TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-338-3p
miRNA Sequence: UCCAGCAUCAGUGAUUUUGUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96469 6034 5465 5021 4366 2057 679 616 56 25679 1183 14306 --
NM_000115chr1322419 1677 ----11659
NM_000141chr101527 1385 ----
NM_000176chr543733 2749 869 396 13030 ----
NM_000208chr1994601 3923 3618 3321 3207 3036 2978 1218 360 11288 ----
NM_000214chr2031386 539 506 ------
NM_000222chr422104 1574 --22075 508 --
NM_000301chr6--1163 --172
NM_000314chr1043121 1087 1038 956 ----1544
NM_000332chr645458 4873 4559 2385 ------
NM_000337chr586430 5248 4101 2093 1901 1355 562 27 ------
NM_000368chr954405 3481 3329 894 39 --21206 756 --
NM_000408chr252613 2410 763 707 148 12509 13021 12569
NM_000430chr1731387 1228 365 ----1329
NM_000448chr111298 --12076 --
NM_000489chrX63171 2582 2222 865 735 193 ------
NM_000525chr1141646 1574 1086 515 11343 11106 --
NM_000539chr3----11445 1376
NM_000555chrX57756 7740 5185 1103 621 --35783 5123 152 --
NM_000601chr7--1282 1343 --
NM_000618chr1225556 4844 1368 15495 14294
NM_000726chr22572 418 2515 378 --1323
NM_000793chr1435096 1151 1064 12031 24749 3499 --
NM_000801chr202842 378 --1919 --
NM_000813chr554082 1393 389 261 124 --25600 3852 23483 1601
NM_000826chr422174 112 ----11877
NM_000833chr1631289 200 137 11146 1292 172
NM_000857chr4----1460 --
NM_000859chr541627 1121 524 215 11666 ----
NM_000901chr42705 668 1846 ----
NM_000922chr114299 290 236 154 ------
NM_000959chr112913 22933 657 22771 1525 12838
NM_001001323chr1242306 2041 687 191 ----12244
NM_001001395chr1232727 2319 2090 12790 11735 --
NM_001001481chr81165 13035 ----
NM_001001560chr222739 313 ------
NM_001001668chr1954198 4174 3675 3417 1397 21687 1544 44299 3982 3890 1576 --
NM_001001787chr12412 60 ------
NM_001001924chr811639 --12021 12116
NM_001001974chr1041977 1552 1451 482 ------
NM_001001995chrX31604 1243 136 ----1662
NM_001002243chr22253 123 ------
NM_001002258chr21216 --123 --
NM_001002762chr1052680 1038 812 234 198 ------
NM_001002909chr1742240 2066 1497 831 ------
NM_001003800chr953063 2794 1452 979 617 --13526 --
NM_001004303chr11666 --1179 --
NM_001004317chr674497 4305 3568 3046 1807 1564 869 ------
NM_001005386chr222009 312 ----11688
NM_001005505chr331425 1379 252 --1345 --
NM_001005845chr821357 1202 ------
NM_001007024chr1753525 3096 2831 1570 184 --23492 3427 --
NM_001007277chr113977 932 750 ------
NM_001007466chr654956 4924 1668 1609 1034 1654 1725 --
NM_001007559chr1811882 1781 11820 --
NM_001007565chr31131 1158 ----
NM_001008239chr1843347 1208 988 843 13590 ----
NM_001008392chr363239 3059 2905 2862 625 554 23464 3246 13435 --
NM_001008408chr785717 4864 4647 3873 2496 2074 2047 1653 1699 ----
NM_001008493chr11147 ------
NM_001008540chr2--1110 1432 --
NM_001008564chr1312155 --11815 --
NM_001008726chr1411702 11241 1258 1457
NM_001008738chr532272 2004 670 ----12859
NM_001009993chr284216 3396 3351 2911 1673 1629 1391 66 23547 1378 ----
NM_001010862chrX43283 2487 2221 1199 ------
NM_001010867chr186263 5528 4913 2659 2017 1768 723 245 --25464 2182 1590
NM_001010989chr162553 369 2390 25 ----
NM_001011666chr7106268 6047 5356 5203 1812 1588 1541 451 440 150 ------
NM_001011722chr1------1464
NM_001012426chr652808 1157 1038 698 575 13017 23037 2746 --
NM_001012761chr512388 --12402 1180
NM_001013399chr631120 833 780 ----1758
NM_001013415chr421200 340 --1124 --
NM_001013438chr32652 405 ------
NM_001013693chr192358 2048 1915 1148 1126 908 565 467 382 1297 ----
NM_001013746chr721864 1617 ------
NM_001014797chr10138054 7899 7810 7435 6331 6074 3289 2965 2665 1232 972 209 129 16974 18121 --
NM_001017371chr221220 1146 --1337 --
NM_001017923chr1411261 ----1234
NM_001017977chr11295 --1327 --
NM_001018067chr174680 3734 1990 1683 1660 815 503 15331 ----
NM_001018108chr1531792 897 559 ----11705
NM_001024808chr1242593 1768 972 673 ------
NM_001025068chr331272 207 72 21759 149 ----
NM_001025076chr1064049 3979 2433 1465 1360 973 --55321 3996 1939 785 442 --
NM_001025079chr353998 3349 1081 214 96 13224 11628 --
NM_001025232chr12----1231 --
NM_001029875chr512663 ----1881
NM_001030006chr1752600 2494 850 268 32 1163 --11667
NM_001030007chr1622853 72 21427 1208 ----
NM_001030055chr1454236 3599 3114 677 515 --21537 1187 --
NM_001031690chr742468 2349 1912 1056 1504 --13103
NM_001031695chr2265374 4978 4286 1100 545 423 ------
NM_001031702chr33824 796 273 ------
NM_001032380chr1041966 1531 1421 637 ------
NM_001032999chr2054978 4019 1130 1013 680 21006 72 21564 812 --
NM_001033057chr311554 11346 1250 --
NM_001033087chr2032443 1037 226 ----13199
