------
NM_002734chr1741783 853 285 142 1675 ----
NM_002737chr17126599 6195 6047 5830 4710 4428 2239 1972 1843 1669 1526 955 16233 26384 1372 --
NM_002738chr16--11054 ----
NM_002740chr362545 2424 2147 2035 465 129 1888 ----
NM_002742chr142753 608 ------
NM_002745chr22114278 4264 4120 3602 3524 3312 1554 1528 659 159 54 33807 1316 490 12955 169
NM_002748chr15----1128 --
NM_002752chr51546 ------
NM_002753chr41163 ------
NM_002755chr151150 --159 --
NM_002756chr172695 668 ------
NM_002758chr171491 ------
NM_002763chr13509 420 167 --1219 --
NM_002764chrX3959 699 22 2858 278 ----
NM_002767chr17--1223 1431 --
NM_002775chr101394 2153 100 ----
NM_002787chr72637 214 ------
NM_002791chr14----1160 --
NM_002796chr1182 ------
NM_002797chr142203 32 ------
NM_002806chr141231 ------
NM_002808chr31112 ------
NM_002811chr164344 141 77 21 ------
NM_002821chr61655 ----1611
NM_002822chr122339 50 11127 ----
NM_002823chr21231 ------
NM_002825chr7--1611 ----
NM_002827chr2021455 1410 31246 1196 452 ----
NM_002830chr21294 ------
NM_002833chr1541491 1147 212 113 ------
NM_002837chr1264369 4301 3595 3542 1564 746 24516 4235 11686 12804
NM_002839chr983569 3512 3384 3258 2927 2709 2202 986 ------
NM_002840chr111259 21628 459 ----
NM_002843chr1143398 3263 2486 894 13136 ----
NM_002844chr61550 11166 ----
NM_002845chr182624 122 ------
NM_002848chr1221085 187 ------
NM_002849chr122828 34 ------
NM_002850chr192786 780 ------
NM_002851chr71696 ------
NM_002855chr1143485 3454 2659 1057 11364 ----
NM_002858chr121215 243 ------
NM_002860chr101534 --180 --
NM_002868chr1242303 2087 1906 1827 --1382 1400
NM_002869chr1152166 2129 1914 743 389 1570 ----
NM_002871chr12323 96 ------
NM_002874chr942242 2231 2058 841 22342 630 21832 243 1812
NM_002881chr251422 1178 914 509 82 11337 ----
NM_002886chr3115194 3638 3437 3305 3298 1236 978 932 654 223 78 23943 2000 15200 --
NM_002890chr5----2822 82 --
NM_002891chr151131 ------
NM_002892chr1431639 244 166 ------
NM_002893chrX--1352 ----
NM_002894chr18----1153 --
NM_002897chr23766 727 27 1622 --1119
NM_002902chr15163 ------
NM_002906chr1182323 1742 1735 829 730 201 153 27 ------
NM_002907chr121416 2321 156 ----
NM_002912chr6174 ------
NM_002926chr421171 140 --1236 --
NM_002931chr61304 ------
NM_002940chr431438 604 208 ------
NM_002941chr331165 315 275 ------
NM_002942chr34347 291 210 175 ------
NM_002943chr151125 ------
NM_002945chr171850 ----1110
NM_002948chr31918 1106 --11242
NM_002951chr20------1255
NM_002955chr611628 11808 1378 --
NM_002959chr1104120 3726 3526 3076 2925 2824 1227 786 498 278 ------
NM_002968chr1621010 145 1930 1857 --
NM_002971chr32745 315 ------
NM_002973chr121123 ------
NM_002977chr252960 2281 1186 1170 912 23277 69 ----
NM_002979chr1--124 1320 --
NM_002994chr431829 1755 495 1527 ----
NM_002996chr1631762 528 423 ------
NM_002997chr241438 1301 1187 534 1729 11193 --
NM_002998chr85863 813 704 453 423 --21402 59 --
NM_003001chr162213 2177 2144 2100 667 116 --2571 314 1587
NM_003010chr1762434 2364 2333 2232 697 230 ------
NM_003011chr951562 1475 475 374 102 ----1124
NM_003012chr813157 --22685 138 --
NM_003013chr43831 716 138 ------
NM_003016chr1732039 2027 247 ------
NM_003017chr641212 1175 967 892 1144 --1906
NM_003020chr152298 172 ------
NM_003022chrX152 --1465 --
NM_003026chr92976 213 132 1406 --
NM_003027chr152176 115 ------
NM_003029chr131433 1384 521 11047 31120 543 481 --
NM_003030chr351772 1622 1363 1351 352 ------
NM_003031chr161246 --2904 852 --
NM_003034chr1266078 5502 5081 2962 2576 639 45617 5146 2091 1038 26858 6388 --
NM_003035chr13829 296 112 --1337 --
NM_003036chr11290 ------
NM_003042chr352009 1775 1381 486 340 --11419 --
NM_003043chr374281 4232 3814 3380 1735 1375 384 12778 14174 11291
NM_003051chr12666 252 11566 --11653
NM_003060chr5--21076 116 ----
NM_003069chrX2270 190 ------
NM_003070chr92700 572 ----2628 253
NM_003071chr341397 822 309 258 1347 ----
NM_003074chr382100 1761 1742 1521 577 535 342 82 11844 ----
NM_003079chr175775 650 408 196 100 --1127 --
NM_003081chr203181 171 60 --1349 1890
NM_003082chr141128 ------
NM_003095chr122379 283 ------
NM_003104chr1511234 195 11011 --
NM_003106chr3----1818 --
NM_003107chr642197 1987 654 490 11676 ----
NM_003108chr2217271 6854 6604 6574 6040 5666 5530 5142 5108 5053 4872 4740 4653 4477 2580 2130 1800 1000 610 500 22 37203 5415 1044 16480 --
NM_003110chr1721098 964 ------
NM_003111chr231410 212 72 1415 ----
NM_003112chr731988 1037 113 --12080 --
NM_003113chr2127 2816 809 1259 --
NM_003114chr82781 174 ------
NM_003115chr13466 425 42 ------
NM_003128chr262443 2226 1130 1099 1059 584 22078 435 ----
NM_003129chr82115 62 1286 ----
NM_003130chr731120 925 256 ------
NM_003131chr632267 1533 396 --11887 --
NM_003133chr11202 152 ----
NM_003135chr5187 ------
NM_003137chr632018 260 93 1703 ----
NM_003139chr113864 800 661 ------
NM_003144chr61527 12192 ----
NM_003150chr1761916 1469 1456 356 334 204 ------
NM_003151chr2160 ------
NM_003153chr12136 --1762 --
NM_003155chr832532 2038 619 21067 500 ----
NM_003156chr114903 527 361 348 ------
NM_003161chr1783552 3445 3351 2874 2644 2601 916 639 11249 ----
NM_003162chr23993 754 100 --11091 --
NM_003174chr101288 ------
NM_003178chr352249 2240 1905 488 109 --1662 --
NM_003183chr22779 595 2246 176 1151 --
NM_003185chr2031032 888 137 ------
NM_003188chr63846 756 96 ------
NM_003189chr163102 1358 1338 646 170 39 --21204 306 --
NM_003198chr12256 112 ------
NM_003199chr18145663 5655 4958 4195 3935 3904 3825 3706 3483 1966 1738 1698 932 345 11329 25444 689 --
NM_003204chr1721720 1177 --1637 --
NM_003205chr1551721 639 579 558 251 11948 ----
NM_003206chr61315 1427 ----
NM_003211chr1261751 1308 1257 689 275 233 --1204 --
NM_003217chr1221759 704 21919 1733 1116 --
NM_003220chr611636 --11427 --
NM_003221chr684130 3492 3210 2802 1651 1353 578 260 14094 ----
NM_003222chr2031257 255 239 --11057 --
NM_003224chr202855 113 ------
NM_003234chr362453 2058 863 715 532 154 11826 ----
NM_003236chr243310 2953 2782 139 ------
NM_003239chr144835 655 168 152 ------
NM_003246chr1511989 1254 --11940
NM_003247chr64641 427 286 132 1453 ----
NM_003248chr5128 ------
NM_003250chr171183 ------
NM_003253chr2151847 1810 1510 1281 243 11576 21493 104 --
NM_003255chr1722063 866 22645 390 --1592
NM_003257chr1551387 1232 972 903 347 11074 1978 --
NM_003262chr394173 3610 3455 3392 3281 2083 2063 1206 322 --13484 --
NM_003263chr4----149 --
NM_003264chr4--1513 ----
NM_003269chr611260 ----1966
NM_003274chr2172714 2049 1887 857 501 335 201 ------
NM_003275chr941140 600 120 107 --11231 1390
NM_003285chr11513 --1162 --
NM_003286chr202976 963 ------
NM_003290chr194404 214 80 64 ------
NM_003292chr11469 12294 1254 --
NM_003297chr122241 37 1274 --178
NM_003298chr3136065 5897 5605 5163 3924 3850 2451 2130 1937 1904 1574 1521 499 21634 209 12276 1963
NM_003299chr12--1219 ----
NM_003304chr331083 505 203 --11368 11003
NM_003305chr41139 ------
NM_003311chr111255 ------
NM_003318chr61248 162 1218 --
NM_003319chr22930 748 ------
NM_003320chr1164455 4309 3060 3008 1686 1425 11246 43792 3114 1652 1061 --
NM_003326chr152633 2345 2076 751 629 --12444 --
NM_003336chrX1303 ------
NM_003338chr10--11881 ----
NM_003339chr541590 1567 1393 276 168 11625 --
NM_003340chr451109 869 432 201 176 ------
NM_003342chr1792994 2476 1143 1098 801 715 568 532 342 --12655 1760
NM_003344chr761744 1711 1505 1258 421 170 --31217 1108 396 --
NM_003345chr161208 ----1453
NM_003347chr2261875 1650 1484 1432 478 272 12252 31840 1439 611 --
NM_003348chr1271523 1449 1414 1306 1120 1114 257 ----11682
NM_003349chr20--11452 11088 --
NM_003350chr831011 866 823 1212 ----
NM_003352chr23834 674 60 ------
NM_003358chr91122 ------
NM_003368chr13307 296 240 193 ----
NM_003369chr1132068 293 207 ----12097
NM_003370chr19--1766 ----
NM_003371chr942161 817 677 36 ------
NM_003373chr1041954 1805 1758 695 ------
NM_003374chr52584 520 ------
NM_003375chr103414 155 82 ------
NM_003376chr651359 1349 1308 277 248 ------
NM_003376chr651359 1349 1308 277 248 ------
NM_003380chr101262 ------
NM_003383chr92180 168 ------
NM_003385chr22320 146 ------
NM_003387chr241959 1900 819 178 --1259 --
NM_003392chr373605 3338 3278 3147 3086 2860 1418 1262 ----
NM_003394chr124649 510 472 93 --1718 --
NM_003400chr22659 614 --1184 1798
NM_003404chr2041855 1849 1474 1388 ------
NM_003406chr81275 11411 11333 --
NM_003410chrX73074 2621 2287 1027 827 651 623 12374 ----
NM_003411chrY21616 614 ------
NM_003412chr392928 2789 2455 2308 918 829 649 359 304 ------
NM_003413chrX51988 1712 796 579 258 1320 --1715
NM_003423chr1921899 1003 ------
NM_003430chr19------1569
NM_003432chr5----1516 --
NM_003439chr762218 1406 1363 1258 313 36 22694 730 12998 12205
NM_003440chr123866 765 79 ------
NM_003442chr113847 573 160 1152 ----
NM_003453chr131307 ------
NM_003454chr1631525 1432 217 11110 ----
NM_003458chr352518 1300 1159 955 925 1859 --122
NM_003463chr663126 2288 996 906 833 210 32806 2174 1061 ----
NM_003467chr21366 ------
NM_003468chr263502 3348 2996 1116 868 482 13830 ----
NM_003472chr621505 236 21407 290 21146 962 --
NM_003473chr1021000 179 1748 ----
NM_003478chr1153354 2799 459 419 333 1470 1325 --
NM_003483chr1272954 2816 2658 2154 1820 1178 969 148 22140 1908 --
NM_003487chr17190 ------
NM_003489chr2182274 2112 1086 870 844 563 524 366 12132 ----
NM_003498chr164899 793 644 372 12608 21741 258 --
NM_003503chr12818 437 --2182 76 11290
NM_003505chr771572 634 576 389 381 256 222 ------
NM_003506chr84902 495 292 96 --11196 11168
NM_003507chr271869 1771 1585 1507 1330 142 40 ------
NM_003509chr6151 ------
NM_003511chr6137 ------
NM_003512chr6150 ------
NM_003517chr1133 ------
NM_003520chr6154 ------
NM_003521chr6151 ------
NM_003522chr6135 ------
NM_003524chr6130 ------
NM_003525chr6142 ------
NM_003527chr6133 ------
NM_003529chr6138 ------
NM_003531chr6134 ------
NM_003532chr6137 ------
NM_003536chr6138 ------
NM_003557chr141426 1236 1100 436 ------
NM_003559chr1763789 3652 3118 3086 1336 1074 --33130 762 552 --
NM_003563chr1761377 1292 1143 1118 566 98 ------
NM_003566chr1273455 3118 2791 951 866 851 645 1885 12379 --
NM_003567chr11116 ------
NM_003568chr12307 213 ------
NM_003574chr18165605 5574 4252 4180 4160 3940 3691 3609 1901 1786 1572 1352 712 696 608 279 45390 4114 377 45 --22293 1865
NM_003575chr7--11498 11004 --
NM_003576chr1382922 2705 2686 2197 2014 1996 729 247 --22756 2359 --
NM_003580chr81516 ------
NM_003581chr22671 663 ------
NM_003583chr1262822 2695 2388 1259 790 635 --1736 --
NM_003589chr131209 11058 1310 --
NM_003590chr283516 1600 1549 1203 1129 1075 62 29 ------
NM_003591chr101274 ------
NM_003597chr252183 1505 913 839 191 11856 ----
NM_003601chr4145 ------
NM_003610chr201349 ------
NM_003613chr151212 --1668 --
NM_003615chr383828 3346 1298 1288 1002 787 402 204 --13661 22688 873
NM_003618chr271205 1189 1183 1134 980 965 400 11018 ----
NM_003621chr111512 ------
NM_003626chr1141293 1241 1124 297 11338 1372 --
NM_003629chr132271 1324 989 22311 377 23373 1266 --
NM_003631chr1051002 816 776 281 265 ------
NM_003633chr542443 2301 940 606 ----12080
NM_003637chr1--21361 141 1277 --
NM_003644chr17116280 5559 4555 4534 2056 1855 1701 1139 1057 979 351 14276 14430 24310 1708
NM_003648chr242553 2038 1009 525 --1504 --
NM_003659chr22828 319 ------
NM_003663chr352945 2433 2195 481 309 12624 ----
NM_003664chr52484 130 2496 122 ----
NM_003670chr351123 1002 480 297 224 ------
NM_003671chr963129 2980 2806 2609 2269 108 ----12510
NM_003672chr13589 87 30 ------
NM_003677chr1211902 ------
NM_003685chr193997 837 204 ------
NM_003688chrX1295 ------
NM_003692chr92799 244 ------
NM_003701chr131709 1395 --1141
NM_003702chr81667 1192 ----
NM_003710chr153445 142 90 ------
NM_003713chr141764 1706 316 103 2708 427 21122 56 --
NM_003716chr31739 --1982 --
NM_003728chr41506 ------
NM_003735chr531762 1533 475 ------
NM_003736chr531762 1533 475 ------
NM_003743chr22904 794 1260 31952 325 164 --
NM_003744chr1421368 1192 21270 1227 ----
NM_003749chr1342267 1530 350 104 1738 ----
NM_003750chr102724 659 1834 ----
NM_003754chr111141 ------
NM_003756chr8164 142 ----
NM_003758chr151117 ------
NM_003758chr151117 ------
NM_003763chr2053083 2858 2447 1068 565 ------
NM_003766chr172508 38 ------
NM_003768chr141825 1719 1352 1285 ------
NM_003772chr113384 347 169 ------
NM_003774chr1273344 2552 2441 2374 2360 2179 2059 23229 1320 ----
NM_003783chr121060 376 ------
NM_003787chr1861550 1481 1456 682 430 226 ------
NM_003795chr61216 ------
