TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-33a-5p
miRNA Sequence: GUGCAUUGUAGUUGCAUUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51259 ------
NM_000027chr41917 ------
NM_000084chrX66348 4610 2299 1239 696 614 ------
NM_000090chr22751 694 ----182
NM_000091chr232849 2031 1144 22734 2554 ----
NM_000093chr952440 2376 1830 1761 819 ------
NM_000097chr341176 1059 1029 837 1446 ----
NM_000108chr741594 1532 660 292 11885 1201 --
NM_000110chr151171 857 478 460 414 ------
NM_000125chr644041 3141 3053 949 12737 34145 3110 507 --
NM_000129chr621446 1063 ----11503
NM_000134chr461577 1472 1137 1085 469 366 --11680 11741
NM_000138chr1551042 874 705 649 453 --1805 --
NM_000141chr1021385 369 --1479 --
NM_000142chr431350 992 24 1303 31515 295 90 --
NM_000163chr52316 80 1386 1673 1212
NM_000165chr631658 1121 68 21405 1157 ----
NM_000170chr9--1147 ----
NM_000202chrX93259 3186 2918 2627 2565 1033 663 634 384 ------
NM_000208chr1944669 3935 3492 1847 24239 2905 --11497
NM_000216chrX53512 1442 1263 250 131 --1806 --
NM_000217chr1275105 4514 1154 1050 996 722 338 1861 2463 143 --
NM_000219chr2142095 1930 903 607 --12508 11641
NM_000222chr432144 1963 1388 ------
NM_000232chr452331 2027 612 454 441 12878 --12844
NM_000245chr762069 1810 1650 1443 567 371 22253 1885 ----
NM_000248chr353028 2973 2846 580 469 32175 392 371 ----
NM_000259chr1596360 5617 5555 4831 4432 4196 3972 3954 2086 44449 2377 2047 662 32283 2271 984 --
NM_000267chr1773034 2973 2706 2408 1306 180 95 33504 2453 2284 ----
NM_000280chr11--1674 1303 --
NM_000314chr1073199 2542 2324 1151 1085 940 485 ------
NM_000318chr882733 2451 2380 1836 490 275 195 35 12186 11013 --
NM_000328chrX144 ------
NM_000329chr11134 1750 ----
NM_000332chr6127209 7111 6838 6442 6041 5064 4469 2005 1630 1310 748 279 1928 --15724
NM_000337chr556366 5439 5072 1110 560 35356 4411 4179 22638 1420 --
NM_000345chr42884 75 ------
NM_000346chr1711450 ----11556
NM_000348chr231429 602 38 11555 1344 --
NM_000351chrX73614 2965 2854 1451 1326 1181 1127 63639 2772 1477 1290 1283 430 --1299
NM_000376chr1283052 2576 2506 1222 1006 801 492 354 22898 2846 13114 --
NM_000399chr1031066 882 832 1763 ----
NM_000406chr473039 2454 1955 1046 929 772 299 32476 2320 784 12117 --
NM_000408chr252963 2681 2565 2172 1259 12855 1242 --
NM_000428chr1442490 1823 980 220 21673 642 ----
NM_000430chr1793679 3051 2809 2750 1274 1071 901 708 44 ------
NM_000441chr771629 1563 1466 857 769 649 463 32320 1956 524 158 --
NM_000448chr1152855 2382 2186 1159 1021 33156 2483 2397 22487 577 --
NM_000459chr91309 ------
NM_000461chr3114143 4023 3866 3513 1417 1399 1046 1019 727 545 165 13983 13246 14178
NM_000462chr1531681 1622 1521 1555 ----
NM_000480chr1161486 1441 1228 1056 574 285 ------
NM_000489chrX52704 1246 1010 849 843 ------
NM_000494chr104865 232 98 43 ------
NM_000523chr231143 895 815 11113 1763 --
NM_000531chrX2301 32 ------