NM_001033117chr374879 4780 4750 4261 4168 3915 1013 23893 229 --12962
NM_001033551chr1793888 3235 3095 2746 1600 1561 909 554 474 13551 ----
NM_001033557chr21522 --11176 --
NM_001033557chr21522 --11176 --
NM_001033925chr10----21588 628 --
NM_001034841chr1654282 4218 1800 1139 1016 --34601 1873 953 --
NM_001035511chr13695 325 193 ------
NM_001037174chr212002 147 ----
NM_001037332chr512399 --1188 --
NM_001038493chr231342 1090 33 ------
NM_001038707chr12845 67 22320 465 ----
NM_001039538chr211130 --13521 --
NM_001039574chr131019 925 715 ------
NM_001039590chrX43105 2775 643 259 11038 --1949
NM_001039618chr1155380 2144 1396 1369 453 34134 2213 758 ----
NM_001040057chr721138 173 --11449 --
NM_001040102chr1021051 918 ----12682
NM_001040151chr1154562 3740 3296 1262 950 23374 346 11200 --
NM_001040152chr753613 3115 1557 311 171 14433 ----
NM_001040153chr13----186 --
NM_001040159chr411457 11089 ----
NM_001040260chr411016 1286 ----
NM_001040272chr932316 1992 514 --22166 206 --
NM_001040284chr1665233 4227 1923 1077 887 347 15643 11056 --
NM_001040402chr452931 2511 2134 892 90 --22973 129 --
NM_001040424chr2132999 2176 590 172 12950 --
NM_001040709chr152569 2527 2520 1976 718 2198 151 ----
NM_001040712chr931320 380 356 12467 ----
NM_001042404chr12644 322 11478 ----
NM_001042413chr963981 3452 3083 941 904 43 --14079 --
NM_001042486chr2031578 1355 255 ------
NM_001042555chr1234024 2975 608 --1272 --
NM_001042599chr287267 7108 6774 6743 6111 5550 2211 286 --12836 --
NM_001042601chr33704 398 203 --1783 --
NM_001042603chr1271534 1490 1461 1441 1038 137 93 15108 ----
NM_001042604chr374801 4479 4261 3546 1046 590 157 --21360 1065 --
NM_001042632chr2071975 1935 942 759 501 451 257 1652 ----
NM_001042749chrX31907 1638 745 1393 ----
NM_001043351chr151916 1800 753 586 270 1924 21661 1597 --
NM_001066chr121953 458 --1264 12164
NM_001079874chr122009 154 --21345 173 --
NM_001092chr1732356 596 253 ----1678
NM_001148chr431778 819 383 ------
NM_001174chrX3160 141 36 --22289 229 --
NM_001174chrX3160 141 36 --22289 229 --
NM_001174chrX3160 141 36 --22289 229 --
NM_001198chr612270 --11476 1599
NM_001219chr731754 1697 660 ------
NM_001222chr1031718 1587 692 11234 11945 --
NM_001241chr231673 948 228 ----166
NM_001284chr51168 ------
NM_001390chr1842362 2267 1143 372 23561 2988 ----
NM_001391chr18------11085
NM_001396chr2132324 922 620 --1319 --
NM_001408chr121172 668 ----11581
NM_001419chr1984130 3258 3251 3124 3043 2995 1801 418 23528 3307 1614 --
NM_001420chr19------12994
NM_001432chr422806 975 --185 --
NM_001438chr173273 2627 2288 2251 1159 958 36 ------
NM_001463chr21287 2309 61 ----
NM_001482chr15----1350 --
NM_001497chr962668 2567 2493 934 397 72 ------
NM_001530chr141851 ----1190
NM_001616chr261343 908 796 768 506 149 ------
NM_001659chr1232352 831 598 11962 ----
NM_001660chr34677 670 592 163 ------
NM_001668chr131845 1827 300 ------
NM_001681chr121730 --2615 100 --
NM_001707chr73816 321 75 ------
NM_001743chr22466 210 ------
NM_001753chr711194 11308 1383 --
NM_001755chr1652056 1724 566 299 71 --12078 --
NM_001826chr12141 82 ------
NM_001830chrX63964 3889 2990 2473 1418 315 13941 ----
NM_001855chr91838 1642 ----
NM_001858chr683855 3369 1807 1691 1624 1373 1330 1256 --14841 --
NM_001859chr933912 3153 1239 ------
NM_001882chr5127 --1581 --
NM_001927chr21238 2570 267 --1618
NM_001938chr141915 1711 1281 417 ------
NM_001957chr411899 11757 ----
NM_001995chr431447 191 71 1604 1955 --
NM_002006chr495644 5070 4430 3563 1837 1687 1041 752 592 21519 516 --11245
NM_002010chr131160 ----1369
NM_002017chr1111378 1110 1156 --
NM_002023chr131319 1202 404 21397 76 ----
NM_002025chrX89140 8008 7116 3082 2250 1835 1537 531 --22945 1569 --
NM_002032chr11----169 --
NM_002070chr33881 705 309 --1222 --
NM_002077chr942072 1927 723 246 ------
NM_002137chr742417 1997 841 724 --1619 --
NM_002140chr92927 302 ----11092
NM_002196chr201754 ------
NM_002227chr131143 862 416 ------
NM_002247chr1022318 807 ------
NM_002254chr242308 1999 499 215 ------
NM_002264chr361974 1964 1510 1107 813 662 --11472 --
NM_002270chr565051 1866 1828 1209 972 520 --21496 196 --
NM_002355chr1231038 1016 431 ------
NM_002356chr61750 157 ----
NM_002359chr17124046 3649 3519 3306 3188 2883 2661 1701 1295 1200 551 292 21304 969 1206 --
NM_002399chr1521350 399 --1293 --
NM_002401chr1741926 746 590 60 --12101 --
NM_002489chr71336 ----1117
NM_002500chr221193 430 --21211 1080 --
NM_002501chr1943547 3466 1161 1018 11322 ----
NM_002515chr1431380 636 132 --21422 644 --
NM_002546chr8------1691
