TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-339-5p
miRNA Sequence: UCCCUGUCCUCCAGGAGCUCACG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr676871 5016 4660 1382 375 367 268 14923 --1781
NM_000337chr585932 5133 4257 2232 2222 2120 2085 1740 --11363 --
NM_000599chr2103521 3422 3385 3328 3055 3020 1823 1069 923 369 --43793 3587 3005 396 13267
NM_001007278chr1353465 2031 1875 1687 1004 15067 21035 552 --
NM_001013839chr1762263 1887 1865 795 550 334 11789 31928 1781 409 22486 744
NM_001018050chr2293409 3286 3145 3097 2266 1312 979 867 388 22675 2626 32860 884 483 12298
NM_001031695chr2274852 3995 3737 3484 1172 554 509 13425 --34950 4297 2169
NM_001037553chr2174987 4628 4419 3891 1709 873 197 --11857 14719
NM_001167chrX86197 6064 4405 4204 1995 1094 818 347 16234 45667 4692 2042 996 --
NM_001204chr277303 7030 6707 5008 4771 564 386 ------
NM_001420chr1982837 2636 2540 1119 781 757 709 151 2823 183 12898 22546 909
NM_001759chr1274775 4475 4132 4077 2120 1560 1499 --24139 4106 --
NM_003298chr365032 4537 3933 2100 1733 1135 --34339 3907 472 14216
NM_003320chr1173871 1725 1129 788 597 586 365 11094 33409 1079 182 --
NM_003458chr393513 3500 3400 2586 1555 1068 563 286 160 11043 --12848
NM_004463chrX2566 552 --1540 1559
NM_004774chr1772907 2329 2106 828 186 91 27 12268 ----
NM_004852chr18814308 12966 12724 12084 11133 3165 2829 2512 213172 1812 212680 2416 --
NM_005188chr1177740 7302 6754 6669 5367 5246 77 16344 15037 25268 446
NM_005596chr964698 4434 2551 2411 1206 1158 25475 4544 12031 --
NM_006252chr196738 6671 5754 5009 2684 2433 1904 1472 1289 --11130 25936 1136
NM_006306chrX75366 5139 4899 4836 3836 1243 235 ----1195
NM_006546chr1775326 5049 4171 2622 2062 846 72 --22597 1065 24964 4685
NM_006690chr2052119 2087 1695 1681 102 --22238 632 41701 1565 282 168
NM_012104chr1183709 3375 3188 2907 2572 2551 982 913 ----2618 491
NM_012199chr143988 1585 1041 162 --13085 24090 3979
NM_014368chr92866 601 --11574 21395 650
NM_014730chr1264440 4410 4277 3924 3197 25 2864 370 13700 24742 1014
NM_014766chr742938 1479 451 341 23253 2671 11530 13675
NM_014772chr18113500 3366 2573 2249 1310 1029 520 434 120 68 55 --21298 81 1154
NM_014830chr1273375 1043 715 489 480 333 230 2521 25 23574 1309 1811
NM_014876chr2241584 1496 1454 1447 22085 1789 11459 --
NM_014909chr1463800 3581 3552 3237 2446 513 --53669 2913 2490 1057 104 22852 1077
NM_015090chr195496 5478 4102 2297 2056 1457 1432 528 490 26118 4151 24633 2044 1684
NM_015455chr553910 3704 2944 1122 62 --33918 3875 1594 1210
NM_015995chr15114784 4689 4463 4026 4002 3875 3632 1854 1356 970 574 11152 23921 781 12025
NM_018667chr1652423 889 765 686 560 22037 827 22060 728 2111 105
NM_021090chr22104785 4302 4107 4024 3406 1774 1684 1091 665 50 2932 404 34873 4331 1426 --
NM_030648chr454464 4034 1970 707 327 25126 320 11890 --
NM_030918chr155150 4659 4649 1048 212 43763 2144 1592 1387 22016 1846 --
NM_031908chr531250 1013 859 11071 --2400 29
NM_032829chr126989 833 123 84 68 55 --4402 341 172 36 2981 287
NM_153487chr6104368 3731 3257 3112 1747 1667 1376 1023 1008 722 13606 2298 103 1514
NM_175736chr12127036 6734 5819 5803 5733 2279 2217 2171 2036 2009 1249 293 --1717 --