TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-338-5p
miRNA Sequence: AACAAUAUCCUGGUGCUGAGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX52411 2261 1206 991 406 22986 768 23102 2380 185
NM_000084chrX56781 4305 1128 411 120 --25466 2153 22059 58
NM_000091chr242894 2801 1904 101 --32816 1096 778 --
NM_000176chr541559 119 106 91 2595 56 13190 --
NM_000216chrX63679 3211 3098 2706 1592 1584 14037 12741 23843 1149
NM_000259chr1596334 5676 4803 2170 919 852 575 481 381 25551 5353 25583 488 25917 5788
NM_000267chr1743438 3200 1368 139 13255 --23121 91
NM_000332chr6127176 6865 6328 6251 5376 4907 4868 2607 1852 1541 1297 769 14357 --16927
NM_000397chrX92054 1987 1955 1675 1648 1576 647 573 540 --11655 --
NM_000430chr1763689 3647 2858 1228 1001 327 13779 195 11389
NM_000489chrX92762 2717 2642 2439 2309 2222 1041 532 193 12655 13172 12319
NM_000826chr472510 2248 2174 852 610 451 222 22601 2009 1756 11946
NM_001001419chr565075 4815 4291 3425 3226 808 1207 45217 5171 3911 29 15093
NM_001001664chr2114020 3847 3727 3043 2736 2702 715 448 326 265 134 ------
NM_001003652chr1898074 6048 5540 3376 3350 2293 1757 1474 341 --28097 7651 11236
NM_001003674chr18176994 6634 6449 6384 6351 6059 5522 4924 4343 2605 1308 775 597 560 504 417 81 11343 45899 5430 1564 643 --
NM_001005473chr566199 5656 4590 769 580 453 --22174 1570 12575
NM_001006623chr242154 2004 1891 761 --1557 22433 1029
NM_001010891chr5126779 5596 5493 5282 4361 2701 2383 1698 1676 1649 1175 307 --14907 16877
NM_001011666chr776467 6047 5203 5122 2306 1541 440 15631 36190 5357 151 --
NM_001013620chr12117841 7379 6733 6281 6071 5519 1837 1429 967 618 263 27330 6619 77309 6239 5953 5698 5152 1711 1475 28056 743
NM_001018090chr1521083 241 --3235 197 87 12086
NM_001025076chr10106114 6062 5872 5320 3995 3897 1465 1275 784 441 25892 3972 14050 --
NM_001025077chr10157472 7420 7230 6678 5353 5255 5063 4734 4702 2823 2633 2142 1799 917 653 27250 5330 25408 4644 --
NM_001025580chrX44291 2763 953 711 ----24272 2887
NM_001030055chr1444398 1744 1536 1186 31504 1129 931 53600 1473 678 516 306 --
NM_001039618chr1175380 4857 4773 4014 2102 1047 122 44956 4271 3997 1004 25808 5122 --
NM_001039840chrX85389 5193 4806 4396 2276 877 820 564 1629 13974 --
NM_001042555chr1284633 4068 3322 2975 1652 1193 958 21 34549 4110 3769 11350 13758
NM_001042599chr2117634 7416 7267 6743 6378 5067 2835 2351 2269 2211 1804 --16112 --
NM_001042749chrX41827 1810 1629 1359 1804 31639 1612 746 21909 534
NM_001099678chr386430 6400 6025 6018 5932 5660 4660 4523 45877 5715 4608 1537 --25466 1244
NM_001167chrX86594 5680 5114 2055 1776 1540 1344 489 21754 1682 130 15213
NM_001204chr277696 6553 5668 5572 2338 449 326 17251 --17147
NM_001259chr785895 5605 3860 2110 1147 953 943 934 22343 757 14834 14080
NM_001304chr1783133 3010 2981 2893 2569 889 862 702 --23368 770 22751 310
NM_001438chr132310 628 36 13180 33573 2289 1160 23565 2452
NM_001455chr6124895 4776 4504 3660 3110 1881 1790 1744 1296 875 382 352 ----1504
NM_001527chr6104875 4357 3999 3507 3100 880 732 708 165 48 --34662 4255 3843 --
NM_001616chr243328 1343 447 149 33387 2242 467 --13489
NM_001621chr742726 967 810 793 11227 11120 12644
NM_002025chrX119231 9197 7594 6931 6724 6317 5708 2944 2280 2250 1221 11793 33083 1836 290 28010 533
NM_002270chr5115114 5067 4765 4450 4346 4172 3802 1495 972 520 195 ----35620 3681 1145
NM_002310chr566597 5755 5577 4625 346 102 14558 11573 11552
NM_002581chr995136 5098 4540 3862 3783 2106 1845 1159 60 25232 4202 13892 --
