TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-33a-3p
miRNA Sequence: CAAUGUUUCCACAGUGCAUCAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX113451 3055 2929 2790 2460 2274 2102 688 477 154 52 1895 33367 405 82 13030
NM_000081chr131680 1346 1222 11715 31824 1322 544 1311
NM_000084chrX126884 6391 6341 6002 5628 5329 5043 4704 2672 2020 1168 548 2556 38 25015 4497 --
NM_000091chr2152857 2841 2807 2797 2786 2763 2092 1846 799 734 576 475 243 100 62 12540 22910 328 22881 2647
NM_000092chr294231 3383 3375 3287 1794 1321 977 466 270 44290 4254 819 660 74549 4415 4091 3639 1773 1276 778 1694
NM_000104chr273011 2772 1918 1911 982 901 283 12014 22883 34 12169
NM_000109chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_000110chr161217 986 960 882 126 105 --31228 428 377 --
NM_000112chr5115328 5152 4768 4171 3942 3756 3712 2208 1343 910 60 1637 44795 3569 1286 939 --
NM_000161chr1481733 1577 519 510 349 340 163 51 1217 31585 703 434 11563
NM_000163chr582223 1823 1807 1488 568 265 153 64 --3516 294 217 --
NM_000167chrX51689 1413 1186 346 220 --41501 1351 547 194 11638
NM_000168chr783070 2714 2557 2086 1054 931 788 583 --22760 1335 --
NM_000176chr583930 3920 3562 2457 2412 1504 1255 429 11497 13188 1652
NM_000189chr272402 1958 1532 583 372 366 255 --1562 11657
NM_000216chrX163929 3763 3657 3622 2807 2689 2619 2546 2490 1284 1115 735 537 408 219 67 21547 961 12739 --
NM_000217chr1285258 4478 4282 1872 1095 865 428 393 24160 1114 34915 3584 330 --
NM_000222chr451985 634 519 447 324 --42013 1955 1408 244 --
NM_000233chr23849 673 580 --1914 2713 349
NM_000245chr752016 1574 884 838 462 --51867 1486 818 503 328 --
NM_000248chr372833 2709 2126 1109 664 614 552 --33074 1962 790 --
NM_000259chr15146240 6126 5985 5537 5434 5270 1780 1770 1618 1496 1365 821 625 314 --46091 6002 5565 1420 --
NM_000264chr963389 3166 2739 2481 1040 776 --62537 446 400 366 178 166 12400
NM_000267chr1743103 2248 1163 1014 1697 --12556
NM_000288chr63360 285 79 ----187
NM_000314chr10112698 2575 2406 2187 1306 1068 888 673 619 243 92 12242 22148 1076 1860
NM_000329chr13870 754 355 --3943 832 250 1857
NM_000332chr695711 5541 4824 2675 1984 1588 1153 600 25 --66924 2400 2263 2060 1806 1120 16956
NM_000337chr5256566 6286 6183 6173 6134 6097 6008 5731 5694 5546 4222 4207 2513 2507 2322 2077 2046 1785 1044 616 328 195 181 171 22 15666 26217 4272 16614
NM_000340chr351483 1311 1144 260 78 --2959 362 1145
NM_000346chr1762014 1560 648 428 198 90 --3796 444 154 --
NM_000351chrX94264 4160 3209 3115 2981 1618 1031 485 85 ----11657
NM_000362chr2262485 1157 1144 1083 743 125 ----13256
NM_000390chrX93373 2959 2741 2550 2529 2500 707 451 160 --32666 566 535 21252 1130
NM_000393chr292068 1912 1850 1527 1380 763 708 169 123 11725 2594 212 --
NM_000408chr2163354 3250 3209 2785 2733 2624 2253 1315 969 825 701 695 561 337 331 32 12860 43315 1151 368 128 --
NM_000439chr562485 2184 2140 1910 636 365 --32416 2070 31 --
NM_000448chr11133300 3250 3220 3005 2877 2624 2438 2267 2065 1149 920 895 601 13267 1943 --
NM_000461chr394120 4042 3609 3522 3398 1723 555 279 141 24253 605 53840 2816 1491 951 684 13700
NM_000462chr1541208 387 311 74 --21379 421 11219
NM_000489chrX83472 3424 3032 2761 903 645 592 179 --43334 2536 2114 1341 --
NM_000492chr741523 1152 589 30 --51227 1129 960 522 147 11263
NM_000522chr73917 400 255 11294 51235 1190 999 928 502 --
NM_000538chr1361765 1255 251 225 105 73 11129 31802 1627 112 11505
NM_000544chr6_cox_hap153421 3334 3145 2607 581 --53017 2880 2303 464 274 --
NM_000550chr951052 979 795 399 115 2853 127 --1899
NM_000555chrX127771 7158 7032 5976 5945 5594 4878 2660 2058 1570 1300 243 11343 66343 6298 2676 1867 1231 666 --
NM_000584chr471234 1218 1206 381 254 193 184 21101 1043 11226 --
NM_000610chr11102992 2712 2600 2472 2312 1201 674 353 190 43 23050 1877 12756 23036 585
NM_000618chr12236547 6411 6169 6152 5826 5759 5629 5266 4930 4708 4235 2580 2499 2199 1968 1792 1574 1203 732 610 265 163 111 12476 34217 1586 155 25889 1869
NM_000618chr12236547 6411 6169 6152 5826 5759 5629 5266 4930 4708 4235 2580 2499 2199 1968 1792 1574 1203 732 610 265 163 111 12476 34217 1586 155 25889 1869
NM_000633chr18135246 4614 4519 4212 4006 3373 1220 891 363 220 188 131 28 --64174 4052 1933 1694 1429 749 11487
NM_000702chr162170 2104 2045 1756 660 108 11939 11812 12208
NM_000783chr103559 364 106 ----1145
NM_000788chr421429 918 11380 21252 204 1221
NM_000793chr14164467 4373 3954 3837 3819 3688 3481 1846 1655 1588 1527 1430 1202 801 793 131 --34267 1541 936 21917 448
NM_000806chr52762 529 31731 1465 1411 41925 1600 389 357 11325
NM_000809chr4349317 9311 9255 9113 8717 8692 8073 7774 7614 7368 7163 6270 6123 5972 5656 5604 3642 3566 3434 3187 3122 2865 2015 1593 1317 1146 934 869 847 573 533 329 218 70 48951 8872 7939 790 98960 8608 7753 6986 6493 3243 901 484 81 59264 6642 2419 1753 1035
NM_000813chr5195630 5587 5268 5221 5171 4768 4078 3776 3749 3683 3601 3453 2223 2210 1498 1418 1013 799 330 --44898 4747 3985 1590 23965 419
NM_000814chr15133961 3422 3333 3294 2746 1587 1516 1266 1006 987 900 834 657 --23706 452 32947 355 52
NM_000818chr106485 457 449 442 396 41 1408 ----
NM_000826chr4112626 2479 2260 1766 1624 1041 829 791 754 699 285 --41696 842 557 540 --
NM_000831chr1105339 4538 4133 2302 2200 2117 1865 1514 1478 1294 14944 16139 --
NM_000859chr561623 634 300 260 246 28 1557 21458 1255 --
NM_000860chr491628 1389 1379 1149 558 485 331 270 263 11326 41615 652 440 134 1315
NM_000866chr351464 709 425 272 230 1685 31663 1428 1340 --
NM_000868chrX102328 2154 2095 1770 1741 627 580 446 423 325 --2942 96 --
NM_000875chr1575547 5489 4937 1973 1626 1602 1124 17017 42615 1664 1184 1106 --
NM_000882chr34353 304 296 149 --2421 322 --
NM_000885chr271648 1586 1346 786 624 453 438 1584 22160 252 --
NM_000899chr12124041 3471 3218 3196 2993 2755 1711 1337 1264 981 785 759 23675 1462 44061 3906 3386 2916 11295
NM_000901chr472523 1721 481 439 414 381 237 11949 ----
NM_000902chr372801 2506 2408 2333 2110 808 461 2255 152 53235 3136 3090 1991 1101 12272
NM_000933chr2081779 1683 1606 1421 1157 665 261 21 --11100 --
NM_000935chr351151 383 357 337 95 --3308 237 137 --
NM_000944chr472338 2034 1808 1471 894 584 311 12428 62420 2246 2192 1502 831 452 --
NM_000945chr22443 436 1832 52097 1838 1355 563 329 11911
NM_000950chrX103543 3071 2869 2673 2555 2448 984 251 216 199 1373 42407 2361 2339 1355 12969
NM_000958chr561347 1091 880 840 423 128 ----11221
NM_000963chr182388 2247 2155 2021 1731 829 480 67 11887 22126 695 1494
NM_001001323chr12113201 2952 2631 2475 2250 2170 1277 1002 558 278 148 12693 22059 912 --
NM_001001330chr1021128 213 --1176 1818
NM_001001389chr11102992 2712 2600 2472 2312 1201 674 353 190 43 23050 1877 12756 23036 585
NM_001001390chr11102992 2712 2600 2472 2312 1201 674 353 190 43 23050 1877 12756 23036 585
NM_001001391chr11102992 2712 2600 2472 2312 1201 674 353 190 43 23050 1877 12756 23036 585
NM_001001392chr1193038 2758 2646 2518 2358 720 399 236 89 23096 1923 12802 23082 631
NM_001001395chr1262782 2490 2041 1773 563 309 1528 --11717
NM_001001419chr5114895 4270 4080 3727 3719 3625 3361 3189 1732 1714 271 --22003 665 1741
NM_001001420chr5114895 4270 4080 3727 3719 3625 3361 3189 1732 1714 271 --22003 665 1741
NM_001001481chr8133179 3169 3113 2944 2810 2541 2354 2344 2216 2114 1163 658 245 1482 22369 968 --
NM_001001484chr1052253 2019 725 388 50 --22186 549 --
NM_001001549chr762540 2291 2064 1883 1756 422 --12701 12869
NM_001001550chr762540 2291 2064 1883 1756 422 --12701 12869
NM_001001555chr762540 2291 2064 1883 1756 422 --12701 12869
NM_001001557chr831961 1510 205 --22160 1551 32047 2000 1930
NM_001001664chr2113079 2912 1566 1250 994 709 605 573 489 325 130 13246 44098 3726 3528 3067 13214
NM_001001665chr293407 2920 2118 1280 1252 1195 1116 516 291 23378 463 12987 13030
NM_001001668chr19123567 3104 2838 2751 1571 1364 1185 1103 1095 1085 487 229 13753 31216 1163 864 --
NM_001001890chr21114183 4005 3961 3337 3232 2962 1411 1015 842 618 569 --33549 3016 789 --
NM_001001928chr22137322 7176 7093 6300 5871 5561 5345 3030 2955 2908 2820 2724 92 11815 47228 7191 5449 493 16103
NM_001001971chr1051253 1088 1043 987 287 --2896 499 --
NM_001001974chr10132333 2262 2218 2197 2145 2075 1961 1784 826 402 283 217 175 --41517 659 441 242 22057 333
NM_001001995chrX71781 1715 1429 1416 1384 594 486 21734 1167 21836 193 --
NM_001002026chr362373 2083 1857 857 752 257 --1177 12489
NM_001002257chr282971 2708 1340 1130 847 771 576 99 1250 53007 1166 884 544 159 --
NM_001002258chr281985 1850 1842 1567 1521 1455 685 382 11740 2355 264 --
NM_001002860chr14134665 4524 3933 3590 3565 3308 3233 3171 1603 1558 1333 154 40 24063 1593 24577 1674 --
NM_001003407chr1074884 4627 3314 3158 1053 411 193 --43695 3683 1651 1269 11718
NM_001003408chr1074884 4627 3314 3158 1053 411 193 --43695 3683 1651 1269 11718
NM_001003652chr18198217 8081 7750 7694 7008 6981 6886 6826 6789 6581 6254 5980 3194 3004 2162 1647 1393 1069 60 48700 2904 1985 173 88556 8511 7253 6337 3334 2025 1751 1495 16098
NM_001003665chr183528 2792 2369 1376 973 958 930 798 ----1139
NM_001003674chr18136730 6708 5202 4518 4510 1577 1367 1106 1030 867 739 704 483 15210 46853 1596 1562 605 1403
NM_001003675chr18136730 6708 5202 4518 4510 1577 1367 1106 1030 867 739 704 483 15210 46853 1596 1562 605 1403
NM_001003679chr152251 1480 1466 762 360 --31675 1403 461 1307
NM_001003712chr12183865 3778 3613 3166 2774 1331 1310 1219 1053 956 861 671 652 478 393 357 224 96 --43717 2975 2802 1246 13279
NM_001003760chr6123108 2955 2670 2464 2409 2385 1474 1457 1180 664 124 97 13327 43589 2538 1046 90 13434
NM_001003790chr84834 661 327 22 1318 --1281
NM_001003791chr84834 661 327 22 1318 --1281
NM_001003792chr32497 308 11027 2819 279 1936
NM_001003793chr32497 308 11027 2819 279 1936
NM_001004313chr1772070 1463 1447 1343 1321 304 35 --41633 1622 1290 497 160
NM_001004317chr6174541 4533 3855 3841 3726 3622 3503 3171 3124 2806 1797 1612 1519 1481 1326 1170 559 13074 23338 2837 21539 401
NM_001004342chr1115717 5696 5510 4651 4442 3878 3763 1471 1127 292 40 1580 45644 4297 1510 1063 1249
NM_001004346chr461075 930 853 407 342 294 1263 3489 480 472 2499 317
NM_001004360chr271900 1573 1377 790 149 71 34 --3801 725 483 1537
NM_001004419chr12123787 3765 3571 3436 3395 3216 3195 1688 1319 532 182 110 1261 --21287 237
NM_001004441chr551718 1617 1135 387 241 31531 1525 1060 51548 1101 1049 595 345 11214
NM_001005386chr252371 1956 1901 1733 839 11631 --22339 929
NM_001005404chr1774235 4083 3153 3135 1348 816 54 33943 3937 2916 13423 24538 3912
NM_001005463chr1042616 757 710 77 --52128 975 932 460 403 --
NM_001005473chr5276443 5993 5694 5603 5317 5221 5017 4750 4451 4374 4199 2664 2557 2517 2484 2275 2172 2070 2034 1714 1568 1420 1276 768 658 579 434 25166 2137 56287 5531 2127 1130 188 --
NM_001005474chr391583 1319 1229 408 380 256 230 173 120 11331 1548 1317
NM_001005502chr12104619 4445 4393 4280 4234 2014 1315 923 847 370 --35227 1591 824 24179 534
NM_001005845chr861659 1386 1198 675 600 132 ----11374
NM_001006600chr572110 2056 1726 1521 651 232 71 11652 11741 12028
NM_001006623chr2102577 2430 2013 1949 1026 930 839 630 297 80 --1815 --
NM_001006657chr252976 698 371 143 33 --53284 3073 731 541 289 --
NM_001006945chr14749 564 281 45 2526 57 2544 536 --
NM_001007023chr14164467 4373 3954 3837 3819 3688 3481 1846 1655 1588 1527 1430 1202 801 793 131 --34267 1541 936 21917 448
NM_001007097chr9104395 3140 1886 1806 1746 1663 1431 1394 358 247 --31568 1464 735 --
NM_001007214chr181741 1369 594 579 543 263 173 68 11405 ----
NM_001007257chr131421 997 138 --41122 1097 1085 435 11296
NM_001007278chr13175281 5259 5179 4409 4237 4180 4063 3697 1934 1184 1129 1061 997 711 340 292 225 --45040 3573 3457 1847 14357
NM_001007466chr674647 4443 3931 3474 1098 576 449 --23965 1749 11395
NM_001008388chr441123 751 345 298 --1446 1760
NM_001008392chr393591 3468 3133 3080 2756 2419 504 460 242 13494 ----
NM_001008401chr1931491 911 89 21175 935 1527 1925
NM_001008405chr771705 1599 1566 1174 1147 536 387 --41858 1713 1497 716 2691 620
NM_001008408chr796150 5187 4458 4449 4391 2066 1101 883 393 24495 353 33973 1260 293 --
NM_001008495chr832297 2193 2051 1408 21955 801 2535 304
NM_001008539chr8135374 4871 4518 4281 4008 3905 1930 1852 1676 1444 1299 947 285 34615 3328 1701 43271 1748 1428 1289 23476 3375
NM_001008564chr1372108 1992 1970 1643 811 457 165 --22081 1423 --
NM_001008707chr1441456 1394 625 243 --61596 1471 1296 759 387 339 11195
NM_001008726chr1451090 576 547 130 76 --41262 1211 667 561 --
NM_001008738chr572721 973 878 717 637 623 141 1293 22660 246 2815 678
NM_001008925chr492827 2475 1289 1256 1141 889 882 627 42 23328 2151 12725 --
NM_001009554chr4194432 4276 4169 4067 3957 3920 3683 3358 3234 1794 1551 1480 1431 1363 971 936 919 841 199 --11841 13305
NM_001009554chr4194432 4276 4169 4067 3957 3920 3683 3358 3234 1794 1551 1480 1431 1363 971 936 919 841 199 --11841 13305
NM_001009555chr491634 1408 542 394 387 263 231 188 104 --1151 11571
NM_001009571chr781431 1204 648 600 389 320 288 44 11084 21303 1123 --
NM_001009894chr12101685 1395 1328 1273 1075 353 203 93 65 46 --11591 1517
NM_001009899chr3186476 6422 6205 6103 6040 5581 5275 4144 2460 2452 1958 1294 1157 1053 1039 713 387 72 25007 4276 45605 4674 4513 989 1926
NM_001009909chr11143581 3490 3481 3352 3159 3071 2803 2702 1371 1167 808 374 93 26 11394 83840 3131 2794 1587 660 623 358 215 --
NM_001009960chr782707 2516 2506 2483 2402 2266 753 428 --22370 1015 --
NM_001010000chr18143474 2729 2629 2330 1398 1020 852 766 678 619 519 511 145 105 --33384 3325 2945 --
NM_001010853chr683290 3197 2779 2763 2329 884 327 145 --33139 2828 910 --
NM_001010861chr192711 2480 2425 1912 1749 1057 1007 954 506 1490 1291 12413
NM_001010888chrX94483 4428 3300 1335 1232 1169 1162 782 33 141 33243 3163 837 12997
NM_001010891chr5176874 6796 6713 6643 6208 6041 5914 5728 4838 4671 4323 2157 1810 1729 1640 1075 656 --46703 5997 4275 1428 1605
NM_001010895chr961919 1544 1322 825 339 29 11584 21854 509 11785
NM_001010922chr1114013 3662 3548 3131 2975 2851 2838 1454 1304 807 30 --44277 3604 2759 1399 --
NM_001010934chr74830 732 232 94 1987 4975 960 948 136 --
NM_001010984chr162531 2403 2186 788 570 263 --12085 12612
NM_001010986chrX32119 862 541 12406 32231 697 134 --
NM_001011513chr4134090 3893 3877 3823 3503 3336 3020 2988 2950 2837 2688 2577 83 13699 43393 3298 2831 160 13688
NM_001011537chr351965 1862 1447 389 159 --32243 1724 97 --
NM_001011663chr1051086 943 699 276 109 --1967 1924
NM_001011666chr7146412 6200 4292 3975 2398 2264 2080 2023 2007 1042 906 749 689 559 --76321 6188 5391 4315 4248 4092 330 1522
NM_001011708chr292731 2677 2490 2235 2032 1923 1005 647 26 --32070 2015 408 --
NM_001011885chr1581829 1664 1454 1401 1286 734 300 261 1213 ----
NM_001012393chr1194754 4546 4261 3419 3351 1998 845 764 340 --11048 --
NM_001012751chr1081787 1699 521 483 457 293 151 112 1371 1269 --
NM_001012755chrX195062 4882 4848 4680 4499 4281 4126 4081 3979 3952 3862 3760 3701 3682 3087 1664 903 748 725 24203 1160 65037 4329 3514 994 689 199 24720 3218
NM_001012968chrX62477 2088 1916 1878 1737 841 12533 12815 22055 770
NM_001012989chrX6573 551 540 464 188 117 --2679 230 195
NM_001013031chr10133375 3117 2910 2278 1189 1117 1091 992 871 629 178 54 47 2892 366 1332 --
NM_001013439chr36694 646 331 283 197 168 1236 --1347
NM_001013620chr12218510 8197 7827 7649 6785 6364 5841 5635 5628 5147 5115 3236 2520 2395 1857 1502 1216 521 510 150 82 12678 97109 6237 5411 5333 2761 1405 1380 1167 464 16062
NM_001013659chr19175332 5293 4880 4637 4630 4622 4229 4130 1905 1746 1545 1421 1399 1041 872 808 802 24547 934 55444 4557 3927 3838 831 --
NM_001013746chr7112253 2218 2063 1815 1792 1754 1731 891 777 653 276 12156 21840 1681 --
NM_001014380chr13155577 5438 5097 4670 4657 4443 3959 3795 3718 2202 1649 1462 988 608 237 35493 3571 714 55302 4861 4741 4522 428 11817
NM_001014797chr10177785 6152 5986 5765 5514 3263 3138 3002 2725 2076 1743 1551 431 406 373 342 293 --47831 5900 2031 28 1229
NM_001015877chrX112851 2541 2374 2347 2276 961 723 399 370 332 42 12354 32999 2948 745 --
NM_001015887chr341559 650 581 490 11691 31827 742 373 --
NM_001017371chr251059 930 550 332 58 ----1560
NM_001017395chr363524 3411 3296 2758 1376 621 13557 33124 2830 1218 13321
NM_001017420chr821411 1037 --31386 1349 1139 --
NM_001017440chr7138210 7550 6547 6278 6146 5861 5820 5800 5638 5577 1759 778 709 12041 15696 15042
NM_001017923chr1451669 1509 1290 415 243 11030 21686 1090 21499 1303
NM_001017926chr821787 86 --31583 287 95 11263
NM_001017992chr551224 1111 952 541 529 11239 31279 1142 358 --
NM_001017999chr152353 2311 1854 1784 1558 12256 1851 12320
NM_001017999chr152353 2311 1854 1784 1558 12256 1851 12320
NM_001018000chr152353 2311 1854 1784 1558 12256 1851 12320
NM_001018000chr152353 2311 1854 1784 1558 12256 1851 12320
NM_001018001chr152353 2311 1854 1784 1558 12256 1851 12320
NM_001018008chr153639 447 426 ----1606
NM_001018067chr1185312 5077 4416 4374 4317 3697 3621 3260 1862 1615 1154 916 777 627 546 316 295 188 25099 4882 31505 1482 416 --
NM_001018068chr1185312 5077 4416 4374 4317 3697 3621 3260 1862 1615 1154 916 777 627 546 316 295 188 25099 4882 31505 1482 416 --
NM_001018069chr1185312 5077 4416 4374 4317 3697 3621 3260 1862 1615 1154 916 777 627 546 316 295 188 25099 4882 31505 1482 416 --
NM_001018074chr583930 3920 3562 2457 2412 1504 1255 429 11497 13188 1652
NM_001018075chr583930 3920 3562 2457 2412 1504 1255 429 11497 13188 1652
NM_001018076chr583930 3920 3562 2457 2412 1504 1255 429 11497 13188 1652
NM_001018077chr583930 3920 3562 2457 2412 1504 1255 429 11497 13188 1652
NM_001018090chr1582611 2564 512 409 345 270 195 187 32468 886 574 31003 907 487 11116
NM_001018091chr1582721 2674 622 519 455 380 305 297 32578 996 684 31113 1017 597 --
NM_001018102chr1582611 2564 512 409 345 270 195 187 32468 886 574 31003 907 487 11116
NM_001018111chr783995 3718 3573 3144 3019 2780 2567 1154 ----13036
NM_001023567chr1542118 1544 892 217 --22109 2062 11971
NM_001024094chr583930 3920 3562 2457 2412 1504 1255 429 11497 13188 1652
NM_001024647chr12187681 7492 7343 7323 6565 6209 4889 2559 2385 1930 1847 1452 1361 1198 943 868 594 57 ----35569 2528 1045
NM_001024649chr572940 2578 1819 365 160 111 93 --2448 222 12903
NM_001024847chr362281 390 296 266 197 181 21875 467 1398 --
NM_001024855chr371834 1811 1728 1209 435 201 42 --41933 1198 652 545 178
NM_001024934chr62638 251 ----2156 23
NM_001024935chr62638 251 ----2156 23
NM_001024936chr62638 251 ----2156 23
NM_001024948chr183500 3384 2818 2596 2367 788 751 199 23042 156 43344 1195 666 170 --
NM_001024956chr11195839 5559 5261 4983 4919 4809 4776 4642 3834 2306 2248 1421 1227 1059 1046 769 674 464 44 14498 55889 4964 4432 4263 723 15376
NM_001025076chr1066239 3847 1918 1829 1192 1079 35956 5771 3931 85979 5810 2359 1310 986 634 326 254 --
NM_001025077chr1087597 5205 2550 2437 1406 611 605 323 47314 7129 5289 5012 97337 7168 4642 2668 2344 1992 1684 1612 855 1628
NM_001025079chr343932 3672 1241 790 23961 3624 83981 3600 3522 3003 2538 1423 1375 1094 24117 3948
NM_001025096chr188832 772 630 617 600 356 299 174 1101 1943 --
NM_001025105chr541503 230 166 49 1212 21238 491 11216
NM_001025108chr2104170 3923 3783 3718 1651 1391 125 113 93 54 13861 23472 1612 --
NM_001025233chr1292473 2334 2254 2038 1983 1892 698 656 61 12060 2580 553 --
NM_001025266chr3114931 4776 4717 4230 3395 3126 1853 1458 1220 898 866 14521 44208 1114 631 178 --
NM_001025356chr12103013 2993 2951 2619 2388 793 651 511 101 51 ----22760 2586
NM_001025366chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025366chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025367chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025367chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025368chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025368chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025369chr651740 1333 663 436 412 --31910 1651 232 --
NM_001025369chr651740 1333 663 436 412 --31910 1651 232 --
NM_001025370chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025370chr651724 1317 647 420 396 --31894 1635 216 --
NM_001025580chrX94223 4072 3730 3710 2884 2769 2759 1529 655 44199 3693 1219 268 43889 1053 935 822 1841
NM_001025616chr481708 1265 1216 476 464 458 413 261 ----1138
NM_001029863chr632927 2674 2164 --53258 3210 2569 927 741 12872
NM_001029875chr572723 912 834 502 421 244 31 1491 2905 343 1802
NM_001029998chr4101371 1223 1169 1143 1079 1033 278 215 180 123 --1545 --
NM_001030007chr1663874 2962 2618 1331 1124 290 1515 43956 3171 2947 163 13822
NM_001030055chr14114656 4442 4183 3273 3129 1883 1018 918 881 186 53 13538 74765 3499 3477 1471 1232 954 363 23882 3174
NM_001031623chr661830 1136 1105 217 181 116 1335 31296 1177 529 --
NM_001031679chr1263279 3011 2998 2783 1153 340 --32375 1179 667 33444 1309 620
NM_001031695chr22115166 3765 3706 3622 3415 3404 1682 1558 808 704 65 11024 22107 1806 1359
NM_001031700chr442515 2456 2183 256 --41987 970 305 210 12544
NM_001031732chr4123654 3076 3002 2806 2744 2584 2547 2473 1315 1015 847 152 22369 570 33426 580 438 22251 1307
NM_001031804chr1683835 3729 3508 3376 2977 2820 1697 737 --43856 3755 1271 397 1962
NM_001031812chr582286 2139 1652 1492 662 553 293 222 --52072 1848 1729 746 456 --
NM_001032280chr631144 1121 524 --21360 1223 11699
NM_001032282chr871298 1193 1155 1066 841 425 249 --1461 1413
NM_001032283chr125813 439 430 336 148 --2782 61 --
NM_001032284chr125813 439 430 336 148 --2782 61 --
NM_001032394chr662331 2019 1881 793 635 390 11825 52280 2191 2050 1083 429 3830 710 95
NM_001033045chr264229 4066 3789 2759 2705 1755 1951 43814 3772 2926 2808 14392
NM_001033057chr352134 2023 829 163 94 11994 1131 11948
NM_001033087chr2053019 2228 1302 868 597 --22889 545 12385
NM_001033578chr852342 2143 2025 523 84 1255 42205 2066 1978 491 --
NM_001033756chr661658 1251 722 581 354 330 --31828 1569 150 --
NM_001033756chr661658 1251 722 581 354 330 --31828 1569 150 --
NM_001033925chr1082126 1887 823 646 602 207 79 67 --41672 797 534 96 --
NM_001034841chr1695244 5180 5060 4922 1558 948 534 228 148 1560 43489 1229 727 261 --
NM_001034850chr561406 1357 1247 644 353 214 --2594 327 2389 261
NM_001035260chr1071297 1027 631 585 571 380 233 --31594 1557 508 --
NM_001037132chr7122001 1928 1838 1676 1664 1598 1412 473 358 147 84 23 --1854 1802
NM_001037133chr7122001 1928 1838 1676 1664 1598 1412 473 358 147 84 23 --1854 1802