NM_000533chrX31407 1333 60 ------
NM_000555chrX77467 6902 6642 4957 2816 1219 1086 26452 255 16579 --
NM_000574chr121232 853 191 ----
NM_000575chr221034 850 11027 ----
NM_000586chr4181 ------
NM_000594chr62687 507 --1547 --
NM_000600chr71383 ------
NM_000602chr741369 1225 1116 44 21571 1145 ----
NM_000609chr1073163 3119 1256 1080 936 875 866 ------
NM_000615chr1162755 2620 2496 2049 1938 1885 ------
NM_000618chr12116561 5914 5607 5343 5089 5033 4882 4554 2511 622 312 46506 1419 1101 683 ----
NM_000618chr12116561 5914 5607 5343 5089 5033 4882 4554 2511 622 312 46506 1419 1101 683 ----
NM_000633chr1874415 4231 3750 1778 1771 1758 603 34537 4046 3544 --14250
NM_000663chr1633018 2903 105 12215 1626 13058
NM_000686chrX21526 1083 1131 ----
NM_000719chr1286748 6410 6051 5804 5481 2545 2491 43 --21062 867 11410
NM_000721chr162442 2322 1667 1026 365 73 --123 1855
NM_000724chr1041672 1290 656 321 11762 ----
NM_000780chr861122 1020 929 134 121 84 ------
NM_000783chr10194 ------
NM_000788chr421463 242 11305 ----
NM_000793chr1465001 4284 3768 3148 1512 312 13178 ----
NM_000800chr521271 1179 --11596 --
NM_000806chr531778 1436 588 ------
NM_000809chr469279 8639 7291 6896 2937 42 37700 7609 6350 48863 8170 8066 815 --
NM_000813chr585392 4758 4169 4022 3910 3622 1830 429 15420 15337 --
NM_000824chr43836 752 364 ------
NM_000826chr452186 1998 1853 821 774 52148 2095 2077 1736 992 1107 --
NM_000828chrX31847 596 169 2632 626 --1203
NM_000833chr1651487 1079 474 305 52 ------
NM_000838chr642776 2394 2104 653 ------
NM_000840chr7--1488 ----
NM_000844chr331098 755 742 ------
NM_000857chr4--1440 ----
NM_000859chr521395 1343 --185 1354
NM_000866chr341677 652 245 151 1543 ----
NM_000868chrX42361 1985 1821 613 191 ----
NM_000891chr1793243 3084 2890 2871 2801 2291 1373 1006 728 12511 12563 --
NM_000899chr1233481 3009 1408 84212 3538 3287 2949 1616 1053 926 651 11503 --
NM_000902chr352889 2381 2308 1172 233 1735 --1317
NM_000917chr101865 ------
NM_000922chr111288 ------
NM_000924chr121888 ------
NM_000944chr442050 1911 296 278 12255 ----
NM_000945chr231601 240 78 ------
NM_000949chr52283 83 ------
NM_000950chrX32750 1419 587 23390 2401 ----
NM_000956chr14--11046 ----
NM_000959chr173324 2908 1534 1294 344 307 226 23619 828 ----
NM_000963chr132441 1628 385 11554 2464 371 --
NM_000990chr11103832 2966 2918 2822 2679 1338 1154 884 481 294 14062 13661 --
NM_001001132chr2161268 1050 1019 559 200 92 11413 ----
NM_001001323chr1262506 1157 958 801 420 189 22714 2483 ----
NM_001001330chr10--1443 --11082
NM_001001331chr332119 333 177 22719 796 --11773
NM_001001342chr10--11104 ----
NM_001001395chr1282670 2079 1732 1115 1054 1006 299 215 1325 ----
NM_001001419chr565152 2067 1106 806 323 216 --1763 --
NM_001001420chr565152 2067 1106 806 323 216 --1763 --
NM_001001436chr16--1695 ----
NM_001001481chr872858 2589 2553 2159 1390 412 222 ------