NM_003797chr111192 ------
NM_003799chr1853881 3544 3350 959 176 ------
NM_003800chr641876 1578 1544 457 --22305 1898 --
NM_003808chr172719 219 ------
NM_003816chr831449 1426 1306 276 65 ----
NM_003822chr111082 --23132 329 --
NM_003825chr1541025 540 286 97 --1376 --
NM_003829chr91198 ------
NM_003831chr1881829 1806 1589 1548 700 673 503 123 ------
NM_003850chr132218 79 ------
NM_003861chr1432903 2829 1951 --1319 --
NM_003864chr4173 ------
NM_003872chr232966 888 687 ------
NM_003873chr1091943 1013 980 945 825 805 594 205 124 1972 ----
NM_003883chr53529 166 47 --1107 --
NM_003884chr31157 1129 ----
NM_003885chr1742316 2173 924 613 2786 170 ----
NM_003887chr242305 1505 748 64 21723 795 ----
NM_003895chr2131638 1617 770 --2789 36 --
NM_003899chr1332112 1873 342 --1725 --
NM_003901chr1082448 2439 1685 1041 516 458 173 150 --21098 51 11977
NM_003902chr13730 634 554 ------
NM_003907chr31325 ------
NM_003908chr2031105 896 230 1456 --1926
NM_003909chr882980 2896 2439 1231 743 489 240 22 12998 ----
NM_003913chr683262 3230 1370 1280 1129 1115 1076 324 53876 3430 1584 1059 469 ----
NM_003916chrX21509 27 ------
NM_003919chr7193 ------
NM_003924chr451466 1409 660 652 116 ------
NM_003927chr184912 769 228 123 1745 183 1268
NM_003931chr6--1138 ----
NM_003932chr2241778 1723 1323 700 ------
NM_003934chr941259 1097 899 478 191 ----
NM_003939chr1084057 3828 3736 3333 2782 1520 373 247 ------
NM_003941chr752369 1677 1628 728 133 ------
NM_003945chr51500 198 ----
NM_003947chr3--21359 93 ----
NM_003949chr1721691 1400 --11656 --
NM_003955chr1721413 389 ------
NM_003957chr1121095 764 ------
NM_003966chr5187218 7044 6810 6768 5865 5852 5755 5652 5245 2756 2684 2562 2189 1996 1555 747 525 25 25464 2965 17591 --
NM_003968chr3--1445 1675 --
NM_003970chr81447 ----1136
NM_003971chr17182 ------
NM_003972chr102413 286 --1139 --
NM_003973chr3131 ------
NM_003980chr681237 1069 1041 592 580 525 236 170 ----1112
NM_003983chr1643836 3348 1357 273 23734 104 ----
NM_003987chr1062268 1858 1697 1589 1562 739 --11678 --
NM_003988chr1062345 1935 1774 1666 1639 816 --11755 --
NM_003989chr1062204 1794 1633 1525 1498 675 --11614 --
NM_003990chr1062204 1794 1633 1525 1498 675 --11614 --
NM_003993chr1169 ------
NM_003994chr1253365 2967 1640 1389 1272 --23275 132 --
NM_003996chr6--136 ----
NM_003998chr42477 162 ------
NM_004006chrX42511 2416 559 528 --21866 1831 --
NM_004007chrX42511 2416 559 528 --21866 1831 --
NM_004009chrX42511 2416 559 528 --21866 1831 --
NM_004010chrX42511 2416 559 528 --21866 1831 --
NM_004011chrX42511 2416 559 528 --21866 1831 --
NM_004012chrX42511 2416 559 528 --21866 1831 --
NM_004013chrX42511 2416 559 528 --21866 1831 --
NM_004014chrX42511 2416 559 528 --21866 1831 --
NM_004015chrX42511 2416 559 528 --21866 1831 --
NM_004016chrX42425 2330 473 442 --21780 1745 --
NM_004017chrX42511 2416 559 528 --21866 1831 --
NM_004018chrX42425 2330 473 442 --21780 1745 --
NM_004020chrX42511 2416 559 528 --21866 1831 --
NM_004021chrX42425 2330 473 442 --21780 1745 --
NM_004022chrX42425 2330 473 442 --21780 1745 --
NM_004023chrX42425 2330 473 442 --21780 1745 --
NM_004028chr1893549 2975 2893 2546 1341 1013 870 476 227 14104 --13611
NM_004036chr21498 1666 1673 --
NM_004050chr1422463 557 1970 12346 --
NM_004056chr81391 2446 87 ----
NM_004061chr5--1537 ----
NM_004063chr82812 116 ------
NM_004067chr731006 592 221 11475 ----
NM_004075chr12--1407 ----
NM_004077chr12165 ------
NM_004078chr12296 42 --1842 --
NM_004081chrY41609 1218 1158 254 ------
NM_004082chr21109 ------
NM_004086chr141227 --1555 --
NM_004087chr321553 610 21759 83 11302 --
NM_004089chrX154 ------
NM_004090chr17113300 3146 3065 2916 2616 2594 2587 2263 1089 928 796 22537 391 ----
NM_004093chr1333262 2858 2405 ------
NM_004094chr1443068 2386 889 441 ------
NM_004096chr1052016 1530 1504 826 776 11901 11660 --
NM_004097chr21288 ------
NM_004098chr101922 ------
NM_004099chr94847 471 262 82 --11923 --
NM_004100chr632282 878 563 11074 11977 --
NM_004109chr1132231 2072 1925 21674 160 ----
NM_004113chr332019 1964 762 12029 ----
NM_004114chrX4880 840 457 367 --11089 --
NM_004116chr21187 --185 195
NM_004124chr1493554 3302 3104 2901 2646 1382 1182 626 253 23214 357 ----
NM_004128chr131152 ------
NM_004130chr33246 208 135 --1608 --
NM_004136chr1533010 2911 51 1169 ----
NM_004156chr82462 49 ------
NM_004162chr31384 1814 1803 --
NM_004169chr171134 ------
NM_004171chr11169650 9512 9294 8393 7922 7563 7391 6095 5844 3769 3187 2341 1836 611 566 325 58452 7178 2708 1056 26 38011 281 148 --
NM_004180chr22533 181 ------
NM_004185chr11676 ------
NM_004187chrX41490 1285 150 84 --1580 --
NM_004193chr102399 87 ------
NM_004200chr1143270 2889 2248 2078 1853 --13064
NM_004202chrY--1132 ----
NM_004209chr162948 294 ------
NM_004215chr81411 ------
NM_004225chr851403 1386 993 140 63 ------
NM_004228chr191130 ------
NM_004229chrX42125 2116 1651 178 ----11983
NM_004231chr71259 ------
NM_004232chr18113840 3320 2675 2464 1511 982 933 885 630 188 91 23384 3116 ----
NM_004236chr151133 1415 ----
NM_004237chr54905 827 580 27 1881 ----
NM_004238chr21105 --1230 --
NM_004241chr10----1736 --
NM_004242chr62162 40 --1347 --
NM_004248chr102210 141 ------
NM_004252chr172574 151 1121 ----
NM_004253chr92673 325 ------
NM_004261chr13784 376 30 1989 ----
NM_004263chr221462 1405 --11146 --
NM_004264chr1231139 775 486 1162 --11152
NM_004267chr31498 ------
NM_004272chr571456 1396 1362 585 521 450 379 1139 ----
NM_004273chr1074395 3809 3225 1558 1357 1333 413 --33555 1606 1382 --
NM_004274chr1422902 1038 1706 ----
NM_004279chr792171 1944 1885 1865 1850 1458 797 355 307 ----1337
NM_004280chr61163 ------
NM_004282chr62219 79 ------
NM_004286chr2272842 2647 2452 2432 2379 901 495 ------
NM_004290chr511141 ----1927
NM_004293chr922999 2690 --1102 --
NM_004295chr1721088 250 --21282 956 --
NM_004301chr34348 315 86 32 ------
NM_004302chr1232905 2757 1987 11968 1920 --
NM_004305chr2165 198 ----
NM_004311chr1073038 2968 2358 2247 1978 641 332 33057 2151 734 12513 12770
NM_004316chr1231076 458 83 --1413 --
NM_004319chr1--23037 2932 ----
NM_004320chr16174 ------
NM_004326chr12926 269 ------
NM_004327chr2272422 2380 1774 1768 909 611 562 1982 ----
NM_004329chr1011443 ------
NM_004330chr153948 199 139 1188 ----
NM_004331chr842025 957 794 370 ------
NM_004337chr841864 1741 1586 263 11443 ----
NM_004338chr18127044 6950 6347 5733 5341 5137 4947 4311 2382 1654 829 443 --21444 819 --
NM_004342chr71738 22092 1945 --1802
NM_004349chr851237 1129 1080 922 420 ------
NM_004352chr161520 ------
NM_004356chr111133 ------
NM_004360chr1621771 213 11750 --11544
NM_004364chr1921128 238 11147 ----
NM_004370chr652128 1726 832 761 528 ------
NM_004379chr251245 652 624 578 246 1394 1157 --
NM_004380chr1642192 235 75 47 1918 138 --
NM_004384chr532179 2129 308 --1676 --
NM_004385chr53527 497 461 ------
NM_004386chr1952292 2140 374 297 188 12127 ----
NM_004388chr1292 63 ------
NM_004389chr2128 ------
NM_004392chr1371955 1846 1830 1670 387 240 128 1488 12342 --
NM_004393chr321459 775 11581 1233 --
NM_004395chr52294 177 1531 ----
NM_004396chr17145 ------
NM_004397chr1133654 1672 1608 12671 13514 --
NM_004404chr251970 1377 740 649 511 11952 11622 --
NM_004411chr72669 73 ------
NM_004414chr2141520 1508 584 299 ------
NM_004415chr61170 1695 ----
NM_004416chr1211033 ------
NM_004417chr5124 ------
NM_004422chr17175 ------
NM_004426chr1221968 1516 ------
NM_004427chr1----1999 --
NM_004428chr13799 758 610 ------
NM_004429chrX51459 1451 252 129 123 --2380 200 --
NM_004430chr832781 2519 2450 1587 11101 --
NM_004432chr932393 1809 765 1834 ----
NM_004433chr131586 677 200 ----11163
NM_004437chr163410 3193 2353 1408 384 200 33057 2902 191 22439 1332 --
NM_004438chr232826 2768 470 22017 30 ----
NM_004439chr41174 ------
NM_004441chr331235 1127 1078 ------
NM_004447chr12--198 ----
NM_004449chr2131322 1052 154 ------
NM_004450chr141250 ------
NM_004451chr11----1729 --
NM_004454chr362312 2148 1607 864 612 507 31971 725 231 ----
NM_004457chr231629 1595 406 ------
NM_004458chrX42252 1748 684 373 22621 1024 12643 --
NM_004459chr1762036 1348 803 419 343 154 1384 ----
NM_004463chrX1179 ------
NM_004464chr494078 3245 3237 3214 3091 3085 2760 409 239 21233 921 12746 --
NM_004472chr51175 ------
NM_004475chr1711126 ------
NM_004482chr21597 ------
NM_004485chr154345 3009 2803 1069 539 24362 4299 ----
NM_004487chr31295 1908 ----
NM_004492chr15------152
NM_004496chr143858 507 404 ----11337
NM_004499chr51437 ----1518
NM_004501chr133961 1418 1068 13461 --24071 962
NM_004504chr232234 513 64 22735 489 1649 --
NM_004505chr171558 ------
NM_004506chr63500 162 136 ------
NM_004514chr1742639 2433 2348 589 1972 --11951
NM_004516chr1951027 786 503 321 118 --1866 --
NM_004520chr52251 159 ------
NM_004523chr1031164 572 544 ------
NM_004525chr221027 41 --1450 --
NM_004527chr1731300 307 126 --11090 --
NM_004529chr941393 1258 1164 489 1188 21303 84 --
NM_004535chr2011495 --11607 --
NM_004537chr1251294 1259 1205 1041 170 ------
NM_004539chr18150 ------
NM_004540chr212170 93 ------
NM_004554chr1421573 371 ------
NM_004566chr1032250 2121 966 12060 1808 11791
NM_004569chr142672 569 ------
NM_004571chr2173402 2933 2751 2251 1288 764 106 12964 ----
NM_004575chr481662 1627 1508 1349 1262 565 79 46 ------
NM_004576chr51271 ------
NM_004578chr12918 870 ------
NM_004586chrX45372 5216 2166 1993 12114 ----
NM_004588chr1154026 3906 3660 3648 3091 --44004 3857 976 81 --
NM_004593chr35780 766 616 139 73 ------
NM_004596chr191202 ------
NM_004598chr593241 3025 2854 2769 2732 2567 1169 1073 424 12723 1840 --
NM_004602chr20--1604 --21177 1022
NM_004612chr974547 3518 3354 1593 1340 592 116 13387 24842 925 --
NM_004614chr1632483 2471 1813 --41908 1514 958 852 --
NM_004615chrX2802 724 ------
NM_004619chr132116 1398 32 31509 258 239 ----
NM_004622chr282474 1666 1596 1577 1566 525 290 273 ------
NM_004626chr114619 523 472 460 ------
NM_004627chr212709 508 --1139 --
NM_004630chr1121139 890 ------
NM_004637chr331327 1150 855 ------
NM_004643chr141539 ------
NM_004654chrY21137 463 1508 ----
NM_004655chr1721283 245 --146 --
NM_004656chr32936 34 ------
NM_004657chr231032 207 68 ------
NM_004660chrY41884 1593 1482 722 12085 ----
NM_004663chr1551392 1385 187 89 78 1139 ----
NM_004666chr651395 1366 449 411 218 11079 1335 --
NM_004667chr15--1476 ----
NM_004670chr1031710 1649 36 11462 ----
NM_004671chr183131 77 46 ------
NM_004685chr1352770 2687 1111 1017 681 1781 12650 --
NM_004686chr831718 610 524 ----1155
NM_004687chr1721809 1586 --11973 1763
NM_004690chr62711 655 --1251 --
NM_004694chr172785 187 --1160 --
NM_004696chr13856 813 159 ------
NM_004705chr113633 224 187 ------
NM_004709chrX31312 1189 31 --11799 --
NM_004713chr142149 51 2554 263 ----
NM_004715chr182604 198 ------
NM_004716chr113901 283 32 1880 1217 158
NM_004719chr1242678 1095 648 298 22909 2460 12198 --
NM_004721chr31354 ------
NM_004723chr121033 682 --2404 128 --
NM_004725chr1041469 559 480 398 21190 1119 ----
NM_004726chrX115165 5152 4793 3588 1935 1782 1469 1340 1102 408 146 157 24715 2171 --
NM_004730chr541930 1731 1467 532 --1298 --
NM_004732chr171241 ------
NM_004733chr3----1612 --
NM_004734chr1372767 2727 2691 2303 1055 649 465 1512 ----
NM_004736chr132029 1966 127 ------
NM_004737chr222343 98 --11083 --
NM_004739chr114631 594 563 533 ------
NM_004742chr331650 1374 129 ------
NM_004744chr413749 13352 13610 1851
NM_004745chr876666 6504 5859 4816 4399 1114 505 16517 1200 --
NM_004747chr1031351 1087 62 --1496 --
NM_004748chr15104178 3972 3798 3720 3387 2708 2574 1272 329 45 43266 2857 1315 853 22683 898 --
NM_004755chr142360 77 2489 246 ----
NM_004758chr172954 315 ------
NM_004760chr732050 1903 360 --1883 1699
NM_004762chr1741623 772 330 50 --31523 252 140 --
NM_004764chr123206 63 27 ------
NM_004765chr16267 47 ------
NM_004768chr151099 929 832 198 169 ------
NM_004772chr541388 1363 1271 358 21278 472 11519 --
NM_004773chr171255 ------
NM_004774chr1712143 32672 2500 1234 12520 --
NM_004779chr53539 460 137 195 --11027
NM_004781chr131424 1279 1167 153 2546 540 --
NM_004781chr131424 1279 1167 153 2546 540 --
NM_004783chr162667 150 ------
NM_004785chr161366 ------
NM_004786chr181195 ------
NM_004787chr4--148 ----
NM_004788chr1152708 1905 868 630 391 --1148 --
NM_004796chr1442448 2380 1889 1842 --22167 605 --
NM_004798chr2043106 2572 379 359 --1500 --
NM_004799chr1----2420 94 --
NM_004801chr21550 1459 1169 --
NM_004804chr242762 686 327 237 1885 ----
NM_004807chr231833 404 30 ------