NM_001037174chr2132127 2036 1710 1703 1697 1653 1400 741 694 688 411 257 228 --1296 22160 1862
NM_001037317chr192711 2480 2425 1912 1749 1057 1007 954 506 1490 1291 12413
NM_001037332chr572244 1910 1897 960 908 794 358 1852 22555 618 1930
NM_001037333chr572244 1910 1897 960 908 794 358 1852 22555 618 1930
NM_001037334chr1851498 872 818 735 519 12311 41709 887 445 227 12112
NM_001037535chrX71393 1269 1208 983 579 270 121 ----11569
NM_001037536chrX71393 1269 1208 983 579 270 121 ----11569
NM_001037540chrX71393 1269 1208 983 579 270 121 ----11569
NM_001037954chr1163347 3155 2281 1126 927 132 12220 13205 13253
NM_001039199chr2085004 4568 4489 4122 3991 1746 578 194 --1224 --
NM_001039395chr9122484 2199 2172 2165 2152 1911 1736 947 941 252 203 64 1536 32041 1809 705 --
NM_001039538chr283143 2554 2288 1472 1289 781 531 33 1834 43342 3310 2327 608 --
NM_001039547chr3247904 7189 7117 6677 6669 6580 6459 6402 5805 3176 3170 3114 2953 2540 2476 2462 1565 1538 755 704 646 536 401 327 31969 525 253 57922 6021 2634 2513 134 21576 489
NM_001039577chr163543 1753 1671 1522 1096 907 --21567 460 14528
NM_001039590chrX83391 3152 2485 1189 920 778 650 81 1772 31404 1262 1182 12743
NM_001039591chrX83391 3152 2485 1189 920 778 650 81 1772 31404 1262 1182 12743
NM_001039618chr11225872 5417 5234 5117 4681 4618 4529 4255 3931 3683 3608 2205 2025 1972 1911 1297 1074 988 841 781 149 121 14432 55972 4962 4905 4868 4066 --
NM_001039840chrX195766 5706 5466 5455 5152 5009 4968 4849 4446 4101 4073 3972 2196 1954 1448 1257 1013 678 121 1618 55036 4395 3694 563 537 21751 1192
NM_001039937chr13144042 3662 3284 3265 3048 2836 1619 1465 1348 1315 941 618 577 480 33604 3233 1542 53384 1447 1390 241 216 --
NM_001040020chr7111486 1183 1150 1067 1009 619 559 348 316 281 171 1424 21336 82 --
NM_001040100chr361298 1251 1117 986 871 822 ----11068
NM_001040142chr272482 2408 1544 1518 979 936 399 ----1737
NM_001040143chr272482 2408 1544 1518 979 936 399 ----1737
NM_001040152chr7105110 4379 3961 3609 3545 3146 1827 1523 1344 936 14703 14635 11980
NM_001040157chr4102258 2235 2052 1954 1843 1789 661 519 292 168 11122 62944 2266 2199 2091 1824 367 --
NM_001040202chr462567 2309 2153 1677 889 246 22215 570 62224 2205 2034 2006 1843 748 --
NM_001040214chr682277 2192 1897 1800 1702 829 485 230 --11864 21453 871
NM_001040284chr16135756 5601 5130 4610 4208 3880 2368 2220 1958 1492 1466 697 297 43889 2204 2051 574 95500 5018 4296 3992 3860 3757 3635 1356 470 --
NM_001040402chr4123202 2998 2723 2688 2208 2072 1277 1091 987 592 532 410 1556 2754 449 --
NM_001040429chr13133543 3500 3380 3331 3099 3044 2188 1419 948 773 651 592 131 12670 32617 1126 549 23322 527
NM_001040441chr1125357 4886 4225 3460 3451 2018 1577 1550 1541 1114 546 305 14195 21988 1958 13771
NM_001040450chr1572481 2264 2205 1066 838 298 232 --11958 21013 396
NM_001040453chr1572481 2264 2205 1066 838 298 232 --11958 21013 396
NM_001040665chr7133236 3156 3121 1745 1565 1517 1332 1221 1089 741 629 618 498 13143 84964 4906 4245 3652 3595 3478 3216 3075 11265
NM_001040712chr982889 2456 2236 1223 1030 1010 692 453 --22441 2185 --
NM_001040876chr491914 1713 1683 1563 1347 610 463 449 222 --21924 238 --
NM_001042355chr16135270 5251 4347 1951 1901 1841 1648 1415 1365 829 766 300 49 13869 45102 4971 1266 189 --
NM_001042383chr3103420 3131 2890 2380 1371 974 408 389 253 84 --23265 3035 13478
NM_001042404chr161768 1746 1652 1383 353 51 --11886 11301
NM_001042412chr16135270 5251 4347 1951 1901 1841 1648 1415 1365 829 766 300 49 13869 45102 4971 1266 189 --
NM_001042413chr954100 1412 1293 1056 483 --43289 2956 2860 726 12946
NM_001042424chr453217 2910 2512 2281 789 --23275 2273 --
NM_001042425chr631144 1121 524 --21360 1223 11699
NM_001042440chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001042441chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001042442chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001042443chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001042444chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001042445chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001042446chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001042453chrX51735 1602 421 367 338 --21770 602 11306
NM_001042473chr1061834 1730 828 656 194 179 1276 11533 --
NM_001042481chr14102425 2221 2135 2105 1771 1718 1659 284 127 107 --22092 801 --
NM_001042492chr1743103 2248 1163 1014 1697 --12556
NM_001042493chr651488 814 483 213 100 21306 476 1330 --
NM_001042494chr1593505 2901 2648 996 842 798 617 591 562 33623 1091 361 31245 496 204 23700 2424
NM_001042495chr1593505 2901 2648 996 842 798 617 591 562 33623 1091 361 31245 496 204 23700 2424
NM_001042496chr1593505 2901 2648 996 842 798 617 591 562 33623 1091 361 31245 496 204 23700 2424
NM_001042497chr1593505 2901 2648 996 842 798 617 591 562 33623 1091 361 31245 496 204 23700 2424
NM_001042510chr841931 776 608 206 11575 --1863
NM_001042511chr841931 776 608 206 11575 --1863
NM_001042533chr3143314 3217 2996 2889 2720 2643 2622 2456 2327 828 744 704 415 119 --13251 --
NM_001042550chr992068 1818 1779 1718 1586 1531 1407 1284 781 21479 382 --11762
NM_001042555chr12184650 4587 4213 4077 4067 4039 3984 3921 3820 3755 3696 3298 3284 1573 502 290 219 124 14599 74817 4713 4464 3959 1553 1086 742 11343
NM_001042599chr2227886 7849 7305 7234 6628 6230 6222 5713 5281 5114 4849 2993 2350 2268 2247 2191 2071 1855 1519 884 833 489 37388 2238 168 87898 6913 5950 2359 1803 1786 1466 766 14901
NM_001042601chr392531 1243 1156 1105 1030 736 492 298 122 --22301 1282 13234
NM_001042604chr3204847 4821 4683 4504 3948 3917 3882 3257 2958 1937 1901 1769 1660 1556 874 805 680 648 360 339 1729 21464 381 2814 299
NM_001042669chr481708 1265 1216 476 464 458 413 261 ----1138
NM_001042749chrX61310 685 643 503 480 176 --41610 1488 531 233 11329
NM_001042750chrX61310 685 643 503 480 176 --41610 1488 531 233 11329
NM_001042751chrX61310 685 643 503 480 176 --41610 1488 531 233 11329
NM_001044385chr283782 3592 3133 2827 435 362 345 125 52854 1570 1148 196 137 --1181
NM_001044722chr582286 2139 1652 1492 662 553 293 222 --52072 1848 1729 746 456 --
NM_001044723chr582286 2139 1652 1492 662 553 293 222 --52072 1848 1729 746 456 --
NM_001046chr582926 2402 2337 2148 2021 1986 1139 932 42840 2079 1997 1116 12770 12199
NM_001071775chr1371875 1848 1784 1460 1410 591 395 --21393 560 --
NM_001083620chr4112624 2477 2258 1764 1623 1040 828 790 753 698 284 --41695 841 556 539 --
NM_001099678chr3216226 6171 6140 6013 5941 5917 5811 5659 5549 5523 4470 2156 1647 1473 1238 1102 1027 843 769 598 337 36038 5693 4705 44341 1193 780 137 15744
NM_001100108chr1178377 8021 7988 7152 6175 5866 5327 3319 3300 3238 2734 1652 1389 1275 852 571 262 42988 2313 1626 862 17954 11869
NM_001106chr3169545 9500 9321 8652 8522 7846 7710 7158 6072 3614 3600 3458 2008 1322 1296 453 43761 1158 776 175 39532 2481 889 --
NM_001117chr1871634 1606 631 229 153 139 101 1384 12283 11815
NM_001126chr11981 --31085 405 62 1772
NM_001128chr1663874 2962 2618 1331 1124 290 1515 43956 3171 2947 163 13822
NM_001146chr8112366 2097 1625 922 892 852 814 723 515 333 96 12336 22140 1499 --
NM_001160chr1262814 2651 1875 1821 519 178 1153 32662 1808 492 --
NM_001167chrX106762 6433 2681 2360 1301 1269 1159 1152 248 100 15149 64527 2157 1833 1571 1539 1070 --
NM_001173chr14114656 4442 4183 3273 3129 1883 1018 918 881 186 53 13538 74765 3499 3477 1471 1232 954 363 23882 3174
NM_001177chr1282486 2271 2189 2136 533 443 366 131 11615 22258 214 --
NM_001186chr21103187 2945 2464 2129 1259 1189 926 498 416 349 62663 2419 2394 2245 2184 836 23086 2967 --
NM_001201chr4123675 3276 3243 3165 3055 2517 1479 1382 1172 1000 708 223 --23333 1042 11147
NM_001204chr2227311 7264 6971 6404 6310 6280 6066 5796 5563 5289 3014 3002 2742 2626 2417 2337 2327 2126 1742 1391 465 50 37618 6734 2766 87709 6763 6058 2218 2163 1817 711 294 35729 2702 881
NM_001219chr741637 508 445 109 --11433 22083 333
NM_001233chr7102339 2167 2103 1955 1820 1722 1616 870 537 319 --62088 2050 1891 775 670 575 --
NM_001241chr282209 2190 1938 1924 1851 315 217 96 1362 1409 11688
NM_001241chr282209 2190 1938 1924 1851 315 217 96 1362 1409 11688
NM_001256chr17102792 2652 2548 2047 1933 1800 960 776 597 178 --21148 1090 --
NM_001259chr7175649 5504 5198 4794 4775 4495 4481 4245 4074 2407 2321 2151 2097 2027 1994 1143 611 --54985 4573 3859 2511 2233 --
NM_001270chr531078 871 823 --1171 11146
NM_001304chr1763457 3366 2745 1006 947 861 12962 --1387
NM_001310chr12102871 2764 2511 2331 2294 2243 1068 580 243 39 --43103 1999 1158 206 --
NM_001315chr662042 1608 1577 1464 599 340 ----175
NM_001331chr1172681 2514 2460 2413 2373 2301 546 --22325 1988 --
NM_001351chr331803 1588 200 149 31729 597 369 --
NM_001356chrX72316 2288 2231 1805 1795 764 561 --11818 --
NM_001364chr11134751 4168 3992 3904 3651 1859 1799 1578 1179 790 720 54 38 --64789 4590 3751 1007 773 198 14782
NM_001390chr1833469 1021 837 1457 43396 1118 796 405 --
NM_001400chr141228 907 489 284 ----31364 1212 1133
NM_001412chrX93768 3624 3606 2662 2387 2377 791 751 566 21487 1281 12330 12570
NM_001419chr19114662 4563 3406 1557 1278 1107 912 850 643 448 302 --34705 1333 904 --
NM_001427chr761972 1524 1482 1364 314 178 195 42002 194 136 109 --
NM_001429chr2251044 721 400 354 159 1365 1440 --
NM_001432chr4173928 3710 3578 3323 3173 3135 2815 2629 2596 2500 2386 1238 950 859 778 511 77 33051 905 52 1194 --
NM_001438chr162930 2737 2395 1182 770 679 23669 2886 13326 --
NM_001460chr1113529 2802 2686 2494 1320 1301 1260 1201 1186 852 721 --42461 2299 884 573 42734 2515 1378 274
NM_001527chr694874 4716 4558 4330 3828 3706 3645 1557 1429 11492 51275 1213 1181 1035 47 11167
NM_001543chr573607 3318 3244 944 832 444 29 --23194 936 --
NM_001546chr64904 526 414 111 11467 2206 130 11335
NM_001560chrX72593 2091 1955 1071 865 836 419 --32663 2239 1827 --
NM_001608chr26929 906 294 142 136 96 --1959 1358
NM_001609chr10104485 4215 3414 2895 1404 1359 1265 819 115 107 33373 1276 643 44125 2969 1032 702 33141 3095 878
NM_001616chr2113327 3246 3174 1325 1314 1300 1193 1070 939 923 758 --13486 1565
NM_001621chr753080 2641 2330 919 280 12902 22412 328 2869 645
NM_001621chr753080 2641 2330 919 280 12902 22412 328 2869 645
NM_001650chr18164059 3969 3886 3869 3441 3099 2868 2651 1530 1093 971 668 465 391 364 237 24018 523 54148 3645 2910 213 147 1961
NM_001655chr1182158 2106 1781 1657 1494 686 673 208 --22122 182 --
NM_001656chr561538 1448 830 812 624 450 --11786 21945 1394
NM_001668chr182039 2031 1712 784 731 720 513 176 --21911 433 1894
NM_001682chr12122915 2666 2345 2189 1964 1884 1162 1152 1112 991 716 272 12407 21773 626 --
NM_001689chr281985 1850 1842 1567 1521 1455 685 382 11740 2355 264 --
NM_001690chr371966 1724 1041 1026 509 463 242 --3944 493 176 --
NM_001695chr8124214 3841 3551 3416 3212 1675 1189 1173 470 397 178 156 --33559 928 364 11136
NM_001701chr961211 1203 1193 1125 597 572 ----11024
NM_001709chr1172909 2885 2749 1768 1071 988 271 --2929 394 12279
NM_001742chr761850 1612 1168 562 372 98 --11672 2645 355
NM_001746chr572940 2578 1819 365 160 111 93 --2448 222 12903
NM_001750chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_001754chr21114183 4005 3961 3337 3232 2962 1411 1015 842 618 569 --33549 3016 789 --
NM_001759chr1284210 4069 3635 3624 1315 1181 1167 943 --31784 1524 189 --
NM_001777chr343932 3672 1241 790 23961 3624 83981 3600 3522 3003 2538 1423 1375 1094 24117 3948
NM_001806chr19102966 2942 2680 2217 2076 1149 862 698 656 261 1909 11983 --
NM_001830chrX114071 3452 3125 3016 2986 2599 2555 1138 1117 852 171 23727 1179 33997 3182 479 24016 3829
NM_001845chr1351191 890 252 245 79 --21214 929 --
NM_001854chr161430 1418 498 322 305 38 1963 --11096
NM_001855chr95880 872 824 172 144 ----2558 92
NM_001858chr6124974 3897 3576 1757 1664 1510 1369 779 440 260 180 35 14363 34465 2006 1749 --
NM_001873chr44494 282 167 97 ----1125
NM_001874chr12104619 4445 4393 4280 4234 2014 1315 923 847 370 --35227 1591 824 24179 534
NM_001892chr541503 230 166 49 1212 21238 491 11216
NM_001918chr1179147 9081 8740 8729 8502 8456 7457 6758 5922 3475 2737 2239 2192 1347 1309 1047 137 12290 48445 8433 6738 712 48044 6132 2704 1603
NM_001920chr124724 562 294 281 --1596 1786
NM_001939chrX73289 2810 2655 2481 762 602 284 1416 --1693
NM_001963chr41808 --2603 589 1620
NM_001969chr1493897 3741 3078 1138 926 871 605 391 168 --21561 755 --
NM_001977chr441556 1322 1125 287 1426 157 21528 1521
NM_001981chr122002 811 11977 21591 541 21846 631
NM_001987chr1284090 2652 1726 1527 1003 794 405 379 --53879 2884 2844 2822 1050 --
NM_001992chr5102257 2232 2170 1641 1610 1469 610 447 216 152 --11534 --
NM_002006chr4235685 5665 5569 5508 5214 5194 4703 4485 4376 4210 4164 4068 3589 2306 1898 1876 1802 1667 1640 1143 1047 419 142 35058 4901 915 65597 5557 4391 1164 1002 658 1935
NM_002009chr1572746 2269 2212 2075 760 609 486 22371 908 1351 --
NM_002015chr1392793 2653 2618 2316 2077 1026 886 777 387 --2717 175 12456
NM_002024chrX92159 2145 2009 1725 1680 1450 707 508 362 1578 1213 31522 1490 655
NM_002025chrX318950 8904 8600 8064 7961 7663 7362 7331 7095 7055 7017 6779 6327 5760 3645 3545 3484 3078 2710 2539 2500 2393 2276 1451 1437 931 692 442 288 223 95 23343 2013 69179 8118 7593 7499 1377 1348 48366 7170 6532 2242
NM_002035chr18143647 3536 3036 3008 2985 2631 2503 2495 2439 1556 1374 952 765 199 --43679 3619 3526 2838 32820 2641 1224
NM_002040chr2192977 2381 2375 2010 1979 1209 1123 458 383 --63174 2963 2803 2618 2319 137 12057
NM_002063chrX81229 1066 1054 312 290 283 268 250 --11279 --
NM_002069chr72379 268 2479 314 2655 550 1489
NM_002092chr4105098 5015 4741 4713 4019 3889 1487 1085 957 260 11037 54100 3076 1059 458 43 11751
NM_002128chr1351830 1025 747 666 426 21919 965 31696 769 43 --
NM_002130chr571478 1356 1349 1339 542 464 302 21673 1420 1438 --
NM_002137chr762383 2201 1861 432 426 130 32393 2361 207 42288 2060 1489 313 --
NM_002158chr283390 3187 3010 2436 715 547 533 214 --43330 1519 940 124 1759
NM_002182chr3122701 2659 2492 2427 2406 2319 2025 1779 1084 1032 354 200 --1657 --
NM_002203chr5144129 3808 3681 3576 3520 3100 2899 2649 1256 649 466 342 320 303 --33062 2974 388 --
NM_002210chr2123600 3594 3451 3381 3073 2394 2359 2227 821 655 591 180 11166 53254 2407 2387 2268 870 12558
NM_002214chr7175514 5449 5183 5144 4990 4583 4233 4087 4050 3947 3866 3809 3652 2022 1013 639 366 --25403 1630 24515 4145
NM_002222chr351101 1025 987 861 202 --11254 1223
NM_002239chr2121147 1103 796 790 733 413 378 352 314 229 118 54 --21133 1045 --
NM_002242chr241995 1914 612 174 --31586 805 605 --
NM_002247chr10122338 2197 2151 1752 1668 1446 878 847 683 610 506 265 --22214 549 --
NM_002264chr364564 4023 3850 3570 1983 1810 1379 45012 4003 3754 3352 --
NM_002270chr5175443 5334 5293 5242 5066 4529 4371 4274 3912 3611 2282 2162 1426 1107 1064 647 236 65317 4658 4461 2253 781 328 45592 4204 3763 204 --
NM_002271chr1392450 1695 1493 816 789 737 652 498 307 --12102 --
NM_002285chr2104170 3923 3783 3718 1651 1391 125 113 93 54 13861 23472 1612 --
NM_002310chr5216616 6566 6472 6455 5718 5532 5522 5510 5275 4908 4766 4698 4527 4286 1908 1860 1773 1106 880 773 518 35338 4892 869 86345 6222 6153 6007 5412 5245 4169 277 --
NM_002313chr1074884 4627 3314 3158 1053 411 193 --43695 3683 1651 1269 11718
NM_002336chr12154930 4696 4635 4567 4106 3713 3264 2025 1406 1176 922 844 467 280 48 --44346 3822 1169 803 13904
NM_002350chr861230 1085 905 786 437 283 1942 1933 --
NM_002351chrX81656 1504 1417 639 628 302 132 45 ----1356
NM_002374chr283143 2554 2288 1472 1289 781 531 33 1834 43342 3310 2327 608 --
NM_002387chr5165154 4810 4772 4529 4239 4125 3896 3838 3570 3279 3185 3149 2038 990 465 178 --45186 5165 5145 341 1861
NM_002395chr661510 1485 1182 1054 598 164 1340 ----
NM_002397chr582048 1834 1717 1484 1439 801 678 670 1325 2735 355 --
NM_002398chr251200 1158 1108 1043 309 --21212 539 1517
NM_002481chr1147939 7649 7204 6651 6173 5163 4862 2614 2604 1725 1155 346 228 40 35222 4834 1799 ----
NM_002500chr24984 403 384 374 --11290 --
NM_002514chr841146 970 404 362 --11089 11171
NM_002545chr1194754 4546 4261 3419 3351 1998 845 764 340 --11048 --
NM_002546chr85706 697 575 547 310 2793 723 ----
NM_002547chrX94248 4199 3733 3660 2723 1508 1386 697 490 13908 33419 3000 2986 --
NM_002552chr231227 828 233 --31129 101 90 --
NM_002568chr85397 171 101 59 51 --2304 92 177
NM_002577chr353375 3053 3014 3007 577 24015 1468 11087 13417
NM_002581chr9145685 5519 5001 4927 4549 4073 3761 3755 3693 3672 2002 1965 369 302 --15637 --
NM_002583chr122580 76 --2489 31 1184
NM_002594chr20102463 2418 2307 2238 2121 1980 1835 678 613 195 11800 12263 22497 2095
NM_002595chr12101980 1629 1607 1596 1507 1439 732 652 611 558 11935 11298 --
NM_002610chr2132923 2913 2864 2810 2653 2627 2559 2256 2119 1105 1064 959 218 22531 2426 42440 2280 2245 354 --
NM_002612chr771712 1596 1516 822 480 457 404 --52126 1815 597 567 559 --
NM_002623chr206626 574 516 502 291 45 ------
NM_002639chr1851319 1254 1228 1141 1059 --2400 259 11353
NM_002641chrX112043 2008 1949 1746 1591 1543 1394 1326 479 220 138 1287 2324 32 --
NM_002645chr1193077 2881 2560 1978 542 351 142 45 29 12494 53151 2897 2873 2476 1095 --
NM_002649chr751380 1233 1200 470 252 --41296 1217 1101 92 --
NM_002655chr8145308 5072 4994 4823 4743 4220 3981 3572 3468 1576 1322 1243 1107 637 24427 1563 45161 1832 1696 585 15214
NM_002656chr631088 817 766 --2239 52 1801
NM_002662chr371955 1532 774 686 634 532 174 --11748 --
NM_002667chr661311 1111 1015 988 189 81 ----21038 356
NM_002709chr2132939 2880 2836 2454 2190 1439 1119 1079 763 680 467 326 284 --42736 2299 488 451 --
NM_002715chr54832 412 221 102 11093 --21226 311
NM_002731chr1122523 2343 2325 2276 2195 1974 1921 961 873 790 722 409 --32131 1938 195 --
NM_002736chr772006 1595 843 787 721 540 406 --189 11359
NM_002737chr17106442 6255 5989 5043 2356 2159 1871 896 401 353 1189 56367 5733 4979 4256 574 16659
NM_002740chr342653 2381 2017 1882 --12240 12219
NM_002745chr2294287 4270 4212 3981 3819 3369 3073 841 44 24497 3722 43333 3270 2873 1160 --
NM_002822chr1261818 1617 1356 1349 1259 643 1568 2702 364 --
NM_002834chr1273762 3441 3269 2832 2797 2787 1618 23948 258 1723 13976
NM_002837chr12134427 4141 3867 3758 1638 1289 1207 1038 1015 851 782 482 207 43606 3471 970 232 34116 3581 3381 --
NM_002838chr171176 1154 1127 948 876 846 117 --31007 890 155 --
NM_002839chr982889 2456 2236 1223 1030 1010 692 453 --22441 2185 --
NM_002843chr11103460 2952 2637 2386 1000 822 783 651 607 516 --13432 --
NM_002844chr671028 1015 492 484 286 213 206 --21350 899 --
NM_002869chr1192235 2135 1804 1692 1506 710 683 272 81 --32175 1991 221 11654
NM_002886chr374590 4496 4130 3904 3719 3563 1904 25111 4678 35220 4455 3846 --
NM_002906chr11102388 1972 1912 1839 1729 1542 948 878 578 358 1161 11692 11785
NM_002912chr63974 857 772 --5784 754 674 345 224 1604
NM_002940chr491914 1713 1683 1563 1347 610 463 449 222 --21924 238 --
NM_002956chr1241375 1308 496 68 11073 3249 191 134 --
NM_002959chr194430 4368 3694 3510 2699 1455 1379 1363 713 23763 2781 1222 --
NM_002968chr1661051 876 750 293 27 21 1129 1139 --
NM_002977chr2133247 3030 2777 2512 2396 2265 2255 2214 2100 1372 1295 865 614 2461 160 21154 105 --
NM_002982chr173362 336 297 ----2319 112
NM_002994chr461818 1765 1705 1684 1651 782 --61750 1475 1334 672 482 368 11977
NM_002998chr841847 1832 888 527 11383 52183 2157 1882 1713 148 1226
NM_003012chr873176 2663 2599 1017 721 145 115 12109 22648 1231 --
NM_003013chr42261 159 --4809 785 700 237 1823
NM_003022chrX31101 521 25 1171 2494 138 11069
NM_003034chr12218031 7459 7199 5925 5661 5570 5371 5297 5214 5010 4996 2889 2881 2615 2277 2155 2077 2016 1915 1819 189 37608 5735 404 55912 4903 2912 2642 2053 47685 7506 2417 669
NM_003043chr384261 4248 4117 4029 4009 3833 1667 1070 151 44325 4050 3797 1414 --
NM_003046chr8135374 4871 4518 4281 4008 3905 1930 1852 1676 1444 1299 947 285 34615 3328 1701 43271 1748 1428 1289 23476 3375
NM_003048chr282800 2761 2544 1997 1048 1040 765 373 11083 32268 2251 1739 --
NM_003051chr11595 --101576 1539 1524 1421 1374 529 487 457 107 58 --
NM_003069chrX2780 715 157 1660 1701
NM_003071chr331919 758 706 11549 32013 2004 1768 11586
NM_003099chr15156333 6169 5541 4816 4623 4476 2636 2231 2173 1972 1589 928 634 329 275 --46150 1607 1366 377 12009
NM_003108chr2107080 5130 4939 4703 4434 2417 1652 1212 995 197 --34562 915 246 27110 6529
NM_003111chr251059 930 550 332 58 ----1560
NM_003112chr7113241 3054 3002 2544 2274 2267 2224 2184 921 673 247 --22594 876 --
NM_003133chr151026 993 437 265 45 1368 1740 11096
NM_003144chr6102285 1420 856 638 466 370 336 307 150 49 --22120 1676 --
NM_003161chr17143635 3242 3228 3108 3004 2729 2560 2548 2462 1422 1299 570 525 146 23368 2775 32188 1401 1235 12323
NM_003184chr851103 1021 1007 938 776 --5948 929 762 435 145 --
NM_003199chr18265681 5437 5321 5267 5056 4988 4712 4080 4005 3799 3781 3700 2182 1911 1540 1406 1120 993 770 655 643 631 550 459 359 161 65076 4293 4053 1425 984 577 45703 4336 2145 390 11454
NM_003220chr631144 1121 524 --21360 1223 11699
NM_003221chr6104020 3923 3897 2624 1620 1209 788 439 338 326 11669 33102 380 82 --
NM_003242chr362281 390 296 266 197 181 21875 467 1398 --
NM_003246chr1571675 1448 503 262 226 215 193 --1362 11519
NM_003247chr681897 1319 1253 699 604 402 204 181 --21926 412 --
NM_003253chr2131913 1358 1175 ----11188
NM_003262chr3184879 3234 2004 1919 1761 1688 1663 1623 1400 1113 1080 909 868 663 376 166 128 94 35204 2073 1261 53973 2079 1896 1812 753 13933
NM_003292chr172243 2149 1778 1634 675 493 113 --32265 311 79 1546
NM_003298chr3145695 5647 5569 5525 4806 4737 4346 4131 4008 2407 2251 1343 885 633 2448 414 25941 93 1842
NM_003304chr371212 1132 549 448 414 394 145 11644 31543 1104 131 --
NM_003330chr1231776 1182 218 ----21841 417
NM_003338chr1051715 1652 1230 445 193 31216 767 61 31845 1582 223 --
NM_003339chr5101462 1423 1348 1280 1194 1111 1086 559 437 201 ------
NM_003342chr1761107 892 737 438 149 56 ----11308
NM_003348chr1251107 571 549 188 117 1540 2669 230 195
NM_003350chr881064 1043 734 312 233 128 116 68 1983 ----
NM_003359chr471340 1320 1264 1206 905 858 62 --31373 1073 977 --
NM_003376chr651724 1317 647 420 396 --31894 1635 216 --
NM_003376chr651724 1317 647 420 396 --31894 1635 216 --
NM_003387chr262928 2501 2458 2115 2052 533 --2609 316 --
NM_003392chr3144206 4115 4021 3824 3684 3352 3256 1534 1468 1462 1456 853 841 363 22785 173 54012 3901 635 219 89 23658 1133