NM_001001484chr1041854 1778 896 428 1806 ----
NM_001001549chr722714 1774 22328 2178 1765 12661
NM_001001550chr722714 1774 22328 2178 1765 12661
NM_001001555chr722714 1774 22328 2178 1765 12661
NM_001001557chr851920 1828 1811 449 388 11884 ----
NM_001001664chr263171 2847 2527 1355 1151 316 1803 ----
NM_001001668chr1983306 3000 2875 1473 1343 1325 1130 876 32695 2643 1046 ----
NM_001001669chr542396 2320 2201 2017 31674 1082 942 1258 --
NM_001001711chr1121120 1010 ----181
NM_001001740chr1------1213
NM_001001740chr1------1213
NM_001001890chr2173557 1640 1589 891 823 521 348 1456 ----
NM_001001924chr852112 1741 826 456 44 12013 ----
NM_001001925chr852112 1741 826 456 44 12013 ----
NM_001001928chr22138309 7820 7424 6085 5703 5124 3118 3001 2899 2485 1724 915 432 22253 1826 1290 --
NM_001001931chr852112 1741 826 456 44 12013 ----
NM_001001933chr11481 ------
NM_001001977chr201132 ------
NM_001001995chrX61793 1458 1365 1255 609 98 ------
NM_001002243chr21157 1204 ----
NM_001002257chr273534 3142 2885 2643 2620 2417 74 1189 ----
NM_001002258chr221654 103 ----1273
NM_001002259chr122317 236 ------
NM_001002838chrX41597 1531 1522 634 ------
NM_001002860chr1494396 4069 3632 2971 1514 1366 1359 730 88 --13477 11554
NM_001002919chr2--1511 ----
NM_001003652chr18138284 8156 8116 6949 6226 6166 5850 5766 2578 2096 1965 955 317 48271 2054 1155 39 ----
NM_001003674chr18127049 6279 5510 5385 5161 5069 4734 4680 4630 2469 1381 963 31539 1077 542 1804 26269 987
NM_001003675chr18127049 6279 5510 5385 5161 5069 4734 4680 4630 2469 1381 963 31539 1077 542 1804 26269 987
NM_001003681chr222707 147 1432 --1294
NM_001003712chr12113961 3929 3395 3263 3135 3017 2554 2522 1608 662 128 ------
NM_001003760chr643624 2846 907 311 12354 12864 --
NM_001003800chr943717 807 562 102 11057 --12417
NM_001004051chrX1107 ------
NM_001004065chr953997 3536 2666 1462 1211 22998 100 13461 13964
NM_001004106chr51267 ------
NM_001004317chr6124379 4039 3779 3549 3275 3131 3024 1552 1333 1285 1165 289 33446 3258 1815 --13451
NM_001004329chr124326 128 88 63 2455 436 ----
NM_001004342chr154670 2415 2403 1179 1016 15142 25651 558 --
NM_001004419chr1233344 1517 1157 33832 3141 1301 1910 12829
NM_001004722chr2148 ------
NM_001005386chr262101 1978 989 906 310 34 ------
NM_001005463chr1022476 356 --12208 --
NM_001005473chr5106268 5620 4314 4156 4025 2399 2360 1743 1233 491 26608 5358 16181 --
NM_001005474chr321364 588 198 ----
NM_001005609chrX53784 3725 3534 3507 2844 13149 ----
NM_001005739chr21564 ------
NM_001005743chr14--21295 339 ----
NM_001005744chr14--21295 339 ----
NM_001005745chr14--21295 339 ----
NM_001005782chr21779 ----1308
NM_001005910chr31637 ------
NM_001005911chr31637 ------
NM_001006634chr162630 618 ----1661
NM_001006681chrX141 ------
NM_001006682chrX141 ------
NM_001006683chrX141 ------
NM_001006684chrX--1572 ----
NM_001007023chr1465001 4284 3768 3148 1512 312 13178 ----