NM_004815chr1104056 3885 3425 1782 889 769 525 502 128 94 44674 4448 3798 861 ----
NM_004822chr1744025 3407 1434 928 ------
NM_004824chr641073 988 482 278 --11061 --
NM_004826chr2----1292 --
NM_004831chr193443 429 166 ------
NM_004834chr252985 2725 2249 1328 976 ------
NM_004835chr32178 167 --1312 --
NM_004835chr32178 167 --1312 --
NM_004836chr24640 602 220 98 1234 ----
NM_004840chrX1677 --195 --
NM_004841chr14795 760 325 189 ------
NM_004842chr621784 1446 ------
NM_004849chr641354 1170 1079 67 ------
NM_004857chr1474642 4135 3264 3110 1021 474 330 1369 ----
NM_004859chr1742338 853 694 244 --32621 1954 99 --
NM_004860chr172192 94 ------
NM_004863chr1495133 5097 5067 3930 3518 3485 1407 713 235 11147 --13365
NM_004866chr563342 1256 1017 912 469 344 21931 32 ----
NM_004867chrX1459 1485 1165 --
NM_004869chr1831645 1170 532 ------
NM_004871chr17104321 4307 4180 3685 3580 3458 3287 2722 386 350 24241 24 1249 --
NM_004872chr1163 ------
NM_004873chr1463038 2363 2319 2266 541 462 23239 23 32533 725 283 1149
NM_004874chr81474 ------
NM_004884chr1521284 132 --11248 --
NM_004888chr94682 432 260 161 1390 ----
NM_004890chr17----1249 --
NM_004891chr21169 ------
NM_004893chr52416 399 ------
NM_004897chr103902 813 94 ------
NM_004898chr482841 2673 2608 2271 2135 1939 1109 698 12297 ----
NM_004902chr203726 214 33 145 ----
NM_004904chr7166441 6297 5404 5094 4690 4653 4503 4411 4349 1925 1664 807 581 354 230 108 1423 ----
NM_004905chr12877 589 1161 ----
NM_004906chr6178 ------
NM_004912chr72407 85 21515 1102 ----
NM_004924chr1921037 259 ------
NM_004926chr1421750 1203 ------
NM_004930chr12604 588 ------
NM_004939chr21122 ------
NM_004947chr332388 2133 1607 1730 ----
NM_004949chr183833 690 673 --12086 --
NM_004952chr13962 814 771 1694 ----
NM_004956chr783685 3439 2790 1340 1331 1270 134 37 ------
NM_004957chr92194 80 ------
NM_004958chr1----144 --
NM_004960chr16134 ------
NM_004965chr213709 167 45 ------
NM_004968chr72684 636 ------
NM_004969chr10--1235 ----
NM_004973chr641393 1259 1116 343 ------
NM_004975chr20279 29 ------
NM_004976chr1123536 1855 15200 --12024
NM_004978chr13592 512 383 ------
NM_004985chr1254326 4193 868 707 129 33794 3225 1432 21187 269 23963 346
NM_004992chrX168374 8348 7838 7657 7496 7449 7053 6532 6310 6253 5768 5418 5405 5316 1241 932 11832 36203 5395 1852 --
NM_004992chrX168374 8348 7838 7657 7496 7449 7053 6532 6310 6253 5768 5418 5405 5316 1241 932 11832 36203 5395 1852 --
NM_004993chr1441272 540 343 299 31383 1372 606 ----
NM_004996chr1641716 1512 1380 1283 ------
NM_004999chr644187 1657 1239 655 11495 1138 11687
NM_005006chr23838 693 228 1799 ----
NM_005010chr732147 1514 617 21922 223 ----
NM_005011chr731618 1607 1570 1180 11340 --
NM_005016chr121359 ------
NM_005020chr72593 585 ------
NM_005022chr171202 ------
NM_005026chr131895 1361 128 ------
NM_005027chr1921121 210 1834 1125 --
NM_005028chr1032080 2059 833 12222 ----
NM_005032chrX61000 417 344 320 305 95 1857 ----
NM_005045chr71365 ------
NM_005054chr231410 1213 116 11615 ----
NM_005055chr112183 45 ------
NM_005056chr12145381 5285 5269 4949 4532 4370 4117 1812 1750 1740 1546 1206 1125 29 24506 4145 21650 588 14957
NM_005063chr1053501 3126 3112 989 950 22514 1547 1482 --
NM_005065chr1485162 1767 1577 1445 351 323 313 244 ------
NM_005066chr12773 70 ----1733
NM_005069chr2131731 669 402 21639 698 11707 --
NM_005076chr144213 4172 3769 1601 ------
NM_005078chr1581773 1454 1386 1335 1318 566 338 325 ------
NM_005079chr863153 2936 2615 2273 179 103 11010 13202 --
NM_005080chr226866 827 725 615 336 322 ------
NM_005087chr3129 ------
NM_005093chr2054441 4357 3575 1169 852 23769 2135 14714 --
NM_005095chr142181 2089 218 199 199 1579 --
NM_005096chrX2376 160 ------
NM_005097chr101221 ------
NM_005099chr111255 ----11134
NM_005104chr62779 229 --2747 621 --
NM_005105chr141643 747 677 352 1696 1795 --
NM_005109chr331700 310 139 --1561 --
NM_005110chr51699 --1159 --
NM_005112chr41171 ------
NM_005113chr141120 --1397 --
NM_005114chr42634 448 ------
NM_005116chr2064287 3861 3164 1769 1489 687 --11649 11075
NM_005119chr111187 1507 --1218
NM_005121chr1763688 2914 1530 1366 599 532 11168 1393 --
NM_005124chr61869 ------
NM_005126chr332027 1974 604 12294 ----
NM_005132chr142153 113 ------
NM_005134chr182848 792 1901 ----
NM_005135chr1553809 3580 3017 1183 897 23266 131 12538 23787 3284
NM_005151chr184786 559 316 250 --1388 1772
NM_005153chr162747 86 ------
NM_005154chr152497 468 157 ----
NM_005155chr6------1535
NM_005156chr944472 4239 3577 1442 ------
NM_005157chr951815 1790 1751 1605 756 --1748 1623
NM_005160chr22126234 5878 5691 5503 4375 2106 1728 1273 474 451 207 55 16487 ----
NM_005168chr211672 ------
NM_005171chr1231291 109 96 ------
NM_005178chr191406 ------
NM_005180chr1051191 502 418 217 117 --2655 376 --
NM_005184chr1941377 352 218 169 137 ----
NM_005188chr11238358 8309 6810 6301 5906 5578 5499 2968 2943 2332 2233 1826 1800 1666 1554 1425 1327 1321 1274 1069 713 642 612 16019 46443 6001 2546 1706 --
NM_005190chr61313 1192 --1268
NM_005197chr1495386 5079 4699 4337 4015 3856 1447 257 106 35564 5014 4535 24290 1334 --
NM_005201chr3--138 ----
NM_005203chr101169 ------
NM_005204chr104948 746 360 354 ------
NM_005207chr2263676 1233 499 487 418 220 23621 3346 13218 --
NM_005219chr571678 1428 1368 487 403 397 334 ------
NM_005221chr71125 ------
NM_005224chr192636 552 ------
NM_005230chr122249 100 1580 ----
NM_005231chr1141054 327 165 149 --170 1178
NM_005233chr332163 1656 220 1650 ----
NM_005235chr2117713 7686 7283 7065 6604 6542 6143 5242 5138 2118 1110 36820 2916 1563 17720 --
NM_005238chr1153374 2958 2859 2735 1037 1218 ----
NM_005240chr12317 109 2602 554 ----
NM_005241chr35944 563 431 393 52 ------
NM_005245chr43219 93 70 ------
NM_005249chr14--1829 ----
NM_005252chr14--1715 ----
NM_005254chr1521229 33 11090 21015 151 --
NM_005264chr103619 161 70 ------
NM_005273chr71296 ------
NM_005275chr6----145 --
NM_005277chr461796 1790 1283 649 381 345 1490 11510 --
NM_005279chr22281 35 2314 179 ----
NM_005311chr782882 2850 2780 2514 2141 735 626 334 ------
NM_005316chr11----11051 1332
NM_005321chr6151 ------
NM_005324chr1771927 1699 1372 833 412 322 233 --12022 --
NM_005326chr16141 ------
NM_005328chr82614 588 ------
NM_005329chr1652314 2266 2196 777 644 1876 11446 --
NM_005336chr232148 841 111 11539 ----
NM_005339chr494251 3729 3119 1592 1168 1019 815 753 105 143 --12858
NM_005349chr4193 --1507 --
NM_005358chr1341842 1494 368 98 ------
NM_005359chr18166482 5937 5907 5901 5434 5378 4667 4561 4437 2247 1816 1633 1357 1270 1150 91 36526 1856 1366 15127 35702 5621 2575
NM_005369chrX3259 174 33 --1426 --
NM_005370chr191858 11213 ----
NM_005373chr121498 619 1303 ----
NM_005374chr1732285 1875 1533 12392 ----
NM_005375chr61165 11133 ----
NM_005378chr21709 ------
NM_005382chr81384 ------
NM_005385chr362663 2498 2147 2050 692 526 1243 ----
NM_005386chr201731 ------
NM_005388chr961664 1441 1270 690 98 87 ----1219
NM_005389chr62671 115 ----2792 523
NM_005392chr941835 1461 1352 1175 ------
NM_005397chr763673 2651 1437 978 601 191 12886 23766 2457 --
NM_005398chr10------1121
NM_005399chr1114344 4293 4258 3887 3779 3274 2998 1631 1445 1401 474 --33470 1769 148 11054
NM_005400chr2102995 2830 2750 2244 2009 1966 608 587 408 325 --21107 203 --
NM_005402chr731506 648 267 2730 282 1714 --
NM_005406chr1811241 --1478 --
NM_005407chr1461354 1156 1124 134 108 27 ------
NM_005410chr51530 --1223 --
NM_005415chr21559 --1156 --
NM_005430chr122993 201 ------
NM_005433chr1842502 967 531 460 ------
NM_005436chr1044034 3935 3136 331 ----13693
NM_005437chr1061457 1233 439 422 345 114 11376 ----
NM_005442chr31158 --2560 511 --
NM_005455chr141662 1317 1294 232 --11144 --
NM_005458chr922285 1832 11947 ----
NM_005460chr5176 ------
NM_005461chr2031450 1236 697 --11506 11486
NM_005465chr141731 1552 1477 81 21914 340 ----
NM_005467chr111163 1319 ----
NM_005471chr531252 1041 407 1395 1134 --
NM_005475chr12--13255 1230 --
NM_005476chr921185 140 --159 --
NM_005477chr152333 189 ------
NM_005477chr152333 189 ------
NM_005487chr2232024 1896 181 ------
NM_005488chr223738 717 704 ------
NM_005494chr71247 1165 ----
NM_005497chr1773925 1965 1843 770 280 202 28 25665 1733 ----
NM_005499chr191667 ------
NM_005502chr943053 2804 979 552 --12559 --
NM_005504chr12106182 5362 5187 2403 1949 1913 1687 1474 1101 291 26269 5639 16333 11971
NM_005509chr531167 729 105 ------
NM_005519chr101134 ------
NM_005520chr53603 487 146 ------
NM_005522chr73946 299 255 11259 ----
NM_005523chr741568 1391 1319 261 2162 96 --1997
NM_005524chr31313 ------
NM_005530chr15--1103 11506 11152
NM_005536chr8135 ------
NM_005539chr1021002 907 181 11297 --
NM_005542chr711925 ------
NM_005546chr552024 1851 1750 308 257 22339 1791 ----
NM_005552chr141531 ------
NM_005563chr12591 236 1344 ----
NM_005573chr52746 457 ------
NM_005575chr5----168 --
NM_005578chr3135079 4768 4110 3875 3744 3591 3376 3369 1908 489 393 328 102 --11864 --
NM_005584chr131789 ------
NM_005587chr15128 1876 ----
NM_005593chr121510 ------
NM_005594chr12198 ------
NM_005595chr12946 131 ------
NM_005596chr9126261 6038 5932 5746 5554 4749 4578 2010 1940 1880 1361 472 32436 2336 1286 ----
NM_005602chr35858 270 258 252 176 11303 ----
NM_005604chr64905 491 101 74 22372 2253 2692 666 --
NM_005606chr14123 --1452 --
NM_005607chr82716 276 2923 37 ----
NM_005610chr12940 811 1593 ----
NM_005614chr721023 1006 ------
NM_005618chr61242 ------
NM_005626chr1141 ----1365
NM_005627chr63392 159 65 ------
NM_005632chr16----11007 --
NM_005634chrX2694 219 ------
NM_005637chr1811617 1198 11650 --
NM_005638chrX41747 1481 1403 418 --1237 --
NM_005639chr1231772 1251 43 ------
NM_005644chr11416 ------
NM_005647chrX93385 3202 3158 3140 3055 2831 1280 952 697 --13132 --
NM_005652chr1621173 70 ------
NM_005655chr841305 1075 326 234 1885 ----
NM_005659chr222362 60 ------
NM_005660chrX145 ------
NM_005664chr152233 121 ----11062
NM_005665chr143526 3337 278 64 --23146 369 --
NM_005668chr5103440 3302 3199 2810 1772 1608 1380 1296 633 547 24164 3207 12918 --
NM_005670chr632088 1977 368 ------
NM_005676chrX1157 ------
NM_005682chr1631340 1320 914 11348 --1176
NM_005688chr32936 220 --11090 --
NM_005704chr12952 940 --1355 --
NM_005707chr15274 38 1174 ----
NM_005711chr51374 ------
NM_005715chr652015 981 201 195 50 12736 12255 --
NM_005717chr131268 942 119 ------
NM_005721chr23911 879 252 ------
NM_005722chr231764 958 388 11788 --12216
NM_005724chr152137 24 ------
NM_005725chr152391 2051 1870 771 280 ------
NM_005730chr12103424 2953 2708 2307 1308 1173 1148 1066 1054 968 1772 22422 1207 --
NM_005731chr2297 73 ------
NM_005734chr11--2647 155 ----
NM_005736chr1021148 991 21223 62 ----
NM_005737chr262901 2060 2051 1159 764 255 --1949 --
NM_005738chr741679 1668 1492 220 ------
NM_005740chr221834 ------
NM_005742chr22164 38 --1299 --
NM_005746chr762693 2193 1817 653 495 213 12406 ----
NM_005748chr1273337 3105 2867 2588 2230 2155 889 1310 13281 --
NM_005749chr171549 ------
NM_005751chr7265 49 --176 --
NM_005752chr1621126 1092 ------
NM_005756chrX41493 1380 1076 563 ------
NM_005759chr284486 3551 3080 1862 1788 855 527 388 ------
NM_005761chr122156 36 ------
NM_005765chrX2669 127 ------
NM_005766chr133514 366 225 ------
NM_005776chr14----1342 --
NM_005777chr3139 --177 --
NM_005778chr31396 ------
NM_005779chr543207 2416 525 440 --1425 --
NM_005783chr22418 197 1602 ----
NM_005786chr181249 --1231 11299
NM_005795chr263007 2747 2504 2239 890 444 ------
NM_005797chr1121752 85 157 ----
NM_005798chr13124960 4415 3676 3440 3327 2110 1897 1633 877 686 333 30 13298 13530 1216
NM_005801chr171126 1631 ----
NM_005808chr353229 3090 1337 1047 232 21283 408 ----
NM_005813chr251914 1691 924 213 70 ------
NM_005819chr193498 3298 3183 3003 1364 1081 923 595 368 ------
NM_005822chr632164 857 49 ------
NM_005826chr14625 598 451 242 --1191 --
NM_005828chr17104982 4730 4658 4573 3764 1934 1763 1721 1663 1645 21371 639 31912 1483 37 --
NM_005832chr331172 933 497 1363 ----
NM_005839chr13834 801 705 ------
NM_005840chrX147453 7209 6895 6838 5610 5193 5010 4889 4674 2264 555 176 119 29 27568 5470 ----
NM_005841chr42955 875 --1264 --
NM_005842chr131143 ------
NM_005843chr21618 123 ----
NM_005851chr111396 ------
NM_005852chr1721067 419 ------
NM_005857chr131390 1276 578 11043 --21059 69
NM_005859chr531529 1509 362 1189 ----
NM_005862chr3--192 ----
NM_005870chr1321385 215 ------
NM_005871chr103857 848 235 ------
NM_005875chr3--131 ----