NM_002709chr252191 1120 1098 956 752 1183 12386 11136
NM_002886chr374434 4309 1885 1495 1378 1183 681 43628 3471 3193 1337 13460 --
NM_002902chr154493 271 194 76 1542 1217 184
NM_003304chr341349 454 93 58 21442 601 --11612
NM_003410chrX62866 897 384 360 97 33 12975 --22895 708
NM_003615chr343763 3653 3571 1443 --23939 1364 183
NM_003618chr24349 261 183 123 1461 --11316
NM_003822chr183187 2849 2678 2498 2441 1064 204 137 11950 23118 2687 --
NM_003909chr862471 2408 1862 988 710 279 --12377 2780 403
NM_004161chr231436 642 319 ----2601 546
NM_004430chr812672 --22733 2567 22690 2619
NM_004612chr964003 3976 1497 942 588 106 14057 --14228
NM_004795chr1341818 766 177 83 --11829 21661 1298
NM_004852chr182114246 13724 12570 11879 11367 11316 10604 10401 10320 9755 5653 5455 5184 4901 4067 3380 2276 2268 2185 1223 841 29603 911 211582 5042 213082 11668
NM_004985chr1274390 4181 4085 3576 2934 1077 318 14524 12857 13471
NM_005116chr2073550 3331 1112 1095 871 605 508 33904 2821 1064 24536 4468 --
NM_005156chr974691 4570 3928 3853 3258 1561 519 14456 34176 3629 1118 --
NM_005160chr2286622 6521 6104 5998 5459 2404 1018 968 --12290 16577
NM_005180chr1051641 1531 1289 1071 197 --11411 11053
NM_005339chr454297 4013 3200 3194 1399 11069 --23347 1569
NM_005436chr1034093 406 172 23726 142 23966 766 21490 997
NM_005504chr12106526 5593 5007 4432 4050 2537 2193 1308 1150 929 16212 22628 854 1631
NM_006538chr224068 208 --22639 1313 22863 2800
NM_006902chr142314 1158 946 290 ----23305 2953
NM_007006chr1673550 3387 3326 2594 1229 336 137 --12786 12245
NM_007249chr13149230 9051 8391 8168 8112 7307 7209 7165 6357 5805 1688 1682 1465 1159 19082 28044 2044 --
NM_012096chr363643 3234 2673 1247 758 79 21098 125 --12888
NM_012214chr266421 5707 5642 5246 5084 2338 46201 1099 1003 835 31852 1046 290 --
NM_012382chr554396 3699 3637 3136 670 1157 33497 1701 1612 11204
NM_012464chr482922 2807 2586 2257 936 908 894 78 32839 2739 926 22699 945 --
NM_013255chr758248 7711 3406 2355 569 --35384 1025 401 38835 3052 1282
NM_013396chr21--11412 21116 1004 21434 461
NM_014021chr163495 3319 2875 971 872 670 1325 11162 12855
NM_014028chr683188 2693 2541 2438 2042 1048 985 455 11261 --23144 479
NM_014106chr1562886 2739 2632 2248 2161 264 ----22265 242
NM_014616chr353064 2428 1352 964 526 13460 23270 1387 13359
NM_014746chr284337 3567 3553 3313 1630 1488 774 726 1853 34269 705 362 11377
NM_014946chr253121 2728 608 440 197 22627 802 22244 318 11251
NM_015025chr282539 2469 2439 2283 2055 1828 1045 473 1703 2518 428 --
NM_015026chr1274265 3327 1866 1441 899 560 112 12981 13671 24415 821
NM_015040chr263292 3216 2988 2595 2445 533 23312 2835 1577 12425
NM_015087chr1382689 2270 1913 667 656 426 311 286 1706 12109 --
NM_015156chr1483412 2718 2642 1587 1434 1194 519 182 13844 23601 2824 13830
NM_015310chr8118299 8240 8161 6948 5901 5759 5167 2899 1082 974 564 25174 134 28058 7627 --
NM_015349chr652990 2648 719 519 513 11969 13031 11065
NM_015879chr1878259 5971 3449 3179 2606 586 226 --38500 8166 805 13152
NM_015886chr8105746 5662 4612 4420 4325 4170 3833 3648 2032 1252 11305 15650 1231
NM_016083chr693938 3642 2449 1433 955 827 705 216 72 13369 --13687
NM_016132chr1583422 3274 3047 2598 1000 976 725 264 1327 --22487 81
NM_016271chr1842341 2312 2244 307 3608 351 260 --21434 820
NM_016374chr121498 1086 21342 1229 11169 21578 1099
NM_017420chr1462989 2622 1353 1172 898 762 13041 --11429
NM_017508chr1162268 2180 331 198 192 186 22414 2395 1460 1723