NM_002569chr1531509 1029 319 --11456 --
NM_002577chr343642 2751 1324 939 --1511 --
NM_002590chr13--1119 --1394
NM_002613chr16135108 5098 4810 4428 4379 4202 3310 1898 1249 1162 748 634 389 --24851 779 --
NM_002618chr2----1160 --
NM_002653chr5------1970
NM_002657chr2023373 2572 11185 --12388
NM_002698chr1932628 2466 22 --190 --
NM_002709chr233031 2701 1134 --22770 1066 --
NM_002731chr153127 2815 1978 417 328 ------
NM_002736chr731875 599 507 ------
NM_002806chr14----140 --
NM_002816chr17----175 --
NM_002840chr131555 580 104 ----11515
NM_002858chr1----1204 --
NM_002886chr345099 4353 4140 3459 ------
NM_002890chr51154 1934 ----
NM_002924chr1299 64 ----1220
NM_002941chr311047 2524 226 ----
NM_002998chr812116 --11460 --
NM_002999chr2041603 1199 618 358 21886 1547 ----
NM_003011chr921483 1279 1323 ----
NM_003071chr341962 1859 1320 274 11282 --1372
NM_003107chr63880 707 299 ------
NM_003108chr246585 5661 2176 153 11545 11086 --
NM_003112chr72932 32 --1724 --
NM_003178chr351647 1604 1542 1456 118 ----12214
NM_003206chr61327 ------
NM_003216chr2243289 3181 3058 1287 12147 ----
NM_003239chr143664 306 172 ------
NM_003246chr1531890 741 578 1565 144 --
NM_003255chr1742574 2205 1927 1712 ----12546
NM_003262chr344863 4673 4611 3965 23446 670 157 --
NM_003284chr2----1167 --
NM_003290chr191417 1105 ----
NM_003292chr121792 361 ------
NM_003298chr3126185 5664 4745 4227 2467 2429 2377 2283 2228 1614 1266 600 25690 5042 ----
NM_003309chr631783 1253 209 153 ----
NM_003337chr5----1256 --
NM_003342chr1743152 2779 1138 166 195 ----
NM_003350chr81767 ------
NM_003392chr344301 4220 1687 741 --11069 --
NM_003404chr201505 ----1444
NM_003412chr332801 1167 710 ------
NM_003418chr3------1583
NM_003427chr61622 ----133
NM_003441chr4------3498 416 336
NM_003453chr132596 53 --1632 --
NM_003470chr1631200 1193 115 11185 ----
NM_003478chr1173248 3142 3064 1246 409 213 191 176 1633 --
NM_003482chr1222720 1959 21883 694 ----
NM_003507chr242005 1874 1369 76 21521 447 ----
NM_003559chr1743347 3150 3008 187 --12630 --
NM_003566chr1252525 2462 2333 1393 1249 ------
NM_003618chr22984 349 --1431 --
NM_003622chr1242638 2506 1865 673 ------
NM_003701chr131672 --1793 1414
NM_003749chr1321607 222 22355 589 ----
NM_003758chr1551088 624 247 122 34 ------
NM_003779chr1--1149 --1431
NM_003787chr1811562 ----1661
NM_003861chr1462773 1166 748 483 199 137 --11917 1509
NM_003872chr232335 624 247 ------
NM_003873chr1031874 809 215 --2359 240 11811
NM_003885chr1762683 2099 1701 1668 928 286 --12480 --
NM_003908chr2021044 955 ----11378
NM_003913chr653882 1329 1025 879 377 12743 ----
NM_003916chrX31504 1350 927 --11155 --
NM_003939chr104790 419 220 156 13652 ----
NM_003998chr4--1281 --1648
NM_004077chr122885 509 ----1441
NM_004080chr7------2921 65
NM_004093chr1332755 981 285 187 22891 2203 --
NM_004100chr672289 2220 2141 2113 2072 567 250 ------
NM_004133chr82660 113 12620 --12458
NM_004136chr1533274 2679 382 158 ----
NM_004152chr192232 104 ------
NM_004161chr221420 223 11093 ----
NM_004171chr11139000 8180 7330 6616 6280 6100 2757 2203 1612 1487 1091 1028 176 1250 ----
NM_004202chrY1123 --1220 --
NM_004232chr1823445 1332 11093 13644 --
NM_004272chr531709 1384 1313 1602 ----
NM_004274chr1422876 2492 --1802 11285
NM_004281chr101383 ----1482
NM_004296chr1411013 --14023 --
NM_004302chr1241840 1827 714 700 --1169 --
NM_004311chr1072845 2703 1183 1114 1065 526 459 ------
NM_004327chr2232103 1778 115 ------
NM_004376chr1031032 557 239 ------
NM_004392chr1352202 910 796 776 606 1269 ----
NM_004397chr1174232 4218 1720 1171 1073 243 215 13306 13914 --
NM_004432chr922006 881 12341 ----
NM_004438chr222803 307 ----13027
NM_004450chr14162 --1266 --
NM_004496chr14----140 1978
NM_004501chr142505 1355 502 310 ------
NM_004571chr2143049 2995 2597 2365 22168 584 ----
NM_004586chrX55220 4048 3407 3316 124 1600 ----
NM_004588chr1163988 3664 3157 3081 2670 411 --22677 621 --
NM_004599chr22----1667 --
NM_004612chr923976 287 23569 318 ----
NM_004622chr262143 1938 1886 892 712 515 ------
NM_004658chr121382 1343 ----
NM_004660chrY21836 350 --12302 --
NM_004725chr102402 30 ------
NM_004730chr52829 549 ----1517
NM_004745chr835923 4676 2089 --16623 --
NM_004760chr7----1239 --
NM_004774chr1722453 933 ------
NM_004781chr121228 280 --1527 11245
NM_004788chr1162560 1967 1837 875 706 386 12238 ----
NM_004798chr2043076 3027 2632 163 --31297 1170 657 --
NM_004801chr21544 1269 --11277
NM_004849chr621306 1201 ------
NM_004850chr211301 ----1604
NM_004852chr181214280 13204 13080 12702 11879 11581 10450 5455 5195 5041 3283 3026 --413672 9756 4902 2269 110007