NM_001007024chr1754287 3804 3576 681 656 1120 14086 --
NM_001007025chr1754287 3804 3576 681 656 1120 14086 --
NM_001007075chr431099 287 263 ----1357
NM_001007094chr1084495 1781 1264 654 528 324 249 148 11699 ----
NM_001007097chr975074 3366 3088 1870 667 439 260 11850 25057 205 --
NM_001007237chr132616 343 255 12487 ----
NM_001007245chr72449 140 --157 --
NM_001007246chr2131805 1305 258 4443 309 87 59 ----
NM_001007277chr11----11004 --
NM_001007466chr6134997 4817 4724 3554 2039 1983 1085 795 545 461 389 182 124 21242 704 24824 4011 --
NM_001007553chr12778 198 ------
NM_001007565chr3127 1398 ----
NM_001007794chr11107 ------
NM_001008225chr73683 488 93 1663 ----
NM_001008239chr1853612 3060 2949 2464 1050 11070 13559 --
NM_001008388chr41203 ------
NM_001008393chr472810 1864 1828 768 604 291 169 12427 1957 --
NM_001008401chr1931235 1213 444 1248 ----
NM_001008405chr721260 665 1211 ----
NM_001008408chr776338 5001 4917 3995 840 693 498 --2422 283 --
NM_001008495chr82552 185 1192 --11594
NM_001008661chr11363 ------
NM_001008662chr11363 ------
NM_001008726chr1431100 447 247 1471 ----
NM_001008738chr532904 2798 668 32712 1855 1171 ----
NM_001008756chr342017 866 855 668 22374 1659 ----
NM_001008801chr1962036 1914 1511 808 537 290 3781 697 613 ----
NM_001008925chr453493 2870 2554 2489 1363 2787 117 11087 13540
NM_001009185chr52667 298 ----1241
NM_001009554chr464480 3837 3528 2980 404 349 14402 ----
NM_001009554chr464480 3837 3528 2980 404 349 14402 ----
NM_001009567chr104439 235 199 73 ------
NM_001009571chr741265 1053 383 143 ------
NM_001009899chr366401 1809 1379 158 138 47 16472 1597 --
NM_001009955chr11236 ------
NM_001009955chr11236 ------
NM_001009959chr242540 2075 314 307 11665 ----
NM_001009960chr752685 2030 1074 745 249 22667 421 ----
NM_001009993chr271510 1374 1177 424 410 292 105 1349 11611 --
NM_001010844chr61237 ------
NM_001010852chr61114 ------
NM_001010861chr152187 964 754 678 135 ------
NM_001010888chrX74517 4232 4142 4048 1746 861 463 24435 1541 11555 --
NM_001010924chr1011094 ------
NM_001010934chr72356 148 2184 113 ----
NM_001010986chrX21766 927 12277 1479 12083
NM_001011513chr433963 3728 3089 --13985 --
NM_001011537chr341972 661 446 171 12204 1483 --
NM_001011663chr1021099 175 182 ----
NM_001011666chr796162 5881 5428 5201 2496 2109 1936 1381 597 26611 2229 ----
NM_001011713chr145622 576 520 356 282 ----31279 1274 60
NM_001011724chr131255 1297 ----
NM_001011725chr131255 1297 ----
NM_001012267chr92251 214 ------
NM_001012393chr1194792 4712 4499 4072 3254 2028 1925 1712 414 --23191 473 21443 929
NM_001012398chr162279 179 ----1880
NM_001012410chr3157 ------
NM_001012420chr1552303 2010 1963 1901 991 42936 2865 2608 1851 11909 12686
NM_001012423chr1552303 2010 1963 1901 991 52936 2865 2608 2498 1851 11909 12686
NM_001012732chr4161 ------
NM_001012751chr1011501 21452 1235 21721 337 --