NM_005876chr21135 ------
NM_005880chr161655 ------
NM_005882chr41107 ------
NM_005885chr531113 1081 459 ------
NM_005888chr121128 ------
NM_005895chr1263177 2756 1450 466 190 45 23083 916 24072 3275 14010
NM_005896chr2136 ------
NM_005897chr12868 58 ------
NM_005898chr11112778 2753 2537 2506 2437 2072 1267 970 803 626 479 11032 ----
NM_005899chr171309 --11604 --
NM_005900chr411134 ------
NM_005901chr18218646 8365 7993 7877 7296 7121 6639 5986 5965 5900 5310 3240 3122 2749 2552 1594 1503 1362 1146 1092 573 2600 401 38297 7624 2289 --
NM_005902chr1574600 4162 3314 1619 1442 1100 983 ------
NM_005903chr5164748 4566 4217 4117 4043 3876 3785 2093 2060 2033 1208 1138 999 656 622 277 11905 34547 1983 798 15179
NM_005904chr1841093 410 177 89 ------
NM_005907chr62435 116 ----11605
NM_005909chr584228 4095 4008 3722 3582 3550 2800 1311 ------
NM_005910chr1723027 1033 1300 43751 3091 3015 145 --
NM_005911chr221160 528 --21050 156 --
NM_005917chr21136 ------
NM_005920chr173704 3321 2974 1272 1003 632 108 --21457 1204 12868
NM_005922chr61482 ------
NM_005923chr6161 ------
NM_005924chr71746 --2431 278 --
NM_005927chr53838 492 311 --11159 --
NM_005930chr145865 718 700 679 87 ------
NM_005933chr1122427 2011 1678 ----
NM_005935chr4115211 4236 4199 4191 3955 3676 2127 1780 1666 938 441 21198 476 13549 13938
NM_005937chr1744160 1177 906 623 ------
NM_005938chrX1563 ------
NM_005941chr843964 3873 212 30 13188 ----
NM_005943chr611066 ------
NM_005944chr321081 498 ------
NM_005955chr194968 4786 4746 4566 3965 3627 1532 766 262 1434 11878 --
NM_005962chr1021771 1440 32027 608 278 ----
NM_005962chr1021771 1440 32027 608 278 ----
NM_005963chr17183 ------
NM_005964chr1721451 1326 ------
NM_005966chr211650 ------
NM_005968chr19155 ------
NM_005977chr133405 283 139 ------
NM_005986chr1362475 2298 642 501 350 115 1245 193 --
NM_005996chr1261516 1327 626 592 176 107 --11041 --
NM_005999chr141082 444 295 97 133 ----
NM_006007chr963948 3617 931 913 874 338 --11064 --
NM_006009chr12129 ------
NM_006011chr1534222 3172 1200 13023 ----
NM_006016chr632182 1692 706 --42171 2034 1409 340 --
NM_006030chr321222 244 ------
NM_006033chr1832384 2243 1739 1206 1193 --
NM_006037chr2124777 4734 4727 4699 4354 3219 2998 1870 1659 1079 104 27 13406 ----
NM_006038chr2051822 1611 1531 854 273 ----11557
NM_006047chr2043322 2945 1103 723 32787 2480 1194 1367 --
NM_006054chr1131471 1463 118 ------
NM_006060chr773752 3245 3196 3190 1687 1252 817 14209 13462 1179
NM_006064chrX1421 ------
NM_006067chr163744 683 263 ----1345
NM_006070chr31332 ------
NM_006079chr61772 ------
NM_006080chr72972 182 --11900 --
NM_006085chr151335 1195 1140 1122 996 1215 ----
NM_006089chrX31289 653 271 ------
NM_006090chr11765 ------
NM_006094chr882346 1751 1729 1488 713 407 322 56 ------
NM_006095chr464455 3909 3466 3416 405 198 --34049 1253 1006 --
NM_006099chr13343 226 135 1364 ----
NM_006106chr1162771 2715 2670 313 240 151 12762 ----
NM_006108chr1142076 1984 1793 1564 1170 41629 1615 739 566 --
NM_006134chr2141490 1336 315 30 11478 ----
NM_006135chr11173 ------
NM_006136chr72376 336 ------
NM_006139chr252438 2422 1864 432 408 12158 ----
NM_006141chr1652366 2171 2050 267 236 --1397 --
NM_006147chr12189 82 --1460 --
NM_006148chr1782670 2520 2365 2034 875 436 213 140 12074 1710 --
NM_006152chr121210 ------
NM_006153chr31430 ------
NM_006155chr251970 1377 740 649 511 11952 11622 --
NM_006157chr111162 ------
NM_006159chr12143 --1621 --
NM_006160chr1731579 1386 32 1468 ----
NM_006161chr53532 241 177 ------
NM_006166chr1252306 1609 972 693 345 ----21859 774
NM_006178chr1741539 1416 1350 258 11088 ----
NM_006180chr91560 1313 ----
NM_006186chr2------11015
NM_006190chr231092 819 250 1846 ----
NM_006191chr12181 ------
NM_006194chr142185 168 1380 ----
NM_006195chr921144 404 ------
NM_006197chr842254 1686 496 115 ------
NM_006203chr5115526 4354 4233 3834 3656 3644 3554 1828 1444 1437 928 13631 ----
NM_006206chr422430 200 22766 454 ----
NM_006216chr21125 ------
NM_006223chrX--168 ----
NM_006224chr1742384 1012 705 359 ----11926
NM_006226chr221260 59 ------
NM_006228chr82397 306 ------
NM_006238chr611970 --1400 --
NM_006241chr3111854 1841 1506 899 815 614 368 294 252 191 69 ------
NM_006243chr13972 379 49 ------
NM_006245chr62864 746 --1945 --
NM_006246chr1431267 854 508 ------
NM_006251chr553035 2950 2103 964 26 12968 12978 --
NM_006252chr1127579 7344 7041 5683 4663 2346 2230 2152 1891 1206 738 73 26815 5059 --25736 1443
NM_006256chr152735 2468 1968 1036 274 11903 ----
NM_006258chr1031166 181 43 ------
NM_006259chr41224 --1832 --
NM_006265chr831451 1193 334 21216 522 --11507
NM_006267chr231582 1192 517 ----190
NM_006268chr114896 865 738 461 ------
NM_006275chr2052034 1938 1910 442 249 1102 11622 1233
NM_006279chr12932 572 ------
NM_006281chr821149 226 ------
NM_006281chr821149 226 ------
NM_006282chr2051343 1133 731 338 233 1156 54405 1604 1332 964 589 --
NM_006283chr873571 3041 1499 1293 1095 549 49 ------
NM_006287chr262137 978 544 391 162 90 ------
NM_006290chr631365 665 140 ------
NM_006292chr113161 145 32 ------
NM_006293chr151172 ------
NM_006298chr672911 2779 2640 1114 1002 306 146 11187 11291 1800
NM_006301chr121607 ------
NM_006306chrX55879 4551 1782 1414 306 21990 1470 15908 --
NM_006310chr172509 367 ----1938
NM_006312chr12------1760
NM_006313chr1221372 1219 ------
NM_006315chr443880 2765 1618 129 21481 484 12811 --
NM_006319chr163752 560 506 1699 ----
NM_006320chr41956 ------
NM_006321chr32834 663 2862 722 12028 --
NM_006324chr16152 ------
NM_006328chr111632 ------
NM_006334chr9183 ------
NM_006345chr421277 946 ------
NM_006352chr151920 1883 762 461 328 1322 11578 --
NM_006353chr641402 1206 145 99 11036 --1244
NM_006357chr21121 ------
NM_006359chrX42245 1735 967 450 --12159 --
NM_006361chr1711686 ------
NM_006363chr203575 233 175 ------
NM_006364chr142939 348 ------
NM_006366chr611080 ------
NM_006367chr15439 215 97 68 21 --1299 --
NM_006371chr375247 4246 3690 752 300 246 29 24606 435 1918 --
NM_006373chr1711048 --21388 292 --
NM_006375chrX31762 747 564 1135 11698 --
NM_006378chr941035 193 156 142 ------
NM_006379chr72418 162 ------
NM_006380chr1754256 4136 3664 3407 3309 --13471 --
NM_006383chr151656 --1540 --
NM_006386chr224514 507 356 297 12442 22323 2291 11916
NM_006387chr1921221 98 ------
NM_006390chr124707 640 576 93 ------
NM_006391chr111324 ------
NM_006393chr1083970 3898 3680 3471 2972 2913 1252 1165 23178 2840 44542 3490 2885 2872 33051 1737 432
NM_006401chr92408 181 ------
NM_006403chr671548 1358 1347 1261 592 524 201 --1261 --
NM_006409chr7--1217 ----
NM_006411chr64844 688 202 182 1226 ----
NM_006416chr61697 ------
NM_006420chr2042829 2785 2263 410 ------
NM_006421chr82932 44 ------
NM_006434chr1052660 2495 1156 792 281 12271 ----
NM_006439chr41193 --1390 --
NM_006449chr241759 667 533 525 --11619 --
NM_006451chr5--1327 ----
NM_006457chr422509 1414 11334 24054 3533 --
NM_006459chr1041945 1638 1384 661 11663 ----
NM_006460chr1731245 210 180 1647 11595 11231
NM_006464chr2114542 4484 3081 3034 1871 1480 1431 947 642 488 250 1683 13788 23179 2891
NM_006467chr541613 512 345 326 12392 ----
NM_006471chr18165 --190 --
NM_006472chr14794 487 365 344 21025 916 ----
NM_006474chr121978 361 11691 ----
NM_006482chr1262822 2695 2388 1259 790 635 --1736 --
NM_006489chr1421702 1644 1196 ----
NM_006494chr19295 50 ------
NM_006496chr171569 1460 1326 1250 779 520 60 11610 ----
NM_006497chr172793 322 ------
NM_006504chr1042384 2024 1028 169 ------
NM_006510chr62846 332 ------
NM_006516chr131362 1276 1030 ------
NM_006517chrX72046 2022 1811 1778 931 194 37 --12197 --
NM_006519chr62328 33 ------
NM_006521chrX21420 1234 ------
NM_006524chr751073 828 408 240 156 ------
NM_006526chr202508 192 ------
NM_006529chr421496 1379 --11285 --
NM_006534chr20103006 2681 2323 2199 1231 1205 1169 1135 883 308 33284 2334 754 ----
NM_006538chr263064 1354 998 379 239 111 1592 ----
NM_006540chr81392 21519 193 1356 --
NM_006544chr1486050 4486 1726 1359 1333 1307 1030 205 26127 239 1343 --
NM_006546chr1766587 5787 5561 4309 2387 2182 44842 4459 2565 395 ----
NM_006547chr731848 1700 1309 1146 --1771
NM_006548chr331633 1520 561 --11340 --
NM_006557chr92438 301 ------
NM_006558chr84519 497 448 391 ------
NM_006559chr13835 250 55 ------
NM_006561chr10136173 5471 5021 4875 4864 4305 3795 2238 2066 1574 1132 833 678 34246 1877 1660 --11793
NM_006565chr1621118 1027 --1430 --
NM_006570chr91388 ------
NM_006571chr82242 236 152 ----
NM_006572chr1793468 2928 2599 2520 1167 1101 965 603 572 22402 125 --13205
NM_006574chr33136 87 69 ----1340
NM_006575chr1441454 1151 487 184 ------
NM_006577chr221261 856 11230 ----
NM_006584chr171121 ------
NM_006585chr211113 ------
NM_006587chr441054 461 250 25 157 ----
NM_006589chr13524 155 79 1574 ----
NM_006591chr1161650 1379 1331 450 377 123 ------
NM_006593chr25686 639 321 232 62 ------
NM_006595chr1142067 1997 208 179 1674 --12051
NM_006599chr16116432 5914 5493 5113 3104 1836 1723 1710 1590 1439 372 77816 6551 5589 2192 1139 640 581 11368 1423
NM_006601chr121885 ------
NM_006603chrX31921 1755 282 11725 --21380 262
NM_006609chr262630 2446 2383 2351 1065 140 1134 ----
NM_006612chr171423 ------
NM_006614chr353550 3287 2803 838 707 --11093 --
NM_006618chr141444 1387 1094 995 ------
NM_006620chr653902 1085 833 669 441 1362 --11888
NM_006621chr13405 182 123 2791 98 ----
NM_006622chr5----1401 1178
NM_006624chr1021828 158 ------
NM_006626chr921060 840 31051 663 270 1484 --
NM_006628chr15114591 3469 3139 3067 1185 1168 1004 932 708 653 402 22861 1413 21727 849 --
NM_006629chr1832541 1824 1767 --11126 --
NM_006636chr21912 1385 1746 --
NM_006640chr1711842 ------
NM_006646chr1372585 1972 950 539 446 267 103 --22243 1981 --
NM_006650chr52544 53 ------
NM_006654chr12114756 4450 4390 4366 4244 3576 3523 1850 1466 484 336 23275 360 ----
NM_006660chr15244 34 ------
NM_006667chrX21128 1012 ------
NM_006670chr62475 225 ------
NM_006675chr1222910 486 --12772 --
NM_006682chr732374 1057 125 12715 12780 --
NM_006690chr2021605 437 12035 ----
NM_006698chr2051436 1320 1213 548 180 ------
NM_006699chr142721 2522 2122 636 ----183
NM_006700chr122625 85 2281 148 --1523
NM_006703chr62177 76 ------
NM_006704chr131413 173 --1428
NM_006706chr53755 294 172 ------
NM_006708chr61434 1482 2875 868 --
NM_006713chr51340 --170 --
NM_006716chr721317 1265 149 11125 --
NM_006717chr963144 2305 1211 1159 1016 584 1530 1860 --
NM_006718chr631078 950 886 1994 ----
NM_006720chr10144877 4856 4800 4713 4116 3575 3378 3239 1868 1698 1218 1134 947 248 44915 4132 3779 496 23746 2047 --
NM_006722chr332923 2052 951 32896 85 46 --23056 843
NM_006724chr61482 ------
NM_006726chr421132 1084 1920 ----
NM_006727chr51356 ------
NM_006729chrX95422 5272 5159 4832 3906 3690 2119 1878 1134 11891 ----
NM_006731chr985853 5009 4945 4515 4229 2146 257 34 ----14084
NM_006734chr651605 1228 538 451 132 --21413 1119 --
NM_006735chr7--1100 ----
NM_006745chr42957 301 1894 --11102
NM_006749chr821263 1034 ------
NM_006750chr16187778 7633 7222 7067 6153 5549 5448 5418 4899 2770 2723 2715 2631 1904 1801 1470 727 408 22643 2284 21506 1264 --
NM_006751chr23979 411 403 ------
NM_006754chr731226 999 137 ------
NM_006761chr178843 763 690 612 263 231 223 178 ------
NM_006763chr1--1594 11859 --
NM_006765chr8151 ------
NM_006766chr862503 2325 2155 1054 950 893 1646 --1707
NM_006769chr1----1493 --
NM_006772chr641780 1614 1294 1249 ------
NM_006773chr271551 1370 570 461 334 244 204 1582 ----
NM_006775chr653031 2982 2947 2057 188 32840 2501 2451 ----
NM_006777chrX52936 2925 2443 817 303 ------
NM_006788chr1831459 452 331 ------
NM_006790chr52382 158 ------
NM_006791chr15266 53 --1421 --
NM_006805chr52182 44 1623 ----
NM_006806chr21180 ------
NM_006807chr172980 963 ----11239
NM_006808chr9156 ------
NM_006810chr3123 ------
NM_006811chr203847 295 275 ------
NM_006815chr1261122 1021 960 545 303 205 ------
NM_006818chr11867 ------
NM_006819chr111335 ------
NM_006822chr171247 --1197 --
NM_006826chr21458 ------
NM_006827chr1443312 384 135 116 22245 1067 33079 2973 2912 --
NM_006828chr61515 1226 ----
NM_006838chr1241657 1649 1343 388 ------
NM_006842chr111105 ------
NM_006846chr52373 344 --1132 --
NM_006851chr1232808 2444 54 ------
NM_006852chr1792727 2573 2491 1124 1067 934 420 128 119 ------
NM_006854chr721714 110 --11582 --
NM_006861chr1222109 683 1348 1339 --
NM_006873chr263505 2628 1326 452 375 178 1882 --1531
NM_006874chr421072 823 ------