NM_004859chr1732413 2205 675 ----1787
NM_004898chr462245 2041 801 606 518 156 ------
NM_004926chr1411754 21472 1437 ----
NM_004956chr762899 1546 1406 1144 1071 950 ------
NM_004985chr1234464 4181 4085 --24391 319 --
NM_004992chrX57998 6960 5660 3185 2462 --27643 6926 --
NM_004995chr1431471 1066 302 ------
NM_005020chr72484 446 --1373 --
NM_005045chr71211 --1624 --
NM_005057chr1--2456 295 ----
NM_005109chr342377 2240 2143 1021 ------
NM_005112chr4----1948 --
NM_005116chr2074535 3895 3283 1718 782 605 234 ------
NM_005121chr1723228 3109 ------
NM_005153chr163758 515 266 ------
NM_005188chr1146739 6194 2477 1564 37968 7625 317 ----
NM_005206chr1711176 199 ----
NM_005238chr1193073 3051 2829 2722 2246 2197 911 799 57 13516 13499 --
NM_005243chr22----193 --
NM_005252chr141274 ------
NM_005254chr152378 363 ----1407
NM_005257chr1811200 1954 ----
NM_005277chr431781 1316 686 ------
NM_005313chr152241 230 ------
NM_005329chr1641885 1804 800 95 ------
NM_005378chr22849 163 --2195 88 --
NM_005406chr181274 11069 --1580
NM_005430chr122751 727 ------
NM_005433chr1832180 1107 1076 ------
NM_005461chr2031687 1678 715 ----1658
NM_005465chr131954 592 233 ------
NM_005483chr191227 ----1144
NM_005494chr72652 177 --1519 --
NM_005502chr963303 3260 2741 1303 827 475 ------
NM_005504chr1276556 6526 5123 4579 4432 4050 629 14996 11309 --
NM_005522chr721410 510 ------
NM_005562chr161703 1669 1437 1238 633 342 21392 586 1199 --
NM_005595chr11652 1190 ----
NM_005596chr975279 5109 4891 4690 4073 1311 544 12489 11087 12420
NM_005652chr1631129 890 348 1474 --11036
NM_005678chr152218 199 1677 ----
NM_005715chr622390 859 --1130 --
NM_005717chr12310 45 11065 ----
NM_005720chr7137 --1245 --
NM_005736chr1011025 11095 ----
NM_005748chr1243189 3159 1191 489 ------
NM_005765chrX------1831
NM_005850chr1172 --1173 --
NM_005862chr321084 735 --1186 --
NM_005898chr1112163 ------
NM_005902chr1533147 3121 2808 12997 14142 --
NM_005933chr1132689 1192 816 22285 26 1320 --
NM_005941chr842709 635 147 77 ------
NM_006076chr763168 2131 2040 1118 1088 604 11235 --1977
NM_006094chr821618 478 ------
NM_006133chr117744 695 537 514 471 362 262 ------
NM_006135chr1----1276 --
NM_006224chr1772400 2308 2115 2102 1681 985 887 ------
NM_006237chr1341825 1568 893 202 --21474 1396 --
NM_006247chr19------1102
NM_006252chr196379 6284 5422 4778 2874 2626 1394 487 408 --16885 12945
NM_006275chr202536 334 --1437 --
NM_006292chr111200 --1208 --
NM_006313chr1221523 41 --21295 346 --
NM_006322chr132941 91 --1877 --
NM_006345chr4------11367
NM_006352chr132057 2030 578 21667 446 --1493
NM_006371chr354353 3359 3316 1993 474 --23392 412 --
NM_006449chr22709 101 21999 1889 1591 --
NM_006460chr1711211 ----1654
NM_006546chr1764787 2198 2034 1618 1496 758 25184 2045 ----
NM_006547chr751924 1908 1450 529 518 ------
NM_006557chr9------2595 565
NM_006599chr1687366 7342 5847 2887 1649 1056 487 160 12287 ----
NM_006614chr32341 141 --23278 99 13198
NM_006618chr121165 625 --21121 571 --
NM_006622chr53557 372 86 1138 ----
NM_006698chr2011238 11273 ----
NM_006717chr923137 1242 --12435 --
NM_006726chr451059 860 811 406 199 11215 ----
NM_006736chr221207 483 --1649 11884
NM_006738chr1574486 4326 4163 3959 3926 1367 979 13725 ----
NM_006749chr841231 919 521 48 ----21209 1095
NM_006761chr173577 559 139 ------
NM_006775chr632218 950 529 --12433 --
NM_006788chr1831888 1500 793 --11854 --
NM_006791chr152477 243 ------
NM_006802chr1--1827 1147 --
NM_006827chr1462748 2384 2175 1252 858 412 ----13368
NM_006851chr1222069 354 --2946 554 --
NM_006876chr112266 140 ------
NM_006896chr711020 ------
NM_006902chr183303 3177 2951 2893 2866 2314 717 240 1677 ----
NM_006915chrX12577 --1620 --
NM_006920chr221827 575 ----12006
NM_006990chr162225 1929 1770 1615 1598 885 21010 317 ----
NM_007006chr1663335 2785 2243 1048 707 336 ------
NM_007039chr1422262 1699 --1324 --
NM_007050chr2097888 7180 5492 2783 2307 2050 1511 353 194 47442 6426 5756 2436 23081 1935 --
NM_007084chr13--1370 1351 --
NM_007106chr13148 --1527 --
NM_007107chr342386 1948 1810 252 --1720 --
NM_007125chrY31202 178 152 11117 ----
NM_007126chr92522 363 1424 --1479
NM_007185chr13775 675 294 ------
NM_007189chr71262 ----1384
NM_007249chr1359261 6301 2259 259 232 11952 18868 --
NM_007255chr5------1573
NM_007270chr751570 1512 1032 973 409 ----11541
NM_007275chr32175 121 ------
NM_007285chr16------1439
NM_007353chr742050 497 246 137 ----12559
NM_007358chr11748 ----1412
NM_007363chrX2974 864 ----1143
NM_012081chr543630 3218 1374 1330 12506 1973 --
NM_012092chr231530 510 121 ----11628