NM_001012755chrX44990 3855 1051 845 ----13548
NM_001012968chrX31988 1032 831 12048 --1271
NM_001012989chrX1143 ------
NM_001013031chr1053526 3481 3257 3014 2218 ------
NM_001013415chr42574 338 11601 1641 --
NM_001013620chr12158310 7135 6068 5881 5121 2445 2345 1865 1446 1436 1414 1063 670 552 451 47470 2876 2684 377 ----
NM_001013642chr12956 890 2946 405 --1769
NM_001013717chr551344 1271 544 452 151 ------
NM_001013746chr732170 661 329 42358 2164 1663 646 --1146
NM_001014380chr1375610 5063 4434 2297 1773 812 153 ------
NM_001014449chr161160 ------
NM_001014451chr161160 ------
NM_001014797chr1087598 7558 7491 5499 5124 5110 1299 920 42383 1703 1589 1407 37752 2414 1932 1455
NM_001014812chr151442 --1298 --
NM_001015048chr1453196 2887 913 875 319 12838 ----
NM_001015049chr1453196 2887 913 875 319 12838 ----
NM_001015877chrX42976 2145 1947 624 12099 --22202 395
NM_001015880chr1031293 383 97 21675 683 ----
NM_001017371chr231253 1198 296 ----1275
NM_001017395chr352914 2593 1035 806 43 2788 248 12522 --
NM_001017405chr41702 1936 ----
NM_001017420chr861426 1356 1331 1009 964 390 ------
NM_001017424chr171893 1559 1478 1298 1192 476 236 11752 1332 --
NM_001017425chr171893 1559 1478 1298 1192 476 236 11752 1332 --
NM_001017440chr778073 6092 5727 2697 2570 2033 213 46159 1114 239 153 --16777
NM_001017535chr1283052 2576 2506 1222 1006 801 492 354 22898 2846 13114 --
NM_001017923chr1441566 1542 490 461 ------
NM_001017926chr821493 1144 2570 239 11397 21481 201
NM_001017962chr101865 ------
NM_001017969chr94573 468 149 69 --1628 --
NM_001018003chr8--1746 ----
NM_001018008chr151458 2125 119 ----
NM_001018037chr931178 1149 578 --11220 --
NM_001018065chr965016 3671 2241 1770 1681 1551 11843 --11297
NM_001018066chr965016 3671 2241 1770 1681 1551 11843 --11297
NM_001018091chr1562793 2560 2460 1949 819 25 ------
NM_001020658chr111666 11468 1275 --
NM_001020658chr111666 11468 1275 --
NM_001023567chr1521579 999 --22233 1930 --
NM_001024401chr161629 ------
NM_001024647chr1266136 5541 2509 2418 1162 335 35897 1867 226 14725 --
NM_001024649chr542764 2451 491 344 1246 1940 --
NM_001024847chr332205 1812 282 ------
NM_001024912chr1951637 1593 1489 591 160 ------
NM_001024916chr91143 ------
NM_001024937chr17----1724 --
NM_001024947chr52977 798 1916 --11087
NM_001024956chr1155363 4570 1409 1392 853 1423 ----
NM_001025068chr341559 1459 1193 180 --11784 --
NM_001025069chr341559 1459 1193 180 --11784 --
NM_001025076chr1075776 3905 3888 3768 1358 713 244 12334 1750 --
NM_001025077chr1097134 5263 5246 5126 4719 2716 2071 1602 684 24669 1268 12108 --
NM_001025079chr314063 11418 --14098
NM_001025100chr18113908 3254 2880 2686 2632 1552 1374 778 644 408 121 1230 11297 --
NM_001025105chr511543 ------
NM_001025108chr2114083 3824 3703 3519 3104 2987 2769 1070 799 673 371 13579 44000 3851 3096 1174 13584
NM_001025266chr384826 4458 3764 3431 3342 1631 1158 79 ------