NM_006875chrX4788 778 614 255 ------
NM_006876chr112496 37 ----1505
NM_006884chr351772 1622 1363 1351 352 ------
NM_006885chr16134057 3407 3394 2843 1338 1332 1073 1037 945 929 687 434 191 1260 24024 1601 --
NM_006886chr201166 ------
NM_006887chr23541 464 200 ------
NM_006888chr1493353 3293 2800 2572 2337 1340 1169 550 67 ----12775
NM_006892chr2051254 292 163 133 90 ------
NM_006892chr2051254 292 163 133 90 ------
NM_006893chr1----182 --
NM_006895chr261659 1460 739 589 561 448 --12001 --
NM_006896chr71189 ------
NM_006906chr111166 ------
NM_006908chr741465 964 572 294 --122 --
NM_006913chr6--1296 ----
NM_006914chr91181 ------
NM_006915chrX62528 2474 2111 1742 321 75 --1809 12389
NM_006918chr11105769 5706 5403 5123 4316 1974 1706 1560 1452 436 35136 1933 865 14735 --
NM_006920chr231781 1607 1302 ------
NM_006922chr231796 1711 1019 ------
NM_006924chr1784139 3183 2886 1128 632 347 330 127 23727 3263 --13944
NM_006925chr14199 1204 1333 --
NM_006930chr531877 1364 557 --21574 205 --
NM_006931chr1252151 1646 1586 286 178 ------
NM_006937chr172599 38 ------
NM_006939chr1441175 1035 139 109 --1325 --
NM_006940chr1211595 ------
NM_006947chr441683 1423 502 125 ------
NM_006948chr2141738 1603 582 362 --11920 --
NM_006950chrX2777 71 ------
NM_006951chr102830 24 ------
NM_006959chr192332 93 ------
NM_006980chr7--1228 ----
NM_006981chr9102936 2880 2631 2578 2395 2253 2199 1943 292 154 1792 12975 --
NM_006988chr2131289 1034 273 --11224 --
NM_006996chr111298 1109 1623 --
NM_006997chr102369 180 --1329 --
NM_007005chr921070 567 ------
NM_007006chr1693535 3379 2870 2807 2792 2269 2184 398 108 11188 13114 12207
NM_007007chr12124106 3769 3674 3658 3358 1808 1802 1737 1544 687 623 83 34845 3148 1372 2346 248 11273
NM_007010chr1751920 1461 1227 685 651 ------
NM_007011chr15114630 4242 2720 2549 2499 1932 1147 945 354 280 161 16823 1247 --
NM_007013chr84814 782 409 134 --130 --
NM_007014chr1611777 ------
NM_007017chr52891 655 ------
NM_007026chr172569 243 ------
NM_007027chr3--1141 ----
NM_007033chr11572 ----1593
NM_007034chr1--1110 ----
NM_007035chr125740 687 611 555 195 --1157 --
NM_007036chr51353 1847 ----
NM_007039chr1422095 510 ------
NM_007040chr193958 772 264 ------
NM_007043chr1252161 1863 143 101 38 2697 337 ----
NM_007045chr61591 ------
NM_007050chr20148036 7379 6823 6695 6504 6072 2999 2712 1630 912 701 694 330 59 --46023 5100 446 308 --
NM_007052chrX3382 211 194 1549 ----
NM_007067chr1721556 1362 21258 594 185 --
NM_007073chr684191 4034 3816 3717 1445 190 161 81 1239 ----
NM_007078chr1052906 2487 2148 586 387 ------
NM_007096chr9292 60 ------
NM_007106chr1332601 1735 202 22422 693 ----
NM_007107chr332321 2010 557 32086 1574 402 ----
NM_007114chr352788 2606 1050 840 672 32670 2518 1015 ----
NM_007121chr191355 ------
NM_007123chr121107 470 1288 1121 --
NM_007124chr631774 1675 738 11948 ----
NM_007125chrY2420 40 ------
NM_007126chr9------1467
NM_007129chr1341029 834 397 314 --1765 --
NM_007139chr731178 1120 1059 1834 ----
NM_007144chr1721298 96 ------
NM_007146chr1732769 2450 1933 ------
NM_007158chr111001 11014 ----
NM_007159chr321592 292 1706 11450 --
NM_007166chr1131603 1266 398 ------
NM_007170chr13371 361 337 ------
NM_007172chr2253213 2557 2404 328 123 ----1377
NM_007173chr1151874 1579 645 234 44 11573 ----
NM_007174chr1262319 2161 1898 1744 275 182 11985 ----
NM_007175chr843411 3248 3215 516 1557 12234 --
NM_007185chr11235 ------
NM_007190chr1031023 422 29 ------
NM_007191chr123661 459 205 ------
NM_007192chr141968 ----2395 226
NM_007195chr1873419 3327 3158 2796 2771 923 72 33507 3235 2897 12802 --
NM_007197chr1251039 754 296 243 54 ------
NM_007198chr821524 1445 ------
NM_007202chr17--1544 ----
NM_007203chr963794 3609 2955 2908 1041 633 --12806 13042
NM_007207chr11670 1176 ----
NM_007212chr13774 571 240 ------
NM_007214chr62886 850 2453 125 ----
NM_007216chr112380 133 ------
NM_007218chr81276 1714 ----
NM_007219chr204952 863 133 115 ------
NM_007222chr841781 1504 1440 709 --11271 --
NM_007225chr1711009 --21029 369 --
NM_007229chr22----1112 1283
NM_007232chr201325 ------
NM_007236chr1592401 1900 959 837 639 483 421 339 232 12359 ----
NM_007238chr2024488 347 14913 14812 11564
NM_007242chr161243 ------
NM_007245chr161834 ------
NM_007246chr42293 190 11058 1353 --
NM_007249chr13119273 9100 8890 8790 8080 7068 2419 1395 1359 1207 155 38518 2679 995 39056 8481 7941 --
NM_007250chrX2373 170 ------
NM_007256chr1121601 1572 --11669 --
NM_007259chr12382 37 ------
NM_007260chr11763 1541 ----
NM_007271chr651685 715 671 57 38 21236 73 ----
NM_007276chr72943 281 ------
NM_007278chr17--166 ----
NM_007282chr32234 228 1148 ----
NM_007286chr532080 2073 1778 ------
NM_007287chr353253 3101 2432 2262 687 11277 ----
NM_007288chr353253 3101 2432 2262 687 11277 ----
NM_007289chr353253 3101 2432 2262 687 11277 ----
NM_007313chr951815 1790 1751 1605 756 --1748 1623
NM_007315chr211238 11353 ----
NM_007324chr1----2420 94 --
NM_007331chr461948 935 891 797 263 131 12345 12557 --
NM_007345chr1862153 1868 1760 1523 1479 205 11452 11874 --
NM_007347chr1531986 943 824 ------
NM_007349chr7--1454 193 --
NM_007353chr74829 411 286 62 12848 22500 1020 12263
NM_007358chr141518 737 578 79 ------
NM_007361chr142265 153 ------
NM_007362chr331511 246 178 ------
NM_007363chrX3945 850 821 1884 ----
NM_007372chr175846 775 714 225 175 ------
NM_007373chr1051797 1591 1346 1225 510 ------
NM_007375chr121029 464 1779 ----
NM_009585chr32178 167 --1312 --
NM_009585chr32178 167 --1312 --
NM_012064chr1231078 1051 155 ----1422
NM_012073chr521211 1137 --1197 --
NM_012074chr142238 123 ------
NM_012081chr553694 2940 2298 916 180 22848 2599 1408 --
NM_012082chr82647 330 1796 ----
NM_012084chrX1445 ------
NM_012089chr151408 1349 1151 298 254 ------
NM_012090chr131166 1065 497 ------
NM_012093chr121069 87 11259 ----
NM_012096chr32379 310 ------
NM_012097chr261894 1756 1407 845 777 358 ------
NM_012102chr142245 2231 1935 525 --143 --
NM_012104chr1143401 1440 799 238 1534 11486 --
NM_012104chr1143401 1440 799 238 1534 11486 --
NM_012105chr213929 697 660 3753 165 158 ----
NM_012108chr4161 ------
NM_012110chr41230 ------
NM_012115chr61391 ------
NM_012124chr113182 135 83 ------
NM_012137chr182425 2170 2143 1889 495 483 371 115 22908 349 ----
NM_012139chr11127 ------
NM_012141chr1371567 1372 611 531 497 273 256 13044 12637 --
NM_012142chr15166 ------
NM_012153chr1172480 1839 1735 1727 908 772 326 --1847 --
NM_012156chr2033051 2449 459 12499 13414 --
NM_012158chr1331854 1379 715 ------
NM_012164chr9167105 6672 6436 5980 5772 5741 5699 5201 4723 2857 2237 1895 1796 1653 466 380 37455 404 286 26208 6114 16274
NM_012174chr1231121 552 483 1768 ----
NM_012193chr11105341 5195 5089 4787 4552 1715 1487 1466 984 711 ----21968 1901
NM_012197chr941604 1476 1364 47 ------
NM_012198chr23668 99 44 --1200 --
NM_012199chr1103457 3322 3295 3279 2893 1505 1464 1139 954 816 ------
NM_012207chr1031025 993 77 ------
NM_012214chr2105827 5729 4541 2358 2291 2152 2053 545 535 98 45897 1979 1877 352 ----
NM_012215chr1021784 542 --11767 --
NM_012218chr191824 --2610 358 --
NM_012223chr23245 115 106 ------
NM_012224chr421025 770 ------
NM_012229chr1021453 1311 ------
NM_012233chr21764 --1944 --
NM_012234chr343625 1254 899 432 1189 23473 3284 --
NM_012238chr1031630 1404 1181 21717 483 1689 --
NM_012247chr104978 896 296 282 ------
NM_012248chr164716 673 495 258 ------
NM_012249chr263399 2892 2832 2495 2478 1242 12211 1407 --
NM_012250chr1141198 525 357 258 ------
NM_012252chr794987 4783 4473 3782 3529 3446 1208 811 283 13563 14883 --
NM_012257chr721054 942 152 1918 --
NM_012259chr621063 975 2346 228 ----
NM_012262chr164518 3929 3338 1996 1980 328 128 24683 1066 --
NM_012272chr12----1163 --
NM_012281chr732094 1856 1756 22157 2062 22198 961 --
NM_012286chrX5471 406 85 69 56 ------
NM_012287chr3104345 4248 3631 3114 1323 1231 745 695 452 312 23970 1543 ----
NM_012288chr6145084 5072 4728 3930 3819 3563 1295 1130 890 342 323 271 165 31 23861 3495 25647 1698 23908 1962
NM_012290chr221279 1246 ------
NM_012294chr784074 3352 2954 2749 2632 1530 903 794 31256 446 242 ----
NM_012295chr221412 ------
NM_012296chr1143424 2473 511 81 12769 13725 --
NM_012297chr432100 419 59 ------
NM_012300chr532443 1781 663 1484 ----
NM_012301chr73891 649 47 --11746 --
NM_012302chr111174 2980 106 ----
NM_012308chr1142426 2169 815 713 11784 1432 --
NM_012309chr11104148 3745 3738 3388 3314 3307 1805 1165 1127 631 21618 1379 2345 34 --
NM_012316chr1125440 5261 4136 4073 4062 3667 1941 1914 1605 602 586 573 15132 35275 5198 513 1135
NM_012325chr2061567 1549 1192 1009 187 75 11621 ----
NM_012328chr721320 248 11163 1910 --
NM_012329chr1731357 1258 468 1121 ----
NM_012330chr1051583 1498 1255 1143 368 ------
NM_012333chr111171 --2473 444 --
NM_012342chr101199 149 ----
NM_012343chr511033 --1107 --
NM_012347chr652018 1943 971 180 30 12838 ----
NM_012382chr594212 3541 3506 3463 1385 882 773 432 355 2307 49 --24381 1711
NM_012383chr9----143 --
NM_012388chr1573165 2932 2446 2330 2041 524 358 32181 973 490 1817 12371
NM_012395chr753416 2797 1244 1065 287 1579 ----
NM_012399chr2221967 1429 ------
NM_012408chr201871 --1219 --
NM_012412chr72831 153 ------
NM_012414chr13712 329 117 ------
NM_012416chr92454 120 ------
NM_012417chr17--1539 ----
NM_012421chr11369 ------
NM_012425chr1062742 2157 1675 246 164 63 1287 ----
NM_012426chr164347 315 151 137 ------
NM_012428chr156801 758 732 680 382 239 ------
NM_012430chr31519 1668 ----
NM_012432chr11297 2345 29 ----
NM_012446chr51153 ------
NM_012448chr175967 645 522 496 55 191 1564 --
NM_012453chr751344 1293 218 177 153 21466 1141 ----
NM_012460chr14--126 ----
NM_012464chr472533 2423 2139 1866 744 701 340 --1269 --
NM_012471chrX51931 1362 632 589 301 --1166 11607
NM_012479chr732595 2372 2050 1831 11839 --
NM_012482chr12684 625 ------
NM_013227chr15295 87 ------
NM_013229chr1282760 2742 2308 1096 1049 404 164 94 1796 --11727
NM_013231chr1453814 2814 1528 1137 225 31597 1409 45 23786 3774 13571
NM_013232chr54376 325 290 102 ------
NM_013233chr221278 1248 ------
NM_013245chr162282 214 1730 ----
NM_013255chr7148567 8313 7431 7334 7227 6854 5818 5643 5497 3032 1813 1349 628 55 17063 26026 2219 12034
NM_013257chr842284 2251 1937 205 --1406 --
NM_013261chr472535 1458 1137 974 790 279 265 13429 12962 --
NM_013263chr16165 ------
NM_013264chr11190 1196 ----
NM_013269chr121776 13382 ----
NM_013277chr1241096 967 226 114 ------
NM_013281chr2041447 1348 1006 344 ------
NM_013282chr1941289 874 230 76 11102 ----
NM_013283chr52856 803 --1136 --
NM_013286chr333018 2324 163 ------
NM_013293chr72279 139 ------
NM_013300chr121241 ------
NM_013302chr1694462 2958 1475 1365 1328 1262 1118 1029 653 1150 13813 --
NM_013305chr182862 618 1767 ----
NM_013309chr1522623 2179 --12663 --
NM_013316chr71923 ------
NM_013320chr121132 ------
NM_013322chr71365 11095 1512 --
NM_013326chr18166 ------
NM_013336chr33651 281 174 ----11654
NM_013341chr262847 1190 1183 1080 251 212 ------
NM_013348chr1911012 ----1376
NM_013351chr171717 --1265 --
NM_013354chr8--1486 11460 1912
NM_013357chr81833 ------
NM_013365chr221529 ------
NM_013372chr1532361 2143 531 ------
NM_013373chr22----1728 --
NM_013381chr1242403 2095 229 58 1883 ----
NM_013386chr151739 1562 1264 387 151 11519 ----
NM_013396chr2131277 293 47 --21549 261 1626
NM_013423chrX3289 262 95 --1507 --
NM_013427chrX3289 262 95 --1507 --
NM_013433chr1932059 1772 1649 ------
NM_013437chr8----2970 389 --
NM_013438chr951816 1689 306 90 51 ------
NM_013443chr931109 874 222 ------
NM_013444chrX51141 972 219 85 53 11120 ----
NM_013446chr721427 544 ------
NM_013448chr141698 ------
NM_013449chr1262368 2249 1986 1854 855 189 ------
NM_013943chr183086 3017 2727 2696 2515 2017 620 53 23214 343 ----
NM_013958chr8129 ------
NM_013959chr8129 ------
NM_013961chr8129 ------
NM_013962chr8129 ------
NM_013995chrX102418 2407 1946 1610 892 644 581 565 414 104 1595 ----
NM_014000chr1041954 1805 1758 695 ------
NM_014011chr222325 94 22161 2128 ----
NM_014015chr162715 647 ------
NM_014021chr142980 2345 1202 697 ------
NM_014023chr1062076 1850 630 192 128 63 --11174 --
NM_014035chr52393 172 ------
NM_014038chr71423 ------
NM_014043chr341671 420 256 161 11556 21615 1595 --
NM_014044chr2161 ------
NM_014048chr1665237 4887 4303 4202 1630 553 --11957 --
NM_014055chr122397 193 ------
NM_014059chr131291 ------
NM_014071chr201185 ------
NM_014089chr1342119 1877 835 176 1417 ----
NM_014106chr1532974 2892 392 1794 ----