NM_003409chr1861204 1144 495 106 97 84 ----11167
NM_003410chrX133119 3020 2879 2689 2509 1221 1129 1111 1010 613 513 433 152 32970 2744 2638 32892 2135 300 --
NM_003412chr3113160 3144 3048 2958 2849 2770 2667 2448 1143 925 167 2630 67 23090 670 22638 2625
NM_003413chrX61604 1558 1493 1370 674 195 1735 1215 1464
NM_003423chr1992521 1849 1795 1652 1037 781 758 697 546 1881 21868 647 41701 807 365 356
NM_003430chr19101693 1574 1401 1159 1083 591 510 342 258 210 1517 11109 --
NM_003463chr6133219 3115 2979 2884 2844 2317 2119 2058 1251 1079 1046 1038 818 --32300 850 461 --
NM_003471chr362259 2195 2059 1936 1921 483 11545 31841 950 663 12203
NM_003472chr651365 1355 1331 1277 480 2321 112 21498 417 --
NM_003477chr115721 682 663 224 62 2554 275 1135 --
NM_003478chr11122888 2645 2618 2562 1196 1133 888 844 822 703 500 23 12689 43296 1171 614 561 33107 2681 112
NM_003483chr1282913 2695 2597 2445 1928 1123 849 397 12305 32872 1974 689 --
NM_003489chr21133169 2875 2611 2372 2264 2178 1209 1124 808 774 502 152 93 1177 --23222 284
NM_003506chr851218 1188 1075 914 224 21004 924 1958 21268 1101
NM_003566chr12133405 3234 3173 3054 2942 2600 2211 1355 1087 1057 999 990 587 3631 40 29 43489 1113 838 450 23476 1107
NM_003574chr18155717 5505 5215 4307 4094 4079 3947 3908 3860 3783 2103 1719 1336 1020 382 23932 1801 25009 4036 23563 2230
NM_003583chr12153714 3498 3407 3360 2931 2727 2537 2451 1332 1233 660 611 603 513 42 23793 3525 33438 895 334 --
NM_003590chr2123969 3214 3176 2660 1543 1180 1108 1037 966 526 510 196 12504 43456 3110 1494 468 22857 80
NM_003597chr251881 1475 1441 623 269 12266 2387 281 --
NM_003607chr194091 3004 2994 2904 2827 852 644 265 225 14363 14292 11284
NM_003615chr3103576 3511 3402 3331 2756 1460 1260 765 463 80 13489 63876 2914 1233 1086 1050 219 11076
NM_003618chr251326 1294 934 375 271 2880 59 1903 --
NM_003622chr1242625 1662 1651 506 3804 391 23 52545 1845 1771 707 431 --
NM_003663chr353504 3111 2659 2463 750 --22578 829 12816
NM_003675chr102437 404 --2417 340 2519 374
NM_003679chr1103477 3379 3120 2923 2602 1242 543 354 192 55 22843 2569 23081 2861 --
NM_003692chr971011 995 864 346 264 138 102 --174 --
NM_003713chr141694 1576 1564 1145 --21597 1544 31646 1435 1412
NM_003714chr552511 2480 2191 475 62 --42590 2578 2335 72 --
NM_003722chr382336 2051 1069 899 760 690 351 306 --1914 --
NM_003743chr292298 2031 1921 1504 891 553 119 56 38 ----11754
NM_003759chr494282 3483 2617 1673 1473 1092 931 808 170 --44148 3865 1281 1263 --
NM_003760chr13803 608 598 --3828 749 246 --
NM_003762chr181477 1214 571 453 442 323 310 146 --1560 --
NM_003774chr1243270 2169 616 192 1311 32904 2384 290 --
NM_003783chr13410 253 51 1170 31166 1112 40 --
NM_003787chr1861627 1594 1470 482 251 57 --11222 1345
NM_003794chr361044 956 834 805 167 96 --11122 1190
NM_003799chr18144542 3250 2945 1492 1226 1154 835 787 607 440 430 389 281 150 14477 34194 3893 2961 11119
NM_003816chr871273 1000 604 464 407 289 214 --1540 1988
NM_003822chr162934 2437 2420 1241 1096 675 2956 762 43186 2533 2032 258 12248
NM_003873chr1052461 2149 1736 997 158 --42567 2002 1959 1868 --
NM_003884chr371733 1601 1164 639 477 352 191 --21703 1650 --
NM_003887chr222087 540 11773 31979 1833 198 123
NM_003909chr893073 2957 2546 2509 2375 2083 891 726 97 --32308 2204 144 --
NM_003913chr684353 3914 3393 823 518 305 280 115 12883 63666 3400 2980 1715 1488 91 --
NM_003921chr161335 1298 671 329 160 124 1411 1257 11465
NM_003930chr772486 2374 2164 1985 704 675 420 --31662 660 155 1111
NM_003931chr62638 251 ----2156 23
NM_003932chr2231896 1459 406 --31510 256 164 11906
NM_003941chr762056 1013 913 855 512 251 21826 839 22126 1887 --
NM_003953chr162876 2808 585 458 419 376 --42228 1911 302 166 --
NM_003966chr5227839 7542 6514 5665 5437 5213 4937 4833 4810 2271 2114 2082 1811 1713 1610 1589 1549 1414 1281 917 435 188 44825 2827 1082 290 77644 7196 5885 2011 1730 1368 994 --
NM_003972chr1081374 1356 1296 1183 909 873 491 119 11345 31304 537 173 --
NM_003980chr63907 551 267 ----21354 472
NM_003983chr1683701 2947 1740 1729 1683 1006 843 539 --14381 13137
NM_003994chr12124041 3471 3218 3196 2993 2755 1711 1337 1264 981 785 759 23675 1462 44061 3906 3386 2916 11295
NM_004006chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004007chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004009chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004010chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004011chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004012chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004013chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004014chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004015chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004016chrX82539 2473 2383 2377 2296 2256 893 42 12313 1804 --
NM_004017chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004018chrX82539 2473 2383 2377 2296 2256 893 42 12313 1804 --
NM_004020chrX92625 2559 2469 2463 2382 2342 1631 979 128 12399 1890 --
NM_004021chrX82539 2473 2383 2377 2296 2256 893 42 12313 1804 --
NM_004022chrX82539 2473 2383 2377 2296 2256 893 42 12313 1804 --
NM_004023chrX82539 2473 2383 2377 2296 2256 893 42 12313 1804 --
NM_004028chr18164059 3969 3886 3869 3441 3099 2868 2651 1530 1093 971 668 465 391 364 237 24018 523 54148 3645 2910 213 147 1961
NM_004056chr831078 792 353 --2890 850 21033 195
NM_004060chr551240 496 457 121 107 1156 1203 --
NM_004079chr1102918 2717 2431 2277 2236 2088 2012 442 130 35 22316 727 12763 1779
NM_004087chr3102053 2003 1752 1734 1573 1535 644 625 580 516 11640 ----
NM_004094chr1492682 2418 2203 2196 858 396 207 149 107 22751 1207 22994 459 12829
NM_004109chr1142157 333 81 21 --2588 529 2631 212
NM_004113chr381996 1641 1626 1573 1492 732 568 531 --21936 1912 3808 324 274
NM_004124chr1483597 3562 3340 3325 3245 3209 2639 61 21251 1076 13125 13423
NM_004133chr862277 1798 1033 1014 656 60 12424 22497 556 11945
NM_004136chr1583223 2877 2684 2235 2025 827 406 203 --12117 12525
NM_004161chr241588 1227 1174 543 --31388 1355 598 11110
NM_004171chr11159628 9568 8487 8176 8001 7377 7076 6602 3042 2696 2543 1847 1743 1732 1206 26970 6928 58689 8200 6045 3514 814 --
NM_004172chr531692 770 664 11764 31742 1362 351 12019
NM_004229chrX72081 1793 727 663 576 506 265 --32074 702 118 --
NM_004232chr18103466 3202 2963 2889 2796 1564 1492 927 860 447 1990 33518 2782 1036 1832
NM_004241chr102684 555 --2724 588 1661
NM_004261chr13868 730 122 ----153
NM_004274chr14113198 3170 2305 1976 1095 937 685 660 614 505 22 11124 32579 1237 876 --
NM_004277chr651439 1280 362 242 52 --21521 540 11578
NM_004290chr521195 368 2849 242 2382 289 1249
NM_004293chr9123799 3785 3418 3140 3034 2944 2786 2616 1218 1186 538 216 31444 1230 737 43701 3187 2546 1049 1457
NM_004331chr8102240 2163 2132 2107 1705 970 780 550 150 90 --52687 2502 2278 572 210 --
NM_004338chr18136730 6708 5202 4518 4510 1577 1367 1106 1030 867 739 704 483 15210 46853 1596 1562 605 1403
NM_004342chr782330 2249 2037 1927 1864 854 832 428 ------
NM_004370chr652113 2065 1978 1800 1613 --22096 1549 1246
NM_004379chr241206 1178 702 515 --41231 633 93 77 --
NM_004384chr582286 2139 1652 1492 662 553 293 222 --52072 1848 1729 746 456 --
NM_004392chr1382422 1823 1660 998 892 819 712 630 11767 3958 653 55 22359 2211
NM_004397chr1184286 3316 3107 2848 1379 1322 916 785 42895 2817 1496 226 44143 2777 1308 133 --
NM_004430chr862728 2653 2594 2555 2178 881 --12671 12263
NM_004432chr962352 1596 1516 656 187 141 --51708 714 447 346 302 --
NM_004434chr1441456 1394 625 243 --61596 1471 1296 759 387 339 11195
NM_004438chr2113159 3110 2954 2937 2883 2503 1303 778 617 444 340 --32975 2765 2376 --
NM_004457chr251545 1140 546 381 304 --21688 1561 21651 160
NM_004458chrX32056 648 418 --42520 2004 839 299 1401
NM_004464chr4204326 4277 4191 3340 3263 2961 2890 2857 2792 2705 2695 2647 1501 1444 960 856 778 377 339 228 23986 718 33502 1115 396 11698
NM_004501chr1104014 3703 3598 3254 3222 3148 2925 2752 1180 212 23810 1498 23117 90 14133
NM_004504chr2102994 2782 2352 2121 2031 1212 1018 702 682 628 21036 244 22752 812 1620
NM_004505chr1751919 1528 1473 702 304 --11420 21246 345
NM_004525chr271414 1353 958 550 246 103 81 1493 11453 --
NM_004586chrX155406 5288 4721 4651 4543 4184 3827 3746 1986 1515 1425 1191 447 269 225 1318 45111 3571 353 335 11128
NM_004598chr573144 2868 2470 2070 1266 650 292 12277 22660 2349 12381
NM_004600chr14978 451 363 58 11233 21548 1037 11340
NM_004612chr9144821 4242 4186 3930 3918 3671 3658 1903 1448 1121 1000 908 553 368 44488 3583 1156 611 34877 1496 1258 --
NM_004622chr272410 2091 1979 1750 1655 722 174 --1496 --
NM_004654chrY41323 1297 546 422 --11218 1870
NM_004657chr261490 1287 1222 496 468 455 21443 1198 21551 1300 --
NM_004660chrY92180 2153 1995 1735 1725 707 570 552 475 --11748 2882 564
NM_004666chr681503 1388 1277 1220 1122 1044 294 206 31379 1084 83 21345 1295 --
NM_004685chr13102983 2969 2345 2147 1119 771 421 305 199 70 22795 1099 42561 2533 2302 474 --
NM_004687chr1762075 1875 1495 818 625 615 --31767 708 660 --
NM_004690chr63635 125 89 1238 1804 1569
NM_004703chr1731602 479 465 ----1836
NM_004713chr141804 --3708 114 23 1786
NM_004719chr12102890 2871 2659 2448 2167 2149 2072 1974 485 157 2475 26 42512 1861 1788 589 --
NM_004725chr101472 1112 --1100
NM_004726chrX135740 5711 5622 5556 4772 4644 4213 4024 3952 3879 877 513 123 25602 321 55592 4061 3833 2319 913 --
NM_004744chr4113856 3789 3215 3115 2985 2954 806 563 467 428 43 --21253 999 31545 1511 80
NM_004745chr8166985 6948 6396 6390 6378 5366 5078 2822 2799 2629 2261 1848 1729 1212 1167 1032 --26438 1919 15308
NM_004748chr1584119 4033 3696 3204 1205 642 148 22 --23123 3022 23435 2652
NM_004760chr752301 1933 1654 498 470 153 32319 1786 531 --
NM_004774chr1752944 1065 944 779 597 22510 850 21935 321 23139 2811
NM_004775chr1872248 2075 1798 1707 1636 1597 330 --52223 1932 1896 1696 439 --
NM_004795chr1381729 1626 1441 1295 750 334 299 269 --2176 123 --
NM_004808chr1083368 3209 2358 2059 617 490 154 48 22784 555 ----
NM_004815chr1114926 4763 4487 4233 3445 3301 1916 1876 1750 1651 1504 --54792 4770 3558 3205 3091 14843
NM_004827chr4141902 1876 1715 1669 1643 1466 1438 1402 1359 1189 665 454 190 173 ------
NM_004842chr681793 1689 1670 1416 1357 1168 1093 590 ------
NM_004857chr1484031 3616 3530 3484 3068 1859 1443 589 44741 3859 3200 1120 33103 1430 1303 13150
NM_004859chr17103066 2316 2118 1972 1161 1143 1039 348 282 45 --52353 2016 1197 1050 844 12454
NM_004866chr5124771 4437 3850 3724 3464 3102 1310 1176 1039 850 256 187 24646 2001 74076 3235 1693 1645 1151 231 71 21829 214
NM_004869chr1831374 399 329 --1291 11730
NM_004896chr1061212 546 500 486 295 148 --31509 1472 423 --
NM_004898chr492889 2812 2498 2476 2265 1083 1063 870 559 12035 2983 596 1283
NM_004904chr7146412 6200 4292 3975 2398 2264 2080 2023 2007 1042 906 749 689 559 --76321 6188 5391 4315 4248 4092 330 1522
NM_004921chr1112575 2549 2397 1922 1901 1801 887 665 569 164 64 --72328 2259 2247 2030 1859 1668 923 --
NM_004929chr831030 494 273 --31146 430 391 --
NM_004932chr551582 1158 698 404 40 11684 11822 11282
NM_004948chr1871315 1038 1028 993 524 344 194 1184 31121 1059 50 --
NM_004949chr1881640 1620 1611 1461 1367 648 194 49 1592 11997 --
NM_004956chr7134595 4561 4107 3831 3764 3070 2848 1193 1131 1024 985 867 407 1716 41752 1529 773 208 34362 3933 1090
NM_004969chr103572 397 191 --1217 2480 148
NM_004985chr1274490 4297 2983 2952 1361 1180 77 2940 90 23695 437 44406 1278 1234 592
NM_004992chrX108122 7905 7065 6880 5583 5144 2932 2267 1054 175 26328 3314 37257 7224 115 --
NM_004992chrX108122 7905 7065 6880 5583 5144 2932 2267 1054 175 26328 3314 37257 7224 115 --
NM_004993chr1421123 1098 143 21240 219 1188
NM_004999chr684213 3274 3042 2859 1801 1113 691 392 --62926 2816 1406 830 490 480 23960 189
NM_005010chr7122001 1928 1838 1676 1664 1598 1412 473 358 147 84 23 --1854 1802
NM_005014chr94278 270 204 72 1351 --1243
NM_005036chr22137322 7176 7093 6300 5871 5561 5345 3030 2955 2908 2820 2724 92 11815 47228 7191 5449 493 16103
NM_005056chr1285641 5463 5431 3402 2242 1476 842 469 14552 15474 --
NM_005065chr14175281 4488 4440 4428 4241 4225 3825 3504 3492 3264 1567 993 986 888 555 436 265 24344 1207 64592 4155 3466 2063 911 125 14472
NM_005086chr1271635 1586 1371 507 188 155 126 --11508 --
NM_005087chr36694 646 331 283 197 168 1236 --1347
NM_005095chr162159 2146 1829 1558 296 224 --32235 2026 1864 --
NM_005104chr65771 641 613 196 164 ----2678 587
NM_005108chr331917 1615 222 11792 11452 21933 1437
NM_005116chr20114521 4513 4154 3827 3359 3330 3218 1739 1027 614 283 --54495 4088 3549 2932 2828 --
NM_005119chr141061 893 873 525 1474 21038 482 --
NM_005121chr17133667 3507 2720 2521 2355 933 802 557 380 343 330 233 222 1323 32989 2878 133 22556 1076
NM_005126chr372258 856 840 800 666 592 21 11902 11430 --
NM_005135chr1593505 2901 2648 996 842 798 617 591 562 33623 1091 361 31245 496 204 23700 2424
NM_005151chr1851498 872 818 735 519 12311 41709 887 445 227 12112
NM_005156chr9185369 5363 5237 5096 5020 4919 4435 4271 4257 4148 3999 3896 1992 1913 1101 349 312 59 --75008 4718 4503 3780 3257 1134 900 15229
NM_005159chr1592262 2035 1584 1506 1480 676 620 253 142 ----21930 1785
NM_005164chr12162544 2470 2373 2074 1869 1819 1776 1661 1652 611 562 409 365 332 322 112 1134 42593 2112 660 53 12137
NM_005171chr1251335 1165 474 220 128 ----1851
NM_005188chr11137774 6629 5867 5837 3272 3036 3022 2429 2072 1441 1186 1025 845 27543 1197 58338 8159 7400 2217 2097 17717
NM_005197chr14105741 5700 5558 5550 5294 2002 1634 1386 1365 1117 --14513 --
NM_005201chr35781 745 291 156 21 --131 --
NM_005204chr104880 651 378 35 --3798 643 613 --
NM_005233chr392605 2446 2330 2240 2178 1796 528 391 125 --32617 2585 1927 22519 230
NM_005235chr2227886 7849 7305 7234 6628 6230 6222 5713 5281 5114 4849 2993 2350 2268 2247 2191 2071 1855 1519 884 833 489 37388 2238 168 87898 6913 5950 2359 1803 1786 1466 766 14901
NM_005238chr1183164 3137 2938 2299 1346 979 458 363 12998 --1926
NM_005254chr1531363 1132 1060 11159 2961 503 11209
NM_005256chr112807 599 1279 4939 791 388 320 --
NM_005259chr281276 1195 1059 1030 969 363 122 35 --1621 11305
NM_005311chr762540 2291 2064 1883 1756 422 --12701 12869
NM_005339chr461563 646 520 351 273 182 --22728 503 13961
NM_005358chr1371694 1638 1556 1386 1277 282 74 --21610 151 1376
NM_005359chr18146177 5610 4629 4434 4358 4158 2583 1945 1787 1477 949 447 333 307 15692 34088 2445 556 11002
NM_005385chr352747 2246 1981 380 38 21735 287 31056 419 190 1784
NM_005388chr941621 1100 286 276 --31709 1633 1069 21405 649
NM_005397chr783995 3718 3573 3144 3019 2780 2567 1154 ----13036
NM_005399chr1104351 4300 4231 4164 3252 3159 3005 765 209 39 23843 777 23571 1421 12856
NM_005400chr2122789 2731 2203 2166 2120 2084 1953 1132 1098 879 706 696 ----43028 2035 2028 1072
NM_005402chr791720 1344 1242 695 620 418 128 98 45 --21556 59 --
NM_005406chr1861564 1441 1175 601 416 102 --11054 --
NM_005433chr1882634 2613 2266 1762 937 850 641 41 32827 1829 1711 ----
NM_005436chr10134030 3495 3196 3167 3107 3082 2819 2538 1487 1471 1049 530 442 1960 33224 994 912 --
NM_005461chr20----21777 1416 21923 643
NM_005476chr91501 1988 31392 1261 1099 11296
NM_005497chr17156095 5589 4574 4148 3937 3728 2419 2103 2021 1484 1404 793 724 717 264 1993 42404 1238 1007 84 --
NM_005502chr962316 2152 2046 2034 781 585 11226 32937 2830 1287 12884
NM_005504chr12216466 6408 5449 5335 5171 4888 4878 4816 4561 4164 2626 2586 2426 2268 2006 1897 1871 1695 901 752 536 32579 2230 1121 35382 1648 1619 24111 238
NM_005509chr581881 1821 1650 1378 1362 1348 1327 478 --31808 1758 1148 --
NM_005578chr3144942 4624 4258 4208 4015 3242 1988 1565 1355 1260 1200 867 826 707 1791 44411 3919 1178 902 1775
NM_005584chr136691 669 659 144 137 82 --2638 533 --
NM_005591chr11142786 2634 2274 2142 1968 1932 1902 1888 1005 888 843 149 138 25 --32301 2129 785 --
NM_005596chr9226258 5769 5740 5725 5491 5251 4714 4708 4685 4425 4318 4217 4102 3896 2456 1810 1749 1697 843 608 435 72 14758 22390 1617 11339
NM_005638chrX31365 615 565 --51590 1505 1221 540 285 --
NM_005655chr871298 1193 1155 1066 841 425 249 --1461 1413
NM_005665chr1194892 4592 4489 4348 3744 3345 3222 3172 1882 1748 1387 1343 1211 1098 1079 1073 1028 460 378 1268 64580 3704 3443 3036 1646 448 --
NM_005668chr5124460 3999 3710 3317 3233 3213 3177 1535 1412 957 342 303 21463 1052 53360 3298 1324 1240 187 23860 1346
NM_005711chr551012 869 755 719 286 ----1983
NM_005715chr692823 2535 2493 2484 2264 2029 998 370 300 --32291 838 118 22842 351
NM_005717chr151119 858 496 454 430 ----1878
NM_005721chr261088 1051 775 211 140 123 ------
NM_005722chr252371 1956 1901 1733 839 11631 --22339 929
NM_005725chr172385 2248 2072 1743 890 783 604 194 42442 1525 792 762 --
NM_005742chr26829 809 720 615 240 74 --3777 268 181 --
NM_005746chr742762 2751 1824 519 12391 12046 11846
NM_005748chr1282853 2633 2505 1364 1352 1340 375 197 --72950 2200 1135 795 695 649 182 1772
NM_005759chr294737 4049 3436 3266 3237 1693 1654 1215 481 22936 1678 13382 --
NM_005765chrX4701 277 245 59 2796 222 2724 301 --
NM_005776chr144654 641 631 609 1552 --1721
NM_005779chr573589 3499 2805 2752 2724 694 210 21347 1092 12629 --
NM_005795chr2112999 2940 2791 2209 1953 1155 999 802 722 425 364 22248 90 22624 1095 12872
NM_005798chr13175281 5259 5179 4409 4237 4180 4063 3697 1934 1184 1129 1061 997 711 340 292 225 --45040 3573 3457 1847 14357
NM_005807chr16712 643 636 495 204 85 1756 167 --
NM_005808chr393591 3468 3133 3080 2756 2419 504 460 242 13494 ----
NM_005813chr292429 2398 1638 855 806 508 340 334 113 --22347 1905 --
NM_005822chr6112391 2253 1980 1679 1600 1510 915 580 491 464 299 ------
NM_005828chr17105091 4826 4423 4265 4257 3819 948 904 767 79 --24843 3470 11211
NM_005832chr351399 1261 927 373 161 11025 31217 987 415 --
NM_005840chrX114865 4849 4795 3067 3042 2956 2270 2194 2114 2063 57 --26960 5021 25133 1149
NM_005843chr231905 1580 1413 11442 41865 749 551 496 2434 76
NM_005857chr131315 1289 940 1925 21496 29 21490 1016
NM_005859chr55510 462 421 319 73 1285 --11550
NM_005868chr772470 2222 2214 2206 2018 971 298 1291 52448 1915 913 903 81 1897
NM_005885chr571605 1591 1503 646 535 349 133 2486 185 11218 --
NM_005898chr11102902 2810 2714 2667 2046 1238 709 698 505 353 --53026 2392 1953 1130 754 --
NM_005901chr18198217 8081 7750 7694 7008 6981 6886 6826 6789 6581 6254 5980 3194 3004 2162 1647 1393 1069 60 48700 2904 1985 173 88556 8511 7253 6337 3334 2025 1751 1495 16098
NM_005902chr15104479 4415 3831 3793 3622 3045 3001 1180 610 488 --24549 1222 14305
NM_005903chr5114895 4270 4080 3727 3719 3625 3361 3189 1732 1714 271 --22003 665 1741
NM_005907chr621478 1184 11542 --11258
NM_005909chr573773 3093 2886 2770 1016 820 256 23384 2630 12655 --
NM_005910chr173623 279 263 --32659 254 240 --
NM_005924chr73381 225 66 1109 2975 912 1939
NM_005935chr4104556 4114 3812 3435 2006 1631 1572 1050 908 131 14282 41095 493 294 74 11422
NM_005941chr893536 3197 2743 2602 2582 1638 1397 912 671 23913 3061 33695 3496 1560 --
NM_005955chr1105477 5463 5392 5299 4527 4498 4188 4145 822 450 15526 --25338 4313
NM_005966chr271989 702 609 569 429 278 219 11823 51896 1867 828 555 287 11481
NM_005989chr751501 1384 1067 287 128 11570 11601 1187
NM_005999chr181603 1391 1225 1197 1153 1031 275 109 --11473 --
NM_006007chr994395 4313 4274 4184 3449 3414 1446 1098 608 13007 53585 2814 1642 1342 591 162
NM_006016chr6101989 1940 1739 1487 1430 884 794 623 284 195 1714 22250 204 --
NM_006036chr272286 1944 1880 1792 1634 780 610 --41826 566 547 42 --
NM_006037chr284497 3779 3628 3614 3517 1133 1039 372 12961 33921 1572 1211 --
NM_006047chr2073474 3064 3010 2881 2717 640 139 22702 2567 32867 2186 181 13134
NM_006055chr2112842 2816 1977 793 681 657 600 556 495 417 375 12637 21095 959 --
NM_006080chr7132893 2870 2667 2125 2063 1986 991 816 781 670 549 426 417 --11097 32569 940 532
NM_006089chrX41739 399 310 52 --31683 232 113 11915
NM_006094chr892267 1966 1960 1919 1675 1664 1643 918 661 ------
NM_006095chr4164083 3479 3100 3092 3050 2812 2740 1592 1309 1299 971 925 667 450 160 136 14421 24492 498 --
NM_006106chr11123464 3326 3205 3131 3032 2733 952 946 640 439 387 117 --13110 --
NM_006136chr741323 1037 1025 401 1847 41369 1277 512 302 --
NM_006154chr15102865 2660 2535 2437 2368 2160 2144 860 695 326 --2393 137 22346 831
NM_006166chr1292487 1990 1838 1635 950 943 498 400 67 --2607 224 1540
NM_006197chr8102271 2234 1593 907 773 624 586 417 157 74 --1693 --
NM_006203chr5165258 4860 4804 4577 4395 4193 3782 3485 3436 1679 1579 1399 1343 1132 416 363 11494 65222 4170 4073 2103 2074 1777 --
NM_006206chr492924 1967 1063 1030 780 541 348 299 153 --32683 2217 1830 --
NM_006212chr1115309 5292 4116 3833 1682 1148 734 713 201 151 21 ------
NM_006237chr1332227 393 248 --42008 1955 1852 1692 --
NM_006246chr1431045 847 225 123 --11133
NM_006251chr573363 3293 2633 2174 1187 143 39 --42479 2471 934 376 1305
NM_006252chr1237476 7163 7144 7061 6964 6938 6835 6809 6802 6415 6409 6104 6036 4795 2922 2329 1919 1182 1148 717 710 159 107 33032 2670 1462 36864 5986 1579 --
NM_006256chr1112599 2510 2409 2164 2113 1990 1072 965 716 243 200 21975 1879 12464 1485
NM_006281chr851078 957 815 348 67 --2992 775 --
NM_006281chr851078 957 815 348 67 --2992 775 --
NM_006282chr2094630 3874 3671 2917 982 813 484 368 362 23734 1041 13607 --
NM_006287chr262687 2433 1977 991 801 528 22474 24 42257 2175 829 39 --
NM_006298chr663037 2630 2392 2133 627 555 42609 260 39 29 --12100
NM_006300chr19102350 2299 2220 2169 2148 1892 1802 1734 574 103 12406 1962 1859
NM_006306chrX62362 2111 2012 1447 627 140 35225 1794 936 45338 4433 3707 1613 --
NM_006315chr4154327 3915 3440 3351 3311 2913 2894 2868 2844 2798 1556 1272 462 118 73 23977 548 11810 11773
NM_006320chr451160 925 820 400 341 4878 801 713 279 1106 1166
NM_006352chr121612 167 11770 31683 1544 1476 1788
NM_006366chr661185 1131 908 843 812 183 1241 1176 --
NM_006371chr374527 4401 4386 3506 1697 1188 802 11783 21051 705 14508
NM_006379chr782343 2034 1425 557 506 487 216 187 --11437 --
NM_006380chr17104411 4357 4220 3857 3629 3192 1609 948 692 174 13953 --14060
NM_006386chr2292136 1998 1922 1871 1740 1610 858 243 222 ------
NM_006393chr10104576 4408 4301 3537 3448 1659 1647 896 757 181 1456 34477 3014 1675 13716
NM_006403chr671393 1368 467 411 392 228 126 --21763 118 --
NM_006420chr20103449 3317 3110 3014 2997 2763 2721 2682 436 361 --43217 2471 2137 325 13428