NM_001025356chr1262848 2784 2558 2314 724 226 32263 1846 176 1159 --
NM_001025389chr1161486 1441 1228 1056 574 285 ------
NM_001025390chr1161486 1441 1228 1056 574 285 ------
NM_001025595chr4--1185 --21520 1315
NM_001025616chr461812 1477 1282 733 188 158 1560 1747 --
NM_001025780chr91117 ------
NM_001029835chr71385 ------
NM_001029858chr643082 2586 1108 472 ----13373
NM_001029863chr662991 2922 2202 1237 940 640 21281 1215 22425 667 22848 1230
NM_001029875chr52677 323 2790 282 12566 --
NM_001029882chr11250 ------
NM_001029882chr11250 ------
NM_001029884chr652680 2150 757 605 573 21882 324 1167 --
NM_001030007chr1663969 3231 2843 1550 1469 551 2841 503 ----
NM_001030055chr1464202 3418 1706 1353 765 369 13087 ----
NM_001031623chr62549 105 ------
NM_001031679chr1263314 3192 3140 1396 938 38 43332 3072 2889 1162 1389 1682
NM_001031695chr2254585 4139 1359 375 280 ----11962
NM_001031732chr443700 3435 416 255 12489 ----
NM_001031803chr171220 ------
NM_001031812chr552238 2210 2161 1600 783 1740 --1758
NM_001032280chr6----21628 1326 --
NM_001032283chr122297 120 ------
NM_001032284chr122297 120 ------
NM_001032296chr1362713 2502 2323 655 319 270 1699 ----
NM_001032380chr1051687 1633 1529 1440 703 1536 ----
NM_001032394chr662211 607 457 417 251 66 22779 556 ----
NM_001032395chr652078 474 324 284 118 22646 423 ----
NM_001032999chr2085305 5220 4017 3651 1621 1413 860 347 25146 3605 ----
NM_001033045chr284348 3955 3915 3151 2903 1763 1364 735 23021 836 --1749
NM_001033057chr331877 784 218 21694 479 11376 --
NM_001033059chr672039 1938 1765 1532 251 86 74 ------
NM_001033085chr2148 ------
NM_001033088chr152417 58 ------
NM_001033117chr374545 4259 3607 3559 3108 3026 1179 14097 23992 1812 13067
NM_001033503chr51192 ------
NM_001033557chr221399 1065 ------
NM_001033561chr172675 64 --1858 157
NM_001033566chr171731 ------
NM_001033568chr171731 ------
NM_001033578chr821588 138 22338 517 11845 11609
NM_001033925chr1031778 1429 504 21559 1511 11575 1852
NM_001034841chr1674930 4662 4068 1870 1506 768 565 190 ----
NM_001034954chr1032139 620 597 32575 2220 403 2956 819 --
NM_001034955chr1032139 620 597 32575 2220 403 2956 819 --
NM_001034956chr1032139 620 597 32575 2220 403 2956 819 --
NM_001034957chr1032139 620 597 32575 2220 403 2956 819 --
NM_001035chr11993 11205 ----
NM_001035003chr421418 195 ------
NM_001035004chr421418 195 ------
NM_001037132chr781642 1605 1559 836 724 460 307 193 32095 253 187 1737 --
NM_001037133chr781642 1605 1559 836 724 460 307 193 32095 253 187 1737 --
NM_001037164chr751656 1399 643 589 175 ------
NM_001037165chr7118501 7461 7030 6809 6766 5724 3049 1760 1681 1314 948 ------
NM_001037290chr113418 322 271 1839 ----
NM_001037317chr152187 964 754 678 135 ------
NM_001037339chr121850 1564 --21812 1747 --
NM_001037340chr121850 1564 --21812 1747 --
NM_001037341chr121850 1564 --21812 1747 --
NM_001037341chr121850 1564 --21812 1747 --