NM_014109chr8--1947 1881 --
NM_014110chr141079 1036 881 249 --1905 --
NM_014112chr8125360 4680 4382 4034 3675 1858 1685 1013 846 816 713 137 34593 153 44 25439 1743 --
NM_014117chr1631672 352 175 12450 11961 --
NM_014141chr7104256 3807 3528 3474 3446 2148 1689 906 436 246 54324 3314 388 154 87 ----
NM_014153chr163625 617 248 ------
NM_014154chr331231 352 168 ----1548
NM_014155chr1175896 5727 1998 1198 1098 1000 156 47011 2978 1369 619 17130 --
NM_014170chr31403 --1326 --
NM_014176chr1137 ------
NM_014181chr22821 524 3881 716 600 1740 --
NM_014189chr411411 ------
NM_014190chr421763 1143 ------
NM_014191chr121823 ------
NM_014217chr141829 1227 352 56 ------
NM_014223chr11491 1299 ----
NM_014236chr11238 ------
NM_014240chr342528 1065 506 202 --31349 1113 918 --
NM_014241chr103305 272 26 ------
NM_014243chr421778 174 11325 ----
NM_014250chr2232024 1896 181 ------
NM_014251chr74842 647 127 104 1770 ----
NM_014252chr134301 117 103 66 ------
NM_014253chrX32337 2130 789 1544 1206 --
NM_014263chr1031153 525 484 31485 254 95 ----
NM_014264chr41222 1543 ----
NM_014268chr181273 ------
NM_014271chrX1699 ------
NM_014278chr42107 96 ------
NM_014279chr93820 629 399 ------
NM_014280chr13840 162 110 ------
NM_014282chr921222 106 --1932 --
NM_014283chr141271 373 346 46 ------
NM_014284chr11133 11023 ----
NM_014286chr983125 2559 1287 1247 1035 625 546 319 --23646 333 --
NM_014288chr12222 216 ------
NM_014292chr2231731 609 59 ----1696
NM_014294chr831206 332 104 ----185
NM_014299chr1951933 1804 1649 640 576 ----11444
NM_014305chr133676 531 103 ------
NM_014309chr22125373 5311 4869 4735 4614 4200 3562 3307 1044 617 205 161 --22179 2173 23796 1737
NM_014313chr1176 ----1522
NM_014316chr1652015 1984 1533 598 511 --11547 --
NM_014319chr1271775 1279 765 365 347 84 61 --11507 --
NM_014323chr222786 657 ------
NM_014325chr1272223 1931 1739 1610 392 232 217 ------
NM_014329chr16----1343 --
NM_014330chr19--179 ----
NM_014332chrX1367 ------
NM_014333chr1162634 2164 1927 1879 467 168 ------
NM_014335chr1521056 63 1436 ----
NM_014342chr113427 152 93 ------
NM_014345chr6------1767
NM_014351chr221333 --11239 --
NM_014352chr1131407 331 135 ----1208
NM_014360chr141587 ------
NM_014361chr11----125 --
NM_014363chr1331069 851 455 --1122 --
NM_014365chr121887 ------
NM_014372chr141831 1821 500 58 ------
NM_014376chr521011 248 11840 ----
NM_014382chr331397 581 494 11342 1217 --
NM_014390chr7------1505
NM_014393chr832013 203 79 --11649 1809
NM_014394chr1041167 983 800 453 11150 1892 --
NM_014397chr921086 433 ------
NM_014405chr1742026 816 341 48 --1451 1465
NM_014408chr1--2619 94 ----
NM_014410chr182342 254 --1359 --
NM_014415chr331264 391 37 1535 1229 --
NM_014419chr19176 ------
NM_014423chr5104654 4056 3776 3643 2237 1957 1576 1337 1166 211 --32222 1263 1084 --
NM_014431chr1031692 1379 1143 --168 --
NM_014432chr641276 589 308 25 ------
NM_014445chr321955 1664 1440 ----
NM_014447chr461480 1321 1097 645 239 115 21120 1087 ----
NM_014452chr62405 173 ------
NM_014454chr62307 238 1739 --11052
NM_014455chr11433 1472 ----
NM_014456chr1021704 256 ------
NM_014458chr121393 1047 1915 ----
NM_014462chr81264 ----129
NM_014469chr111621 1311 1155 --
NM_014470chr122747 642 ------
NM_014488chr112625 511 --1268 --
NM_014491chr72310 272 1250 ----
NM_014494chr1671692 1548 898 747 475 387 350 ------
NM_014498chr32350 129 ------
NM_014504chr742007 1802 1496 802 ------
NM_014515chr12139 ------
NM_014522chrX1229 ------
NM_014552chr221467 1022 ------
NM_014554chr1291932 1644 1626 1444 600 364 254 168 47 --11845 --
NM_014570chr222857 261 1153 ----
NM_014572chr13101739 1511 1448 1184 1113 670 573 563 205 140 1171 ----
NM_014574chr141432 --1401 --
NM_014577chr224741 316 270 103 1286 ----
NM_014584chr1421410 1124 --1119 --
NM_014585chr21387 ------
NM_014586chr2144485 4301 3749 1804 34094 3541 1419 --13221
NM_014587chr1621587 1550 ------
NM_014592chr5199 1213 ----
NM_014606chr421417 1146 ------
NM_014608chr151117 1200 2380 182 --
NM_014612chr931343 1089 528 1312 --11211
NM_014613chr562381 1214 942 884 746 361 12079 12448 --
NM_014614chr221037 30 ------
NM_014615chr1682377 2321 1266 965 647 602 586 371 --1416 --
NM_014616chr352753 1059 868 830 468 ------
NM_014620chr122529 114 ------
NM_014630chr1563980 852 342 256 241 229 --1919 --
NM_014633chr111579 ------
NM_014634chr2242794 2591 2260 677 1389 1249 --
NM_014635chr231378 1176 80 11593 ----
NM_014636chr984244 4187 3755 3537 2949 1238 400 230 ------
NM_014637chr831017 573 528 --1174 11223
NM_014646chr1893080 3038 3015 2891 2317 2222 2033 797 68 12025 21255 1002 --
NM_014647chr1632236 1808 1632 ------
NM_014655chr172285 1996 773 622 488 377 370 --1161 --
NM_014659chr1511092 ------
NM_014660chr73371 273 164 ------
NM_014663chr11391 ------
NM_014665chr832779 2313 702 13642 ----
NM_014666chr51951 1435 ----
NM_014667chr332481 2311 370 1385 11622 --
NM_014670chr241595 1219 1163 75 11377 ----
NM_014671chr72564 200 --11039 --
NM_014674chr343985 3954 2999 826 11606 12498 --
NM_014676chr141643 1417 1165 438 11149 ----
NM_014677chr811290 ------
NM_014682chr842203 1762 443 184 11728 ----
NM_014683chr1722015 1838 11509 22021 830 --
NM_014685chr161492 --1132 --
NM_014686chr1941917 1874 1849 470 --22016 331 --
NM_014689chr21560 ------
NM_014690chr793071 2780 2634 2566 1893 1013 660 427 355 --22652 813 --
NM_014699chr161317 ------
NM_014701chr1542452 873 164 136 22753 898 1747 --
NM_014703chr34852 220 186 30 ------
NM_014705chr721600 260 1772 31983 1765 581 21772 552
NM_014707chr732266 2225 1970 ------
NM_014709chr22405 145 ------
NM_014711chr1621373 808 1710 1722 11991
NM_014713chr24149 114 80 40 ------
NM_014720chr1051484 580 432 265 35 11403 ----
NM_014721chr6217346 6838 6830 6655 6328 6309 6137 5968 5503 5376 5048 4800 4712 2716 2270 1954 1755 1427 729 564 212 22183 874 ----
NM_014723chr2063214 3197 2340 2333 716 297 ------
NM_014726chr1741211 561 303 184 ------
NM_014729chr852217 1760 1531 1521 725 ------
NM_014730chr12105021 4540 4433 4339 3787 3387 3234 1761 1636 973 24755 247 31735 1353 1192 --
NM_014730chr12105021 4540 4433 4339 3787 3387 3234 1761 1636 973 24755 247 31735 1353 1192 --
NM_014733chr542095 1871 351 129 ------
NM_014735chrX41694 1568 1542 1497 1384 11468 --
NM_014737chr2011185 21642 219 11099 --
NM_014738chr171218 1246 ----
NM_014739chr664046 3748 1385 1215 1195 1131 33969 3424 1363 ----
NM_014742chr2061614 1316 1270 1182 1124 233 --11111 --
NM_014743chr4122953 2441 2369 2163 953 783 651 563 382 290 210 146 ------
NM_014746chr284415 3614 3041 1322 982 846 770 95 2638 557 23144 1114 --
NM_014751chr821880 1659 2249 125 1407 --
NM_014752chr115558 513 429 287 242 ------
NM_014755chr294270 3985 3475 3157 2652 1669 1589 1062 996 21402 1009 24098 2769 13925
NM_014756chr112386 331 ------
NM_014757chr542085 1946 1757 573 1546 ----
NM_014759chr82292 169 --11079 --
NM_014761chr161854 --11095 --
NM_014762chr152511 2324 2195 848 546 --1383 --
NM_014764chr121309 ------
NM_014765chr132502 1038 54 ------
NM_014767chr1062818 2595 993 894 495 322 12336 ----
NM_014779chr33822 152 67 ------
NM_014781chr821013 389 ------
NM_014782chrX2281 83 ------
NM_014787chr172809 2799 2653 847 841 535 419 ------
NM_014791chr91287 ------
NM_014795chr211044 21398 1227 ----
NM_014802chr121142 ------
NM_014803chr1052607 2378 861 413 310 1923 ----
NM_014804chr171172 ------
NM_014810chr183414 3387 3056 3028 1272 1198 731 251 21386 381 ----
NM_014811chr91193 ------
NM_014812chr121848 240 ------
NM_014813chr11555 ------
NM_014819chr531952 480 441 12136 ----
NM_014820chr392056 1483 1470 1427 1274 819 653 589 197 ------
NM_014822chr43617 98 54 ------
NM_014824chr1141809 1600 1490 790 198 21719 419 --
NM_014827chr131584 1563 342 21064 227 ----
NM_014828chr1422543 201 --12207 --
NM_014830chr1243307 2888 1542 593 1251 1219 --
NM_014836chr1031488 495 138 ------
NM_014838chr2242894 2770 2095 351 --21757 430 --
NM_014839chr112188 1843 11866 --
NM_014840chr1252321 2203 1255 1037 179 1872 ----
NM_014841chr631175 965 282 2382 203 ----
NM_014848chr1542707 2379 2287 1129 ----12614
NM_014850chr364038 3540 3427 3293 1589 1427 13590 ----
NM_014859chr172223 104 2259 242 ----
NM_014862chr1551477 1461 1365 1158 835 34130 402 305 13871 --
NM_014868chr121848 1620 167 --
NM_014870chr194733 4248 2953 1765 1383 1051 783 747 655 ----11801
NM_014872chr93605 107 55 1630 12004 --
NM_014873chr163900 3823 3715 1197 663 613 ----11511
NM_014876chr2252191 2180 1915 1795 603 ------
NM_014877chr17127726 7290 6945 5642 5618 2983 2707 2606 1968 1688 521 215 26129 1279 15667 --
NM_014888chr731595 1433 985 1132 ----
NM_014892chr63176 91 31 ------
NM_014893chrY62347 1829 768 670 456 426 ------
NM_014897chr1722054 321 --1449 --
NM_014899chr562766 2197 2059 817 595 556 22319 1047 11016 --
NM_014902chr2031391 251 159 ------
NM_014903chr123755 369 36 ------
NM_014904chr1063672 3312 3293 3147 2929 2617 2685 593 13022 --
NM_014906chr1753922 3895 3642 1238 1191 24034 2958 1723 --
NM_014909chr1433449 2727 36 ------
NM_014912chr1062732 2670 2187 1309 778 347 --1690 --
NM_014913chr1821071 342 1263 ----
NM_014914chr211007 ----11296
NM_014917chr12966 697 1723 ----
NM_014918chr1561349 1295 1284 587 402 190 21194 276 ----
NM_014920chr693757 3074 2657 2613 2375 634 545 513 198 12953 ----
NM_014921chr1943127 2821 2153 1117 --1626 --
NM_014923chr133730 592 73 ------
NM_014924chr1472807 2627 2172 909 720 456 45 1427 ----
NM_014925chr121177 --1291 --
NM_014926chr32247 29 ------
NM_014934chr1333960 3577 982 23938 3794 ----
NM_014937chr1041286 403 61 32 ------
NM_014938chr1252424 2253 2236 2170 810 ------
NM_014939chr1821272 961 21357 1195 ----
NM_014942chr612187 22638 34 ----
NM_014944chr141204 963 591 193 ------
NM_014945chr541340 517 121 83 --11980 --
NM_014946chr253052 2963 2675 1137 614 ------
NM_014947chr162935 766 699 473 256 170 31225 1137 129 12784 --
NM_014949chr12856 238 1711 ----
NM_014950chr1411432 ------
NM_014951chr1042514 2473 2365 1930 1789 --11672
NM_014952chr152834 126 12040 --11843
NM_014953chr1374184 4110 3838 3320 2780 2647 751 23628 3314 ----
NM_014961chr481934 1887 1862 1622 1405 1383 873 506 1614 --11547
NM_014962chr2072539 2452 2429 1790 344 214 184 ----1889
NM_014964chr1752136 1616 691 445 111 1525 ----
NM_014969chr13940 448 253 11207 ----
NM_014974chr1021786 378 ------
NM_014977chr143503 354 187 ------
NM_014978chr1071664 1374 1130 721 558 329 101 --21775 1336 --
NM_014982chr1495369 5045 4935 4288 4093 1805 1625 1379 1125 24037 453 --11021
NM_014988chr432820 144 122 ------
NM_014989chr652034 1596 1382 1279 419 1468 ----
NM_014990chr141945 ------
NM_014991chr453132 2195 2150 374 312 ----12720
NM_014992chr141772 ----1718
NM_014999chr1211148 --11692 --
NM_015000chr1263021 2826 2167 783 569 189 22007 1025 11215 --
NM_015001chr12634 380 ------
NM_015002chr122879 165 1679 ----
NM_015008chr362711 2692 2638 2548 1069 965 22660 579 12685 --
NM_015013chr12214 62 ------
NM_015015chr191350 ------
NM_015020chr1663571 3293 2369 1089 1035 779 21451 332 ----
NM_015023chr131648 1325 432 ------
NM_015024chr831406 1082 99 --11290 --
NM_015025chr242243 446 47 27 ------
NM_015026chr1284597 4451 4196 3156 3121 3114 800 101 ----21903 1248
NM_015027chr165792 707 545 365 304 --12020 11404
NM_015032chr1352802 2676 2653 2256 311 2901 480 1653 11049
NM_015035chr20116538 5212 5200 4614 2280 1749 1228 1067 747 314 222 26709 4068 25769 4630 11731
NM_015039chr184208 4195 4108 3512 3416 2865 547 484 11342 21651 431 --
NM_015040chr253388 2822 2724 2633 117 13209 22866 2388 --
NM_015042chr1544379 2780 1190 931 12971 11045 11468
NM_015044chr1673027 2878 2618 2113 829 550 51 --13081 12120
NM_015045chr103827 519 299 2664 628 21379 480 --
NM_015051chr943278 2604 1118 362 ------
NM_015054chr123431 353 189 ------
NM_015056chr2152561 725 628 527 194 11050 135 --
NM_015057chr131167 1209 ----
NM_015059chr1532984 2590 577 --1326 --
NM_015061chr9--1594 --1652
NM_015063chr191963 1858 166 --
NM_015064chr121450 32840 578 365 22849 1308 --
NM_015068chr773851 3434 3376 3192 1011 720 459 ------
NM_015069chr162606 234 ------
NM_015071chr586396 5724 5159 4336 2470 2235 2152 2101 1960 26410 438 --
NM_015074chr1124900 4666 4599 4523 4494 911 722 667 485 360 192 90 33829 3514 78 24874 939 1753
NM_015075chrX32053 1997 1658 ------
NM_015076chr6134531 4350 3537 3281 3104 1458 1357 1240 1055 1008 359 189 163 24480 1504 14283 24458 3727
NM_015086chr121243 --1427 --
NM_015087chr1362407 2379 2230 651 575 182 12658 ----