NM_012096chr353180 2886 2861 403 79 --13235 --
NM_012104chr1143759 1110 438 224 --13609 --
NM_012120chr672856 2776 2138 1930 695 570 217 ----1742
NM_012156chr2073452 3391 3318 2741 2288 985 214 ------
NM_012158chr1311255 --11288 --
NM_012164chr985073 2470 2001 1942 1849 1322 1072 431 --32914 2408 247 --
NM_012197chr931608 1250 1060 --1131 --
NM_012199chr154377 3544 2987 1767 798 ------
NM_012281chr722253 522 ----12419
NM_012286chrX1466 ------
NM_012297chr43991 965 928 --1368 --
NM_012300chr511899 1810 --1534
NM_012325chr2031433 383 311 ----1290
NM_012338chr73906 211 102 ------
NM_012343chr5--1297 1827 --
NM_012402chr112488 393 ------
NM_012465chr1022130 721 11354 1405 11300
NM_012479chr742431 1002 894 199 12555 ----
NM_013250chr1111075 ----2147 71
NM_013283chr53781 684 374 ------
NM_013374chr343070 2257 2140 670 ------
NM_013390chr951239 1191 1145 712 24 ------
NM_013437chr821356 1018 ------
NM_013444chrX1309 --1793 --
NM_013449chr123756 510 82 12872 --1740
NM_013943chr133291 3179 1246 ------
NM_014023chr1072553 2464 1827 1814 493 429 403 ----1583
NM_014079chr31434 --1412 --
NM_014112chr865290 4435 4019 2179 1287 862 11965 15341 --
NM_014154chr321179 200 1144 ----
NM_014181chr252883 1169 792 159 55 ----1212
NM_014232chr1721585 1189 11321 --11572
NM_014243chr442120 262 247 141 ------
NM_014299chr1931937 1692 1617 ------
NM_014319chr122378 175 --1592 --
NM_014323chr224946 684 55 46 ------
NM_014368chr922165 1367 ------
NM_014372chr131946 1616 413 --1143 --
NM_014411chr711357 11898 ----
NM_014426chr20----1160 --
NM_014454chr65826 746 406 256 163 1420 ----
NM_014456chr10----1412 --
NM_014469chr11----1598 --
NM_014552chr221425 954 ------
NM_014571chr132935 2733 958 1997 ----
NM_014577chr221239 --1888 --
NM_014612chr911474 ----133
NM_014620chr123544 255 234 ------
NM_014667chr332168 948 137 ------
NM_014670chr21228 1158 1166 --
NM_014671chr741432 1075 974 327 --11152 --
NM_014682chr832321 1821 447 --1909 1664
NM_014701chr1553341 1134 784 663 564 --13144 --
NM_014705chr751403 1333 816 346 147 --12116 --
NM_014720chr1031511 1187 478 1293 21754 205 --
NM_014729chr81271 --1251 --
NM_014730chr1254481 3756 3208 915 742 ------
NM_014742chr201410 --11426 --
NM_014755chr241258 605 269 261 ------
NM_014772chr1843377 2785 1342 456 --13077 --
NM_014776chr1253004 2494 2263 616 208 22029 1178 ----
NM_014803chr1021080 686 --12164 --
NM_014807chr111791 --1534 --
NM_014827chr131458 1320 1151 --21258 1070 --
NM_014830chr1252586 852 343 69 51 11135 1541 --
NM_014839chr131814 458 48 --1565 --
NM_014849chr1--1489 1495 --
NM_014869chr341512 1110 1086 936 1968 ----
NM_014874chr191836 1788 1520 1184 1178 624 603 510 42 31821 673 191 ----
NM_014877chr1796167 6106 5602 5358 5352 3095 2313 803 547 --21590 403 --
NM_014892chr6----2620 236 --
NM_014913chr1831432 116 88 1143 ----
NM_014962chr2022831 2201 ------
NM_014989chr631902 1525 454 189 1219 --
NM_015020chr1663883 3232 3201 2490 1457 371 2985 826 23040 309 21426 1397
NM_015025chr232418 1828 427 ----22690 475
NM_015027chr16----11385 --
NM_015045chr1031459 365 338 ----138
NM_015074chr164146 3722 3357 898 402 197 14169 11375 --
NM_015077chr1773811 3021 2963 1599 1006 779 694 13392 11079 --
NM_015100chr1----1645 --
NM_015144chr1643564 2812 2592 919 ------
NM_015170chr821688 706 --11490 --
NM_015172chr111470 31315 1003 495 171 --
NM_015191chr1172522 2480 2363 1682 931 852 161 1211 ----
NM_015215chr132275 952 439 23111 262 ----
NM_015231chr112343 178 ------
NM_015236chr461210 424 405 335 309 107 ------
NM_015271chr454143 3809 3548 3533 2656 12954 ----
NM_015277chr1831824 1183 262 ------
NM_015282chr2--12109 12837 --
NM_015288chr573878 3580 3037 2605 1039 276 182 11068 ----
NM_015310chr876794 6108 5730 2454 656 509 26 1584 26949 2973 --
NM_015317chr272502 2391 1855 1834 1151 859 238 ----12321
NM_015326chr123016 2826 ----12958
NM_015347chr1242707 843 605 460 ------
NM_015349chr641063 719 585 577 1976 --12992
NM_015397chr911188 ----11705
NM_015446chr1----1603 --
NM_015455chr543830 3428 3313 1186 12701 ----
NM_015509chr1251641 1547 1184 658 593 ------
NM_015550chr73989 509 355 23351 516 ----
NM_015559chr184907 809 786 361 ------
NM_015576chr372960 2690 1907 986 540 466 303 1436 12361 --
NM_015850chr882317 2101 1894 1762 1707 196 104 66 11992 --1257
NM_015872chr131310 1263 110 11348 ----
NM_015906chr154681 4589 3335 1090 554 194 --13805
NM_015912chr842132 1991 1819 1020 1986 ----
NM_016061chr231471 653 497 1522 ----
NM_016083chr613006 --13301 --
NM_016162chr126649 285 273 154 116 77 1788 1605 --
NM_016201chr321666 373 11473 ----
