TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-339-3p
miRNA Sequence: UGAGCGCCUCGACGACAGAGCCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000090chr22688 248 1339 1615 --
NM_000389chr6------11509
NM_000430chr1722989 2798 ------
NM_000480chr1111280 ----11219
NM_000484chr21----1742 --
NM_000612chr11--12434 12763 --
NM_000908chr5----189 --
NM_001005404chr1713181 13771 --14509
NM_001005505chr3------11515
NM_001005910chr3----1169 --
NM_001005920chr16--156 ----
NM_001007279chr222359 139 ------
NM_001007471chr9------1786
NM_001010986chrX----1255 --
NM_001012614chr41206 --1185 --
NM_001012755chrX21719 1053 ----11656
NM_001013031chr1023076 2449 --1205 --
NM_001013622chr41790 ------
NM_001013635chr121480 --11039 1766
NM_001014797chr1027722 2964 --18126 --
NM_001017396chr2------1842
NM_001029859chr11----12303 --
NM_001030007chr1633654 2852 913 --22817 729 --
NM_001032289chrX1770 ------
NM_001033026chr19--1629 ----
NM_001038707chr1----12220 --
NM_001039577chr163688 3369 3138 2966 2782 31 11471 14037 --
NM_001039690chr1621988 51 --1267 --
NM_001039802chr111003 ------
NM_001039916chr12------1278
NM_001040158chr51371 --1397 --
NM_001040167chr71993 --11207 --
NM_001040273chr101403 --2797 52 --
NM_001040715chr16----1399 --
NM_001042681chr14837 808 387 323 --1712 --
NM_001083621chr1--1374 --11693
NM_001116chr1642079 925 911 653 --130 --
NM_001149chr10------11085
NM_001174chrX1152 ------
NM_001362chr141353 --1689 --
NM_001407chr321712 669 ------
NM_001616chr2----12551 --
NM_001622chr3----1314 --
NM_001668chr122196 744 --1864 --
NM_001702chr8------1128
NM_001742chr7----1317 --
NM_001797chr16----144 --
NM_001854chr11280 ----1330
NM_002167chr1137 ----1165
NM_002264chr355070 4584 1867 1446 1013 23625 122 11341 --
NM_002501chr1934090 3486 2798 23178 1114 ----
NM_002616chr171485 --1511 --
NM_002669chr4------167
NM_002710chr12----1384 --
NM_002716chr1113261 ----12401
NM_002827chr20------11361
NM_002894chr18----1177 --
NM_003051chr1------189
NM_003061chr10------1254
NM_003076chr12----198 --
NM_003108chr232602 2060 445 12162 12915 --
NM_003128chr222569 339 1361 --11030
NM_003253chr2131786 1519 101 ------
NM_003297chr12--1294 ----
NM_003300chr14--186 ----
NM_003305chr4------1394
NM_003320chr1124427 4173 --12793 --
NM_003347chr2211723 --1112 --
NM_003373chr1011822 ------
NM_003403chr14------1782
NM_003404chr20--21523 673 11795 --
NM_003410chrX----12037 --
NM_003470chr1621515 497 ------
NM_003474chr101750 --1166 --
NM_003597chr212115 ----1404
NM_003692chr9----1797 --
NM_003792chr9127 ------
NM_004116chr2------1340
NM_004162chr3------11324
NM_004183chr11----1678 --
NM_004296chr1463640 3102 2763 1275 714 647 --21585 61 --
NM_004316chr12194 1240 ----
NM_004392chr1312397 ------
NM_004393chr31724 --1897 --
NM_004416chr121732 --1804 --
NM_004418chr21507 1526 1185 --
NM_004474chr11669 --1921 --
NM_004586chrX13855 13604 1724 --
NM_004637chr3----11111 --
NM_004663chr15------11401
NM_004734chr13--1210 1991 --