NM_015090chr196240 6031 5888 5730 5396 5110 4077 1326 744 1422 11183 --
NM_015091chr142787 548 ------
NM_015092chr1684609 4502 4012 3612 3109 3073 1459 948 ----23184 3139
NM_015093chr63725 630 505 1682 ----
NM_015094chr2251221 1157 1017 860 801 11168 ----
NM_015097chr32813 398 21732 738 ----
NM_015100chr121727 1582 11912 ----
NM_015107chrX72035 1966 1809 532 304 124 62 11830 ----
NM_015110chr942398 2380 767 121 --1224 --
NM_015115chr463009 2034 1043 795 181 99 21269 975 --12827
NM_015120chr2171 ------
NM_015122chr191211 ------
NM_015124chr2242389 2054 1765 834 --1108 --
NM_015129chrX61607 1582 1483 1439 506 396 11139 11732 --
NM_015130chr461168 1135 443 387 201 59 ------
NM_015132chr741344 730 702 150 ------
NM_015137chr82705 477 21648 100 21839 642 --
NM_015138chr1562567 2547 963 936 276 238 --12806 --
NM_015143chr42503 285 ------
NM_015144chr1653808 3245 1282 1092 257 12930 ----
NM_015147chr262173 1155 942 620 588 218 --12403 --
NM_015149chr142182 2131 1861 839 ------
NM_015153chr61626 ------
NM_015155chr1043310 1329 1011 371 1164 ----
NM_015156chr14123702 3485 3364 3308 2868 1314 1252 863 499 459 320 262 13787 11430 --
NM_015158chr91835 --1616 --
NM_015163chr1471878 1778 1669 749 492 285 34 ------
NM_015170chr811663 21887 1611 1217 11871
NM_015172chr11434 ------
NM_015176chr151616 1399 1143 497 427 --1707 --
NM_015178chr852491 853 692 134 64 ------
NM_015180chr14------1693
NM_015187chr41269 ------
NM_015192chr2062910 2887 2841 2490 2001 1983 ------
NM_015197chr1443388 2137 595 555 --21269 308 1700
NM_015198chr751287 1256 521 259 107 1420 ----
NM_015199chr332534 980 50 21902 1103 12494 --
NM_015200chr442478 2394 933 520 1205 11010 --
NM_015202chr1621710 1322 --11482 --
NM_015206chr1573751 2838 2575 551 543 450 317 13697 1808 --
NM_015208chr1823511 912 21519 75 ----
NM_015215chr172779 2722 2396 2017 1944 731 41 1617 12085 --
NM_015219chr1742094 673 243 170 22470 2322 22479 1672 --
NM_015225chr932611 382 30 12008 32594 2223 537 --
NM_015226chr1633201 625 613 --1456 --
NM_015227chr2143310 3254 3090 135 --1353 --
NM_015229chr1711147 ------
NM_015230chr4--11766 ----
NM_015233chr1322271 830 ----1258
NM_015236chr42364 220 ------
NM_015238chr5--1541 1117 --
NM_015239chr91458 ------
NM_015245chr672580 2246 2121 1855 560 531 132 ------
NM_015247chr1665239 3352 1859 753 708 402 34674 4518 3632 1160 --
NM_015250chr931566 1440 322 1352 ----
NM_015251chr1632072 504 142 22346 2288 ----
NM_015252chr21376 ------
NM_015254chr872770 2241 2066 1977 1054 335 123 148 ----
NM_015263chr152855 367 ------
NM_015264chr2294173 4048 4009 3997 3558 3339 3264 1314 649 23981 3723 14250 1429
NM_015265chr262591 2468 2211 563 503 158 12481 ----
NM_015267chr12--12035 ----
NM_015268chr31232 ------
NM_015269chr11420 ------
NM_015271chr484125 3921 2757 2628 1354 761 651 478 13845 23876 358 --
NM_015272chr1611306 ------
NM_015277chr1841356 76 55 30 ------
NM_015278chr663265 716 609 587 535 376 --43312 2136 1288 898 --
NM_015282chr282922 2205 2048 1952 1870 427 406 148 13053 ----
NM_015288chr543597 3366 1451 981 ------
NM_015291chr172750 2609 2535 2485 1087 283 115 23392 2376 ----
NM_015294chr1721129 212 ------
NM_015296chr1331041 958 503 1377 ----
NM_015299chr1421416 651 1825 ----
NM_015305chr1441902 1549 466 419 1361 11466 1326
NM_015308chr113892 835 155 ------
NM_015310chr8167695 6896 6564 6537 6122 5633 5161 3141 2978 2415 1183 1088 1019 290 279 183 28030 2358 --25825 174
NM_015313chr11124808 4545 4456 4342 3828 3699 3451 2928 1283 877 642 167 1857 ----
NM_015315chr553460 2923 2422 1388 694 1223 ----
NM_015317chr252753 2466 2274 992 887 22711 2697 22557 161 --
NM_015321chr1964296 3057 1519 1488 1238 797 --44893 3999 1700 1106 --
NM_015326chr13825 738 243 --31922 775 117 --
NM_015327chr11969 --21008 332 --
NM_015328chr752878 2777 2761 402 320 --13062 --
NM_015329chr1942848 1895 1073 937 ----12092
NM_015330chr2222348 1919 12604 ----
NM_015335chr1252433 1908 1842 331 299 11736 ----
NM_015336chr1232377 266 234 --12200 --
NM_015338chr2031948 1251 117 21464 1453 11619 --
NM_015339chr202715 696 --1177 --
NM_015344chr851654 673 239 197 106 12174 ----
NM_015346chr1431561 481 237 ----1407
NM_015347chr1262800 2743 2734 2500 1905 355 ------
NM_015349chr682290 2065 1115 747 703 671 543 163 ------
NM_015353chr1742247 1008 969 841 --22628 2304 12102
NM_015355chr1741864 1713 1447 378 ------
NM_015358chr213517 315 42 ------
NM_015359chr842832 1895 312 213 12378 ----
NM_015361chr22628 295 ----1131
NM_015365chrX63859 3837 3094 3030 939 69 33883 1276 541 13972 12629
NM_015375chr1104872 4857 4703 3829 3786 1578 1395 1139 1116 55 13621 14141 --
NM_015378chr132523 2164 734 22953 1983 ----
NM_015379chr71213 ------
NM_015381chr2222017 446 11946 ----
NM_015384chr51121 ------
NM_015385chr1052660 2495 1156 792 281 12271 ----
NM_015387chr21759 11311 11996 --
NM_015393chr453729 3358 3156 2483 38 ----12650
NM_015396chr31202 --11232 11452
NM_015397chr931422 239 185 2347 64 195 --
NM_015416chr122290 205 1657 2888 332 --
NM_015435chr821292 1104 --11110 --
NM_015443chr1741446 951 193 154 1383 ----
NM_015446chr121134 634 ------
NM_015447chr91141 --1243 --
NM_015455chr5144143 4109 4035 3664 3637 3580 3500 3391 3349 3120 1075 681 646 351 --32524 1576 1058 --
NM_015458chr8115235 5079 4894 3226 1856 1809 1013 898 567 309 35 24872 4293 --14461
NM_015460chr321610 722 ------
NM_015461chr181167 1677 ----
NM_015463chr21549 2824 268 --1318
NM_015464chr72924 266 ------
NM_015465chr52742 731 1761 ----
NM_015466chr31217 ------
NM_015475chr211016 ------
NM_015477chr1531039 966 865 ------
NM_015481chr121386 ------
NM_015485chr11330 ------
NM_015496chr81274 ------
NM_015497chr151989 ------
NM_015503chr161584 ------
NM_015508chr321453 148 ------
NM_015509chr1231554 1433 616 11565 ----
NM_015511chr2021118 261 ------
NM_015514chr143421 396 134 ------
NM_015520chr342579 2553 2536 2288 ------
NM_015523chr112256 241 ------
NM_015528chr171176 ------
NM_015530chr22798 394 ------
NM_015534chr11892 ----11071
NM_015535chr244131 3964 3409 1259 13042 1413 --
NM_015541chr3--11077 122 11259
NM_015542chr102919 219 1254 1931 --
NM_015548chr62669 82 ------
NM_015549chr14--1554 ----
NM_015554chr1542687 2017 519 371 21032 591 ----
NM_015555chr641348 1114 553 341 21247 61 11569 1312
NM_015556chr141177 ------
NM_015564chr543447 1048 489 450 --12843 --
NM_015567chr132372 225 --2449 28 --
NM_015568chr20103894 3759 3110 2842 1716 1587 1005 787 294 116 11297 11248 --
NM_015569chr134717 4623 1903 14396 --14803
NM_015570chr731832 1339 625 ------
NM_015571chr642230 949 909 662 --32307 881 238 --
NM_015575chr273333 3036 2451 947 635 354 134 ------
NM_015576chr322743 1872 --12139 --
NM_015577chr531601 660 412 ------
NM_015578chr1961917 1472 1286 471 178 42 ------
NM_015584chr173946 534 129 1907 ----
NM_015601chr102648 60 ------
NM_015602chr141825 713 524 82 ------
NM_015607chr12194 31 ------
NM_015609chr112328 --12007 --
NM_015610chr782209 1953 1776 769 659 611 222 195 ------
NM_015622chr7--1229 ----
NM_015626chr172285 151 --21151 124 --
NM_015630chr21442 --21067 254 11148
NM_015635chr94874 328 219 188 11944 ----
NM_015640chr124832 276 24892 1887 34872 4675 57 15308
NM_015652chr10176 ------
NM_015678chr1321356 466 1309 ----
NM_015680chr22588 533 --1654 --
NM_015686chrX52322 1885 950 421 398 --12511 --
NM_015687chr6180 ------
NM_015691chrX2418 58 12750 12388 --
NM_015695chr631915 805 560 1327 ----
NM_015696chr11139 ----1218
NM_015704chr222118 39 ------
NM_015711chr193828 693 114 ------
NM_015714chr11322 ------
NM_015716chr17----196 --
NM_015723chr72201 170 ------
NM_015726chr141862 1538 1171 345 11425 11554 --
NM_015831chr71239 ------
NM_015833chr2162167 2143 2025 1977 1923 1509 1367 ----
NM_015836chr131545 1502 1223 --131 --
NM_015845chr182682 237 ------
NM_015850chr842225 1795 1703 823 ------
NM_015852chr7123146 3047 2687 2522 1086 1002 750 582 498 330 246 162 ------
NM_015866chr1------1457
NM_015872chr131450 1357 1219 ------
NM_015874chr4193 --1507 --
NM_015878chr81107 ------
NM_015879chr18158465 8299 8054 7490 7174 6100 5655 5207 2950 2796 2714 1423 1401 148 138 37275 2501 826 12753 --
NM_015885chr111829 2651 619 ----
NM_015886chr8105729 4980 4587 3733 3666 3597 2220 1720 1433 1373 ------
NM_015888chr141193 1071 1041 862 31100 1064 264 ----
NM_015889chr221119 ------
NM_015891chr631562 620 495 11396 ----
NM_015902chr81890 --1356 --
NM_015904chr22570 319 ------
NM_015906chr1104750 3418 3358 3141 1505 1476 999 870 183 141 13969 ----
NM_015912chr832327 1805 69 11597 1153 --
NM_015916chr102112 21 ------
NM_015933chr3183 ------
NM_015955chr21405 ------
NM_015959chr112727 47 ------
NM_015967chr141042 979 689 135 ------
NM_015976chr11257 ------
NM_015980chr511083 11632 ----
NM_015981chr573180 3060 2988 2397 2220 2182 1081 12090 12008 --
NM_015982chr173311 291 129 ------
NM_015990chr4--1844 ----
NM_015995chr1544160 3842 952 61 ------
NM_015999chr12595 45 ------
NM_016003chr782209 1953 1776 769 659 611 222 195 ------
NM_016009chr184609 3824 3629 3261 1952 814 458 319 23978 262 11161 1641
NM_016018chr842646 2440 2134 533 32580 2182 1755 22223 1141 --
NM_016022chr11148 ------
NM_016023chr832037 1891 836 1800 ----
NM_016032chrX61182 1056 238 166 154 23 --1452 --
NM_016037chr111112 1336 ----
NM_016039chr141152 ------
NM_016040chr132518 2290 1870 ------
NM_016041chr17--2319 95 ----
NM_016047chr21169 ------
NM_016048chr54381 320 235 76 ------
NM_016059chr63818 276 26 ------
NM_016061chr221104 517 ----11608
NM_016070chr17--196 ----
NM_016072chr1271910 1690 705 557 549 380 107 3958 777 261 ----
NM_016073chr152822 71 ------
NM_016075chr1372670 2589 2466 2329 2160 783 460 12534 ----
NM_016076chr183166 3098 2312 2257 983 910 753 688 ------
NM_016078chr173854 718 370 155 ----
NM_016079chr262253 2061 932 307 164 65 ------
NM_016083chr643585 3096 1215 1183 ------
NM_016087chr741410 1137 198 101 1236 ----
NM_016090chr111337 ------
NM_016096chr841595 842 149 80 1835 11763 --
NM_016103chr5192 ------
NM_016107chr531367 873 404 ------
NM_016120chrX2792 65 --1844 --
NM_016121chr111147 1175 ----
NM_016131chr292271 2143 2002 1921 1705 1454 282 144 51 ------
NM_016132chr1563376 2149 1132 1044 260 130 ------
NM_016133chr221433 22 ------
NM_016152chr32388 357 1998 ----
NM_016156chr1111496 141 ----
NM_016166chr151188 ------
NM_016169chr1053251 3208 3100 2363 724 ------
NM_016173chr352995 2806 1150 702 84 --23790 1650 --
NM_016185chr173297 176 85 1145 ----
NM_016201chr352261 659 513 492 270 22025 886 ----
NM_016203chr71841 ------
NM_016205chr41326 1191 124 --
NM_016206chr3138586 8236 7818 7689 6960 6453 6195 3101 2979 1814 1107 262 249 46438 3308 1790 154 15967 --
NM_016217chr6123563 3537 3520 3306 3231 2931 2511 2489 2398 1472 836 750 --13383 --
NM_016220chr762033 1568 581 497 417 165 11980 ----
NM_016221chr532306 2231 659 1339 1185 --
NM_016224chr652139 1469 718 380 186 ------
NM_016227chr141271 373 346 46 ------
NM_016230chr63544 173 162 ------
NM_016231chr1731052 662 196 ------
NM_016235chr1631387 1093 441 21519 68 11102 --
NM_016248chr13114015 3961 3936 3839 3721 3612 3529 2745 1402 543 178 12495 11233 --
NM_016252chr21193 ------
NM_016257chr133091 1324 1020 23518 332 1273 --
NM_016258chr12742 562 --1609 --
NM_016260chr296478 5471 4983 4789 2217 1863 1373 1276 476 25332 434 ----
NM_016269chr41317 ------
NM_016271chr1842073 2045 907 737 11740 --1314
NM_016274chr1170 ------
NM_016275chr372088 2021 641 396 144 123 30 ------
NM_016277chr661542 1528 1148 1015 400 151 ------
NM_016281chr1231164 1093 1004 ------
NM_016283chr5133 ------
NM_016284chr166962 668 626 283 200 87 ------
NM_016287chr141910 1481 175 86 21631 1428 ----
NM_016289chr251908 1790 770 607 137 2646 208 ----
NM_016303chrX3386 129 49 ------
NM_016307chr9----1285 --
NM_016308chr161860 1849 1562 1540 377 157 --1452 --
NM_016312chr122391 62 ------
NM_016315chr221598 1454 ------
NM_016316chr21479 ------
NM_016319chr122709 652 ------
NM_016322chr952275 1123 1106 1048 1007 22765 2554 2978 478 --
NM_016329chr32404 341 ------
NM_016333chr161192 --1382 --
NM_016338chr51319 ------
NM_016351chr7194 ------
NM_016352chr761410 1380 1343 927 235 75 11094 1580 --
NM_016359chr153677 144 53 ------
NM_016374chr13630 271 185 1124 ----
NM_016374chr13630 271 185 1124 ----
NM_016376chr1764136 3596 2957 1512 1066 502 43983 3157 2720 1286 ----
NM_016377chr621784 1446 ------
NM_016395chr1571812 1603 1370 365 346 218 25 168 ----
NM_016396chr1543043 2207 116 52 11980 12018 --
NM_016399chr121557 1340 ----