NM_016248chr1353047 2567 938 657 327 33671 2878 1004 11397 --
NM_016287chr1------11509
NM_016308chr112082 --11879 12037
NM_016322chr932651 2350 862 151 11266 2888 301
NM_016424chr1731502 1296 403 ----1460
NM_016436chr2052667 2033 1038 492 89 12346 --12084
NM_016530chr1522813 2690 --13337 11547
NM_016559chr32563 188 ------
NM_016577chr354472 3273 3174 1510 808 --24519 945 --
NM_016607chrX41654 1398 1103 132 ----1355
NM_016946chr143368 1422 1069 997 31393 1152 1088 23308 2294 --
NM_017420chr1432890 2817 1427 ------
NM_017423chr441819 661 507 307 --1258 --
NM_017508chr113999 388 331 --12181 --
NM_017548chr321931 1724 185 ----
NM_017580chr1031626 867 717 ------
NM_017582chr151639 1588 1281 1222 62 2293 235 1463 --
NM_017622chr173712 635 215 1113 ----
NM_017635chr1121029 511 ------
NM_017637chr9148831 8077 8014 7735 7280 6626 6435 5759 3621 2619 1698 1062 750 646 --13495 --
NM_017651chr61227 1287 11293 --
NM_017730chr32594 252 ------
NM_017753chr9----11011 --
NM_017811chr962836 2810 2045 927 414 398 ----11959
NM_017831chr1854177 3866 3003 684 54 --12956 --
NM_017848chrX54645 4049 3829 3155 908 11776 ----
NM_017902chr1045677 4859 4423 3924 15703 31860 1106 790 --
NM_017919chr943867 3810 735 164 163 ----
NM_017966chr1131331 455 182 ------
NM_017974chr2189 --11264 --
NM_017994chr712563 1753 1108 --
NM_017998chr911016 --11142 --
NM_018011chr132676 63 ------
NM_018014chr221262 368 ----1411
NM_018026chr112928 253 --11428 --
NM_018028chr1911140 --11367 --
NM_018061chr11473 --1309 --
NM_018086chr211199 --137 --
NM_018110chr1651379 1002 955 478 32 ------
NM_018128chr171460 ----1931
NM_018133chr351535 1357 489 424 72 1457 12155 --
NM_018214chr631230 1080 342 --1287 --
NM_018244chr204916 393 181 68 ------
NM_018287chr101402 ----11163
NM_018293chr333005 2785 172 --1901 --
NM_018323chr42461 242 ----1277
NM_018327chr2031389 651 512 ------
NM_018328chr2------1188
NM_018364chr133774 1376 757 ------
NM_018367chr1162111 1881 734 311 171 135 ------
NM_018383chr221486 228 11529 11433 --
NM_018416chr1222333 154 12348 --11827
NM_018440chr868666 7673 5676 2270 1979 98 12160 35787 3320 889 --
NM_018553chr174743 719 661 629 11292 ----
NM_018566chr145128 4135 4120 3128 1230 13536 --
NM_018710chr821349 973 ------
NM_018898chr521714 654 ------
NM_018948chr13995 165 157 1192 ----
NM_018979chr12299 49 2895 704 ----
NM_018999chr1044716 3141 1562 1055 --24939 1545 --
NM_019063chr222255 622 --12127 --
NM_019067chrX94734 4401 4072 3123 1712 1649 905 675 168 --14293 --
NM_019084chr10----1351 --
NM_019096chr651028 946 344 118 66 --1775 1788
NM_019106chr2253142 2288 2109 1331 358 12858 12728 --
NM_019114chr942455 2024 1790 434 ------
NM_019116chr1672988 1328 1122 821 657 326 277 33715 2917 2332 ----
NM_019555chr321746 1722 1279 1119 --
NM_019610chr1--11640 1562 --
NM_019885chr232917 2895 753 --22528 799 --
NM_020159chr41226 ------
NM_020211chr1521389 1123 1560 --11412
NM_020338chr1013160 ------
NM_020341chr2021275 1251 11321 ----
NM_020346chr11----11199 --
NM_020363chrY1125 189 ----
NM_020365chr1----153 1118
NM_020390chr393171 3156 1450 1184 1121 867 647 575 133 ------
NM_020403chr1341136 591 479 411 ------
NM_020432chr732265 2061 1748 ------
NM_020453chr41770 ------
NM_020463chr25589 509 422 413 43 ------
NM_020466chr644022 4000 3143 698 ----21602 254
NM_020640chr331932 344 77 ------
NM_020644chr11172 1115 ----
NM_020647chr822087 1687 --12026 1250
NM_020699chr165322 4543 3938 1420 1042 371 ------
NM_020713chr2062696 2361 2219 2029 907 540 --12403 --
NM_020728chr7--1190 1379 --
NM_020734chr1242934 2346 787 80 1395 ----
NM_020760chr21118 --11711 --
NM_020772chr1777764 6417 6366 6123 2816 950 627 11670 --1539
NM_020774chr1864892 4532 4158 1825 1602 1396 33934 325 173 ----
NM_020778chr1574481 3305 3203 3047 1489 1468 475 1306 ----
NM_020794chr1--191 1450 --
NM_020795chr1751669 1621 1447 710 679 --1360 --
NM_020796chr522960 1904 --21216 626 --
NM_020801chr532561 1899 1700 1867 ----
NM_020810chr1443256 2975 1041 769 12852 12830 --
NM_020858chr1572170 1808 1780 1667 834 215 62 ------
NM_020859chr463461 3049 2958 2679 912 364 33878 1190 204 23398 2934 --
NM_020866chr133832 772 134 139 ----
NM_020871chrX21017 788 ------
NM_020899chr17------12299
NM_020919chr211042 --11253 --
NM_020962chr1522399 1897 --11767 --
NM_021038chr353188 2620 2403 646 233 ----12420
NM_021072chr5--12534 11950 --
NM_021097chr252512 1231 1172 1064 948 --22460 2100 --
NM_021117chr1152264 1949 529 237 200 ------
NM_021132chr1031121 976 519 ------
NM_021249chr1431465 1438 1375 --11697 11545
NM_021252chr101306 --21364 827 --