NM_001037535chrX51428 1383 1356 1091 51 21401 1349 ----
NM_001037536chrX51428 1383 1356 1091 51 21401 1349 ----
NM_001037540chrX51428 1383 1356 1091 51 21401 1349 ----
NM_001037553chr2174429 4152 4101 4015 3695 725 74 23738 2040 ----
NM_001039091chrX21343 416 11364 --1982
NM_001039465chr141368 ------
NM_001039577chr183850 3695 3331 1297 1113 1030 604 270 11067 170 --
NM_001039580chr475038 1865 1696 1129 1031 908 719 34913 4342 152 11648 --
NM_001039585chr193581 3165 2642 1551 601 564 483 154 143 23876 1085 ----
NM_001039590chrX32770 2748 2493 --13085 1518
NM_001039591chrX32770 2748 2493 --13085 1518
NM_001039618chr1185549 5301 4328 3783 2142 1921 790 465 13743 21787 1662 --
NM_001039649chr131217 ------
NM_001039709chr2085305 5220 4017 3651 1621 1413 860 347 25146 3605 ----
NM_001039802chr151359 1341 1224 961 58 ------
NM_001039840chrX65620 4286 4169 1817 1379 691 36068 613 582 ----
NM_001039937chr1333072 2662 466 22961 1610 ----
NM_001040020chr761399 1254 628 599 290 239 11379 ----
NM_001040092chr81163 --1293 --
NM_001040101chr481460 1335 578 464 327 187 133 26 --11517 --
NM_001040135chr71670 ------
NM_001040142chr2112139 2091 1930 1884 1814 1791 1763 1710 774 136 120 12315 ----
NM_001040143chr2112139 2091 1930 1884 1814 1791 1763 1710 774 136 120 12315 ----
NM_001040152chr734500 3732 3113 1720 ----
NM_001040153chr134863 846 773 303 ------
NM_001040159chr411481 ------
NM_001040202chr432511 2358 120 1440 ----
NM_001040214chr632340 1851 1493 1130 21874 598 1464
NM_001040284chr1684487 3768 2184 1870 1714 1563 1543 809 31484 1408 288 ----
NM_001040402chr442944 2821 828 328 ------
NM_001040424chr212966 873 ----1108
NM_001040429chr1372986 2708 2625 1258 1230 998 107 2985 678 11046 --
NM_001040441chr153990 3343 2187 1438 419 14212 ----
NM_001040450chr1562392 2150 937 789 570 425 12449 12420 --
NM_001040453chr1562392 2150 937 789 570 425 12449 12420 --
NM_001040624chr872272 2014 1036 1002 922 798 758 --12381 --
NM_001040625chr872272 2014 1036 1002 922 798 758 --12381 --
NM_001040626chr872272 2014 1036 1002 922 798 758 --12381 --
NM_001040627chr872272 2014 1036 1002 922 798 758 --12381 --
NM_001040628chr872272 2014 1036 1002 922 798 758 --12381 --
NM_001040629chr872272 2014 1036 1002 922 798 758 --12381 --
NM_001040630chr872272 2014 1036 1002 922 798 758 --12381 --
NM_001040633chr75951 355 333 252 97 2963 856 ----
NM_001040665chr774024 1982 1601 1254 1180 557 431 13640 ----
NM_001040712chr963403 3159 2600 2398 1095 576 11241 11294 --
NM_001041chr32365 157 1459 ----
NM_001042355chr1685384 4695 4685 3955 1687 1593 1142 273 24443 352 ----
NM_001042412chr1685384 4695 4685 3955 1687 1593 1142 273 24443 352 ----
NM_001042413chr931485 1038 337 2669 446 ----
NM_001042414chr13199 ------
NM_001042425chr6----21628 1326 --
NM_001042453chrX21471 73 --1615 --
NM_001042473chr101760 21932 426 ----