NM_004852chr18211378 9613 29958 760 --13009
NM_005168chr231415 319 122 --11353 --
NM_005181chr8----177 --
NM_005386chr20----143 --
NM_005400chr21475 --1193 --
NM_005417chr20----1751 --
NM_005418chr112637 254 ------
NM_005477chr151595 ------
NM_005719chr12------1215
NM_005828chr1753632 1511 1480 1021 297 --1693 --
NM_006047chr2022342 1328 --1364 --
NM_006128chr8----1230 --
NM_006336chr9----21417 550 --
NM_006534chr2011159 --12321 --
NM_006690chr201810 187 12024 --
NM_006717chr913142 ------
NM_006729chrX25323 3431 ----15166
NM_006836chr12----1102 --
NM_006837chr8----1104 --
NM_006852chr171116 ----157
NM_006854chr721965 722 --141 --
NM_006897chr121252 --1407 --
NM_006943chr2033323 2614 1124 ------
NM_007011chr1514989 --25066 4872 --
NM_007033chr132113 2056 1651 ----1173
NM_012081chr51753 ------
NM_012110chr41228 --166 --
NM_012193chr1123406 1334 --11575 --
NM_012199chr123503 2827 --14110 --
NM_013396chr21------1191
NM_013416chr22--1114 ----
NM_014035chr5----1170 --
NM_014117chr1632621 663 583 --12017 --
NM_014494chr1622380 490 12203 ----
NM_014572chr1311712 ------
NM_014665chr833406 1214 1146 ----23270 2961
NM_014729chr81276 ------
NM_014757chr5------12077
NM_014770chr121815 --2869 313 --
NM_014806chr9--1147 --1504
NM_014822chr4------1159
NM_014829chr5----12165 --
NM_014906chr1721446 719 11427 13893 --
NM_014912chr1012569 --11166 --
NM_014918chr15------11367
NM_014938chr1212377 ----12177
NM_015042chr1533403 765 67 ----13314
NM_015045chr10----126 --
NM_015074chr113308 34462 3246 3199 ----
NM_015075chrX32294 1406 255 ------
NM_015086chr12------11570
NM_015206chr1513756 --11315 --
NM_015239chr9----1179 --
NM_015294chr171936 --1371 166
NM_015305chr142286 172 ------
NM_015326chr1----12312 --
NM_015344chr8----1124 --
NM_015346chr14------11410
NM_015347chr12--1953 ----
NM_015374chr2221443 447 --185 --
NM_015488chr2------11778
NM_015557chr133185 2247 1398 134 12797 --
NM_015872chr121345 606 --11448 --
NM_015897chr19------133
NM_016308chr111760 ----1219
NM_016396chr15--1888 2542 377 --
NM_016505chr1------1503
NM_016547chr11472 ----190
NM_016605chr5----12532 --
NM_017443chr921429 1420 ----11327
NM_017482chr2180 --144 --
NM_017643chr1712681 ------
NM_017668chr161122 ------
NM_017849chr2----11035 --
NM_017893chr10----2236 219 --
NM_017907chr11------1381
NM_017993chr13----1146 --
NM_018013chr612263 ------
NM_018027chr1022989 934 --1313 --
NM_018240chr11914 --1174 --
NM_018371chr8--1317 11115 --
NM_018423chr12--11185 ----
NM_018448chr12----11268 --
NM_018948chr1------11225
NM_018977chrX----1357 --
NM_018983chr4------1238
NM_019594chr911325 --11089 --
NM_020180chr1811375 ------
NM_020341chr2011513 ------
NM_020440chr142511 2231 2148 2048 --1133 --
NM_020699chr114807 ------
NM_020724chr432431 2106 61 --1120 --
NM_020734chr121776 ----13288
NM_020772chr1715402 --26574 914 --
NM_020808chr11291 --1454 --
NM_020888chr1--1191 1711 --
NM_020919chr2----11093 --
NM_020935chr21711 --11236 --
NM_021033chr1323381 2895 ----11271