NM_017637chr9167735 7655 7280 6994 6563 3621 3457 3281 2615 2478 2198 2152 2109 1822 1698 569 45764 2134 1366 390 19074 16628
NM_017650chr7116062 5255 5112 4281 2292 2242 1881 1722 786 355 285 24975 2042 25346 4858 13685
NM_017813chr884622 4523 2330 2294 2274 2143 660 202 13831 14963 24644 507
NM_018437chr9------2553 78
NM_018638chr1275263 5142 3946 2237 1093 879 95 34543 2093 1278 1936 34613 4438 280
NM_020228chr1162466 2351 1603 867 816 614 12503 32191 1902 333 --
NM_020390chr384485 4361 3342 1624 1429 867 437 365 24325 3147 21857 1122 13780
NM_020771chr61508 1443 --2624 550
NM_020772chr1757258 6366 3297 2996 751 46650 5330 3399 1824 38030 5863 5632 11910
NM_020796chr562730 2358 2337 2097 709 625 12876 22894 2465 12962
NM_020856chr1931472 183 82 ----21260 596
NM_021038chr383188 2942 2913 2620 2418 714 383 142 --22245 647 186
NM_021252chr1091879 1846 1654 1645 1608 1595 1363 826 306 1780 --11735
NM_021629chr344749 4517 4386 254 1992 25087 1534 23878 1655
NM_022048chr1585816 5735 5727 5628 4590 2234 1264 816 --26358 802 --
NM_024665chr384680 4646 4512 4047 3151 1646 1001 966 24438 2881 21139 656 14195
NM_024947chr3159362 8896 8764 8252 7501 7265 6446 5889 3418 3054 2476 1757 1254 711 97 12316 49574 9506 6779 911 29597 9123
NM_025191chr193413 3400 2555 1369 1344 1285 771 447 308 11292 --13284
NM_030920chr111843 --12048 21663 186
NM_032199chr1082894 2449 1525 983 965 785 728 662 13589 11304 13598
NM_032373chr1065505 4492 4216 1690 721 227 15319 1162 25494 1560
NM_032869chr881849 1802 1745 1564 1426 1381 400 331 21569 409 11840 --
NM_032968chrX104244 4072 3256 2789 1700 1368 982 508 490 293 14174 23107 611 --
NM_032973chrY94236 4064 3251 2784 1694 1368 982 508 293 14166 23102 611 --
NM_052885chr1253667 3606 3360 1916 605 24841 4248 --1280
NM_057175chr422030 1919 12164 --22434 546
NM_130847chr11145783 5692 5679 5312 5254 5172 4333 2173 1935 1295 1249 1149 957 712 ----15847
NM_133334chr4105948 5382 5273 4685 4264 4075 2277 1232 995 603 36211 925 474 --15925
NM_133493chr684612 4558 4295 4211 2985 2839 1729 1506 12999 24257 4091 24597 3534
NM_138286chr1974292 2934 2815 1308 1067 1020 450 1845 12831 13352
NM_138731chr1463476 3290 2667 871 836 720 11287 22853 389 --
NM_144578chr14115005 4790 4057 3500 1835 1484 1341 770 541 335 264 14590 11767 13988
NM_144599chr1585365 5328 5138 3412 1525 1202 860 401 14879 35455 4386 3528 --
NM_144973chr12115256 5187 5058 4475 4273 3831 3285 1485 1297 480 319 1161 15173 1156
NM_145175chr2------31379 1312 1288
NM_153207chr1273711 3123 2535 2518 1194 1061 368 22836 1047 12585 11206
NM_153810chr10124618 4563 4475 4246 3803 3130 1475 1211 873 797 400 132 --24642 639 --
NM_170710chr452918 1232 1206 424 332 13075 11253 12447
NM_173468chr475745 4652 4133 1683 711 617 55 25479 4620 25693 275 21968 487
NM_173582chr1146052 2077 2047 262 24264 2034 24241 3809 12305
NM_173829chr532188 800 366 25838 884 15879 32481 1306 531
NM_175856chr54119 100 80 60 173 ----
NM_181358chr193947 3899 3044 2916 2726 2702 1273 404 63 21624 189 12671 --
NM_181723chr862115 1737 679 644 452 382 2923 769 2891 612 --
NM_182485chr4103621 3332 2933 2717 2595 2347 1404 890 802 455 13660 13739 --
NM_182503chr685219 4974 4449 3510 2180 1573 1269 617 --199 14010
NM_182515chr1955462 2315 2136 1915 1249 11180 24687 2483 16348
NM_182758chr1553893 2782 969 230 89 --33900 3469 543 23938 903
NM_194317chr252614 2434 2202 1759 161 --11945 22738 2243
NM_198581chr2157542 7501 7276 6611 5667 5339 5039 4839 2682 2218 1887 1723 1625 792 545 56250 5969 5010 607 250 ----