NM_006457chr4134090 3893 3877 3823 3503 3336 3020 2988 2950 2837 2688 2577 83 13699 43393 3298 2831 160 13688
NM_006482chr12153714 3498 3407 3360 2931 2727 2537 2451 1332 1233 660 611 603 513 42 23793 3525 33438 895 334 --
NM_006504chr1092690 2681 1904 1007 606 438 243 217 163 2235 84 31023 901 21 --
NM_006520chrX101713 1650 1612 1404 1384 478 433 375 297 245 31486 1394 142 --11724
NM_006526chr2072199 1957 849 671 416 279 137 --21353 815 12136
NM_006534chr20123253 3241 2893 2755 2146 1122 1075 1005 974 749 372 281 --11068 --
NM_006538chr264061 3858 3843 3796 2591 229 --62860 2797 1659 883 665 37 --
NM_006544chr14215918 5802 5576 5517 5001 4833 4728 4702 4681 4337 3902 2423 1920 1862 1793 1782 1529 1153 953 532 114 55967 1992 1540 820 579 45647 4166 3983 1069 23854 641
NM_006546chr17146420 6315 6192 6102 4590 4232 2654 2299 2260 1792 1562 1298 349 255 --25747 2218 15668
NM_006561chr1066239 3847 1918 1829 1192 1079 35956 5771 3931 85979 5810 2359 1310 986 634 326 254 --
NM_006572chr1793452 2792 2772 2637 2287 2218 955 716 382 13226 33507 2357 788 12829
NM_006577chr231037 1022 332 --31236 1069 1011 1415
NM_006595chr11101818 1393 736 586 536 491 330 81 71 64 21783 599 11609 --
NM_006599chr16178238 7094 6667 6625 6270 6040 5790 5417 5003 3184 2499 2397 2029 1144 541 300 96 26136 1344 47604 7453 6057 5376 18210
NM_006603chrX61310 685 643 503 480 176 --41610 1488 531 233 11329
NM_006614chr3173588 3565 3329 3304 3214 2938 2522 1447 1387 1272 1128 930 913 674 502 168 94 1967 33647 3296 1140 12710
NM_006620chr674016 3178 3006 1182 1174 1140 708 24665 1344 54345 3370 3195 3167 677 34047 1338 236
NM_006624chr1072139 1782 1525 1444 709 424 405 --41748 573 354 270 --
NM_006628chr15144602 4459 4165 3969 3783 3748 3103 2990 2850 1434 1227 958 625 563 14470 ----
NM_006629chr1882477 2275 2025 1953 1145 991 683 125 --32858 2494 599 2302 258
NM_006646chr1362785 2759 2458 2265 612 191 --12154 --
NM_006654chr12184650 4587 4213 4077 4067 4039 3984 3921 3820 3755 3696 3298 3284 1573 502 290 219 124 14599 74817 4713 4464 3959 1553 1086 742 11343
NM_006682chr7142675 2666 2473 2414 2405 2331 2074 1776 1750 859 791 423 230 140 11827 72892 2523 2184 1956 1852 1142 921 22886 2437
NM_006699chr152492 1879 1854 416 195 --32558 1072 429 --
NM_006716chr741230 1153 1068 64 1320 31045 459 136 1124
NM_006717chr962856 2502 706 627 347 58 22461 2096 33394 2086 176 --
NM_006718chr631088 817 766 --2239 52 1801
NM_006720chr1074884 4627 3314 3158 1053 411 193 --43695 3683 1651 1269 11718
NM_006722chr372833 2709 2126 1109 664 614 552 --33074 1962 790 --
NM_006726chr461246 511 459 384 321 270 1311 21016 113 --
NM_006729chrX84501 4346 4009 3587 1314 1112 634 458 1488 34615 876 29 12130
NM_006731chr9145656 5574 4633 4337 3975 2076 979 960 866 792 730 483 337 85 25787 4540 35510 3837 1719 24468 942
NM_006746chrX71393 1269 1208 983 579 270 121 ----11569
NM_006750chr16148027 7977 6894 6731 5578 5541 5207 2845 1704 1455 1084 469 334 247 27575 2373 66689 6169 3222 1384 353 45 --
NM_006754chr75991 944 491 463 449 ----173
NM_006756chr881547 1352 457 328 294 271 218 22 1563 --1415
NM_006766chr842194 264 217 33 22373 561 2748 101 --
NM_006775chr6102819 2737 2566 2492 2418 2350 990 966 741 696 13058 12125 --
NM_006777chrX52609 2148 1922 850 401 21837 1126 22493 839 --
NM_006803chr871933 1819 1713 1336 299 274 73 --21533 1420 --
NM_006827chr1483068 3018 2953 2306 1207 1181 294 49 1680 1623 --
NM_006838chr1261275 731 691 639 622 55 11352 2519 428 --
NM_006851chr1292932 2861 2064 1943 1789 1126 544 370 112 --2517 98 32743 337 194
NM_006854chr722056 619 ----21365 1246
NM_006857chr24766 660 310 210 --2862 788 2568 187
NM_006873chr2143125 2861 2685 2472 2187 1384 1338 1262 1138 1035 784 701 420 41 32388 1392 1101 33161 2672 2447 --
NM_006874chr471263 1205 1160 1107 1042 872 312 --2102 56 --
NM_006885chr1674271 3905 3784 3285 3224 2607 447 23212 215 44223 3770 2768 1390 --
NM_006888chr1473121 2938 2600 1280 1203 988 801 --33530 3093 694 --
NM_006902chr1103311 3245 3085 2943 2913 2743 2160 1157 684 90 --52884 2553 2408 991 289 11247
NM_006912chr151709 1655 980 791 674 22171 1839 32057 1592 762 --
NM_006914chr951487 366 226 218 162 31406 499 102 11088 --
NM_006918chr11195839 5559 5261 4983 4919 4809 4776 4642 3834 2306 2248 1421 1227 1059 1046 769 674 464 44 14498 55889 4964 4432 4263 723 15376
NM_006920chr272044 1921 1571 1476 1422 1396 1361 11463 ----
NM_006922chr2112581 2320 2107 2072 1778 995 956 801 668 286 192 ------
NM_006924chr17113789 3292 3258 3101 2960 1535 1369 1322 1004 928 368 11067 44162 4069 1764 595 --
NM_006947chr491725 1236 1099 664 657 461 447 438 145 --21803 1673 --
NM_006948chr2161851 1617 1532 512 120 94 1315 21723 849 32401 2274 331
NM_006956chr752122 811 517 427 327 11876 42402 1743 927 605 1228
NM_006981chr9122930 2821 2318 2302 2283 2218 2205 1921 1206 993 568 450 ----12294
NM_007006chr1643411 2609 1228 593 23180 238 33569 890 818 11029
NM_007007chr12144807 4741 4290 4143 3711 3313 3040 1815 1087 904 765 671 604 527 11746 84085 3720 3491 3342 3298 1714 1634 548 11862
NM_007017chr56911 697 307 278 149 73 --3863 844 296 --
NM_007023chr251110 865 834 727 344 --2774 756 --
NM_007027chr32490 392 ----2178 30
NM_007038chr21166118 6013 5605 5420 5376 5208 5190 5118 4403 4075 3944 1405 441 276 228 110 34021 2140 1198 46049 5638 4472 1275 35925 4586 1119
NM_007039chr1442143 622 596 159 12248 21972 408 1762
NM_007043chr1251939 1844 1450 592 284 --1319 11425
NM_007054chr593763 3351 3236 3132 3061 2967 929 730 516 43832 2586 1597 182 21558 713 22555 995
NM_007078chr1042168 1922 1896 722 12507 63017 2973 2517 2037 374 252 --
NM_007106chr1372734 2443 1756 1131 683 176 72 12700 11893 1816
NM_007107chr362232 2066 911 819 506 413 1389 ----
NM_007114chr3173317 3064 2943 2886 2694 2618 2589 2555 2255 2079 1038 933 775 385 290 185 158 --62342 2210 1128 235 56 41 --
NM_007124chr681953 1908 1415 1407 1333 1312 598 306 --11424 --
NM_007125chrY21146 315 21440 208 11167 21182 530
NM_007139chr741114 329 279 46 21080 371 31208 1143 212 1458
NM_007146chr17111904 1844 1143 1068 879 700 596 555 234 134 23 21977 324 2666 40 --
NM_007147chr1991211 945 766 485 466 431 395 345 36 ------
NM_007157chrX123009 2391 1988 1970 1936 948 836 661 538 426 395 314 --52866 2356 1166 562 76 21149 1115
NM_007172chr2292905 2823 2626 2501 2044 1153 1040 949 92 ----12355
NM_007175chr8103615 2845 2701 2635 2462 1379 1217 1098 495 444 13596 12621 --
NM_007195chr18153758 3704 3694 3249 2427 2401 2317 1355 1108 982 863 740 445 268 173 23647 3301 1587 --
NM_007212chr131906 743 225 21719 57 21511 1402 1394
NM_007222chr821787 86 --31583 287 95 11263
NM_007231chrX82365 1579 883 814 552 490 481 412 --22388 2008 1366
NM_007249chr13289251 9087 8680 8572 8263 6930 6787 6743 6525 6494 6197 6003 5978 5804 5765 3723 3682 3411 2659 2590 2030 1928 1836 1589 1553 1104 952 632 29039 1808 69386 7098 6994 6146 2999 317 27342 1983
NM_007287chr372801 2506 2408 2333 2110 808 461 2255 152 53235 3136 3090 1991 1101 12272
NM_007288chr372801 2506 2408 2333 2110 808 461 2255 152 53235 3136 3090 1991 1101 12272
NM_007289chr372801 2506 2408 2333 2110 808 461 2255 152 53235 3136 3090 1991 1101 12272
NM_007308chr44662 483 170 91 1726 1577 1559
NM_007345chr1892195 2177 2164 2056 1832 1501 846 406 358 21903 1566 22108 1798 --
NM_007347chr1562989 2156 1973 954 469 392 12903 42999 1111 796 292 --
NM_007350chr12184580 4469 4422 4291 4251 3960 3878 3410 3289 3042 2870 1821 1809 1677 1526 928 719 591 13787 31065 711 354 1462
NM_007358chr161698 1495 1386 722 521 353 12028 2487 386 --
NM_007375chr152142 2065 1849 299 149 --32301 599 215 --
NM_012069chrX82683 2486 2415 2330 2321 2262 287 160 --32352 1761 926 --
NM_012081chr593620 2948 2439 1309 1288 1251 719 474 417 33509 2923 596 32627 936 508 11396
NM_012095chr10103525 3492 2759 2606 2238 1355 1298 1219 1150 391 1779 32348 816 105 --
NM_012096chr383377 3258 1230 1103 887 395 195 85 1486 3474 418 364 --
NM_012097chr2132127 2036 1710 1703 1697 1653 1400 741 694 688 411 257 228 --1296 22160 1862
NM_012104chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_012104chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_012120chr6132954 2869 2788 2713 1197 1187 1158 858 765 736 687 341 108 11165 32543 912 754 13032
NM_012124chr115905 802 724 636 329 1128 --1321
NM_012129chr772095 2068 844 620 581 443 413 1659 --12076
NM_012141chr13144042 3662 3284 3265 3048 2836 1619 1465 1348 1315 941 618 577 480 33604 3233 1542 53384 1447 1390 241 216 --
NM_012153chr11112300 2266 2234 2186 1815 1023 890 448 418 235 214 --22170 76 --
NM_012164chr9217390 7369 7313 7303 7024 6772 6747 6713 6518 6380 5363 4864 4850 2348 1816 1780 1740 1517 1025 981 942 --25414 1304 11471
NM_012193chr11115112 4813 4462 3540 3389 3302 1861 1671 1158 518 52 --31811 1760 253 1384
NM_012214chr2146257 6128 5903 5890 5840 5717 5626 5595 2324 1061 1044 425 417 60 11198 41807 690 678 213 1576
NM_012223chr23945 840 319 1536 2922 133 21352 1299
NM_012234chr393229 3011 2991 1168 1080 921 710 568 488 --23055 1271 --
NM_012249chr242679 2603 2240 379 --33205 2707 584 --
NM_012252chr7235360 5190 5168 4994 4919 4569 3702 3403 2087 1883 1788 1674 1442 1420 1158 911 769 724 714 669 586 477 361 11828 65210 3985 3771 3436 1020 606 --
NM_012259chr62441 271 --21364 517 21340 1322
NM_012262chr1205210 4812 4736 4651 4606 4541 4510 4408 4190 3582 3405 3214 1968 1573 1528 1418 1097 702 636 251 12102 94087 1881 1862 1799 1767 965 931 344 215 11959
NM_012269chr72227 72 ----2307 119
NM_012281chr782456 2243 1545 915 397 352 318 210 12101 41819 1534 362 85 11924
NM_012287chr3124521 3495 3487 3080 2920 1723 1687 1644 1004 377 158 24 --33820 3266 3190 43928 3911 1156 1143
NM_012294chr774082 3840 3606 3441 3107 2804 993 --53848 3588 354 237 123 13374
NM_012297chr482646 2429 2340 2282 2091 888 503 126 1159 12375 22536 2276
NM_012301chr772228 2152 2092 2040 1598 815 264 --1312 --
NM_012309chr11104808 4399 3991 3963 3684 3423 3200 1724 1585 66 --14009 13155
NM_012329chr1731562 628 580 --41106 1097 514 74 1600
NM_012343chr551138 1013 895 798 385 2931 367 2877 404 --
NM_012345chr1351650 1275 512 441 34 --41948 1660 555 497 21805 572
NM_012347chr662096 2082 2061 546 386 276 32481 1213 859 63031 3016 2939 2927 2549 423 12774
NM_012382chr5174511 3817 3223 3142 1601 1567 1556 1523 1450 750 678 566 478 469 416 401 110 24110 3757 33933 3698 69 --
NM_012388chr1553104 3038 2655 2554 684 32159 2143 616 12176 --
NM_012420chr1092077 2023 1520 793 612 504 327 236 106 --1135 --
NM_012425chr1042070 1775 1743 753 22166 222 31887 1840 875 12758
NM_012463chr1281567 1462 1425 1216 1158 487 397 227 --2458 165 1246
NM_012464chr452790 2546 2040 693 53 22081 181 22605 2415 --
NM_012465chr1073353 2483 2184 836 752 714 514 --22952 2811 --
NM_013229chr1262814 2651 1875 1821 519 178 1153 32662 1808 492 --
NM_013231chr1484068 3830 3663 3616 3501 3477 3287 1701 13367 43297 3232 3002 1726 13645
NM_013235chr55893 865 859 850 279 ------
NM_013238chr1371639 1329 1211 585 321 234 79 --31907 726 70 --
NM_013250chr111156 --31411 1087 104 21279 354
NM_013254chr124202 156 137 127 --1568 --
NM_013255chr7188282 7973 7936 7848 7681 7619 7375 7188 7144 5830 5813 5779 2096 1773 1527 1276 694 240 12668 55974 5526 3197 3043 1463 16980
NM_013257chr852342 2143 2025 523 84 1255 42205 2066 1978 491 --
NM_013261chr473304 3049 1404 1389 1210 851 495 --23543 2898 --
NM_013269chr12123714 3692 3498 3363 3322 3143 3122 1615 1246 459 109 37 1188 --21214 164
NM_013309chr1592378 2205 2117 1881 638 515 332 317 117 31614 1052 722 32577 2472 1920 --
NM_013322chr761744 1088 635 602 357 337 31688 1354 655 31441 1139 531 21422 237
NM_013341chr292731 2677 2490 2235 2032 1923 1005 647 26 --32070 2015 408 --
NM_013352chr63922 650 614 1353 2805 632 --
NM_013354chr821064 278 11316 --11420
NM_013372chr15133175 3125 2976 2912 2791 2561 2499 2353 2329 2114 875 709 240 12991 ----
NM_013374chr383117 2972 1170 1075 970 760 693 316 21111 646 23065 286 --
NM_013381chr12102421 2369 1943 1917 1902 1547 563 396 332 289 1824 21766 1589 --
NM_013386chr181814 1789 1639 1310 1150 1109 488 470 11543 31648 1412 1225 --
NM_013396chr2171581 1571 1447 1215 1114 1072 386 --1197 11329
NM_013438chr941370 636 519 247 ----2351 315
NM_013943chr183271 2975 2891 2799 1000 458 163 105 1543 63039 2123 723 632 501 430 --
NM_013989chr14164467 4373 3954 3837 3819 3688 3481 1846 1655 1588 1527 1430 1202 801 793 131 --34267 1541 936 21917 448
NM_013995chrX72498 2338 2243 2057 1830 1802 887 --41923 1796 1605 298 11663
NM_014011chr242392 1596 340 164 12440 1225 22480 2068
NM_014016chr381490 1466 1438 1231 1209 1066 512 234 21305 1253 11278 31522 1339 1142
NM_014021chr193170 2945 2762 2415 2116 1076 1023 349 213 43250 776 747 722 53386 2989 2447 2372 669 --
NM_014023chr1072938 2910 2678 2089 2001 572 285 --22890 2064 1712
NM_014028chr693066 2815 2792 2640 2617 855 366 334 254 1816 13141 23300 1268
NM_014034chr681304 1172 940 616 586 416 241 114 --11413 21545 1525
NM_014043chr341542 1325 563 505 --11511 1380
NM_014048chr16134835 4403 3962 3849 3842 2068 1404 1049 983 874 801 107 44 13933 55321 4565 3607 781 165 --
NM_014057chr951399 1385 1192 1109 126 2226 93 41627 1304 392 214 11227
NM_014089chr1372108 1992 1970 1643 811 457 165 --22081 1423 --
NM_014106chr15132784 2674 2510 2441 2262 1850 1027 449 340 272 247 239 206 ----22698 2384
NM_014109chr841144 1136 856 798 --2903 197 1806
NM_014112chr8135432 5248 5209 5125 5029 4836 4453 3881 3615 3408 1891 1022 918 44853 3641 1266 1140 34218 1935 1782 23767 1500
NM_014117chr16102655 2289 2170 2071 1801 783 434 322 260 80 --22683 613 --
NM_014141chr7175294 5042 4887 4674 4632 3415 3230 2053 1956 1939 938 837 736 424 188 149 104 --45174 3542 3276 1763 11706
NM_014155chr11227565 7522 7348 7281 6763 6697 6558 6390 6270 6263 4914 4670 4636 4608 2624 2270 2125 1881 1871 1792 712 532 37194 4625 1773 35023 1894 1617 --
NM_014157chr16124002 3756 3664 3548 3491 3329 2828 2736 408 373 259 245 ------
NM_014211chr581767 1692 620 484 451 245 210 121 2557 188 21718 1591 --
NM_014223chr12227 182 --1569 1272
NM_014243chr462166 1715 1494 1392 597 243 --31604 1349 448 11553
NM_014253chrX82309 1728 1610 782 161 117 104 51 12226 22327 1844 --
NM_014264chr43518 435 187 --1486 1640
NM_014265chr88760 691 320 312 255 177 123 75 ------
NM_014294chr841062 1046 592 267 21391 66 51120 1107 1030 916 187 --
NM_014309chr22115156 3755 3696 3612 3405 3394 1672 1548 798 694 55 11014 22097 1796 1349
NM_014313chr161518 1411 1091 1014 502 413 --41622 1592 439 420 --
NM_014319chr1281787 1613 1607 1452 536 330 125 97 --21803 270 --
NM_014331chr4207488 6753 6636 6484 6401 6383 6297 5876 5704 5376 5004 2063 2042 1980 1925 1810 1072 860 490 437 15330 97844 7819 6942 6919 6324 3037 3024 2154 2018 --
NM_014372chr172015 2000 1849 1804 1594 1486 231 1756 --1836
NM_014376chr572244 1910 1897 960 908 794 358 1852 22555 618 1930
NM_014379chr871020 895 839 411 268 250 153 1328 21048 402 --
NM_014388chr1105295 4659 4470 1630 1113 955 682 602 286 274 --71651 1643 1207 998 791 775 414 --
NM_014393chr862385 2284 2086 840 520 485 --2341 246 11856
NM_014394chr1061058 791 784 381 114 38 --21156 776 --
NM_014395chr491993 1943 1899 1867 1372 1325 745 532 465 --1473 --
NM_014415chr361724 1689 414 244 133 58 1345 31584 477 143 --
NM_014421chr481953 1893 1466 586 490 482 154 112 1401 11907 --
NM_014423chr5175642 5482 5246 4895 4830 4699 4552 4518 4007 3953 3877 3569 3549 2264 623 387 181 23661 833 45528 5231 792 411 --
NM_014426chr204733 582 148 50 --2565 124 1173
NM_014445chr372313 2132 2106 1945 882 619 98 12280 22264 912 --
NM_014456chr1081902 735 640 575 524 238 126 39 11781 ----
NM_014574chr1411466 1553 21172 544 11513
NM_014615chr1652977 2870 291 74 67 23577 996 11003 21186 44
NM_014616chr363148 3009 1053 971 741 201 --43356 3182 963 228 1160
NM_014630chr1594007 3536 2791 2782 1605 1575 1308 1173 789 --33393 2668 781 --
NM_014637chr871424 1403 1229 1140 1131 462 301 1956 1509 11249
NM_014666chr561212 1038 924 515 486 157 21340 1007 1861 --
NM_014682chr862285 932 783 703 300 122 --31958 1942 1881 --
NM_014686chr1992598 2502 1934 905 610 602 525 499 364 --22280 1977 --
NM_014701chr15113394 3232 3162 2919 2722 2615 2601 2521 2375 2097 76 --2303 124 12333
NM_014702chr6143199 3095 2928 2762 2754 2545 1233 1072 768 707 572 440 248 60 --42531 2519 2344 856 32877 2592 509
NM_014705chr742080 1704 1583 140 1157 31664 219 71 12139
NM_014707chr782242 1951 1822 1578 917 765 587 560 31980 807 743 51869 1588 1528 1447 366 1621
NM_014720chr1071808 1787 1652 1587 709 691 474 ------
NM_014721chr6227441 7293 7055 6873 6472 6459 6273 5994 5950 5147 4762 4555 4504 2669 2539 2105 1143 768 759 701 456 355 67013 6006 2927 2761 1743 740 76541 6500 5734 5291 5182 1586 419 36069 5922 2921
NM_014733chr5122300 2105 1946 1778 1601 769 721 379 267 175 168 96 ------
NM_014735chrX91939 1927 1909 1847 1591 1475 1321 657 117 --21561 265 --
NM_014739chr6113964 3828 3674 3211 2894 1632 1447 829 676 252 150 1954 33848 2997 89 1370
NM_014743chr483190 3130 3109 2846 2674 885 406 355 --32557 2200 1243 --
NM_014746chr284110 3007 2675 1734 1581 744 725 87 --43745 3605 1417 1374 --
NM_014749chr145824 619 342 144 123 --1883 --
NM_014751chr841605 1576 549 500 --1205 11904
NM_014765chr192373 2364 1909 1710 628 503 265 238 90 22707 453 141 --
NM_014766chr7103825 3759 3570 2856 2682 2675 1123 1095 978 735 --21499 1168 --
NM_014772chr1852363 2324 2306 2300 235 ----12487
NM_014776chr1282813 2517 2295 1182 1092 820 490 427 --42313 686 367 98 --
NM_014781chr861266 1234 992 379 334 33 --41223 1193 965 842 --
NM_014787chr182367 2190 1950 1774 812 556 281 205 --42683 2253 2222 865 11962
NM_014802chr1261122 1038 932 825 798 172 ----11013
NM_014803chr10142736 2583 2309 2260 1930 1861 1099 1064 1001 891 761 501 249 114 12327 42818 1909 1023 81 --
NM_014810chr193668 3481 3300 3228 2871 2661 1474 1279 997 23111 425 23435 2580 13192
NM_014812chr161768 1746 1652 1383 353 51 --11886 11301
NM_014819chr562253 2197 985 831 681 88 32184 578 137 21809 181 12110
NM_014826chr194091 3004 2994 2904 2827 852 644 265 225 14363 14292 11284
NM_014828chr1462241 1857 1808 1574 707 265 11884 --1338
NM_014829chr5142366 2275 2217 2004 1818 1665 1542 890 812 750 268 248 241 125 --21946 294 11782
NM_014832chr13102105 1981 1549 1368 789 700 677 535 244 227 21932 770 1493 --
NM_014839chr162405 1948 1751 1017 970 955 --22049 697 1825
NM_014848chr1572496 2202 1959 1905 1868 763 526 --2754 304 12084
NM_014873chr1134338 4291 3549 3150 2990 1715 983 935 557 551 252 211 131 33645 3245 1961 44844 4367 3385 1548 --
NM_014877chr17177174 7078 5526 5293 4855 4848 2993 2762 2629 2309 2230 1993 1916 1779 1559 1072 371 54897 2563 1008 392 110 55496 4758 1213 1028 683 --
NM_014888chr7111486 1183 1150 1067 1009 619 559 348 316 281 171 1424 21336 82 --
NM_014893chrY52043 2000 913 796 368 11459 1396 12011
NM_014897chr17153208 3199 3015 2985 2924 2908 2871 2357 2201 2153 2034 1289 1230 1224 76 1407 --1500
NM_014899chr563056 2240 2119 900 803 186 --11993 12288
NM_014900chr25934 753 399 387 65 --1429 1118
NM_014904chr1072812 2561 2506 852 547 509 301 11161 63977 3637 2913 2806 1326 398 43880 3681 946 150
NM_014906chr1793933 3785 3739 3459 2825 1273 1203 748 85 12982 3903 672 75 12583
NM_014912chr1053416 3202 3091 2255 2209 23313 2369 33055 2526 927 11257
NM_014918chr1551568 1010 383 315 309 1200 11037 11340
NM_014920chr683788 3521 3236 355 285 257 148 139 1387 1176 --
NM_014923chr1342068 709 604 194 --22294 666 11584
NM_014932chr361952 1922 1867 1763 1310 324 1110 ----
NM_014934chr1383872 3802 3522 3439 1225 965 737 201 12733 53988 3835 3487 853 382 --
NM_014936chr662599 2228 1944 1875 349 121 22682 806 32431 2112 581 12148
NM_014946chr272841 2084 1180 687 371 171 29 22821 2174 32124 1248 931 42665 2658 2037 596
NM_014950chr1471473 1439 1245 548 377 367 226 11504 --21399 449
NM_014951chr1082593 2249 2225 2206 1990 1903 1784 48 --62543 2316 1754 1642 452 86 12634
NM_014953chr13114196 1732 1683 1661 1651 1465 1281 919 802 347 127 --34361 945 689 --
NM_014962chr2092815 2633 2623 2277 1868 1061 211 176 82 12788 11923 --
NM_014982chr14185380 5241 5145 4177 3765 3745 3536 3394 1842 1739 1421 1348 1280 802 741 603 506 397 24271 1698 65332 3339 1204 236 208 24 --
NM_014988chr492580 2227 2054 1967 1869 835 484 417 99 --31902 761 569 --
NM_014991chr462684 1224 975 933 868 558 --22884 755 1584
NM_015000chr1293113 2477 2104 1977 1208 861 479 257 201 --32926 2708 2275 --
NM_015002chr1262097 1751 1436 894 369 278 --22220 2189 1542
NM_015008chr363524 3411 3296 2758 1376 621 13557 33124 2830 1218 13321
NM_015026chr12164192 4169 3811 3669 3521 3315 3239 2996 1710 1681 1110 966 792 721 446 80 --43733 1865 1811 1161 --
NM_015032chr1382958 2520 2402 2092 2080 259 238 190 22536 907 22546 968 22465 2073
NM_015045chr1051632 1547 894 437 101 21775 744 22081 1784 1836
NM_015049chr2113318 2735 2517 2105 1289 852 814 357 313 274 65 22148 550 ----
NM_015051chr993203 3038 2279 2132 1289 914 597 562 286 12485 --12344
NM_015055chr1132981 565 530 --42858 2844 2827 1891 --
NM_015057chr134664 530 436 282 --2480 275 --
NM_015068chr773962 3231 2813 2461 679 375 196 23555 1121 13487 1832
NM_015071chr586423 5843 5492 5453 4171 1950 985 230 --66153 6125 5661 4574 2300 1871 25478 5398
NM_015076chr6123976 3940 3897 3884 3707 3583 3550 1319 1120 740 287 143 --14085 --
NM_015087chr13122539 2497 2312 2197 1875 1827 1786 1725 1705 821 694 310 --2855 249 --
NM_015091chr143653 598 253 --2630 200 1624
NM_015092chr1674107 3884 3719 3685 3325 1388 43 13896 23952 924 13455
NM_015097chr352235 2125 1875 940 419 11626 31920 471 389 --
NM_015110chr942533 1776 1671 1561 1276 42293 1747 926 821 --
NM_015115chr4123202 2998 2723 2688 2208 2072 1277 1091 987 592 532 410 1556 2754 449 --
NM_015130chr431247 887 522 --3505 168 100 --
NM_015132chr791898 1843 1828 1821 755 503 460 296 228 --21975 1361 --
NM_015137chr8122357 2347 2225 1884 1853 727 649 593 437 371 248 117 --1839 --
NM_015141chr362542 2270 1927 1763 777 205 1413 42787 1916 765 337 --
NM_015144chr1693879 3586 3541 3511 3155 2533 1446 295 43 126 43872 3845 2923 1024 --
NM_015147chr283276 3035 2917 2250 2235 926 551 379 ----13129
NM_015149chr172008 1929 1397 807 308 261 253 ----1146
NM_015155chr1093010 2950 2902 2346 2090 1278 1184 1114 740 --22543 274 11171
NM_015156chr14154058 4011 3945 3853 3824 3762 3233 3072 2822 2651 1536 738 583 554 69 13916 11290 --
NM_015170chr8132350 2296 2268 2212 1893 1852 1796 1697 875 592 394 69 24 1358 ----