NM_021168chr161215 --1530 21175 1030
NM_021625chr12------1508
NM_021629chr313763 --14738 --
NM_022048chr1511519 --1663 --
NM_022055chr2----186 --
NM_022114chr114056 1387 14333 --
NM_022166chr1644627 1624 1076 384 ----15343
NM_022719chr2231413 931 416 ----12704
NM_022768chr1--1358 ----
NM_022776chr311433 ----11270
NM_022823chr2----1476 --
NM_022898chr1444611 1030 776 435 14047 14428 --
NM_022912chr212254 11964 ----
NM_024036chr11125 ----1202
NM_024076chr1912406 --12138 11640
NM_024089chr13----135 --
NM_024507chr16128 ------
NM_024595chr1--1767 ----
NM_024613chr8----1569 --
NM_024617chr9----142 --
NM_024676chr151082 373 353 185 132 1867 ----
NM_024798chr1522434 750 22385 1927 ----
NM_025010chr32468 141 --152 21112 947
NM_030627chr523191 1401 ------
NM_030645chr131218 1131 395 --2243 169 1960
NM_030661chr71171 --1453 --
NM_030795chr82129 86 ------
NM_030949chr621201 173 --21395 1143 --
NM_030962chr112531 502 ------
NM_031911chr41564 --11723 --
NM_032047chr3----12186 --
NM_032153chr322756 718 ------
NM_032256chr121387 ----1133
NM_032325chr111356 1552 177 --
NM_032536chr92150 118 --1109 --
NM_032622chr4----11485 --
NM_032784chr6----168 --
NM_032932chr1735983 4289 4275 ----16045
NM_032982chr721926 562 ----12467
NM_032983chr712740 1541 --13281
NM_033121chr121381 ----11871
NM_033129chr2031961 1881 1567 --21968 1474 --
NM_033259chr3--1227 ----
NM_033389chr1734352 4185 825 --14686 --
NM_033626chrX21772 472 ------
NM_052910chr1321518 543 ------
NM_052925chr191113 ------
NM_053023chr111348 ----1682
NM_057161chr6----1222 --
NM_080430chr22--164 ----
NM_080546chr91918 ------
NM_080616chr201281 --1215 --
NM_080744chr7----1532 --
NM_080867chr14----11867 --
NM_133457chr731319 1264 263 --11487 --
NM_133507chr121150 ------
NM_138473chr1264562 3968 3590 3551 3173 914 21088 612 14800 --
NM_138992chr2121060 778 166 1286 --
NM_139058chrX----2428 168 --
NM_144571chr436865 2494 1845 --15682 --
NM_144635chr31125 ------
NM_152253chr2283884 3759 3455 3259 3176 555 420 121 --13669 --
NM_152264chr111908 1897 ----
NM_152287chr162117 101 --21900 1854 1428
NM_152335chr151122 --1227 --
NM_152341chr16----21225 180 --
NM_152470chr1854107 3962 1547 1157 1045 --1460 13015
NM_152570chr9----1241 --
NM_152636chr1112452 ----1443
NM_152641chr1222751 1965 --12594 --
NM_152755chr7------1577
NM_152888chr82646 380 ----1993
NM_152890chr11523 ------
NM_153619chr1511452 --1631 --
NM_153634chr12----169 --
NM_153812chr152384 1848 1454 580 219 ------
NM_171999chr18----1160 --
NM_173156chr11755 --1718 --
NM_173588chr11199 --126 --
NM_173602chr1212758 --13315 --
NM_175834chr12--1157 ----
NM_175895chr12181 ------
NM_178012chr6----1133 --
NM_181354chr8----1318 --
NM_181571chr101785 ------
NM_181783chr12------1681
NM_197941chr512083 --11146 --
NM_198850chr19----2270 65 --
NM_198859chr333508 3501 85 --13120 1974
NM_198867chr19----176 --
NM_199355chr16----1510 --
NM_207387chr171111 --1352 --
NM_207442chr14----2756 259 --
NM_212464chr1531858 756 295 ------