NM_021648chr62713 161 --1418 --
NM_021813chr694987 4794 4730 4510 3880 3660 3619 2334 1772 34353 2326 675 --11142
NM_021961chr11117175 6951 5674 5555 5253 5037 4938 4521 2344 1988 1287 ------
NM_022037chr2--1724 --1189
NM_022041chr1632574 1712 99 22690 1674 --1241
NM_022044chr22----1117 --
NM_022048chr1566412 5735 5628 5447 1181 658 11522 25728 3919 --
NM_022130chr531283 1075 167 ------
NM_022170chr751654 516 461 445 347 ------
NM_022459chr1395825 5394 4710 4081 2283 1550 774 673 498 --14450 --
NM_022461chr3------11340
NM_022494chr10----1498 --
NM_022574chr731721 1583 717 11528 ----
NM_022719chr2241183 932 731 148 33860 3485 796 ----
NM_022749chr841282 1066 287 137 ------
NM_022756chr141096 1053 369 242 ------
NM_022763chr322892 1997 13009 12868 --
NM_022766chr2262652 2434 1947 1913 602 75 ------
NM_022776chr321621 1191 1612 ----
NM_022826chr211187 1191 ----
NM_022897chr51918 1369 179 --
NM_022912chr262746 2271 1212 995 388 249 1939 ----
NM_022918chr1151856 1560 515 177 59 ------
NM_023016chr22861 803 --12316 --
NM_023037chr1331006 224 43 --152 --
NM_023927chr521134 91 ------
NM_024015chr1731169 1007 977 ------
NM_024034chr205762 660 372 181 46 --11001 --
NM_024050chr191183 --1239 --
NM_024111chr151654 --1215 --
NM_024496chr14--1683 ----
NM_024613chr831823 1780 1372 ------
NM_024640chr12957 169 139 ----
NM_024646chr133295 824 714 ------
NM_024665chr354544 4193 1138 748 655 1218 ----
NM_024742chr1641644 1399 1365 140 ------
NM_024939chr1661535 1478 1121 1027 633 534 ------
NM_024963chr745509 5231 657 438 13948 14261 --
NM_025160chr121276 222 21500 212 13340 12871
NM_025203chr231342 543 429 ------
NM_025248chr1762953 2909 2665 2365 782 170 --13063 --
NM_030571chr5----21161 404 --
NM_030579chr1623053 2783 23685 2731 ----
NM_030625chr10277 58 12496 12596 --
NM_030627chr524149 3510 23289 249 ----
NM_030647chr796294 5999 5871 5770 5592 4571 1106 283 142 25114 1036 --11199
NM_030751chr1021781 94 --1391 --
NM_030786chr121268 524 1209 ----
NM_030918chr183873 3739 3604 3490 2092 2029 1538 196 1342 13385 --
NM_030927chr1031128 538 158 ------
NM_031296chr421045 461 --1985 12000
NM_031445chr232156 1059 859 13020 11138 --
NM_031452chr152174 73 ------
NM_031469chr633196 1216 990 ----1325
NM_031476chr1682618 2315 1773 673 611 531 332 226 11790 12253 --
NM_031954chr1232898 2786 2119 --22059 1831 --
NM_032102chr1133093 2823 648 22676 2373 1610 --
NM_032120chr72466 92 ------
NM_032182chr1011131 --11443 --
NM_032199chr1063749 3479 3236 2894 1303 68 ----12451
NM_032208chr293309 2890 2399 2311 2232 677 669 379 364 --1505 --
NM_032221chr2041775 1751 1362 464 ------
NM_032324chr1------1179
NM_032387chr17------1370
NM_032410chr81247 ------
NM_032420chr52802 626 ------
NM_032436chr131831 142 ----
NM_032439chr101255 ----11159
NM_032510chr1842033 1846 1627 445 ------
NM_032552chr931906 1435 1267 31486 492 30 1611 --
NM_032679chr1911066 --1160 --
NM_032682chr363534 3225 2603 2247 860 459 ------
NM_032701chr19----1618 --
NM_032818chr941854 1044 486 426 --1618 --
NM_032900chr1033721 1499 395 11286 --12502
NM_032932chr17116414 6294 5360 5337 5306 4851 4771 4290 4022 1590 1573 11543 11389 --
NM_032983chr712269 --1677 --
NM_032995chr24680 582 506 432 11242 ----
NM_033030chr2----1224 --
NM_033088chr1----1677 --
NM_033133chr1753295 2849 1411 1368 1090 ----23745 2365
NM_033224chr738012 2801 1370 --16796 16860
NM_033226chr16------1598
NM_033394chr2----21314 1066 --
NM_033419chr174647 533 159 51 1463 ----
NM_033512chr852264 942 611 390 33 --2408 84 --
NM_033656chr2185457 4077 3764 3686 1095 671 602 171 15040 ----
NM_052879chr1233073 3050 1399 23237 2722 23924 2757 1193
NM_052880chr223582 564 265 ----11352
NM_052907chr1223207 2859 --14151 155
NM_052910chr1341665 1514 516 431 1283 ----
NM_052913chr621104 806 11056 ----
NM_053023chr1122543 209 ------
NM_058170chr11525 ----1176
NM_080872chr813955 --23900 317 --
NM_130830chr343844 3695 3515 2800 23995 3002 ----
NM_133265chrX53074 2961 2307 1127 425 --1735 --
NM_133329chr241622 1318 77 51 ------
NM_133334chr4106405 5923 5200 4576 4533 3903 2469 1949 1232 25 11180 25949 4137 --
NM_133369chr53680 656 618 --1143 --
NM_133433chr5----1143 1297
NM_133443chr1692166 2086 2071 1920 1449 905 556 315 164 12260 1579 --
NM_133496chr1104283 4248 4176 3783 3341 3165 1583 1398 937 331 1423 1877 --
NM_138290chr7266 35 ------
NM_138316chr101444 2120 61 ----
NM_138357chr101710 --1295 --
NM_138396chr122649 102 168 1666 --
NM_138468chr256362 5835 4248 366 201 36057 5336 5135 --16210
NM_138473chr1244904 4479 583 224 ------
NM_138771chr75966 513 210 75 23 ----1135