NM_015172chr151603 1412 1102 338 46 1103 1622 11554
NM_015192chr2092810 2157 2122 1161 1069 955 909 435 102 32413 2407 402 1363 --
NM_015199chr342830 1087 604 531 --22735 768 22482 510
NM_015200chr462586 1668 979 850 816 771 12622 21809 502 12285
NM_015205chr13135130 5068 5026 4652 3704 3512 3270 3261 3244 1778 1447 968 377 15202 21704 1481 --
NM_015206chr15133916 3890 3580 3460 3215 3071 2938 2699 2381 2360 945 284 252 12864 33046 939 602 22912 1131
NM_015208chr18183478 3298 3171 3145 2957 2709 2573 2511 1570 1478 1398 1274 1197 1188 1003 594 498 371 12944 53416 3384 2978 1435 1388 152
NM_015209chr152353 2311 1854 1784 1558 12256 1851 12320
NM_015215chr183147 3071 924 393 357 238 76 35 --52709 2002 1082 1052 379 11245
NM_015216chr571444 1386 1336 976 515 265 179 --11563 1597
NM_015225chr962606 2068 1099 913 822 55 --72995 2924 2863 2699 2568 1262 940 --
NM_015230chr481702 1642 1342 713 667 156 147 41 --31661 1258 247 21884 1314
NM_015235chr1081776 1762 1724 1448 690 291 284 238 --1511 1381
NM_015247chr16135270 5251 4347 1951 1901 1841 1648 1415 1365 829 766 300 49 13869 45102 4971 1266 189 --
NM_015251chr1672304 2082 2028 2021 1967 1462 402 --1362 --
NM_015252chr25876 817 794 96 32 ----1370
NM_015263chr1551159 1002 820 384 245 1890 3935 786 270 1951
NM_015271chr4124274 4095 3779 3581 3452 3182 2636 1611 1474 736 510 485 --22882 1676 33494 3322 1054
NM_015275chr1282188 2070 1976 1473 1435 1388 645 462 21957 1951 1614 12180
NM_015278chr693233 3206 3122 2837 2578 2237 841 677 493 12690 43274 2614 2568 557 --
NM_015288chr573587 3540 3173 3029 2975 1473 1382 1195 23532 1256 --
NM_015291chr173380 3276 3234 2918 2727 2619 998 12525 23108 2351 --
NM_015310chr8208379 8078 7766 7460 7324 6984 6790 6390 6359 6011 5800 5309 5193 3092 2226 1703 1677 1358 1096 1055 12302 35966 5441 3258 18144
NM_015313chr11104723 4555 4468 4445 4393 4275 4070 3961 3708 3645 --34649 3873 913 13937
NM_015314chr7112407 2117 1986 1830 1745 1657 853 665 339 260 22 1572 ----
NM_015317chr282836 2082 1872 1010 969 962 855 514 1618 21827 685 1506
NM_015323chr611145 11291 61558 1419 1169 1110 584 35 --
NM_015335chr1272510 2166 2154 1073 961 878 861 --22456 1686 --
NM_015336chr1282433 2111 1834 789 435 326 170 23 11769 --12687
NM_015344chr882201 2040 1743 1375 799 540 494 148 12145 31479 730 266 --
NM_015347chr1281119 1029 775 379 288 280 265 140 1179 12971 --
NM_015349chr642554 1216 1030 887 1865 32929 2752 2677 --
NM_015355chr1761965 1737 764 280 242 229 1178 31920 372 214 --
NM_015358chr2141325 1304 1110 63 1505 3247 154 27 --
NM_015365chrX94223 4072 3730 3710 2884 2769 2759 1529 655 44199 3693 1219 268 43889 1053 935 822 1841
NM_015378chr182898 2406 2213 803 339 328 248 239 --1847 --
NM_015387chr241958 1894 1799 1328 143 11689 1556
NM_015394chr12132461 2425 2373 2328 2253 2058 1838 976 928 913 457 407 238 12205 22278 723 11706
NM_015423chr1181777 1685 1661 1642 557 460 412 404 11556 1296 --
NM_015436chr482646 2294 1108 1075 960 708 701 446 13147 12544 --
NM_015446chr171478 1435 1390 1154 1140 224 67 ------
NM_015455chr5103149 2954 2858 2658 1496 1113 1031 674 280 58 33689 3066 1621 33774 1092 800 --
NM_015458chr8125248 5116 5104 5096 4953 4879 4243 1406 1265 1247 1063 337 --14678 13898
NM_015483chr74763 271 141 86 11145 --21094 864
NM_015507chrX3309 174 162 ----1124
NM_015520chr362832 2721 1909 861 792 641 12692 1829 12646
NM_015532chr1582611 2564 512 409 345 270 195 187 32468 886 574 31003 907 487 11116
NM_015535chr284048 2716 1223 652 488 449 386 228 11690 63608 3590 3243 2887 2679 746 13283
NM_015550chr7123371 2858 2331 2299 2268 1295 897 732 530 458 218 124 21321 26 1628 --
NM_015553chr6155201 5147 5111 3990 3742 1920 1849 1625 1510 1026 954 860 704 485 112 11757 34771 3948 372 --
NM_015554chr1572737 2193 2064 1886 596 573 445 1862 --1969
NM_015555chr661830 1136 1105 217 181 116 1335 31296 1177 529 --
NM_015560chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_015565chr2142201 1961 1695 284 2221 99 52193 1509 1417 874 241 --
NM_015569chr1164869 4178 4168 3766 3560 3282 3258 3217 3030 1853 1706 1461 772 743 654 344 13728 33824 3503 1173 --
NM_015571chr6132673 2490 1970 1865 1813 748 696 483 406 393 386 203 176 1457 4820 595 575 303 --
NM_015575chr283547 3235 2616 2536 1290 1077 990 187 --2813 459 --
NM_015576chr3102750 2442 2304 2275 1101 752 380 359 87 68 --21110 1086 12185
NM_015578chr19111955 1937 1553 1447 1430 1347 823 793 711 204 57 21853 212 31381 1334 694 1641
NM_015601chr1031022 711 228 1183 3957 763 322 2155 40
NM_015626chr174480 231 199 190 --11028 1160
NM_015640chr1185312 5077 4416 4374 4317 3697 3621 3260 1862 1615 1154 916 777 627 546 316 295 188 25099 4882 31505 1482 416 --
NM_015713chr8103302 2869 2752 2579 1142 835 821 768 602 260 1468 --12404
NM_015852chr7223615 3473 3453 3259 3242 3129 3085 2762 2742 2707 2612 2551 2318 2302 2279 2218 1395 1359 1278 945 273 105 --53632 3419 2588 2420 2327 12645
NM_015866chr131421 997 138 --41122 1097 1085 435 11296
NM_015878chr892121 2089 1943 1633 1582 789 438 256 59 ------
NM_015879chr18198451 8011 7907 7660 7607 7299 6980 6813 6412 3389 3149 3101 3086 2135 1505 1195 1006 815 428 12072 66134 6032 5962 5346 1868 1258 27930 1860
NM_015886chr8235556 5526 5518 5462 5186 4744 4621 4324 4284 4218 4112 3775 3542 2195 2031 1648 1508 774 393 318 187 43 25 65231 4483 4429 4193 3722 2263 55330 1923 1564 1423 179 --
NM_015888chr1103298 2636 2141 2095 1275 1120 868 728 710 563 1377 63084 2555 2394 2075 254 62 42897 2547 2229 2107
NM_015906chr1124436 4372 4266 4013 3401 2950 1917 1683 1525 1252 1191 1015 --43946 1936 1200 302 --
NM_015912chr8152562 2420 2397 2387 2372 2351 2166 1582 966 893 879 669 448 261 108 --21846 410 --
NM_015967chr15968 950 674 327 106 --1912 --
NM_015975chrX4689 295 158 73 --21573 454 1644
NM_015986chr1731140 222 144 1340 11194 1549
NM_016009chr164197 3703 3478 1533 1392 719 1554 63832 3145 2992 1093 918 163 --
NM_016021chr632419 897 145 11077 61121 905 566 531 156 49 --
NM_016023chr841913 770 287 150 11676 31382 873 586 --
NM_016040chr192538 2407 2264 2253 1074 966 645 208 26 --32674 932 95 1607
NM_016045chr2071726 1632 1543 1526 1447 1235 463 --1537 --
NM_016063chr63707 686 276 ----3269 253 39
NM_016072chr12112412 2404 2302 2132 2088 1888 978 572 530 125 65 --41570 772 411 34 11961
NM_016073chr156994 848 463 375 364 67 --2780 178 --
NM_016075chr1392458 2356 2202 897 675 478 421 149 63 12928 43210 3115 3104 1236 --
NM_016076chr1113205 3184 2728 2685 2436 2300 2080 1974 899 658 75 ------
NM_016081chr491666 1380 905 823 394 340 295 214 126 12120 22269 2227 --
NM_016083chr6153988 3921 3848 3684 3629 3013 2975 2550 2539 1490 1432 823 618 607 476 13659 33386 2652 704 --
NM_016087chr741591 1421 1186 1174 21732 396 31750 1533 532 1439
NM_016090chr1171098 1066 935 839 765 439 357 --170 1825
NM_016096chr841931 776 608 206 11575 --1863
NM_016125chr176515 456 419 377 213 180 ------
NM_016131chr292219 2166 1899 1866 1691 590 577 564 427 22241 292 12386 --
NM_016132chr15123468 2671 2405 2305 2121 1069 896 862 338 152 78 22 11194 --12167
NM_016142chr1161351 1282 1082 932 312 248 ----1125
NM_016156chr1162365 1488 869 742 615 371 2325 238 11904 --
NM_016201chr372322 2242 2019 1740 1673 1635 917 --31726 1593 1460 --
NM_016206chr3258898 8850 8610 8567 8509 8459 8452 8302 8201 8157 7552 6908 6788 6481 6415 6344 5853 5791 3143 2935 2836 2678 1695 1689 430 16932 67097 6493 6258 1741 192 179 27025 6044
NM_016217chr6153701 3477 3455 2982 2810 2560 2549 2471 2456 1452 1368 1175 639 613 412 22405 85 23615 74 --
NM_016220chr7112253 2218 2063 1815 1792 1754 1731 891 777 653 276 12156 21840 1681 --
NM_016221chr561592 762 681 484 464 423 11579 1937 --
NM_016226chr123418 117 103 --168 1458
NM_016231chr1741738 1597 685 150 --31573 1495 210 11727
NM_016248chr1383665 2558 2550 1530 1517 934 249 126 33136 644 93 13473 1583
NM_016255chr673311 2408 1139 1130 1032 1006 639 12608 1307 11079
NM_016257chr172965 2693 2608 2564 2239 1267 845 --43425 3391 2983 724 1899
NM_016260chr2227631 7559 7112 7092 6835 6573 6105 5546 5200 5112 4968 4908 4720 2750 2537 2141 2117 1251 989 957 685 212 26092 117 66685 5876 5532 3054 2278 1437 15893
NM_016275chr3142781 2685 2553 2455 2415 2320 2240 2232 1958 1871 949 527 485 407 2795 69 22628 1910 1295
NM_016277chr641438 1197 323 304 --2371 135 11086
NM_016289chr282017 1901 1876 1669 941 634 259 39 191 22282 2097 --
NM_016298chr3102388 2266 2182 1243 1155 1051 1043 834 768 622 1735 ----
NM_016302chr37758 577 301 222 194 118 95 2125 102 ----
NM_016308chr181886 1874 1818 1653 835 499 341 41 --11700 --
NM_016315chr291811 1391 522 445 420 400 259 118 110 --21160 657 1716
NM_016353chr8111938 1618 1609 1533 854 796 726 650 315 264 166 ----2439 227
NM_016357chr1241190 974 790 377 21069 320 31243 1210 271 1406
NM_016374chr18999 586 536 412 379 324 301 85 --21393 1159 1558
NM_016374chr18999 586 536 412 379 324 301 85 --21393 1159 1558
NM_016376chr1794305 4030 4018 3776 3538 2771 1581 1330 356 --33902 1493 1429 13940
NM_016377chr681793 1689 1670 1416 1357 1168 1093 590 ------
NM_016395chr1581703 1626 1514 1490 1235 668 553 143 --21959 529 21189 730
NM_016396chr1542635 2325 713 686 --53013 2794 2782 646 70 --
NM_016422chr1173208 3182 2759 2723 2224 893 856 1381 144 12073
NM_016424chr1771811 1724 1599 1365 576 420 138 --41428 1259 442 186 21876 1802
NM_016436chr20102682 2601 2460 2133 1083 990 772 751 475 145 --12112 --
NM_016467chr271443 1269 1224 1170 976 556 361 11129 ----
NM_016485chr682292 1918 1551 587 548 475 464 426 1838 41522 1454 482 154 1514
NM_016507chr17132937 2793 2568 2503 2309 2205 2095 2072 1179 1113 1055 615 219 --13215 --
NM_016513chr683788 3521 3236 355 285 257 148 139 1387 1176 --
NM_016529chr1351178 884 858 315 308 --1256 1293
NM_016530chr1583954 3019 2975 2534 783 486 406 197 1792 43416 3262 2842 2729 23043 470
NM_016531chr4194175 4123 3693 3670 3433 3332 3169 2885 2744 2715 2662 1292 1240 1181 961 809 788 430 296 23862 3777 33581 936 405 --
NM_016542chrX51735 1602 421 367 338 --21770 602 11306
NM_016559chr381362 1224 1068 1045 1013 442 371 291 --31033 497 101 --
NM_016591chr531164 991 194 1847 1242 1262
NM_016607chrX61714 1428 1220 461 428 200 --21447 239 --
NM_016617chr1392059 2037 1535 797 737 688 479 452 370 1329 32099 2079 44 --
NM_016622chr241916 1709 292 115 2337 130 21678 1392 --
NM_016625chr34502 377 155 42 172 2420 181 --
NM_016631chr2131050 821 656 --1911 21033 119
NM_016654chr1531363 1132 1060 11159 2961 503 11209
NM_016834chr173623 279 263 --32659 254 240 --
NM_016835chr173623 279 263 --32659 254 240 --
NM_016841chr173623 279 263 --32659 254 240 --
NM_016929chr694282 4259 3847 3834 3438 3269 1625 1343 354 24085 3813 --14632
NM_016953chr2175829 5801 5454 5401 5113 5092 4830 4210 3865 3746 2438 1924 1332 1269 1135 150 126 36052 4865 4855 23738 842 --
NM_017420chr14103710 1264 1139 961 897 781 731 641 508 439 1862 21392 74 13542
NM_017423chr491980 1720 1618 1557 859 759 720 303 142 1170 32237 2151 1466 --
NM_017437chr1492439 1786 1653 746 474 415 180 156 143 --1343 --
NM_017447chr21143881 3808 3773 2958 2946 2935 1394 1082 881 596 398 259 119 51 11579 31724 1041 288 --
NM_017563chr3126355 6288 6018 5726 4985 4566 4193 2237 1760 1334 1264 301 25245 921 35344 2316 23 11914
NM_017577chr371530 1387 477 246 149 133 93 11676 11553 --
NM_017594chr9113109 2985 2896 2855 2709 2629 2075 2050 1083 995 740 --43029 2721 2606 108 --
NM_017610chr1571634 1618 1578 1368 675 465 214 --2480 102 1797
NM_017628chr4124482 4168 4024 3464 3214 1605 1168 964 704 689 533 339 21548 595 55330 4982 1686 1118 318 --
NM_017633chr693924 3803 3564 3164 2853 2771 1347 981 497 --23385 2665 --
NM_017637chr9188989 8346 8033 7986 7434 6112 3667 3175 3030 2168 2061 1985 1888 1477 1234 1135 704 509 1674 46596 2587 1956 531 12689
NM_017641chr1281181 1100 1033 872 861 748 117 92 11053 41141 1110 726 414 --
NM_017643chr1782806 2708 2667 1155 477 248 107 96 1313 1588 13072
NM_017644chr3145131 4731 4399 4336 3330 3151 1920 1650 1590 1487 1308 835 619 144 --34720 4314 1706 --
NM_017645chr9102855 2825 2780 2638 2533 789 727 457 236 153 --33192 3131 3028 1285
NM_017650chr7165966 5927 5549 4853 4651 4481 4137 2257 2168 1801 1669 1094 942 824 721 550 45575 2428 2027 1237 35079 3928 1785 1767
NM_017651chr661646 1405 1356 1340 1029 1011 1383 11195 --
NM_017655chr151161 1082 232 178 139 11567 21642 491 --
NM_017658chr14174517 4434 3974 3728 3717 3680 3609 3447 1844 1680 1277 1223 1210 755 699 316 54 13281 23068 816 13595
NM_017666chrX21947 462 21920 286 22081 1804 11885
NM_017704chr1161001 722 320 124 112 87 --21014 415 --
NM_017709chr173659 1517 1490 800 740 492 235 --14176 1289
NM_017736chr1683079 2899 2497 2359 1164 1147 956 507 22238 985 2601 402 --
NM_017737chr182209 2093 1527 739 694 562 158 128 11751 22053 628 --
NM_017752chrX122179 2166 2126 1840 1781 1603 803 710 335 262 120 41 12062 11974 22012 530
NM_017754chr694780 4091 3406 3111 1640 1399 343 241 193 --34633 4027 3579 --
NM_017762chr1571777 1537 687 141 132 62 21 --21639 621 21862 674
NM_017769chr14113258 3151 3026 2899 2850 2592 2133 1274 803 768 188 21033 147 22392 2140 1423
NM_017770chr6122917 2870 2821 2641 2573 2484 1942 1846 871 323 315 188 1983 22728 2397 32983 639 494
NM_017784chr361231 1122 1071 960 830 253 153 1982 --
NM_017813chr894695 4621 4120 4056 1812 864 707 525 132 55611 4310 4152 3994 924 35671 4861 3617 --
NM_017824chr1032689 1699 126 1633 22584 518 1313
NM_017831chr1894646 4308 3958 3839 3825 3266 1098 947 388 21333 473 43971 979 958 414 13200
NM_017845chr46769 722 642 336 158 127 --3843 674 267 --
NM_017847chr162196 1837 1798 1570 1560 39 2340 216 52284 1671 1530 1426 630 --
NM_017919chr9115836 5563 4961 4726 4522 4090 4036 1268 1256 960 910 44537 4327 3723 2296 45576 5402 3772 322 --
NM_017925chr971706 1504 1480 1233 394 205 168 --162 --
NM_017933chr281628 1523 1428 1027 606 459 72 33 11358 --11227
NM_017938chrX42046 1961 1687 640 --11988 22108 2100
NM_017943chr1451070 1014 802 412 317 ----1994
NM_017944chr1162907 2158 1088 1079 623 614 1603 12789 --
NM_017954chr781431 1204 648 600 389 320 288 44 11084 21303 1123 --
NM_017987chr1051781 1739 1568 525 420 11433 12240 1862
NM_017994chr763020 2358 2039 543 405 343 12211 31141 682 129 --
NM_018010chr361510 1222 549 525 273 80 11055 21580 1286 --
NM_018017chr10112703 2620 2269 2202 2070 1830 1806 986 688 502 335 1284 2394 109 --
NM_018018chr1291781 1326 1191 757 680 651 604 581 392 --1376 --
NM_018027chr1032968 2552 720 --43317 752 587 274 22644 2265
NM_018036chr14184315 4096 3975 3916 3825 3696 3528 3462 2824 2711 1740 1627 1035 910 683 577 457 174 33203 1280 518 64486 4405 4285 2947 235 119 13738
NM_018046chr591925 1820 1703 1683 1610 1372 615 466 383 --11643 --
NM_018084chr273303 3127 2274 2194 2058 1253 1114 --43260 1069 1042 709 --
NM_018092chr1661522 1415 1257 1129 1036 361 1269 --11623
NM_018120chr871460 1093 961 552 418 324 153 1541 31236 570 481 --
NM_018121chr1082797 2596 2520 706 508 370 185 24 12367 ----
NM_018126chr431472 243 27 11355 11249 140
NM_018139chr14----3362 287 271 130
NM_018151chr23832 119 35 --2807 624 1579
NM_018155chr3113489 3067 3050 2850 2473 2258 2139 993 544 481 107 22773 1058 32881 2842 2412 11012
NM_018156chr182898 2406 2213 803 339 328 248 239 --1847 --
NM_018169chr123521 431 358 --2554 62 1530
NM_018184chr392195 1947 1887 1866 1615 832 710 504 380 1643 11505 --
NM_018191chr1352136 1400 738 251 151 12169 31918 1812 632 --
NM_018204chr1361453 1414 1198 918 312 147 --1119 --
NM_018225chr9125330 5218 4983 4843 3592 1960 1915 1360 1183 983 51 34 14546 11213 --
NM_018238chr741201 1006 986 503 11270 21074 944 --
NM_018243chr4124085 4068 3968 3951 3768 3460 3153 2474 1419 923 762 550 23737 572 44102 3910 3228 1082 1522
NM_018247chr6153162 3115 2971 2785 2448 2426 2316 2086 2064 2048 1226 1099 963 884 174 12675 22198 2104 --
NM_018254chr172004 1805 1795 1743 800 489 375 --32153 1815 946 --
NM_018279chr1262748 2718 2238 1940 696 613 --22666 2509 --
NM_018293chr392996 2245 2025 1923 907 726 625 483 291 1395 31890 1184 1148 1942
NM_018299chr8133179 3169 3113 2944 2810 2541 2354 2344 2216 2114 1163 658 245 1482 22369 968 --
NM_018302chr472166 1955 1618 819 754 386 303 --21868 432 --
NM_018312chr1121474 364 --3543 185 154 11443
NM_018313chr3102165 2016 1832 1809 1668 1039 978 743 651 33 --1920 1945
NM_018323chr451707 714 590 329 55 --1663 1170
NM_018325chr961678 1623 1479 1280 1214 492 --31634 1241 75 1249
NM_018351chr12144722 4610 4509 3648 3551 2949 1602 1306 953 830 805 774 522 499 1618 23494 910 1816
NM_018361chr8164103 3680 3600 3469 3039 3031 2543 1613 1505 1483 1446 967 673 618 436 175 23400 331 43488 3460 3218 908 1801
NM_018362chr11164000 3704 3676 3590 3486 3471 3018 1516 1403 1351 1293 1155 707 699 608 463 2736 306 33045 1173 976 12787
NM_018364chr1103721 2807 2759 2698 1496 1432 1425 948 145 128 23945 3107 21451 1334 33646 3254 1482
NM_018367chr1192568 2232 1889 1010 1000 806 476 379 91 12320 --11620
NM_018372chr14749 564 281 45 2526 57 2544 536 --
NM_018373chr14125153 4905 4851 4726 4462 4356 4208 4081 2593 1862 900 477 12286 15801 1530
NM_018374chr7175144 5027 4801 4461 4219 3486 3393 3192 1483 1314 1306 1207 968 489 347 329 33 14630 34080 915 509 23339 709
NM_018401chr481910 1220 1162 760 358 346 301 103 --21549 1270 --
NM_018403chr3134109 4002 3933 3841 3828 3642 1545 1161 1077 598 187 154 81 1651 23132 2734 14049
NM_018416chr1252342 2006 1862 896 104 ----2979 505
NM_018429chr56994 820 379 299 203 88 32364 964 565 1168 12762
NM_018439chr1862650 2509 861 766 717 402 1132 12669 1617
NM_018440chr8228164 8117 7883 7866 7504 7456 7293 7211 6811 5817 5452 5433 5316 2509 2497 2260 1961 1576 1420 1386 1378 761 11657 67933 7855 7494 3271 3086 1049 25287 2472
NM_018444chr852325 2002 1815 1769 418 --2107 84 1259
NM_018452chr6_random133877 3593 3278 2983 2803 2522 2461 1120 1051 795 692 139 100 12657 2989 342 12557
NM_018482chr872608 2585 2504 2090 999 917 154 21604 410 21689 572 1781
NM_018489chr162319 2256 2220 717 302 27 1134 21585 1485 --
NM_018490chr1151866 649 407 358 236 1616 --11718
NM_018553chr1781708 1672 1296 571 307 298 147 41 --1286 --
NM_018555chr1962244 1932 1790 1581 714 672 ----32296 1726 90
NM_018557chr291420 1411 1364 1301 1288 1075 590 497 41 196 --11453
NM_018566chr1205171 5118 4993 4791 4688 4072 3889 3649 3510 3449 3342 3312 1716 1644 1592 865 754 488 441 334 44020 3718 3564 3224 34929 4411 4291 1624
NM_018569chr471373 1365 1289 1211 648 411 272 1464 11446 1371
NM_018590chr1041717 1117 657 98 21403 127 --11363
NM_018638chr12125577 5322 5045 5020 1860 1631 1523 1456 1181 761 677 180 2601 79 64435 3631 3515 934 684 418 24604 3937
NM_018640chr1262782 2490 2041 1773 563 309 1528 --11717
NM_018650chr15885 797 674 275 185 --12144 12251
NM_018695chr572110 2056 1726 1521 651 232 71 11652 11741 12028
NM_018698chrX51293 1267 225 163 115 2315 240 1614 11441
NM_018700chr551452 1149 690 638 571 11416 31631 1263 1065 --
NM_018710chr841280 1244 953 535 --1357 1271
NM_018717chr482830 2630 2459 2278 2266 2009 1973 541 --22923 2696 --
NM_018718chr772251 1579 1542 1458 1445 1436 59 --12219 --
NM_018841chr193846 3822 3758 2397 1319 1170 928 511 283 11075 33064 2790 2770 1758
NM_018844chr791947 1841 1808 1416 1389 778 629 217 211 --42100 1955 1739 156 --
NM_018847chr931852 598 459 ----1497
NM_018898chr541863 1776 1452 951 --11911 12014
NM_018899chr541863 1776 1452 951 --11911 12014
NM_018900chr541863 1776 1452 951 --11911 12014
NM_018901chr541863 1776 1452 951 --11911 12014
NM_018902chr541863 1776 1452 951 --11911 12014
NM_018903chr541863 1776 1452 951 --11911 12014
NM_018904chr541863 1776 1452 951 --11911 12014
NM_018905chr541863 1776 1452 951 --11911 12014
NM_018906chr541863 1776 1452 951 --11911 12014
NM_018907chr541863 1776 1452 951 --11911 12014
NM_018908chr541863 1776 1452 951 --11911 12014
NM_018909chr541863 1776 1452 951 --11911 12014
NM_018910chr541863 1776 1452 951 --11911 12014
NM_018911chr541863 1776 1452 951 --11911 12014
NM_018947chr7154920 4898 4875 4867 4769 4253 3737 3443 3245 3170 1781 1706 1108 1096 119 1583 24913 4443 --
NM_018958chr15113805 3650 3641 3205 3040 2755 1503 1160 973 632 342 159 34101 3172 2776 23750 3067
NM_018970chr7103169 2234 2188 2152 1999 664 560 348 330 127 1760 31131 465 430 --
NM_018981chr22954 414 1103 21169 200 1302
NM_018993chr2051519 1315 963 591 584 --2556 537 --
NM_018999chr10124117 4027 3976 3881 3845 3315 1844 1732 1646 1023 606 515 11627 21785 1703 23033 170
NM_019000chr561406 1357 1247 644 353 214 --2594 327 2389 261
NM_019001chr3204847 4821 4683 4504 3948 3917 3882 3257 2958 1937 1901 1769 1660 1556 874 805 680 648 360 339 1729 21464 381 2814 299
NM_019004chr772361 1941 1722 1715 1669 1599 340 31855 837 117 22420 1818 --
NM_019022chr18133066 3050 2768 2661 2570 2560 2384 2002 1991 830 320 284 99 11030 271 22 12334
NM_019027chr471899 1838 747 650 452 442 76 --22507 2316 1497
NM_019035chr482096 1647 1607 1450 801 726 587 266 31710 741 135 --1404
NM_019041chr631888 578 422 1260 2528 93 1561
NM_019045chrX6938 848 259 199 116 26 --1785 1210
NM_019050chr431772 648 141 --42194 1922 1884 1455 --
NM_019067chrX94762 4750 4687 4490 3410 3376 1381 1093 90 11399 24674 3600 --
NM_019072chr5134004 3959 3854 3752 3696 3597 1106 1019 1005 876 870 318 202 2732 484 24212 1126 14130
NM_019080chr1381473 1343 1121 1004 538 466 378 21 ----11438
NM_019083chr151666 447 369 286 76 ----21383 174
NM_019084chr1052337 1788 1660 944 843 12534 2271 260 12283
NM_019087chr571656 1646 1560 1376 1124 276 153 --31285 665 426 --
NM_019094chr12103829 3497 3448 3022 2875 2712 1076 735 697 74 1387 33809 3087 183 2711 430
NM_019114chr962176 1929 1758 874 572 484 ----1188
NM_019116chr1693601 3499 2798 2353 1462 1418 1140 273 49 --32712 417 391 --
NM_019117chrX133449 3362 3308 2893 2481 1302 855 748 424 416 396 207 182 13497 61172 953 831 373 287 173 2703 334
NM_019590chr107920 547 438 318 309 242 122 --1531 --
NM_019593chr2092910 2381 1973 897 772 291 274 252 73 --1239 1687
NM_019610chr1122139 1968 1957 1932 1734 1706 877 857 583 351 205 177 --31916 1907 1392 --
NM_019885chr262909 2887 2799 2755 2732 815 22586 2411 12714 22769 1888
NM_019891chr161213 510 208 142 67 31 --2963 856 1924
NM_020116chr4111712 1620 1491 1187 1111 668 557 460 246 210 164 --2739 434 1331
NM_020119chr763033 2486 1509 1456 1200 883 13520 22842 1094 1788
NM_020122chr2135907 5809 5583 5483 5420 4237 4117 2400 2278 1934 1476 822 147 1330 25318 1823 25238 483
NM_020123chr101494 --21083 333 21241 586