NM_016404chr11125 ------
NM_016410chr91135 1602 ----
NM_016424chr1731312 799 69 ------
NM_016426chr2221688 1681 1568 ----
NM_016436chr2041995 1960 570 222 11074 22737 639 --
NM_016441chr252404 2132 1507 776 682 1757 12276 --
NM_016448chr11342 1589 1504 --
NM_016451chr11171 ------
NM_016467chr231296 1094 496 ------
NM_016470chr203491 184 137 1178 ----
NM_016480chr52721 87 ------
NM_016484chrX1553 1505 ----
NM_016486chr11352 ------
NM_016488chr1241962 1317 764 732 ----21833 785
NM_016500chrX4288 282 235 100 ------
NM_016506chr112669 163 ------
NM_016507chr1751963 721 578 493 372 1423 1502 --
NM_016513chr693757 3074 2657 2613 2375 634 545 513 198 12953 ----
NM_016516chr2--1862 ----
NM_016519chr42358 169 ------
NM_016522chr1121457 1200 ------
NM_016525chr92625 104 ------
NM_016526chr1172413 2236 2220 2018 1645 150 55 ------
NM_016529chr1321127 235 ------
NM_016530chr1563825 3729 1653 1354 501 354 23697 821 11075 --
NM_016531chr464072 3235 1101 1037 1010 577 14061 --11473
NM_016539chr192506 29 ------
NM_016542chrX4636 403 258 101 --1376 --
NM_016544chr273843 3796 2537 1546 523 468 104 23479 2869 ----
NM_016545chr13746 278 219 ------
NM_016559chr341503 1217 429 309 ------
NM_016569chr1261516 1327 626 592 176 107 --11041 --
NM_016570chr122398 311 ------
NM_016574chr111850 ------
NM_016575chr1294502 4249 4027 2141 1597 1552 1282 1237 631 1112 34519 1803 87 23758 344
NM_016578chr111657 1204 ----
NM_016587chr72943 281 ------
NM_016588chr63740 172 81 ------
NM_016598chr31207 --11351 --
NM_016603chr51336 11662 ----
NM_016604chr551306 815 342 251 76 ------
NM_016607chrX21645 213 ------
NM_016612chr82269 238 ------
NM_016618chr22173 104 ------
NM_016619chr4380 68 22 ------
NM_016621chr11134469 3924 3772 3393 3149 1564 1048 1001 652 348 241 113 107 13192 11703 --
NM_016622chr231884 612 259 --1555 --
NM_016623chr83498 151 101 ------
NM_016626chr1841601 1186 692 187 ------
NM_016628chr102352 201 ------
NM_016630chr152512 443 1231 144 1211
NM_016631chr21199 1673 ----
NM_016644chr51385 ------
NM_016651chr142982 110 1337 ----
NM_016654chr1521229 33 11090 21015 151 --
NM_016656chrX1421 ------
NM_016824chr1041895 1799 1711 1600 11276 ----
NM_016830chr122403 158 ------
NM_016831chr13951 690 218 2764 123 11517 --
NM_016834chr1723027 1033 1300 43751 3091 3015 145 --
NM_016835chr1723027 1033 1300 43751 3091 3015 145 --
NM_016836chr23766 727 27 1622 --1119
NM_016839chr23766 727 27 1622 --1119
NM_016841chr1723027 1033 1300 43751 3091 3015 145 --
NM_016929chr654111 3389 3278 1354 934 --14389 --
NM_016932chr28936 916 821 795 706 305 210 31 --1168 --
NM_016936chr1641889 713 597 104 --22140 1424 --
NM_016946chr1103584 3214 2823 2701 1370 1319 1180 1104 1026 398 32600 2325 979 1617 --
NM_016952chr1164007 3987 3167 1494 1048 336 13158 ----
NM_016954chrX1652 ------
NM_017409chr122771 584 ------
NM_017410chr1231168 407 384 11144 ----
NM_017412chr831074 148 64 --11037 --
NM_017415chr584264 3139 3088 3056 2993 2893 1218 817 23680 3264 ----
NM_017416chrX1127 ------
NM_017420chr1493517 3303 3115 2959 2735 2626 2457 1053 932 ------
NM_017423chr431592 512 203 ------
NM_017426chr42182 111 ------
NM_017437chr143358 287 190 11612 22021 1941 174
NM_017447chr2174256 4114 3840 3118 794 724 642 ------
NM_017450chr173983 323 133 1239 197 --
NM_017451chr172998 427 ------
NM_017452chr20--1604 --21177 1022
NM_017453chr20--1604 --21177 1022
NM_017454chr20--1604 --21177 1022
NM_017455chr156801 758 732 680 382 239 ------
NM_017456chr1741623 772 330 50 --31523 252 140 --
NM_017457chr191130 ------
NM_017459chr1174 ------
NM_017483chr231230 1113 1019 11293 ----
NM_017488chr231565 1448 1354 11628 ----
NM_017489chr821157 95 ------
NM_017491chr41171 ------
NM_017519chr62307 285 --172 --
NM_017533chr17155 ------
NM_017544chrX----1711 --
NM_017545chr202401 124 ----1165
NM_017548chr352038 1828 850 792 233 ------
NM_017551chr1042613 2253 132 55 ------
NM_017575chr1711497 ------
NM_017578chr3193 ------
NM_017580chr1072355 2310 1492 744 548 521 396 ----12168
NM_017582chr11379 11527 ----
NM_017594chr942194 1123 701 544 1802 --12646
NM_017599chr1231855 391 305 1218 ----
NM_017602chrX3773 103 88 ------
NM_017610chr153629 196 21 11982 ----
NM_017613chr21--170 1365 --
NM_017615chr10------1120
NM_017622chr172258 120 ------
NM_017626chr1051514 1481 1094 691 191 11765 ----
NM_017628chr474986 4728 4632 4034 1357 1219 216 --11576 --
NM_017629chr131383 784 678 ------
NM_017632chr42102 59 ------
NM_017633chr673796 3447 3043 3034 2978 2680 956 12525 ----
NM_017634chr82630 309 31857 1228 248 ----
NM_017635chr1131353 452 355 --11175 --
NM_017637chr9189451 9430 9363 9268 9101 8757 8626 8250 7354 6754 3538 3437 3123 2433 1147 1081 470 362 17671 12707 48058 6799 3292 194
NM_017640chr63794 202 92 ------
NM_017641chr12----1319 --
NM_017643chr1772930 2507 2236 1924 978 542 465 12829 --1231
NM_017644chr375139 5082 4849 4711 3474 3225 1566 --11338 --
NM_017649chr102959 379 --1904 --
NM_017650chr7106045 5981 5874 5803 5596 4923 1742 1453 507 258 --15168 11560
NM_017651chr641588 1367 1146 126 11153 ----
NM_017655chr161576 1293 1267 620 597 40 ------
NM_017657chr22583 32 2912 314 ----
NM_017658chr14144446 3213 1751 1744 1172 1115 1015 970 900 679 618 502 447 326 21715 1157 --1177
NM_017661chr1531087 823 430 ------
NM_017666chrX92147 2108 1784 1666 878 802 518 248 139 21755 494 1884 1707
NM_017668chr16--1540 ----
NM_017672chr1551151 1100 917 417 256 1155 ----
NM_017673chr12897 78 1247 1803 --
NM_017680chr941001 757 656 380 ------
NM_017686chr131143 108 24 2882 274 ----
NM_017691chr151422 ------
NM_017693chr1331323 559 508 11469 ----
NM_017705chr15--33775 1369 123 ----
NM_017709chr1104145 3942 1428 1311 1057 1022 878 458 124 94 1705 1505 --
NM_017712chr19146231 5726 5190 5162 5117 4893 2346 2068 709 646 548 532 402 93 12471 11473 11241
NM_017714chr202682 92 1960 154 --
NM_017715chr72579 271 ------
NM_017719chr32973 342 11716 ----
NM_017730chr31646 ------
NM_017737chr141942 1924 1464 373 --2510 58 --
NM_017739chr11410 ------
NM_017740chr1631727 1166 1144 ------
NM_017742chr185734 508 411 269 139 ----1178
NM_017745chrX1631 ------
NM_017747chr51352 ------
NM_017753chr961026 1016 967 884 706 238 2997 420 ----
NM_017754chr6124857 4416 4076 3854 3794 3438 3065 1540 1045 884 268 165 --13194 --
NM_017757chr1821102 835 ------
NM_017758chr1751469 1229 943 203 60 ------
NM_017762chr1551821 1745 1528 746 569 --1228 --
NM_017769chr1432778 2435 2290 3790 225 109 --11057
NM_017770chr632812 2787 750 1107 ----
NM_017778chr81383 ------
NM_017779chr152773 2730 2434 1104 329 1505 ----
NM_017780chr83940 283 270 138 1629 --
NM_017786chr83564 475 267 ------
NM_017787chr102816 363 ------
NM_017789chr2154 ------
NM_017790chr9148 ------
NM_017798chr203361 303 124 1423 ----
NM_017799chr1411694 21604 388 31677 1527 575 21331 238
NM_017801chr31108 12600 174 --
NM_017811chr942638 2378 2116 217 1343 ----
NM_017813chr885553 5468 5073 5060 3659 1583 1056 28 34131 3980 1105 25163 1042 15489
NM_017824chr1051911 1062 989 881 352 --11710 --
NM_017847chr111439 124 ----
NM_017848chrX34035 3022 1300 13038 --24413 4005
NM_017866chr83445 121 69 ------
NM_017873chr92891 188 12174 2632 359 --
NM_017880chr25429 313 169 112 25 ------
NM_017893chr1041093 1004 551 27 ------
NM_017902chr1084689 3977 2214 1901 1840 1077 209 121 --44713 778 461 279 --
NM_017905chr132164 150 1478 ----
NM_017907chr112182 25 ------
NM_017913chr9--169 ----
NM_017915chr123957 751 324 ------
NM_017918chr41114 ------
NM_017919chr995625 4808 4267 3749 3622 3590 1413 764 80 25198 1807 15367 --
NM_017922chr141261 ------
NM_017923chr41284 ------
NM_017925chr941822 1326 233 119 ------
NM_017926chr144893 370 358 305 ----1327
NM_017933chr221218 592 11554 ----
NM_017938chrX41979 1910 1548 644 --42182 843 605 41 --
NM_017943chr1411018 ------
NM_017944chr1173019 2462 2195 2089 1071 523 483 12388 ----
NM_017945chr3--2433 31 ----
NM_017952chr264381 4193 3937 1322 1083 793 1738 23578 273 --
NM_017954chr731129 539 239 ------
NM_017964chr21849 1783 ----
NM_017972chr144893 370 358 305 ----1327
NM_017987chr1061970 1938 1787 1481 548 505 21703 1662 --11621
NM_017988chr12--1918 ----
NM_017990chr16174398 4198 3582 3331 3181 3114 3071 2709 1632 1225 1203 882 804 729 703 410 220 12883 ----
NM_017994chr782922 2795 2741 1008 998 887 793 658 --1380 --
NM_018010chr351532 1439 1309 1075 658 ------
NM_018011chr13------1501
NM_018018chr1241411 1262 1181 765 11578 ----
NM_018019chr1711042 1465 ----
NM_018023chr312032 ------
NM_018027chr1023236 2196 --1316 --
NM_018028chr1931313 1257 147 ------
NM_018030chr181271 ------
NM_018036chr14114253 4214 3905 3468 3417 3400 2957 1430 1043 656 266 24468 3361 ----
NM_018045chr153024 2840 2709 2245 996 --22443 1205 1108
NM_018046chr521390 148 --2696 343 --
NM_018060chr1--1355 ----
NM_018061chr151183 1101 514 407 56 --2544 223 --
NM_018078chr42654 73 ------
NM_018084chr222793 358 11036 ----
NM_018086chr231651 1429 1344 11789 1611 --
NM_018087chr12213 74 ------
NM_018092chr1651547 1333 1321 1048 592 21159 1092 --2521 338
NM_018095chr112669 163 ------
NM_018098chr31229 1150 ----
NM_018100chr663066 2855 2663 1346 794 120 --13233 --
NM_018103chr12260 218 ------
NM_018105chr821097 784 ------
NM_018110chr1641386 1138 1057 483 ------
NM_018114chr31136 ------
NM_018120chr851013 499 486 431 386 ------
NM_018121chr1083210 3097 2644 2503 2430 1192 453 304 --22471 803 --
NM_018124chr1662425 1641 1606 875 842 235 11666 ----
NM_018126chr41153 ------
NM_018128chr171430 ------
NM_018131chr102842 170 ------
NM_018133chr351861 1570 1541 545 207 ------
NM_018144chr101106 ------
NM_018150chr11676 ------
NM_018155chr373269 2975 2959 2928 2205 1192 700 33350 904 861 --11099
NM_018156chr132523 2164 734 22953 1983 ----
NM_018159chrX51697 363 240 230 170 11454 1466 --
NM_018172chr1131483 1089 221 ------
NM_018178chr141944 1851 777 655 41608 1539 832 111 1291 --
NM_018179chr124616 543 108 46 ------
NM_018181chr1851867 1648 1338 1260 326 ------
NM_018182chr1751808 1737 1395 227 190 2643 302 ----
NM_018184chr381997 1587 1550 1455 1383 750 611 31 ------
NM_018193chr152203 156 ------
NM_018195chr1181951 1899 1864 1804 1459 179 78 49 1219 ----
NM_018201chr942542 2118 1634 1621 ------
NM_018202chr12255 185 1309 ----
NM_018211chr121543 1460 21426 1410 1732 --
NM_018217chr20----160 --
NM_018230chr11479 ------
NM_018243chr453278 3144 1209 246 75 33456 2535 416 142 --
NM_018244chr202981 308 --11171 --
NM_018246chr832482 1783 63 12564 12378 22199 288
NM_018247chr652962 2688 1019 870 253 ------
NM_018252chr11520 1267 ----
NM_018254chr161886 863 570 431 361 329 --11708 --
NM_018256chr2--199 ----
NM_018263chr232392 1850 75 --1637 --
NM_018264chr72979 933 ----160
NM_018279chr1252846 1091 976 577 295 12939 ----
NM_018287chr1011061 --1414 --
NM_018293chr342267 2072 705 440 11884 --1680
NM_018294chr10150 ------
NM_018298chr15941 924 917 290 243 ------
NM_018299chr851370 1054 1039 993 200 12404 1281 --
NM_018301chrX--139 1141 --
NM_018312chr1122046 553 --1807 --
NM_018313chr322664 353 ------
NM_018314chr111616 1291 ----
NM_018315chr42542 373 1242 ----
NM_018318chr122667 179 1371 ----
NM_018320chr111198 1868 ----
NM_018323chr441358 1278 1238 403 21543 1178 ----
NM_018327chr2041752 1562 1154 647 ----1681
NM_018328chr21520 ------
NM_018330chr1041213 1058 351 334 1655 ----
NM_018339chr921679 1490 ----11728
NM_018342chr421255 287 ----1609
NM_018351chr1244566 4212 3519 732 22926 1717 --13191
NM_018361chr863319 3224 938 737 446 397 ------
NM_018362chr1163124 2945 1433 1139 810 297 ------
NM_018364chr174024 3853 2823 1222 916 355 307 23055 1420 13117 12662
NM_018367chr1132145 559 286 ------
NM_018371chr82156 44 ------
NM_018373chr1446154 5708 1788 1623 22513 254 25884 2042 12421
NM_018374chr7115217 3734 3718 3663 3625 1856 1180 944 752 519 498 11561 1155 --
NM_018375chr142170 89 ------
NM_018383chr221673 54 ------
NM_018388chrX31165 466 357 --1337 --
NM_018403chr353620 3499 3160 2634 2551 --11532 --
NM_018413chr122243 33 ------
NM_018416chr12102329 1642 926 889 857 421 392 310 219 123 ------
NM_018424chr951839 1543 1499 1167 298 --21667 1600 --
NM_018429chr562875 594 442 394 257 149 12666 ----
NM_018433chr22502 444 ------
NM_018439chr18101672 802 698 683 474 418 384 369 145 138 --11978 --
NM_018440chr898701 7874 7303 5808 3308 2312 2218 1737 438 27707 1172 --13380
NM_018444chr82508 352 21820 118 ----
NM_018445chr152568 77 124 ----
NM_018448chr121426 --11175 1994
NM_018452chr6_random33530 1510 414 ----