NM_138775chr11253 34 ----1166
NM_138927chr213869 666 220 ------
NM_139057chr1552532 2401 934 779 451 12698 ----
NM_139246chr922189 1880 11627 ----
NM_139283chr1252564 2459 932 71 61 12506 1336 --
NM_144563chr22602 333 1651 ----
NM_144571chr456041 4958 2742 1022 633 --22548 644 11220
NM_144578chr1454790 3570 1766 1594 81 ----11517
NM_144600chr1621334 1178 --21490 421 11556
NM_144642chr3------11322
NM_144723chr51190 ----138
NM_144778chr132526 164 --11678 --
NM_145049chr51431 187 ----
NM_145117chr1133077 2696 2439 13251 ----
NM_145239chr1621204 40 ------
NM_145251chr1421140 115 ----1167
NM_145284chrX3652 620 241 --12515 --
NM_145808chr732125 797 434 1607 ----
NM_145891chr163589 336 229 ------
NM_152253chr2234100 1306 1060 23914 843 11075 --
NM_152272chr8149 --11329 --
NM_152309chr1042154 144 132 77 --11965 --
NM_152409chr553122 2827 2523 1233 161 --11449 --
NM_152437chr1232365 2358 149 ------
NM_152470chr1864160 4108 2840 1548 1470 448 ------
NM_152493chr121457 370 ------
NM_152556chr722038 978 --12007 --
NM_152594chr1532132 2114 1918 ------
NM_152608chr152463 1871 1770 1648 742 ------
NM_152622chr553006 2811 2741 1348 929 ------
NM_152641chr1262757 2356 1789 918 815 131 ------
NM_152653chr31139 1610 ----
NM_152678chr352435 2285 1755 344 313 --11693 --
NM_152707chr101319 --1236 --
NM_152756chr532647 1694 492 ------
NM_152793chr754925 4468 3848 3827 1493 --24364 2016 1300
NM_152835chr142702 1080 522 36 --1368 --
NM_152994chr2--2139 115 185 --
NM_153020chr641450 1255 1132 363 ------
NM_153184chr321795 1481 --11274 2574 46
NM_153226chr103472 452 234 ------
NM_153235chr611669 --1728 --
NM_153619chr1573408 3046 3018 2905 2430 1453 1300 ----1745
NM_153810chr1054641 4487 3409 1373 638 --1798 1134
NM_170606chr721585 449 --11802 --
NM_170746chr11128 --1533 2371 54
NM_170750chrX4907 279 178 39 ------
NM_171998chrX2491 176 ----12417
NM_173065chr173611 3536 3175 2594 2450 731 562 --13113 --
NM_173083chr121218 913 196 ----
NM_173470chrX42838 2232 2153 1066 --1297 --
NM_173475chr1651188 718 477 245 149 ------
NM_173476chr1631918 333 106 1287 --11487
NM_173492chr9------1306
NM_173576chr1022238 2201 1697 11897 --
NM_173595chr1255262 5014 4833 4798 2081 --11786 --
NM_173822chr221350 858 ------
NM_173851chr863592 3164 3006 2759 1511 53 11270 --12965
NM_175061chr732084 750 297 ------
NM_175736chr1255248 2876 1784 1497 1095 21866 1723 ----
NM_175854chr131865 1624 1393 --
NM_175856chr52764 53 ------
NM_176814chr71231 21410 1375 ----
NM_176871chr882904 2884 2836 2710 1041 1021 436 104 ------
NM_177424chr131791 1498 813 ------
NM_177999chr993671 3590 3131 3060 1181 926 617 188 39 --1627 1806
NM_178011chr1023191 523 ----12580
NM_178126chr1742273 1896 701 309 --2639 118 11857
NM_178426chr131945 1927 400 --129 --
NM_178539chr1212090 --1606 --
NM_178554chr353617 3610 2644 2451 304 ------
NM_178568chr1741670 1144 608 92 ------
NM_180989chr1321886 1004 --1890 --
NM_181457chr231090 331 174 1843 ----
NM_181504chr553740 3455 1195 1096 457 --11670 --
NM_181571chr102786 735 ------
NM_181672chrX22061 519 ------
NM_181704chr2131011 86 45 11047 ----
NM_181844chr1751487 786 712 460 192 ------
NM_182526chr1452557 2539 2025 184 163 1622 ----
NM_182557chr1162218 1745 619 603 160 35 1428 177 --
NM_182663chr152176 2106 1926 1674 772 ------
NM_182700chr721875 1661 ----11617
NM_182717chr1041191 1140 1081 146 1332 1976 --
NM_182935chr352360 2216 1725 406 371 --11600 --
NM_182944chr141316 ----1104
NM_182978chr182704 540 ------
NM_194247chr211374 11187 ----
NM_194249chr52350 140 --1466 --
NM_194314chr144027 3951 3546 827 15101 ----
NM_198270chrX43096 2983 1174 149 --13234 --
NM_198560chr373791 3672 3665 3074 1470 1273 831 1768 1491 --
NM_198581chr297287 7095 6674 5730 5402 5103 5039 1901 1263 --47277 6612 5668 5340 12684
NM_198859chr381492 1435 1399 876 860 852 185 123 --11910 --
NM_198935chr2072773 2577 2497 2378 2292 1289 213 --2148 93 --
NM_199000chr7--12288 ----
NM_199262chr1722137 1592 1642 --11727
NM_199320chr422946 2207 11941 12387 --
NM_199355chr1621730 1184 1531 ----
NM_201520chr1721657 208 11434 ----
NM_201613chr12----1175 --
NM_203301chr1451705 1370 1301 269 93 1644 ----
NM_203365chr2--142 --159
NM_206855chr676348 6285 6242 2124 1119 1108 670 44077 1803 974 367 ----
NM_207317chr51400 --1391 --
NM_207371chr1021132 1069 --11514 --
NM_207396chr12393 355 --3660 597 293 --
NM_207406chr486543 4382 4275 2559 2460 2389 2375 2113 26214 4548 14661 --
NM_212558chr923696 3645 --1166 --
NM_213589chr234157 762 422 15460 ----
NM_213606chr1011687 --1950 --
NM_213609chr31945 ----11082