NM_020147chr156956 913 816 352 306 190 --1299 21106 826
NM_020159chr481325 1257 343 290 208 93 61 37 --11747 --
NM_020177chr5123364 2681 2290 1249 1049 903 225 181 169 155 140 86 13132 --1133
NM_020198chr1741371 1343 560 60 11433 41583 1127 466 282 --
NM_020199chr551306 1110 1056 509 458 ----1220
NM_020228chr1162583 2567 2495 2167 1666 1007 --32310 1900 1602 1320
NM_020245chr674553 4349 3837 3380 1004 482 355 --23871 1655 11301
NM_020311chr23543 535 525 1656 ----
NM_020336chr20123843 3725 3653 3544 3234 3116 2358 1509 1193 1030 431 276 22376 576 33685 2950 813 1836
NM_020337chr4173183 3073 3018 2798 2577 2552 2541 2444 2302 2140 1066 687 559 531 418 352 68 --43160 2818 606 31 --
NM_020341chr2051731 1659 1529 1489 78 --21911 788 31869 1721 1713
NM_020342chr282553 2495 2220 1733 848 553 505 194 22276 1930 2396 372 --
NM_020346chr1191696 1577 1570 1305 1150 1071 634 438 96 ----11489
NM_020347chr3122258 2233 1850 756 649 589 583 448 400 128 113 39 --31802 1757 79 11836
NM_020357chr341411 1254 1236 611 11292 21115 198 11606
NM_020390chr3224888 4843 4633 4533 4223 4158 4090 4043 4002 3858 3823 3757 3751 3721 3614 3338 3244 1974 1635 883 809 223 41801 1380 1364 1252 34512 3550 1855 11577
NM_020403chr1351735 1399 1210 348 39 2491 432 11176 1465
NM_020425chr651488 814 483 213 100 21306 476 1330 --
NM_020432chr772218 2165 1842 1820 1681 1614 396 12131 52337 1936 1587 427 212 --
NM_020443chr176194 6054 1378 1321 1065 522 340 15113 21253 1073 --
NM_020453chr451605 1587 1358 807 108 1144 51920 1533 452 270 218 12021
NM_020455chr662331 2019 1881 793 635 390 11825 52280 2191 2050 1083 429 3830 710 95
NM_020456chr1362205 2185 686 608 103 89 --3588 384 200 --
NM_020466chr6114993 4853 4286 3957 3895 3783 1699 1412 1027 850 167 14191 33234 1993 1956 23530 871
NM_020473chrX112043 2008 1949 1746 1591 1543 1394 1326 479 220 138 1287 2324 32 --
NM_020638chr1242105 1930 1583 340 21973 511 11575 11612
NM_020640chr3102300 1794 1647 1638 1553 898 421 389 381 234 --22110 219 --
NM_020647chr852205 2163 2042 618 515 1904 31932 1510 894 11479
NM_020651chr251365 669 580 251 230 --2375 131 --
NM_020654chr391653 1509 1372 1281 1205 450 263 140 63 21185 130 31037 550 241 --
NM_020666chr55764 671 365 246 82 --2125 74 195
NM_020673chr20247705 7688 7328 6906 6884 6864 6775 6699 6129 5514 5409 5297 4791 4706 2966 2737 2719 2042 1783 1154 966 561 324 259 36938 5842 5394 67773 7212 7143 2539 1702 1417 15388
NM_020714chr1984368 4337 3634 3290 3202 2976 2954 1588 13005 1159 --
NM_020718chr1695941 5914 4359 4286 4278 4243 2491 1430 551 --76536 5644 2357 2285 1794 678 227 22249 1483
NM_020727chr2182930 2799 2780 2718 2535 1575 1204 816 23780 934 52759 753 536 196 82 --
NM_020734chr12133060 2952 2852 2713 2536 2482 2425 1270 910 825 724 421 365 1688 23176 986 --
NM_020738chr271611 1603 1505 1124 1101 174 141 11583 21257 373 --
NM_020739chr1584119 4033 3696 3204 1205 642 148 22 --23123 3022 23435 2652
NM_020742chrX132760 2744 2526 2372 2111 2068 1860 1720 1096 977 860 758 514 --1414 12079
NM_020748chr1772156 2068 2049 1958 1689 839 736 --12170 --
NM_020752chr10102943 2771 2317 2233 1068 1035 888 474 381 106 --42878 2491 551 74 --
NM_020766chrX63643 2852 1797 1556 1491 1453 --53934 3704 3415 3089 2830 --
NM_020771chr661253 1159 1001 535 527 200 31437 1086 1077 --11559
NM_020772chr17168574 8409 8177 7939 7466 6837 5523 2629 2488 2173 1743 1472 1176 888 475 138 21259 39 97971 6957 6824 6751 6066 5283 2069 975 841 13202
NM_020774chr18256237 6134 6110 6098 5793 5358 5103 4637 4538 4405 4351 4256 3978 3899 3859 1832 1779 1325 1266 1161 895 641 584 338 210 24023 4003 56279 5753 5579 5473 2428 14135
NM_020779chr252976 698 371 143 33 --53284 3073 731 541 289 --
NM_020783chr1872425 2353 2218 1637 706 656 327 --21961 271 --
NM_020792chr382772 2731 2528 2176 1778 667 197 64 1921 --22536 1112
NM_020794chr1101549 1521 1221 1075 1061 522 502 486 401 173 11345 21558 428 1107
NM_020800chr351352 1344 945 92 66 2573 488 1332 2313 220
NM_020801chr592244 2185 2072 1870 804 619 499 277 174 12489 22368 2015 --
NM_020802chr11123415 3314 2703 2248 2118 2105 1009 631 359 166 114 90 --2469 304 1218
NM_020805chr1871859 1616 1569 1555 1324 720 383 --11816 --
NM_020810chr1493249 3069 1381 1059 907 629 526 245 221 11096 32918 2323 256 --
NM_020841chr12183865 3778 3613 3166 2774 1331 1310 1219 1053 956 861 671 652 478 393 357 224 96 --43717 2975 2802 1246 13279
NM_020844chr8147695 7032 6997 6981 6680 6370 2968 2903 2744 2705 1950 1521 1063 1056 26389 5193 77329 5923 5229 4978 2785 2670 1788 27539 5774
NM_020858chr1582425 2123 2113 2035 1877 678 516 384 32185 2060 1475 11498 11972
NM_020866chr134886 788 419 324 ----21036 181
NM_020868chr271900 1573 1377 790 149 71 34 --3801 725 483 1537
NM_020871chrX92370 1997 1933 1005 955 733 358 144 82 11770 72291 1623 671 621 548 158 59 --
NM_020909chr284057 3761 3402 2867 2811 1457 622 35 --34210 2847 1630 --
NM_020918chr10103684 3591 3463 3306 2965 2885 2235 1296 797 299 22444 641 32722 2655 1315 --
NM_020935chr294110 3860 3149 3131 1413 993 920 447 266 21267 872 34095 3462 1536 --
NM_020940chr1092870 2836 2348 2213 1998 475 372 301 156 --32639 2166 273 --
NM_020948chr193208 3133 2904 2866 2794 2765 2634 1082 985 --52754 2278 2236 897 466 11478
NM_021007chr272482 2408 1544 1518 979 936 399 ----1737
NM_021032chr381996 1641 1626 1573 1492 732 568 531 --21936 1912 3808 324 274
NM_021033chr1383467 3454 2335 2158 1283 1122 661 168 22185 516 52872 2296 847 418 381 23220 2653
NM_021061chr874074 3964 3633 1430 1232 509 389 33424 371 280 14497 --
NM_021072chr5112632 2223 2076 1724 992 660 620 583 217 173 151 1887 12172 --
NM_021083chrX83491 3461 2885 2862 2579 1384 748 398 11296 13621 13517
NM_021090chr2284646 4565 3721 3627 2020 1881 1289 496 ------
NM_021097chr2112640 2422 1190 1182 1030 801 714 672 613 536 83 --22071 1963 12670
NM_021148chr7102147 2041 2004 1947 1822 1611 567 531 505 483 --42514 1662 457 118 42269 616 294 210
NM_021163chr7183871 3580 3140 3068 2969 2959 2914 2862 2637 1512 1387 1329 951 887 866 651 334 253 22430 489 33769 246 111 12404
NM_021167chr782237 2031 1861 1845 1808 1753 948 152 --12765 11106
NM_021176chr241232 432 209 193 31717 1501 1270 ----
NM_021183chrX72585 1020 988 781 762 697 309 12304 32467 1828 717 --
NM_021190chr161146 1083 984 849 529 395 --11109 --
NM_021238chr1241412 843 438 40 --31699 1564 1528 1734
NM_021239chr1451427 1368 1266 1022 348 --187 1307
NM_021249chr144504 471 433 146 11154 178 11126
NM_021255chr1483713 3168 3147 2975 2846 826 589 147 11559 22709 1493 --
NM_021622chr10132333 2262 2218 2197 2145 2075 1961 1784 826 402 283 217 175 --41517 659 441 242 22057 333
NM_021629chr3144958 4919 4768 3950 3875 3096 1652 1476 1102 1048 885 734 683 523 14592 44861 4385 3936 861 24154 1846
NM_021645chr1342428 2293 311 164 ----32336 2272 184
NM_021647chr4194432 4276 4169 4067 3957 3920 3683 3358 3234 1794 1551 1480 1431 1363 971 936 919 841 199 --11841 13305
NM_021649chr571818 1711 1694 1439 488 468 201 --41608 1500 445 318 --
NM_021813chr6115858 5156 5058 4556 4523 3920 2114 1066 757 557 453 11993 25721 962 24624 2095
NM_021815chr292847 2494 1240 1222 868 570 523 97 86 23118 2414 32784 2705 1978 12836
NM_021818chr1451531 1406 1398 570 452 11355 41259 487 405 45 1432
NM_021911chr5195630 5587 5268 5221 5171 4768 4078 3776 3749 3683 3601 3453 2223 2210 1498 1418 1013 799 330 --44898 4747 3985 1590 23965 419
NM_021912chr15133961 3422 3333 3294 2746 1587 1516 1266 1006 987 900 834 657 --23706 452 32947 355 52
NM_021914chr14102419 2409 2364 1883 1672 974 861 785 433 141 22461 1764 22352 2111 --
NM_021942chr45933 691 600 321 198 ----1164
NM_021943chr632157 240 230 ----12169
NM_021956chr671482 1289 1259 1228 948 183 79 --21340 395 --
NM_021961chr11166744 5822 5551 4735 2733 2503 1675 1647 1629 1606 1499 1116 772 463 375 361 --67445 6258 5075 4587 947 348 --
NM_021964chr3196238 6213 6198 6036 6009 5961 5909 5735 5620 5493 5117 4176 2612 2504 2242 840 651 317 175 --75561 5196 4860 4628 4037 1947 1610 --
NM_021977chr6133846 3777 3481 3358 3064 2985 2424 1554 1240 911 745 537 475 ----11222
NM_022041chr1662732 2626 2606 424 304 263 32521 2276 2124 12474 12467
NM_022048chr15195928 5602 5326 4322 4250 4127 4078 3977 2233 2178 1613 1526 1395 1085 984 894 878 786 549 12039 26356 5202 --
NM_022049chr151773 1598 1453 1365 431 11711 11509 11885
NM_022058chr291994 1930 1911 1547 1334 831 695 655 266 1508 52091 1685 556 330 30 --
NM_022079chr1031022 711 228 1183 3957 763 322 2155 40
NM_022121chr641174 1053 263 240 --2443 150 1853
NM_022136chr215464 222 188 165 64 --2629 94 --
NM_022145chr53656 276 234 --2467 250 185
NM_022154chr471291 1146 964 902 881 291 52 --11344 --
NM_022166chr1676238 5981 5832 5763 4950 2002 1131 15136 25904 5561 15747
NM_022351chr8173777 3720 3699 3236 3003 2760 2384 1268 948 885 710 664 309 289 211 202 61 --33142 1287 1056 --
NM_022444chr771790 1671 1644 1221 1201 344 309 ----21233 48
NM_022456chr12187681 7492 7343 7323 6565 6209 4889 2559 2385 1930 1847 1452 1361 1198 943 868 594 57 ----35569 2528 1045
NM_022458chr793068 3003 2672 2578 2126 1249 1016 235 59 --42239 840 264 80 --
NM_022459chr13146352 5703 5606 5376 5299 5115 5087 5007 3898 3875 1725 1214 656 368 24965 2290 46003 4838 4649 572 14577
NM_022461chr37924 531 489 473 387 360 221 ------
NM_022469chr153107 2900 2059 1272 552 1775 32916 1228 1065 --
NM_022474chr1472703 2097 1726 1036 704 425 259 32574 1830 1080 32176 614 366 22056 1113
NM_022483chr541939 1619 673 320 5775 622 396 217 64 --21609 1457
NM_022491chr1273232 3137 2905 2596 2207 658 212 --33410 3210 728 --
NM_022497chr393919 3775 3497 3375 3254 2895 2728 2377 399 --33743 3342 735 13882
NM_022716chr193155 3089 2929 2787 2757 2587 2004 1001 528 --52728 2397 2252 835 133 11091
NM_022726chr681775 1715 1536 1460 1453 1291 1186 1113 --1201 --
NM_022763chr362579 2410 2121 684 405 389 --21952 966 13143
NM_022787chr132415 2376 1875 --12452 22716 1853
NM_022817chr262055 892 784 598 219 200 11946 2644 531 --
NM_022826chr28948 929 870 791 393 286 64 34 1980 11203 --
NM_022828chr551785 1495 1293 375 30 --2284 165 11406
NM_022832chr452128 1881 1576 1567 307 --42175 1980 1716 407 --
NM_022836chr171843 1785 1695 1665 1332 332 28 --11744 --
NM_022841chr1592727 2716 2345 790 678 487 455 104 41 12183 62798 2448 1075 938 857 473 21890 594
NM_022843chr1361421 1407 502 464 439 184 1455 11543 11239
NM_022893chr292874 2816 2618 2172 2132 1957 796 721 422 12477 ----
NM_022897chr551098 954 799 285 110 --11073 1242
NM_022898chr1484848 3798 3281 3158 3084 856 461 398 --54696 4503 4095 1359 1338 --
NM_022900chr771169 1141 928 836 145 100 68 --41197 895 729 107 --
NM_022912chr2103093 2304 2267 925 798 758 669 595 458 182 --1606 --
NM_022977chrX32056 648 418 --42520 2004 839 299 1401
NM_023012chr124535 258 227 143 ----1724
NM_023016chr272510 2473 2427 2223 1988 1981 666 ------
NM_023073chr51860 11037 41265 1239 1077 167 1958
NM_023929chr862640 2399 1997 1884 1028 89 --32501 2331 254 --
NM_023934chrX71907 1610 1373 809 720 433 141 ----21701 736
NM_024052chr1782982 2849 2481 1178 1172 1044 991 133 --13043 --
NM_024332chrX71747 1577 1307 1278 1255 215 33 --11353 --
NM_024345chr9135885 5460 5412 4973 4890 4764 4691 4143 3930 2284 1161 383 218 33869 770 425 16145 21342 679
NM_024408chr1113750 3681 3629 3452 3434 3137 2755 1362 1083 450 27 13593 43217 2821 1037 312 --
NM_024416chr951399 1385 1192 1109 126 2226 93 41627 1304 392 214 11227
NM_024524chr3113177 2339 2015 1262 1200 1104 918 832 528 469 168 22805 334 32842 2096 1231 1238
NM_024539chrX71252 1221 1153 786 306 238 198 1132 31271 248 159 --
NM_024548chr3121750 1740 1567 1339 1280 1257 1223 1148 709 446 433 353 --11678 --
NM_024557chr1171685 1650 1624 587 569 476 363 1191 11380 11421
NM_024569chr172953 2885 662 535 496 453 94 --42305 1988 379 243 --
NM_024582chr461075 861 802 251 186 27 --11153 --
NM_024583chr24966 835 422 190 2828 24 1918 1320
NM_024613chr851835 1397 1142 748 215 --21881 682 --
NM_024624chr271649 1575 1479 1269 1058 344 143 11608 21278 1022 11048
NM_024645chr82413 21 1297 21603 105 136
NM_024646chr1103735 3367 3050 3026 2853 2725 2689 1438 1010 751 23394 1368 33772 1452 1395 --
NM_024665chr3144732 4309 3944 3768 3742 1851 1810 1779 1363 1097 309 289 249 131 --24183 577 --
NM_024692chr261721 1685 1536 1350 104 30 --31474 1318 1296 --
NM_024704chr2071058 973 908 711 702 421 118 11130 ----
NM_024713chr1581647 1480 1355 490 331 193 41 25 2507 292 1513 --
NM_024721chr872079 1923 832 492 435 429 225 --1513 --
NM_024744chr272509 2322 2055 1829 1754 1714 1044 --42196 1890 368 319 --
NM_024751chr4102107 2013 1975 1741 1708 1699 1536 554 533 171 196 11988 --
NM_024761chr995368 5002 4406 4233 4048 1692 1038 945 616 --65251 3565 3448 3416 1381 146 24637 3408
NM_024770chr2105980 5893 5823 5811 5780 5590 5103 4507 2312 325 36562 4953 605 65839 5707 5042 4129 1069 273 --
NM_024817chr15186008 5901 5810 5385 5349 5224 5096 4426 4034 3771 3663 3644 3638 1937 1876 1835 559 211 --25467 3745 25425 515
NM_024828chr971559 1343 1287 1230 1050 453 362 1402 ----
NM_024854chr12131502 1435 1343 1322 1134 1097 604 447 368 266 260 149 141 --21282 1195 --
NM_024881chr1973698 2650 2464 1479 935 542 364 23649 1469 11029 13725
NM_024899chr181587 --1635 2595 287
NM_024913chr771542 1427 1379 421 396 319 260 --3677 619 521 21586 250
NM_024920chr481354 1348 1312 1008 606 586 478 190 --1330 --
NM_024921chrX61406 1347 805 741 702 286 11431 11746 --
NM_024930chr562762 2663 2649 2394 914 344 1986 1273 --
NM_024941chr531511 193 95 11174 2353 142 1136
NM_024945chr94952 923 812 757 --2974 48 11188
NM_024947chr3399515 9504 9392 9080 8570 8552 8375 8015 7988 7823 7767 7732 7074 6979 6916 6910 6846 6777 6722 6640 6205 5984 3488 2878 2789 2502 2491 1708 1579 1261 1158 1075 956 859 802 625 509 496 144 79417 9174 7165 7125 6101 2970 987 99059 8661 7870 5797 1308 909 718 229 195 12124
NM_024949chr464770 3431 2014 1647 1304 1026 --24590 1985 14242
NM_024953chr1292781 2208 2072 641 393 349 342 292 156 1984 22825 2474 --
NM_024989chr2208118 7909 7626 7578 7144 7063 6684 6617 6492 6294 5266 3097 3067 1259 1144 704 675 634 174 125 78092 6210 6130 6062 1692 980 338 67042 5685 3266 2622 2526 361 47273 6027 2074 1066
NM_025054chr894164 3832 3156 1558 1269 1239 583 553 51 13878 34186 3594 1533 --
NM_025073chr1184417 4368 4288 3713 3640 3563 3531 3417 1514 1372 1224 1070 795 755 507 349 315 150 24450 1238 11351 --
NM_025126chr124552 532 485 51 --1163 1111
NM_025134chr16112588 2502 2449 2440 2247 2197 784 693 164 107 25 --22164 991 12141
NM_025146chr342728 2549 1037 523 --3471 349 282 12068
NM_025152chr1471843 1742 1508 1490 1230 612 536 140 11272 --
NM_025160chr1164163 4082 3421 3393 3321 3060 2816 1221 1186 1132 970 906 813 206 103 82 33280 842 600 44040 3529 3484 154 --
NM_025180chr3103419 3131 2890 2380 1371 974 408 389 253 84 --23264 3035 13477
NM_025191chr1103548 3437 3249 3103 2570 2531 2338 2287 285 66 1840 63557 3308 3281 3265 3209 2476 --
NM_025208chr11112442 2014 1939 1648 950 942 556 481 396 387 262 11972 22491 589 --
NM_025214chr1882544 2511 2139 1725 1032 455 399 148 --22450 796 --
NM_025222chr342860 2238 303 110 --43029 2942 530 518 12165
NM_025238chr1581626 1461 1251 1198 1083 531 97 58 --1577 --
NM_030621chr1494136 3872 2938 1661 1196 1035 1019 589 281 --54100 3451 2899 847 161 --
NM_030623chr251731 1541 609 176 92 --2541 82 --
NM_030625chr1082660 2581 2385 2312 1855 911 889 609 --22204 544 --
NM_030627chr5133935 3665 3645 3270 3039 2983 2827 2579 1545 1489 881 644 280 32687 1298 612 34132 3463 2656 1306
NM_030647chr7136015 5801 5214 5152 4041 2492 1769 1579 1539 1514 1193 832 416 45202 4812 2504 853 36209 4585 4188 --
NM_030648chr495618 5294 3519 3512 2239 2152 1197 890 231 1731 35548 4097 1143 --
NM_030650chr2143751 3683 3218 3106 2780 2773 1312 1162 1071 1027 866 323 283 144 33645 1270 761 33276 1386 727 --
NM_030660chr1421123 1098 143 21240 219 1188
NM_030664chr1052253 2019 725 388 50 --22186 549 --
NM_030674chr12115838 5266 4803 4574 4117 3778 2253 571 325 156 23 15473 24828 656 25887 4968
NM_030751chr1051798 1550 1286 599 447 21226 56 ----
NM_030751chr1051798 1550 1286 599 447 21226 56 ----
NM_030755chr14123025 2870 2847 1922 1214 1174 1113 1013 913 179 149 97 127 32285 725 360 --
NM_030763chrX7927 671 609 355 222 129 111 --4664 624 173 71 --
NM_030777chr20102467 2376 2329 2313 2115 2054 1884 778 424 279 --12268 12258
NM_030780chr871750 1595 1388 1330 1320 304 92 ------
NM_030806chr1179433 8964 8731 8457 7730 7360 6515 6506 3656 2126 2046 1120 1091 669 577 412 177 49301 2730 2565 1496 68196 3681 3647 2531 1281 754 28820 907
NM_030809chr1242509 1649 1588 583 42523 2187 854 245 12533 12174
NM_030816chr192958 2366 1469 1440 1420 450 340 324 209 1503 73451 3350 3115 2803 1117 1019 460 --
NM_030820chr62421 144 2670 210 3994 678 317 1936
NM_030881chr2292136 1998 1922 1871 1740 1610 858 243 222 ------
NM_030885chr392362 1893 1828 851 839 636 435 84 57 --21430 361 11574
NM_030918chr1135366 3820 3758 3751 3600 3480 1888 1182 773 460 426 117 35 15186 24535 1378 1955
NM_030945chr592690 2603 2559 2488 2326 2161 775 701 400 22425 74 42383 2029 965 290 32654 2415 1870
NM_030954chr84648 259 113 51 1199 2342 136 --
NM_030979chr134422 179 59 51 --1333 --
NM_031216chr1882161 1989 1822 872 553 382 376 221 22168 2043 3644 456 249 1565
NM_031217chr112485 75 --2538 228 1514
NM_031243chr762383 2201 1861 432 426 130 32393 2361 207 42288 2060 1489 313 --
NM_031271chr891732 1724 1618 1525 1325 140 114 76 31 21718 1417 51678 1570 1336 470 51 --
NM_031296chr482589 2582 2389 2307 2103 1109 279 235 --42442 2431 2325 2144 --
NM_031305chr481708 1265 1216 476 464 458 413 261 ----1138
NM_031362chr2142783 2767 2733 2723 2712 2689 2018 1772 725 660 502 401 169 26 12466 22836 254 22807 2573
NM_031365chr2162919 2903 2869 2859 2848 2825 2154 1908 1797 861 796 638 537 305 162 124 12602 22972 390 22943 2709
NM_031366chr2162919 2903 2869 2859 2848 2825 2154 1908 1797 861 796 638 537 305 162 124 12602 22972 390 22943 2709
NM_031371chr18999 586 536 412 379 324 301 85 --21393 1159 1558
NM_031371chr18999 586 536 412 379 324 301 85 --21393 1159 1558
NM_031411chr541863 1776 1452 951 --11911 12014
NM_031419chr391583 1319 1229 408 380 256 230 173 120 11331 1548 1317
NM_031427chr14105839 5371 4874 4685 4255 4014 3865 1938 960 397 25628 3695 33764 1194 365 24666 812
NM_031435chr12123316 3259 3159 3058 2857 2794 2742 2562 1257 1008 681 393 33342 2509 114 43522 3406 597 586 --
NM_031438chr561587 1456 1371 667 298 187 --21427 131 1356
NM_031442chrX143067 3043 2980 2817 2748 2742 2553 2393 2061 1245 897 624 365 213 12511 22095 768 --
NM_031461chr861523 1516 700 199 165 49 3530 174 78 61950 1936 885 665 343 229 --
NM_031468chr7138210 7550 6547 6278 6146 5861 5820 5800 5638 5577 1759 778 709 12041 15696 15042
NM_031469chr6103173 2529 1331 1231 1224 980 970 684 505 405 --22943 1380 13818
NM_031483chr20113042 2772 2534 2494 2488 2290 2192 2184 1298 350 287 --32625 2172 340 13497
NM_031844chr1104014 3703 3598 3254 3222 3148 2925 2752 1180 212 23810 1498 23117 90 14133
NM_031845chr283143 2554 2288 1472 1289 781 531 33 1834 43342 3310 2327 608 --
NM_031847chr283143 2554 2288 1472 1289 781 531 33 1834 43342 3310 2327 608 --
NM_031849chr541863 1776 1452 951 --11911 12014
NM_031857chr541863 1776 1452 951 --11911 12014
NM_031860chr541863 1776 1452 951 --11911 12014
NM_031911chr492759 2645 2505 2461 1845 1017 366 338 313 --41047 991 238 109 --
NM_032012chr9115173 4934 4844 4403 4366 4250 3743 3728 1956 1807 973 34703 3665 3611 35273 2055 1222 11788
NM_032047chr362048 1902 1772 1757 834 369 1921 42362 1677 827 110 --
NM_032102chr11122708 2695 2409 1963 1952 1943 1932 1130 885 407 396 358 --12971 --
NM_032105chr1148072 7782 7337 6784 6306 5296 4995 2747 2737 1858 1288 479 361 173 35355 4967 1932 ----
NM_032116chr13155577 5438 5097 4670 4657 4443 3959 3795 3718 2202 1649 1462 988 608 237 35493 3571 714 55302 4861 4741 4522 428 11817
NM_032121chrX72742 2608 2531 1068 975 965 246 --22254 1827 --
NM_032131chr63234 75 69 189 1158 --
NM_032144chr271660 1363 1235 1139 562 535 122 --11847 11510
NM_032145chr611246 11468 31937 1876 422 31686 1398 87
NM_032154chr1051086 943 699 276 109 --1967 1924
NM_032160chr18124115 3918 3596 3546 2978 2875 1697 1661 1237 858 716 659 --23519 3217 23459 3211
NM_032175chr561634 1601 329 298 191 173 11647 ----
NM_032177chr56470 167 137 95 79 46 --1358 --
NM_032189chr13114932 4870 4828 4454 3506 3314 3072 1580 1249 770 179 15004 21506 1283 --
NM_032199chr1093888 3526 3080 2953 2568 1457 989 862 153 --33595 3277 982 --
NM_032208chr263350 2658 1467 1121 925 794 23500 2968 22794 2414 --
NM_032228chr11103570 3391 2883 1008 581 542 324 238 150 26 22439 1000 43407 3372 2343 395 22667 97
NM_032256chr124915 886 865 110 --11057 1321
NM_032288chr351965 1862 1447 389 159 --32243 1724 97 --
NM_032289chr521933 639 ----11916
NM_032291chr1101980 1969 1841 1763 1401 1299 416 410 289 204 11958 11989 1623
NM_032303chr951384 1357 1321 618 183 11454 --1572
NM_032321chr283095 2701 2570 2513 2436 2175 2150 1211 1666 43296 3282 2562 1276 --
NM_032352chr1441248 928 462 92 --21427 268 --
NM_032373chr10175525 5478 5298 4761 4747 4628 4585 4271 2205 2133 1882 1576 1422 1317 820 612 294 2975 580 65773 5533 5188 3843 1412 604 24667 951
NM_032435chr152378 1939 1866 1565 1510 --3822 705 29 --
NM_032436chr133918 249 150 --3994 902 318 1370
NM_032439chr1071330 1312 544 355 287 99 51 11165 41041 584 558 385 --
NM_032440chr1072924 2804 2710 2302 2066 2021 2003 --12472 12736
NM_032445chr15102396 1806 1741 1652 478 409 333 317 283 42 1756 32322 1780 247 11749
NM_032446chr5183799 3635 3029 2993 2710 2481 2432 1379 1285 972 827 636 462 444 356 321 277 247 43376 3116 3058 753 53323 2568 1457 1008 540 11192
NM_032457chr4113934 3621 3175 2784 2533 1460 1431 1355 597 468 387 21407 1102 42848 1338 714 80 --
NM_032458chrX123181 2871 2704 2677 2606 1291 1053 729 700 662 372 296 22684 271 33329 3278 1075 --
NM_032471chr661081 950 938 426 381 101 --2892 74 --
NM_032505chr382588 2010 1998 1758 471 321 215 171 1926 12748 --
NM_032521chr2093032 2865 2553 2453 2337 2257 457 118 70 1135 12568 --
NM_032557chr46652 353 255 225 78 37 21016 849 21022 300 --
NM_032582chr1751551 1496 1283 316 63 ----21265 356
NM_032622chr42232 164 --3439 413 386 11388
NM_032664chr861520 1500 1390 413 77 70 11690 1212 --
NM_032679chr1961074 1041 350 302 242 115 1972 1337 --
NM_032682chr393378 3275 3265 2673 2346 1441 1100 794 350 --33569 2761 824 --
NM_032778chr3143314 3217 2996 2889 2720 2643 2622 2456 2327 828 744 704 415 119 --13251 --
NM_032804chr1032335 975 297 ----11002
NM_032832chr631721 1693 222 --31268 1258 177 --
NM_032833chr182689 2124 2069 1064 908 594 340 91 --32388 2048 165 --
NM_032842chr7101614 1606 1597 1590 1560 1085 1074 171 64 26 --21727 198 --
NM_032857chr15276 70 --1245 156
NM_032859chr1393956 3589 2585 2497 1571 1448 1439 787 486 21416 106 53919 3413 2774 2759 378 --
NM_032869chr8111965 1766 1688 1487 756 572 484 202 144 136 103 --42053 1930 1838 325 --
NM_032873chr11124213 3893 3235 1775 1487 1454 1038 851 786 595 490 391 13337 12794 11415
NM_032961chr451218 1188 1050 517 61 11394 1527 --
NM_032968chrX144054 3863 3737 3714 3303 3198 3105 2826 1699 1585 1443 1310 932 379 33455 433 316 13813 24037 1353
NM_032969chrX144054 3863 3737 3714 3303 3198 3105 2826 1699 1585 1443 1310 932 379 33455 433 316 13813 24037 1353
NM_032973chrY164136 4046 3855 3729 3706 3298 3193 3100 2821 1693 1584 1443 1310 932 820 379 23451 316 13805 24029 1353
NM_032975chr1833469 1021 837 1457 43396 1118 796 405 --
NM_032980chr1833469 1021 837 1457 43396 1118 796 405 --
NM_033014chr951399 1385 1192 1109 126 2226 93 41627 1304 392 214 11227
NM_033020chr1124436 4372 4266 4013 3401 2950 1917 1683 1525 1252 1191 1015 --43946 1936 1200 302 --
NM_033030chr21629 1478 11133 1641
NM_033058chr87959 929 898 882 870 735 293 2747 193 ----
NM_033081chr2031441 204 103 --11190 1119
NM_033117chr92374 119 --1283 2350 324
NM_033132chr1361922 1732 1600 1422 675 622 1404 22096 596 --
NM_033135chr11112442 2014 1939 1648 950 942 556 481 396 387 262 11972 22491 589 --
NM_033138chr782330 2249 2037 1927 1864 854 832 428 ------
NM_033139chr782330 2249 2037 1927 1864 854 832 428 ------
NM_033140chr782330 2249 2037 1927 1864 854 832 428 ------
NM_033143chr4214657 4608 4522 3671 3594 3292 3221 3188 3123 3036 3026 2978 1832 1775 1291 1187 1109 708 670 559 335 24317 1049 33833 1446 727 --
NM_033157chr782330 2249 2037 1927 1864 854 832 428 ------
NM_033181chr6153988 3921 3848 3684 3629 3013 2975 2550 2539 1490 1432 823 618 607 476 13659 33386 2652 704 --
NM_033196chr1971366 1274 1133 1000 965 447 395 --1218 1440
NM_033211chr541500 538 457 127 --3648 504 491 --
NM_033222chr961229 1107 1010 910 254 93 11128 --1159
NM_033224chr7157716 7041 6735 6532 6423 6266 3193 3115 2980 1920 1609 925 477 351 131 12264 46304 5848 1959 1389 13050
NM_033225chr822954 2440 13097 33216 2760 769 1745
NM_033281chr51124 ----2275 107
NM_033285chr8124394 4226 4100 3731 3298 3112 1505 1187 299 274 235 194 2481 475 34405 2795 310 22991 674
NM_033290chrX93387 3335 3058 2737 1115 1088 1063 971 251 1733 53559 3244 2910 1503 1447 --
NM_033326chr1192496 2406 1785 913 670 594 242 233 37 --22444 371 --
NM_033360chr1284611 4418 3104 3073 1482 1301 198 52 21061 211 23816 558 44527 1399 1355 713
NM_033389chr17134706 4053 3994 3152 3128 1489 1193 1094 728 709 595 100 72 13671 --13569
NM_033394chr261565 1458 1409 507 345 37 ----1250
NM_033425chr1163347 3155 2281 1126 927 132 12220 13205 13253
NM_033430chr4173904 3804 3759 3515 3419 2962 1607 1494 1346 1287 1249 1212 1196 1062 903 886 440 --22974 256 23061 588
NM_033437chr4173904 3804 3759 3515 3419 2962 1607 1494 1346 1287 1249 1212 1196 1062 903 886 440 --22974 256 23061 588
NM_033480chr662096 2082 2061 546 386 276 32481 1213 859 63031 3016 2939 2927 2549 423 12774
NM_033481chr662096 2082 2061 546 386 276 32481 1213 859 63031 3016 2939 2927 2549 423 12774
NM_033505chr2216495 6265 5946 5900 5764 5565 5448 4930 4844 4470 4339 4258 2370 2137 1974 1615 1123 847 708 576 209 35392 5347 5009 21897 52 --
NM_033624chr1262097 1751 1436 894 369 278 --22220 2189 1542
NM_033656chr21144820 4177 3921 2256 2056 2009 1558 1448 1138 738 288 272 207 187 31687 1467 315 45986 5854 1086 632 --
NM_052811chr13175281 5259 5179 4409 4237 4180 4063 3697 1934 1184 1129 1061 997 711 340 292 225 --45040 3573 3457 1847 14357
NM_052832chr8133039 2765 2745 2727 2469 2462 2206 731 685 663 476 367 260 22496 1910 --22691 494
NM_052860chr54713 263 253 188 2784 326 1639 1822
NM_052864chr432138 1673 27 12086 3879 633 625 22222 891
NM_052879chr12103864 2955 2706 2516 1617 1114 1006 662 350 215 23126 2598 32856 407 392 11425
NM_052885chr12144652 4403 4301 4235 3367 3359 3314 3021 1851 1580 1514 659 277 191 34437 1910 650 54581 3048 1809 1636 203 13208
NM_052905chr241787 1655 1622 1408 31839 746 719 21417 106 --
NM_052907chr12114178 4055 4040 4009 3939 3594 2872 1690 1549 532 416 --104332 4324 4237 4080 3012 2787 1206 864 836 294 --
NM_052917chr2103398 3375 3333 3083 2520 2249 2221 2077 572 433 --23179 661 52967 2213 534 384 73
NM_052918chr10133574 3316 3109 2477 1388 1316 1290 1191 1070 828 377 253 246 21091 565 1531 --
NM_052932chr11122237 1694 1541 994 890 832 517 510 494 192 145 84 1639 12210 --
NM_052965chr131233 1150 189 21140 823 --11160
NM_053016chr9187640 7482 7163 7009 6714 6496 6036 5640 5582 5004 2793 2076 1944 1740 1553 1499 1299 777 --1766 32089 1860 1223
NM_053025chr341513 1325 1271 1101 21402 603 2668 298 1594
NM_053026chr341513 1325 1271 1101 21402 603 2668 298 1594
NM_053027chr341513 1325 1271 1101 21402 603 2668 298 1594
NM_053028chr341513 1325 1271 1101 21402 603 2668 298 1594
NM_053031chr341513 1325 1271 1101 21402 603 2668 298 1594
NM_053032chr341513 1325 1271 1101 21402 603 2668 298 1594
NM_053043chr796150 5187 4458 4449 4391 2066 1101 883 393 24495 353 33973 1260 293 --
NM_053056chr1163160 2112 500 444 425 92 --21999 434 --
NM_053064chr14132890 2842 2741 2256 2168 2059 2031 1990 1130 1113 768 383 44 --22662 985 --
NM_057157chr103559 364 106 ----1145
NM_057168chr741591 1421 1186 1174 21732 396 31750 1533 532 1439
NM_057169chr1282813 2517 2295 1182 1092 820 490 427 --42313 686 367 98 --
NM_057170chr1282813 2517 2295 1182 1092 820 490 427 --42313 686 367 98 --
NM_057175chr492652 2282 2095 1850 1648 822 746 171 55 1180 --1344
NM_057180chr123418 117 103 --168 1458
NM_058170chr191622 1609 1572 1550 1318 1150 633 556 146 1486 31343 395 116 --
NM_058241chr272109 2090 1838 1824 1751 215 117 1262 1309 11588
NM_058241chr272109 2090 1838 1824 1751 215 117 1262 1309 11588
NM_078476chr651782 1750 1684 1439 408 ----1384
NM_078487chr9133338 3271 3209 2870 2675 2622 2481 2246 2190 2172 2075 1141 568 --12713 23305 3036
NM_080546chr991785 1700 1681 895 888 554 313 207 34 1613 42058 1999 1447 903 --
NM_080618chr2051146 850 435 166 64 11211 1266 1493
NM_080629chr161430 1418 498 322 305 38 1963 --11096
NM_080630chr161430 1418 498 322 305 38 1963 --11096
NM_080645chr652113 2065 1978 1800 1613 --22096 1549 1246
NM_080666chr1451090 576 547 130 76 --41262 1211 667 561 --
NM_080676chr2053019 2228 1302 868 597 --22889 545 12385
NM_080759chr1382422 1823 1660 998 892 819 712 630 11767 3958 653 55 22359 2211
NM_080760chr1382422 1823 1660 998 892 819 712 630 11767 3958 653 55 22359 2211
NM_080764chr2283292 3165 2545 2472 1073 1011 713 190 --1394 --
NM_080867chr14144554 1921 1793 1667 1547 1404 1269 1258 1054 778 672 450 351 51 --43891 2028 1513 410 1612
NM_080872chr863104 3016 2951 959 163 46 --23821 3467 --
NM_080874chr461775 1558 1494 426 133 79 1685 21475 1318 11784
NM_080921chr171176 1154 1127 948 876 846 117 --31007 890 155 --
NM_080927chr3113161 2955 2859 2455 2194 1329 1251 1133 1040 923 26 --1504 11228
NM_130387chr361280 981 780 321 302 205 ----21142 920
NM_130391chr982889 2456 2236 1223 1030 1010 692 453 --22441 2185 --
NM_130392chr982889 2456 2236 1223 1030 1010 692 453 --22441 2185 --
NM_130393chr982889 2456 2236 1223 1030 1010 692 453 --22441 2185 --
NM_130434chr151379 11071 2899 785 1274
NM_130435chr1092690 2681 1904 1007 606 438 243 217 163 2235 84 31023 901 21 --
NM_130446chr394364 4309 4033 3908 3615 1010 972 238 231 --14262 --
NM_130809chr5103138 3130 3048 3004 2546 675 639 391 366 238 --1306 2950 355
NM_130831chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_130832chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_130833chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_130834chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_130835chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_130836chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_130837chr392724 2473 2099 1949 1063 1018 589 105 52 21842 850 32918 1041 859 --
NM_130838chr1541208 387 311 74 --21379 421 11219
NM_130839chr1541208 387 311 74 --21379 421 11219
NM_130847chr11155844 5663 5530 5395 5124 4751 4583 4482 2282 2154 2077 1411 1022 742 513 --15782 --
NM_133330chr453217 2910 2512 2281 789 --23275 2273 --
NM_133331chr453217 2910 2512 2281 789 --23275 2273 --
NM_133334chr4166368 6302 6280 6106 5189 4572 4563 4408 2229 1787 1716 1618 917 904 379 63 --35376 4195 2023 --
NM_133335chr453217 2910 2512 2281 789 --23275 2273 --
NM_133370chr4123654 3076 3002 2806 2744 2584 2547 2473 1315 1015 847 152 22369 570 33426 580 438 22251 1307
NM_133372chr572721 973 878 717 637 623 141 1293 22660 246 2815 678
NM_133473chr1961802 1382 678 399 360 73 --31959 651 33 31289 754 27
NM_133474chr4111369 1350 1273 1122 497 413 405 360 211 46 37 --11094 1459
NM_133477chr463249 3210 2875 1165 839 448 22307 240 43091 2714 2403 501 12346
NM_133478chr282474 629 569 534 450 156 56 36 ----1407
NM_133493chr6114210 4086 3528 3279 3247 2954 2881 1747 1548 1227 35 23857 1026 23163 3018 23373 350
NM_133496chr1134499 4475 3995 3828 3801 3374 3219 2863 2775 1497 1259 1106 1022 --22792 67 14351
NM_133503chr124724 562 294 281 --1596 1786
NM_133504chr124724 562 294 281 --1596 1786
NM_133505chr124724 562 294 281 --1596 1786
NM_133506chr124724 562 294 281 --1596 1786
NM_133638chr571269 1103 949 542 473 343 140 --21023 174 21062 87
NM_133646chr2105401 5021 4963 4953 4103 3529 2059 1998 1101 291 13735 45605 5281 3480 1448 24798 1136
NM_133647chr1593505 2901 2648 996 842 798 617 591 562 33623 1091 361 31245 496 204 23700 2424
NM_134265chr174480 231 199 190 --11028 1160
NM_134442chr241206 1178 702 515 --41231 633 93 77 --
NM_134470chr34686 605 131 27 2581 469 2284 166 2501 481
NM_138270chrX83472 3424 3032 2761 903 645 592 179 --43334 2536 2114 1341 --
NM_138286chr19264288 4152 4117 4047 4041 3731 3579 3560 3460 3156 3132 3110 3019 3006 2840 1755 1615 1489 1053 1019 862 598 563 334 284 170 43677 1670 957 723 83905 3872 3683 3067 2933 574 490 145 21521 247
NM_138288chr1462198 2012 1842 1615 643 228 2734 287 1660 --
NM_138333chr962297 1883 869 342 234 200 --42420 2412 944 644 12273
NM_138357chr1061819 1789 464 454 418 213 --21199 63 --
NM_138426chr782030 1797 1573 717 600 220 203 59 12067 2904 571 12229
NM_138444chr1394806 4533 3944 3784 3267 1555 1139 1119 1051 --44985 3446 1994 1412 13838
NM_138459chr663095 2929 1456 1274 1122 826 12537 52956 989 957 794 473 11165
NM_138468chr2146066 5383 5065 4810 4554 4395 4156 4121 3842 2244 1209 1025 870 37 36334 5452 1962 56038 1911 1770 1662 1347 34341 244 220
NM_138473chr12104718 4590 3932 3445 1320 1231 367 245 80 26 11769 33906 3383 1622 34099 208 104
NM_138494chr782707 2516 2506 2483 2402 2266 753 428 --22370 1015 --
NM_138554chr982689 2364 2288 2203 2045 970 828 712 --1312 --
NM_138576chr1484848 3798 3281 3158 3084 856 461 398 --54696 4503 4095 1359 1338 --
NM_138621chr264061 3858 3843 3796 2591 229 --62860 2797 1659 883 665 37 --
NM_138633chr681793 1689 1670 1416 1357 1168 1093 590 ------
NM_138638chr14102419 2409 2364 1883 1672 974 861 785 433 141 22461 1764 22352 2111 --
NM_138694chr673367 3128 3027 2996 2444 1116 463 --63723 3038 2734 2692 442 338 13453
NM_138713chr16178238 7094 6667 6625 6270 6040 5790 5417 5003 3184 2499 2397 2029 1144 541 300 96 26136 1344 47604 7453 6057 5376 18210
NM_138714chr16178238 7094 6667 6625 6270 6040 5790 5417 5003 3184 2499 2397 2029 1144 541 300 96 26136 1344 47604 7453 6057 5376 18210
NM_138731chr14164244 4143 3721 3289 3128 2877 2851 1617 1565 924 899 719 547 484 317 200 13268 53786 3777 3314 3141 387 11646
NM_138771chr781579 1540 1392 1376 1099 1090 506 325 1996 11402 --
NM_138782chr572417 1947 1541 564 440 215 110 --62360 1659 1487 909 877 661 22002 135
NM_138786chr34325 300 83 33 1316 --153
NM_138959chr1166838 6576 5979 5940 5664 5461 4625 4225 2691 2600 2379 1711 1678 1528 792 43 14862 22205 1892 15599
NM_138971chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_138971chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_138972chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_138972chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_138973chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_138973chr1193802 3460 3381 2725 1261 1115 1103 927 513 21326 1282 23853 3024 --
NM_139012chr662042 1608 1577 1464 599 340 ----175
NM_139035chrX2780 715 157 1660 1701
NM_139057chr159994 888 715 572 392 376 339 303 123 --32874 2513 1915 --
NM_139076chr471383 1138 1109 923 569 439 182 --157 --
NM_139136chr1241040 955 729 24 ----1720
NM_139182chr481702 1642 1342 713 667 156 147 41 --31661 1258 247 21884 1314
NM_139281chr5113618 3477 3251 2629 2324 1428 1336 1247 972 896 592 --22885 2638 --
NM_139319chr1261809 1778 1671 1633 1451 1365 --61424 1267 707 631 312 99 1145
NM_144563chr23755 203 197 --2275 225 --
NM_144563chr23755 203 197 --2275 225 --
NM_144567chr172690 2269 2164 1045 724 621 286 12237 1189 12124
NM_144571chr4196957 6806 5892 5648 5498 5107 5050 5001 4985 4979 4954 2756 2267 2241 2053 1909 1720 1590 268 12101 56902 4537 2405 2195 1089 --
NM_144578chr14154697 4314 4165 4049 3951 3733 2036 1660 1450 1332 1096 1061 1021 456 196 14268 23933 1545 --
NM_144583chr24704 646 554 515 --41257 615 537 385 --
NM_144599chr15255502 5359 5154 4958 4885 4550 4435 4381 3807 3334 2185 1976 1872 1801 1288 1109 1029 868 760 752 605 471 461 280 195 22033 307 54461 1314 828 565 298 --
NM_144628chr2073104 3003 2921 2776 879 713 377 --12257 12204
NM_144632chr262179 1934 890 767 756 262 --21636 783 1967
NM_144662chr188832 772 630 617 600 356 299 174 1101 1943 --
NM_144664chr11102583 2557 2474 2441 2384 1843 1691 580 153 21 52108 2069 2059 2053 567 2172 93 --
NM_144684chr19103051 2823 2539 2533 2523 2416 2293 1948 942 559 2746 268 22858 1013 --
NM_144689chr193525 252 159 1266 --2453 185
NM_144775chr1794850 4580 4027 3979 3715 1867 959 588 379 --24894 4840 --
NM_144778chr13162731 2627 2491 2291 2241 2168 2145 2049 1979 980 429 384 316 295 258 190 2681 413 52776 2601 2024 1917 54 12391
NM_144949chr242392 1596 340 164 12440 1225 22480 2068
NM_144963chr8122503 2367 2354 2342 1825 1772 929 550 472 350 137 84 32654 122 55 22308 2131 1876
NM_144973chr12145331 5232 4430 4380 4298 3838 3628 3281 675 375 367 285 226 106 14353 35083 4338 1037 --
NM_145049chr571093 1042 991 928 904 835 206 --1227 --
NM_145176chr6153320 3085 2721 2707 2262 2223 1393 1284 1214 1013 1006 687 641 615 322 13463 22680 2465 33354 775 652
NM_145251chr1461253 1234 1022 154 126 87 --11354 21094 508
NM_145259chr2297114 6815 6701 6508 6499 6465 6137 6127 5780 5755 5486 5242 2808 2696 2662 2463 2375 2168 1775 1410 1381 1293 990 924 907 401 388 262 165 36967 1306 954 41104 997 485 368 16239
NM_145307chr10154601 4332 4041 4003 3711 3521 3375 2929 1771 976 841 670 468 364 95 44069 1698 651 570 54482 4366 1850 143 23 1314
NM_145320chr7123371 2858 2331 2299 2268 1295 897 732 530 458 218 124 21321 26 1628 --
NM_145321chr7123371 2858 2331 2299 2268 1295 897 732 530 458 218 124 21321 26 1628 --
NM_145322chr7123371 2858 2331 2299 2268 1295 897 732 530 458 218 124 21321 26 1628 --
NM_145341chr1081902 735 640 575 524 238 126 39 11781 ----
NM_145698chr1061834 1730 828 656 194 179 1276 11533 --
NM_145753chr381656 1643 1526 1234 1058 452 427 264 21268 389 ----
NM_145808chr7102914 2830 2796 2666 2229 1109 945 773 301 253 --11249 --
NM_147166chr77783 748 642 564 526 347 333 --1677 1822
NM_147175chrX82127 2076 1443 569 460 439 321 229 --31983 592 409 --
NM_147189chr832193 1701 475 21999 751 21746 616 11538
NM_147223chr282481 2214 2104 1687 736 302 239 221 ----11937
NM_147233chr292298 2031 1921 1504 891 553 119 56 38 ----11754
NM_148174chr892121 2089 1943 1633 1582 789 438 256 59 ------
NM_148571chr1731429 526 21 2846 811 168 3723 562 308
NM_148955chr15156333 6169 5541 4816 4623 4476 2636 2231 2173 1972 1589 928 634 329 275 --46150 1607 1366 377 12009
NM_152227chr204733 582 148 50 --2565 124 1173
NM_152233chr144504 471 433 146 11154 178 11126
NM_152263chr175284 4657 2107 1965 936 929 348 --25298 4767 14316
NM_152265chr191506 1376 1353 1337 553 207 146 83 74 --1114 --
NM_152270chr1761900 1883 1508 703 477 418 21730 658 21467 1431 11454
NM_152291chr47863 801 698 442 434 394 288 --1875 --
NM_152309chr1062242 2201 1867 1508 1438 866 --32114 2046 1549 --
NM_152330chr14102425 2221 2135 2105 1771 1718 1659 284 127 107 --22092 801 --
NM_152332chr1492914 2821 2752 2571 2008 1821 1767 567 37 11054 2933 717 12327
NM_152375chr162658 2533 1817 996 640 442 --12008 12619
NM_152388chr283782 3592 3133 2827 435 362 345 125 52854 1570 1148 196 137 --1181
NM_152400chr4102088 2018 1745 1619 1350 655 633 574 545 29 --62072 1860 1460 820 476 373 --
NM_152402chr42641 279 --1145 2718 664
NM_152407chr533229 396 240 12131 33261 2987 1264 --
NM_152409chr5153560 3473 3457 3389 3379 3324 2840 2401 1444 1433 1406 1252 1019 767 467 --32319 895 815 11398
NM_152422chr96583 503 308 268 174 21 1255 11443 --
NM_152437chr1252158 1950 645 549 112 22282 2117 190 12445
NM_152448chr154579 521 393 176 --2534 210 147
NM_152515chr23913 859 242 1938 2266 58 --
NM_152519chr262236 2150 1671 592 454 435 12002 21841 802 22117 1602
NM_152529chr264229 4066 3789 2759 2705 1755 1951 43814 3772 2926 2808 14392
NM_152538chr341559 650 581 490 11691 31827 742 373 --
NM_152551chr692842 2793 2772 858 577 493 321 300 162 1811 42194 2081 1002 467 12829
NM_152594chr1592283 2261 1861 1778 1726 1565 1443 626 268 --11693 1872
NM_152622chr5123430 3291 3275 3088 3030 2519 2414 2358 1251 1000 552 493 13461 33199 3021 1199 --
NM_152624chr5127415 6705 6396 5917 5612 4678 2982 2799 2792 2114 1751 848 1458 67031 6964 4881 2247 1038 127 16129
NM_152626chr741114 329 279 46 21080 371 31208 1143 212 1458
NM_152629chr954100 1412 1293 1056 483 --43289 2956 2860 726 12946
NM_152636chr1192690 1987 1940 689 601 594 309 262 34 ----1985
NM_152641chr1232390 2222 337 12013 41905 1019 621 379 2694 373
NM_152678chr352035 618 390 57 48 12608 --21093 770
NM_152687chr581240 1164 1144 1137 854 428 414 325 1142 141 1449
NM_152695chrX122309 2228 2142 2043 1903 1726 1689 1459 788 296 289 110 --21513 1468 --
NM_152707chr1031033 899 207 180 2919 220 2194 57
NM_152723chr1161121 1062 932 888 717 448 160 145 11024
NM_152724chr1042070 1775 1743 753 22166 222 31887 1840 875 12758
NM_152737chr642089 1870 1740 1294 21476 111 21483 1440 --
NM_152754chr7123865 3282 2651 2527 2392 2341 1466 1254 1037 786 596 365 11456 63632 3403 1127 1073 765 47 12405
NM_152756chr5154333 4196 3836 3815 3800 3625 3557 3441 3374 2906 2788 1508 1379 1228 317 22925 1425 34125 1577 762 2983 886
NM_152758chr8112464 2145 2049 1969 1209 1005 936 916 629 591 568 11158 12265 12411
NM_152774chr7162626 2586 2291 2190 2094 2081 1663 1085 955 751 744 650 542 501 369 139 --32392 471 197 --
NM_152793chr7164523 4507 4435 4407 3510 1470 1110 923 838 713 671 471 393 311 160 78 11961 23174 787 --
NM_152826chr15156333 6169 5541 4816 4623 4476 2636 2231 2173 1972 1589 928 634 329 275 --46150 1607 1366 377 12009
NM_152835chr172873 2541 1978 1892 816 402 298 163 22502 320 --
NM_152838chr2073474 3064 3010 2881 2717 640 139 22702 2567 32867 2186 181 13134
NM_152890chr121254 267 --1107 21210 1185
NM_152903chr13102676 2625 2347 2279 2077 1872 474 394 82 73 --22449 1927 --
NM_152996chr161909 1707 1601 1362 726 517 --2849 782 11926
NM_152999chr7133236 3156 3121 1745 1565 1517 1332 1221 1089 741 629 618 498 13143 84964 4906 4245 3652 3595 3478 3216 3075 11265
NM_153013chr5112489 2405 2277 2133 904 852 779 505 481 81 42 --4842 816 310 171 --
NM_153018chr172619 73 22842 698 33343 2634 187 2566 450
NM_153050chr2284646 4565 3721 3627 2020 1881 1289 496 ------
NM_153051chr2284646 4565 3721 3627 2020 1881 1289 496 ------
NM_153182chr3143314 3217 2996 2889 2720 2643 2622 2456 2327 828 744 704 415 119 --13251 --
NM_153184chr392009 1954 1652 1494 615 530 514 203 164 --41880 1627 1544 762 --
NM_153188chr5175443 5334 5293 5242 5066 4529 4371 4274 3912 3611 2282 2162 1426 1107 1064 647 236 65317 4658 4461 2253 781 328 45592 4204 3763 204 --
NM_153207chr12184121 4000 3978 3741 3725 3619 3521 3081 2568 2492 1569 1437 1329 1193 1080 1026 737 145 --43667 2994 472 164 11558
NM_153235chr652242 2039 614 512 247 11895 42090 1944 1921 123 11862
NM_153262chr1113091 2946 2623 2452 2337 1234 1089 992 403 217 178 158 12521 --
NM_153332chr873247 2565 2443 2323 1116 629 350 33021 2398 2220 32110 1256 108 --
NM_153346chrX51601 1560 1518 1502 505 1284 32065 1978 1342 --
NM_153354chr510900 850 677 628 321 275 176 113 50 22 --2884 763 --
NM_153365chr492787 2503 2216 2041 1817 584 568 480 80 --32803 2274 94 2466 446
NM_153367chr1093979 3626 3287 3101 2955 2727 2557 1218 183 13002 22985 2869 --
NM_153371chr1362067 1771 1666 1511 852 788 11530 12317 --
NM_153456chr13185983 5141 5071 4991 4474 4107 4089 3912 1781 1393 1100 1051 911 870 843 741 728 194 16249 63842 2488 2238 2006 1614 458 16341
NM_153605chr381650 1581 1181 1043 481 405 305 126 --1179 1216
NM_153607chr552936 637 590 524 152 193 3366 286 103 11114
NM_153616chr1582425 2123 2113 2035 1877 678 516 384 32185 2060 1475 11498 11972
NM_153617chr1582425 2123 2113 2035 1877 678 516 384 32185 2060 1475 11498 11972
NM_153618chr1582425 2123 2113 2035 1877 678 516 384 32185 2060 1475 11498 11972
NM_153619chr15103663 3361 3351 3273 3115 2362 715 671 212 82 33423 3298 2713 22736 584 13210
NM_153634chr1271678 1435 1407 1310 1028 175 150 --31594 1181 332 --
NM_153645chr2292905 2823 2626 2501 2044 1153 1040 949 92 ----12355
NM_153686chr452202 2010 1611 926 772 31801 463 128 21673 64 11591
NM_153689chr282177 2018 1797 1621 608 371 288 41 --62160 1974 1934 1573 843 405 --
NM_153712chr2123570 3435 3196 3111 3033 3018 1440 751 701 684 673 473 --32926 1383 852 --
NM_153748chr1241040 955 729 24 ----1720
NM_153757chr491236 970 853 499 465 429 210 201 129 ----1809
NM_153810chr10143848 3835 3507 3476 2045 1976 1944 1761 1726 1673 1360 820 331 266 44743 3973 1069 516 45108 4610 3779 187 --
NM_170665chr12124590 4262 4255 3773 3207 1688 1156 1083 904 788 261 97 --64465 834 774 681 322 240 --
NM_170709chr852342 2143 2025 523 84 1255 42205 2066 1978 491 --
NM_170710chr4143111 3041 2930 2885 2805 2766 2732 2601 2229 374 338 314 277 163 2508 63 42659 2648 331 243 23222 552
NM_170731chr1172909 2885 2749 1768 1071 988 271 --2929 394 12279
NM_170732chr1172909 2885 2749 1768 1071 988 271 --2929 394 12279
NM_170733chr1172909 2885 2749 1768 1071 988 271 --2929 394 12279
NM_170734chr1172909 2885 2749 1768 1071 988 271 --2929 394 12279
NM_170735chr1172909 2885 2749 1768 1071 988 271 --2929 394 12279
NM_172069chr2112335 1816 1785 1556 1480 720 682 476 332 184 21 1584 22194 159 1172
NM_172070chr272233 1432 804 481 402 354 117 31408 1385 201 --21886 1548
NM_172071chr197480 7437 7095 6507 5517 1962 1267 972 639 12165 46428 6309 5114 1175 --
NM_172159chr362259 2195 2059 1936 1921 483 11545 31841 950 663 12203
NM_172160chr362259 2195 2059 1936 1921 483 11545 31841 950 663 12203
NM_172178chr1281100 538 467 413 397 280 163 108 1920 21433 521 --
NM_172193chr1431169 444 356 21109 940 41285 1154 514 223 1479
NM_173060chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_173061chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_173063chr582008 1929 1863 1756 1709 531 282 144 --32056 438 154 --
NM_173075chr491583 1446 1365 1340 1294 701 432 190 147 31409 1157 266 1256 --
NM_173082chr63560 191 122 --31605 520 356 --
NM_173083chr191311 1045 899 523 273 265 216 164 35 21031 178 1250 --
NM_173198chr9122930 2821 2318 2302 2283 2218 2205 1921 1206 993 568 450 ----12294
NM_173200chr9122930 2821 2318 2302 2283 2218 2205 1921 1206 993 568 450 ----12294
NM_173214chr16178238 7094 6667 6625 6270 6040 5790 5417 5003 3184 2499 2397 2029 1144 541 300 96 26136 1344 47604 7453 6057 5376 18210
NM_173359chr311692 11495 51884 1681 1475 735 617 --
NM_173468chr4165691 5212 4959 4605 4416 4169 2377 2230 1787 1777 1536 1512 1153 586 415 273 45286 5239 4626 450 66025 4345 3989 3893 1242 596 21416 1104
NM_173470chrX92564 2495 2014 1985 1825 1175 946 661 48 --22764 2180 --
NM_173473chr1052451 556 514 411 405 12725 2488 364 --
NM_173475chr1681803 1521 1354 1328 1305 1131 618 226 1404 ----
NM_173496chr1092759 2616 2532 2104 2057 2051 882 656 200 --11101 --
NM_173510chr2262014 1168 823 776 607 339 --22700 2530 --
NM_173511chr273876 3740 3399 2769 1155 675 458 --23841 733 12802
NM_173519chr842026 1657 1578 1274 11376 21523 1297 --
NM_173531chr19203892 3790 3706 3027 2930 1496 1271 1181 1088 844 821 763 556 519 505 482 407 213 130 46 21237 1145 42625 928 397 380 21459 1175
NM_173536chr4215105 4943 4852 4668 4404 3839 3764 3543 3312 1850 1818 1697 1590 1203 1122 1002 988 905 760 386 344 1631 44805 3463 1911 896 24369 794
NM_173552chr352439 2239 1526 739 278 11601 52377 2362 2262 2042 1827 3910 621 163
NM_173576chr10102149 1843 1645 1519 828 608 480 231 158 130 --11570 1195
NM_173582chr11145787 5748 5408 5401 5089 4431 2476 2225 1990 1073 650 536 283 85 ------
NM_173602chr1263532 2865 2634 661 209 199 --53809 1495 1401 636 536 --
NM_173631chr1971157 1108 967 953 939 850 390 2360 192 1223 --
NM_173642chr1219243 8953 8079 7922 7450 7192 7169 6987 6115 6006 2472 1665 1289 1241 1137 596 558 374 187 128 22 29114 8265 27104 5634 --
NM_173648chr26903 824 356 314 254 78 --1724 --
NM_173654chr392120 2028 1838 1763 1731 946 937 246 122 --32002 1712 804 --
NM_173694chrX52185 928 607 78 45 12472 32297 763 200 --
NM_173698chrX71652 1528 1516 724 390 335 318 21592 740 31777 1311 821 --
NM_173797chr571372 1200 1145 260 229 162 133 --11112 --
NM_173808chr1164410 4368 4039 3714 3662 3634 3284 3212 3029 1210 1131 856 630 498 472 350 21502 1043 43972 1225 391 301 --
NM_173812chr1281551 1435 1422 1357 1336 1302 1101 1094 --31539 1485 1071 --
NM_173822chr281911 1856 1840 1625 1369 617 530 47 12184 22049 91 11400
NM_173825chr372741 2039 2031 1229 622 393 247 1887 32774 2360 802 --
NM_173826chr371684 1644 1255 635 625 533 435 11380 158 --
NM_173829chr5156154 5784 5273 4704 4482 4355 4255 4224 3988 1320 1313 1013 609 463 50 25723 4841 65831 2478 2151 1782 1190 121 11924
NM_173851chr8113624 3381 3299 3027 2796 2483 1322 1000 899 534 49 --3887 760 669 1409
NM_175052chr59922 899 888 879 777 763 673 281 136 2367 167 21020 106 1976
NM_175056chr352112 1729 1456 279 103 11804 1247 1375
NM_175607chr341348 221 85 45 --41725 1513 1333 397 --
NM_175612chr341348 221 85 45 --41725 1513 1333 397 --
NM_175623chr12187681 7492 7343 7323 6565 6209 4889 2559 2385 1930 1847 1452 1361 1198 943 868 594 57 ----35569 2528 1045
NM_175624chr12187776 7587 7438 7418 6660 6304 4984 2654 2480 2025 1942 1547 1456 1293 1038 963 689 152 ----35664 2623 1140
NM_175625chr12187776 7587 7438 7418 6660 6304 4984 2654 2480 2025 1942 1547 1456 1293 1038 963 689 152 ----35664 2623 1140
NM_175736chr1287191 6713 5934 5516 5242 4978 4895 479 --47272 6932 5081 1164 16832
NM_175768chr691686 1493 1463 1432 1152 1145 387 283 108 --21544 599 --
NM_175854chr1362579 2564 1965 1921 596 375 21725 461 32628 2261 744 11792
NM_175861chr12225995 5704 5589 5324 5160 5128 4900 4859 4750 4716 4678 4589 4577 1922 1552 1199 1146 1053 931 901 800 239 11093 55032 3879 1238 408 336 24886 4811
NM_175876chr162441 2032 2022 936 281 203 --42455 1812 861 702 --
NM_175884chr741291 1246 1228 491 1955 --21060 374
NM_175907chr1862402 2366 2281 2167 529 102 32883 2081 1962 ----
NM_176814chr781335 1173 1117 1097 973 427 358 80 --51306 530 514 129 117 --
NM_176823chr193404 3036 2971 2518 1330 1316 1185 736 194 23825 3158 23276 1160 --
NM_176824chr481371 1278 1182 1083 922 484 345 307 1862 1121 --
NM_177414chr141694 1576 1564 1145 --21597 1544 31646 1435 1412
NM_177438chr1494136 3872 2938 1661 1196 1035 1019 589 281 --54100 3451 2899 847 161 --
NM_177531chr851174 172 98 85 36 --41036 990 358 110 --
NM_177538chr2148726 8136 8052 7017 6064 5471 2583 2293 2213 1837 1322 1298 1114 377 15742 58861 8208 7741 1195 514 15690
NM_177553chr112807 599 1279 4939 791 388 320 --
NM_177947chrX61714 1428 1220 461 428 200 --21447 239 --
NM_177948chrX61714 1428 1220 461 428 200 --21447 239 --
NM_177968chr261677 387 320 191 139 109 21840 623 21865 90 --
NM_177985chr2132127 2036 1710 1703 1697 1653 1400 741 694 688 411 257 228 --1296 22160 1862
NM_177990chr2051731 1659 1529 1489 78 --21911 788 31869 1721 1713
NM_177995chr96583 503 308 268 174 21 1255 11443 --
NM_178011chr1082745 1267 1199 1139 857 846 533 162 --22417 1126 13237
NM_178151chrX127771 7158 7032 5976 5945 5594 4878 2660 2058 1570 1300 243 11343 66343 6298 2676 1867 1231 666 --
NM_178152chrX127771 7158 7032 5976 5945 5594 4878 2660 2058 1570 1300 243 11343 66343 6298 2676 1867 1231 666 --
NM_178153chrX127771 7158 7032 5976 5945 5594 4878 2660 2058 1570 1300 243 11343 66343 6298 2676 1867 1231 666 --
NM_178424chr54648 434 200 44 --3600 581 33 --
NM_178426chr182139 2131 1812 884 831 820 613 276 --22011 533 --
NM_178427chr182039 2031 1712 784 731 720 513 176 --21911 433 1894
NM_178498chr1183961 3913 3137 3007 1386 854 399 363 13724 53734 2887 2714 1356 863 33765 3353 612
NM_178505chr10123592 3411 3390 3074 2674 2659 2418 2387 2251 1329 976 750 12813 21430 710 12332
NM_178509chr17114125 4068 3991 3940 3055 2959 1156 841 481 376 97 13904 12563 11068
NM_178539chr12102057 2043 1589 1521 1340 583 455 180 45 39 ------
NM_178566chr981735 1687 1555 1438 1271 1194 506 204 --21288 743 --
NM_178585chr462684 1224 975 933 868 558 --22884 755 1584
NM_178815chr10112790 2434 2422 1948 1793 1776 1001 678 446 152 48 12074 42187 739 707 315 --
NM_180989chr1342427 1782 387 192 12495 32202 875 296 --
NM_181077chr1562111 1542 1436 892 534 217 --12102 12061
NM_181265chr4143111 3041 2930 2885 2805 2766 2732 2601 2229 374 338 314 277 163 2508 63 42659 2648 331 243 23222 552
NM_181332chrX132760 2744 2526 2372 2111 2068 1860 1720 1096 977 860 758 514 --1414 12079
NM_181354chr851605 1453 550 448 258 --31374 1257 57 --
NM_181358chr184161 2666 1286 1263 1247 1067 552 62 13625 31214 1183 327 --
NM_181361chr351399 1261 927 373 161 11025 31217 987 415 --
NM_181443chr2092815 2633 2623 2277 1868 1061 211 176 82 12788 11923 --
NM_181481chr18136730 6708 5202 4518 4510 1577 1367 1106 1030 867 739 704 483 15210 46853 1596 1562 605 1403
NM_181482chr18136730 6708 5202 4518 4510 1577 1367 1106 1030 867 739 704 483 15210 46853 1596 1562 605 1403
NM_181483chr18136730 6708 5202 4518 4510 1577 1367 1106 1030 867 739 704 483 15210 46853 1596 1562 605 1403
NM_181504chr5124119 4007 2982 2926 2769 2584 1639 925 720 708 693 167 13724 21011 900 --
NM_181523chr5124119 4007 2982 2926 2769 2584 1639 925 720 708 693 167 13724 21011 900 --
NM_181524chr5124119 4007 2982 2926 2769 2584 1639 925 720 708 693 167 13724 21011 900 --
NM_181645chr115677 606 288 274 233 --2452 68 1686
NM_181659chr20123253 3241 2893 2755 2146 1122 1075 1005 974 749 372 281 --11068 --
NM_181659chr20123253 3241 2893 2755 2146 1122 1075 1005 974 749 372 281 --11068 --
NM_181705chr5114840 4674 4415 4369 4268 4155 4139 2162 1261 899 177 14754 85428 5343 5121 4110 1042 574 216 82 35438 612 424
NM_181706chr1182423 2376 1967 1874 1587 384 119 44 --11647 --
NM_181714chr631294 540 224 21615 642 4662 71 45 37 21881 1644
NM_181723chr8112195 2029 1832 1762 1514 1448 807 451 401 163 62 31916 1490 318 22335 1893 --
NM_181741chr231227 828 233 --31129 101 90 --
NM_181742chr231227 828 233 --31129 101 90 --
NM_181782chr632311 875 22 21633 29 21844 187 21440 572
NM_181783chr1241953 1702 1389 37 --1544 1223
NM_181784chr272633 2530 2447 2227 1880 852 464 1897 1699 12366
NM_181787chr8113342 1315 938 884 766 361 355 308 275 215 95 13229 1104 23887 173
NM_181794chr661081 950 938 426 381 101 --2892 74 --
NM_181795chr661081 950 938 426 381 101 --2892 74 --
NM_181836chr5102546 2250 2223 2119 2102 677 510 92 83 41 11912 1226 1704
NM_181838chr5101462 1423 1348 1280 1194 1111 1086 559 437 201 ------
NM_181861chr1262814 2651 1875 1821 519 178 1153 32662 1808 492 --
NM_181868chr1262814 2651 1875 1821 519 178 1153 32662 1808 492 --
NM_181869chr1272899 2736 1960 1906 604 263 32 1238 32747 1893 577 1100
NM_182485chr493737 3472 3291 2798 1445 1309 1159 1017 357 23366 3267 73728 3604 2791 2710 2383 1403 572 1655
NM_182493chr16104606 3727 3424 2086 1043 773 548 432 244 188 11525 35367 5169 75 --
NM_182503chr6105513 5125 4980 3991 3963 3766 1938 1788 1167 678 --35297 1694 554 22241 2120
NM_182515chr19266273 6210 6032 6020 6012 6006 5953 5830 5447 4965 4946 4885 4518 2649 2481 2292 2170 2135 1664 1396 1135 1108 1086 673 387 348 --76168 5964 5626 5593 2190 1186 646 56525 2333 2073 1575 744
NM_182551chr282971 2708 1340 1130 847 771 576 99 1250 53007 1166 884 544 159 --
NM_182557chr1142161 2138 2132 2120 ------
NM_182607chrX31772 1301 231 31542 692 24 11794 1309
NM_182643chr892267 1966 1960 1919 1675 1664 1643 918 661 ------
NM_182646chr493737 3472 3291 2798 1445 1309 1159 1017 357 23366 3267 73728 3604 2791 2710 2383 1403 572 1655
NM_182700chr781977 1926 1796 1624 1604 1418 1320 1259 --11409 11463
NM_182715chr75991 944 491 463 449 ----173
NM_182729chr1231776 1182 218 ----21841 417
NM_182742chr1231776 1182 218 ----21841 417
NM_182743chr1231776 1182 218 ----21841 417
NM_182757chr683393 3168 2501 2423 2261 1348 330 257 ----1919
NM_182765chr1062231 1753 786 545 143 39 ----32360 2202 122
NM_182767chr12152107 1934 1862 1847 1788 1689 1607 1576 1563 1515 661 573 488 160 51 --2531 278 174
NM_182797chr2081799 1703 1626 1441 1177 685 281 41 --11120 --
NM_182830chr14102207 2163 2116 2054 2047 1795 1682 201 169 73 11599 1573 11693
NM_182848chr1381534 1046 511 453 423 258 124 111 --21268 268 --
NM_182896chr381832 1665 1555 1507 1243 1163 407 69 11185 41736 1725 1374 222 --
NM_182898chr7146412 6200 4292 3975 2398 2264 2080 2023 2007 1042 906 749 689 559 --76321 6188 5391 4315 4248 4092 330 1522
NM_182899chr7146412 6200 4292 3975 2398 2264 2080 2023 2007 1042 906 749 689 559 --76321 6188 5391 4315 4248 4092 330 1522
NM_182943chr351151 383 357 337 95 --3308 237 137 --
NM_182948chr1122523 2343 2325 2276 2195 1974 1921 961 873 790 722 409 --32131 1938 195 --
NM_182972chr162780 2584 2449 2057 386 116 32841 2750 220 31911 537 200 12479
NM_182975chr12795 446 --2464 128 1335
NM_182977chr551138 1013 895 798 385 2931 367 2877 404 --
NM_183004chr1493897 3741 3078 1138 926 871 605 391 168 --21561 755 --
NM_183050chr672113 2040 1996 1795 1739 886 523 152 32379 2206 2052 12427
NM_183079chr2071492 1297 1280 1127 1102 456 161 --1636 --
NM_183227chr641438 1197 323 304 --2371 135 11086
NM_183376chr1582377 1998 1715 1046 992 611 533 101 --1523 11812
NM_183398chr521195 368 2849 242 2382 289 1249
NM_183399chr521195 368 2849 242 2382 289 1249
NM_183400chr521195 368 2849 242 2382 289 1249
NM_183401chr521195 368 2849 242 2382 289 1249
NM_183416chr161757 1607 1356 559 517 218 --2381 243 1115
NM_184085chr87847 817 786 770 758 623 181 2635 81 ----
NM_184086chr87847 817 786 770 758 623 181 2635 81 ----
NM_184087chr87847 817 786 770 758 623 181 2635 81 ----
NM_194247chr2104522 4275 3698 3057 1667 1544 982 827 684 390 44092 3122 1813 703 54453 4322 3884 1758 1731 --
NM_194271chr124552 532 485 51 --1163 1111
NM_194282chr443089 2734 610 461 12482 12368 32104 801 621
NM_194283chr5114221 3850 3821 3731 3526 3243 3017 2844 948 549 429 1933 32731 1586 172 13136
NM_194285chr1193148 3127 2405 2358 1334 1291 1163 680 602 22113 931 63451 3233 1372 1358 797 162 2971 811
NM_194286chr12106212 6170 6058 5792 4798 4757 4500 4101 911 855 --43995 1577 1547 556 --
NM_194291chr893016 2894 2092 2063 1124 455 242 70 56 --2484 351 --
NM_194292chr151512 484 228 211 60 21269 1136 31456 1111 561 --
NM_194301chr1471082 1033 906 876 832 386 51 1166 21172 425 --
NM_194314chr1185659 5513 5479 4507 4101 3674 3569 2253 2184 1600 1249 1029 902 756 705 194 169 162 34788 1919 460 11635 --
NM_194317chr262695 2613 1901 1671 562 416 --52735 1804 456 243 134 --
NM_194356chr1262330 1946 1721 1650 403 116 1413 32297 421 397 --
NM_194434chr18155717 5505 5215 4307 4094 4079 3947 3908 3860 3783 2103 1719 1336 1020 382 23932 1801 25009 4036 23563 2230
NM_194463chrX71252 1221 1153 786 306 238 198 1132 31271 248 159 --
NM_197970chr21629 1478 11133 1641
NM_198076chr151702 607 330 266 183 --2549 58 1717
NM_198150chr521377 43 --1605 11526
NM_198158chr372833 2709 2126 1109 664 614 552 --33074 1962 790 --
NM_198159chr372833 2709 2126 1109 664 614 552 --33074 1962 790 --
NM_198177chr372833 2709 2126 1109 664 614 552 --33074 1962 790 --
NM_198178chr372833 2709 2126 1109 664 614 552 --33074 1962 790 --
NM_198181chr1562495 2271 2182 901 623 308 12157 22486 38 --
NM_198212chr7112301 2129 2065 1917 1782 1684 1578 930 832 499 281 --62050 2012 1853 737 632 537 --
NM_198215chr1051253 1088 1043 987 287 --41470 1444 896 499 --
NM_198240chr1241375 1308 496 68 11073 3249 191 134 --
NM_198261chr124535 258 227 143 ----1724
NM_198262chr124535 258 227 143 ----1724
NM_198268chr184161 2666 1286 1263 1247 1067 552 62 13625 31214 1183 327 --
NM_198269chr184161 2666 1286 1263 1247 1067 552 62 13625 31214 1183 327 --
NM_198270chrX153517 3350 3296 3287 3092 2906 2857 2801 2253 2128 1105 898 828 705 653 12528 32166 311 175 --
NM_198273chr5103084 3003 2830 2803 2063 1972 1149 794 785 513 12333 32223 583 409 1938
NM_198281chr4193502 3474 3331 3275 3029 2928 2631 2582 2266 1250 1146 779 713 650 602 582 575 516 281 52719 2572 674 547 306 53233 2969 2942 2518 424 23039 2508
NM_198320chr12104619 4445 4393 4280 4234 2014 1315 923 847 370 --35227 1591 824 24179 534
NM_198400chr15102865 2660 2535 2437 2368 2160 2144 860 695 326 --2393 137 22346 831
NM_198450chrX81665 1417 773 763 695 563 284 139 22280 202 22272 891 --
NM_198465chrX102746 2443 2215 1893 1184 1112 1046 970 400 35 --42724 2558 2188 905 1265
NM_198467chr75496 426 208 131 108 --2625 194 --
NM_198468chr684565 3872 3761 3739 3588 889 851 622 1974 74307 3913 1852 1396 1165 765 264 --
NM_198503chr1132322 2252 2178 1816 1809 842 734 718 641 256 191 117 90 12162 2700 583 --
NM_198506chr491525 1180 1134 1104 1037 595 429 406 325 ----1352
NM_198549chr1143039 3006 2944 2284 2227 2165 1290 1274 717 588 576 443 281 259 12447 142 1762
NM_198567chr54203 192 152 74 1345 2501 416 --
NM_198578chr1241243 1043 985 148 --2496 57 1423
NM_198581chr2146853 6264 6110 5818 2262 2210 1950 1917 1770 1648 1389 1304 646 177 22228 554 31402 573 487 --
NM_198584chr892514 2486 2085 743 600 590 564 320 30 11063 42669 915 534 116 --
NM_198715chr1226285 5570 5350 5177 5058 4616 4574 4480 4433 4403 4319 4110 3884 1926 1143 955 640 506 317 193 143 46 12029 51007 893 530 400 270 --
NM_198793chr343928 3668 1237 786 23957 3620 83977 3596 3518 2999 2534 1419 1371 1090 24113 3944
NM_198859chr3104819 4531 4456 4177 3738 3726 1866 1713 659 626 1192 64568 3983 1478 1076 680 447 --
NM_198896chr1192235 2135 1804 1692 1506 710 683 272 81 --32175 1991 221 11654
NM_198900chr1287191 6713 5934 5516 5242 4978 4895 479 --47272 6932 5081 1164 16832
NM_198904chr571562 1421 830 814 795 460 247 --1547 11951
NM_198935chr2093183 2683 2026 1243 1213 863 714 574 320 22517 1139 43105 2203 992 904 11110
NM_198956chr781977 1926 1796 1624 1604 1418 1320 1259 --11409 11463
NM_198968chr1383872 3802 3522 3439 1225 965 737 201 12733 53988 3835 3487 853 382 --
NM_198990chr7123314 3180 3036 2706 2698 2270 1077 1004 321 272 264 197 12103 33001 904 350 1240
NM_198992chr1251095 327 169 96 32 1467 --11108
NM_199000chr782154 1658 1505 1438 803 490 335 143 1846 1267 --
NM_199003chr831417 405 373 --31437 995 490 --
NM_199040chr12103829 3497 3448 3022 2875 2712 1076 735 697 74 1387 33809 3087 183 2711 430
NM_199053chr45955 713 622 343 220 ----1186
NM_199072chr7123207 2422 2415 2367 2218 2020 1979 1289 1062 935 338 243 --32756 2576 2263 12452
NM_199188chr12103864 2955 2706 2516 1617 1114 1006 662 350 215 23126 2598 32856 407 392 11425
NM_199190chr12103864 2955 2706 2516 1617 1114 1006 662 350 215 23126 2598 32856 407 392 11425
NM_199246chr551240 496 457 121 107 1156 1203 --
NM_199324chr493687 3020 2817 770 659 600 438 432 402 --32994 893 150 1301
NM_199421chr14144554 1921 1793 1667 1547 1404 1269 1258 1054 778 672 450 351 51 --43891 2028 1513 410 1612
NM_199436chr272841 2084 1180 687 371 171 29 22821 2174 32124 1248 931 42665 2658 2037 596
NM_199437chr1162583 2567 2495 2167 1666 1007 --32310 1900 1602 1320
NM_199438chr1162583 2567 2495 2167 1666 1007 --32310 1900 1602 1320
NM_199439chr1162583 2567 2495 2167 1666 1007 --32310 1900 1602 1320
NM_199461chr1083389 3234 3051 2789 2755 491 400 272 --22705 911 --
NM_199482chr241958 1894 1799 1328 143 11689 1556
NM_201278chr1162365 1488 869 742 615 371 2325 238 11904 --
NM_201281chr1162365 1488 869 742 615 371 2325 238 11904 --
NM_201437chr881547 1352 457 328 294 271 218 22 1563 --1415
NM_201438chr122329 66 --152 1388
NM_201548chr261392 1168 597 502 399 195 --11496 11405
NM_201999chr471263 1205 1160 1107 1042 872 312 --2102 56 --
NM_203282chr19111821 1707 1533 1346 1194 1159 742 704 681 582 456 --51858 1223 631 318 290 2475 394
NM_203327chr20114521 4513 4154 3827 3359 3330 3218 1739 1027 614 283 --54495 4088 3549 2932 2828 --
NM_203341chr13941 803 195 ----1126
NM_203372chr251545 1140 546 381 304 --21688 1561 21651 160
NM_203382chr541674 1591 473 457 ----11640
NM_203390chr811646 11498 31727 736 105 11492
NM_203391chrX51689 1413 1186 346 220 --41501 1351 547 194 11638
NM_203394chr1232712 1959 1799 --31875 868 346 12727
NM_203406chr5112617 2581 2370 1987 1173 780 688 623 469 456 80 1826 32710 2176 490 22949 2669
NM_203446chr2193030 3009 2932 2682 2157 1153 641 254 121 --32987 2808 2335 --
NM_203451chr1381914 1856 1780 1694 830 636 521 500 11848 2842 533 --
NM_203453chr981899 1869 1710 1522 727 489 410 390 11772 ----
NM_203454chr161382 1341 1183 1053 268 176 21298 413 11305 --
NM_203458chr143331 2964 1187 596 21049 56 32369 1171 903 --
NM_203459chr1112636 2531 2208 2062 980 642 580 483 324 174 28 21881 116 22320 1849 --
NM_203463chr284669 4353 4343 3828 3567 1991 1906 1133 31675 1175 254 34021 968 127 --
NM_203487chr1351735 1399 1210 348 39 2491 432 11176 1465
NM_203504chr482646 2429 2340 2282 2091 888 503 126 1159 12375 22536 2276
NM_203505chr482646 2429 2340 2282 2091 888 503 126 1159 12375 22536 2276
NM_205768chr121612 167 11770 31683 1544 1476 1788
NM_205852chr1251796 1560 831 823 71 11582 1120 22023 302
NM_205860chr162934 2437 2420 1241 1096 675 2956 762 43186 2533 2032 258 12248
NM_206594chr162930 2737 2395 1182 770 679 23669 2886 13326 --
NM_206595chr162930 2737 2395 1182 770 679 23669 2886 13326 --
NM_206853chr6103761 3753 3630 2767 1491 1322 1075 658 467 397 33382 569 175 64158 3326 3178 2707 2678 1303 --
NM_206854chr6115022 5014 4891 4028 3285 1919 1728 1658 1150 1001 894 44643 1830 1436 202 65419 4587 4439 3968 3939 474 --
NM_206855chr6155987 5979 5856 4993 4250 4223 3973 3926 2115 1966 1859 747 571 461 443 45608 2401 1167 252 86384 5552 5404 4933 4904 4214 1439 22 24057 901
NM_206866chr21103187 2945 2464 2129 1259 1189 926 498 416 349 62663 2419 2394 2245 2184 836 23086 2967 --
NM_206876chr2132939 2880 2836 2454 2190 1439 1119 1079 763 680 467 326 284 --42736 2299 488 451 --
NM_206907chr573363 3293 2633 2174 1187 143 39 --42479 2471 934 376 1305
NM_206909chr8208379 8078 7766 7460 7324 6984 6790 6390 6359 6011 5800 5309 5193 3092 2226 1703 1677 1358 1096 1055 12302 35966 5441 3258 18144
NM_206933chr152836 2757 2092 1916 208 2953 903 12876 22688 1782
NM_207012chr10103525 3492 2759 2606 2238 1355 1298 1219 1150 391 1779 32348 816 105 --
NM_207015chr372079 838 275 181 164 153 78 22330 1728 31761 774 614 --
NM_207303chr10114147 4015 3553 3449 3371 1387 1208 1131 1062 663 296 21279 245 44195 2582 523 348 --
NM_207304chr13172618 2514 2378 2178 2128 2055 2032 1936 1866 1066 867 316 271 203 182 145 77 2568 300 42663 2488 1911 1804 12278
NM_207322chr1572084 2061 1534 1515 552 385 74 --31508 526 400 11836
NM_207325chr1951950 1392 725 502 162 1528 62077 1802 1778 1582 1290 565 --
NM_207406chr4206435 5767 5506 5021 4741 4588 4514 4429 4099 4072 2090 2073 2003 1689 1620 1459 1342 691 481 381 2515 200 66454 6428 5691 1822 1044 413 --
NM_207435chr1251149 1107 952 278 128 --1374 1141
NM_207445chr15112116 2042 1819 1794 1505 1440 1414 824 483 470 262 1751 1695 --
NM_207647chr9102620 2537 2479 2183 2051 1997 1897 1719 1611 1593 --32565 597 156 --
NM_212554chr10101650 1595 1566 1533 1349 1341 535 459 408 75 11471 ----
NM_212558chr9134283 3941 3088 3060 2833 2678 1580 1553 1285 959 885 876 667 21126 793 44081 2925 1705 751 12894
NM_213589chr2115177 4551 4450 4342 1954 1816 1634 1091 1019 966 657 25224 1345 35021 4593 3548 14909
NM_213590chr13175281 5259 5179 4409 4237 4180 4063 3697 1934 1184 1129 1061 997 711 340 292 225 --45040 3573 3457 1847 14357
NM_213606chr1072722 2392 2292 2174 2134 314 142 --62710 2578 2330 2191 1764 1028 32638 1085 400
NM_213609chr34329 305 158 67 --1724 1340
NM_213651chr181814 1789 1639 1310 1150 1109 488 470 11543 31648 1412 1225 --