NM_001042481chr1482053 1899 855 739 648 610 254 205 --12059 --
NM_001042492chr1773034 2973 2706 2408 1306 180 95 33504 2453 2284 ----
NM_001042494chr1553210 1231 866 392 225 1491 ----
NM_001042495chr1553210 1231 866 392 225 1491 ----
NM_001042496chr1553210 1231 866 392 225 1491 ----
NM_001042497chr1553210 1231 866 392 225 1491 ----
NM_001042510chr831336 728 182 2771 413 ----
NM_001042511chr831336 728 182 2771 413 ----
NM_001042517chr134710 669 647 155 2919 637 ----
NM_001042537chrX22278 1743 1994 183 --
NM_001042543chr461588 1416 1280 1021 367 291 133 ----
NM_001042550chr941433 1400 1369 337 145 ----
NM_001042555chr12114622 4177 4022 3242 3222 3135 3071 2996 405 235 158 33691 3429 58 1367 --
NM_001042599chr2127122 6860 6586 5548 5435 5226 4858 2854 2786 1077 284 210 47760 1355 276 135 16315 --
NM_001042601chr362828 2627 980 780 729 702 ------
NM_001042603chr1254002 1845 987 874 484 13587 ----
NM_001042604chr394799 4743 4029 3693 1907 1612 1441 306 88 24066 3113 14046 --
NM_001042646chr331970 1767 696 11289 184 --
NM_001042669chr461812 1477 1282 733 188 158 1560 1747 --
NM_001044385chr263764 3617 2814 1431 544 62 ------
NM_001044722chr552238 2210 2161 1600 783 1740 --1758
NM_001044723chr552238 2210 2161 1600 783 1740 --1758
NM_001046chr542480 2172 916 44 22922 2454 ----
NM_001071775chr1351859 1257 702 232 76 11844 ----
NM_001083620chr462184 1996 1851 820 773 202 52146 2093 2075 1735 991 1107 --
NM_001095chr121426 ------
NM_001100108chr1118126 6764 5965 3098 3019 2939 1814 1316 624 452 27 25736 2356 1288 --
NM_001101662chr1133 ------
NM_001106chr3199698 9208 8564 8464 8227 7755 7704 7695 7324 6565 6252 2984 2581 2068 1281 967 405 272 108 27194 1538 22532 1758 --
NM_001113490chrX53690 3562 3155 2959 300 --1142 --
NM_001116chr1633081 2720 1904 --32375 2363 2305 22711 1078
NM_001117chr1842123 2046 2033 185 ----12537
NM_001121chr1051906 1871 1806 1528 35 21751 1326 11679 11397
NM_001122631chr112274 186 --1157 --
NM_001122679chr51259 ------
NM_001126chr13388 318 261 ------
NM_001128chr1663969 3231 2843 1550 1469 551 2841 503 ----
NM_001143chrY1122 ------
NM_001148chr432250 2218 1430 11743 21999 552 --
NM_001151chr41299 ------
NM_001167chrX64651 2560 1903 1021 271 126 66518 6429 5560 5169 1030 658 14962 15442
NM_001173chr1464202 3418 1706 1353 765 369 13087 ----
NM_001186chr21113239 2903 2837 2614 2316 2107 1040 966 911 450 225 ----13129
NM_001187chr211162 ------
NM_001195chr20254 29 ------
NM_001198chr632393 595 453 12421 ----
NM_001200chr201240 ------
NM_001201chr443835 3563 2856 2509 23829 197 23910 99 --
NM_001204chr236298 4783 2882 37018 5743 2730 25068 323 --
NM_001206chr952629 2335 2312 1078 809 22425 501 ----
NM_001219chr711937 11796 --12266
NM_001231chr11462 ------
NM_001241chr242202 1784 932 580 22420 2012 --1793
NM_001241chr242202 1784 932 580 22420 2012 --1793
NM_001256chr17--32831 561 521 --22876 174
NM_001259chr753908 2482 2378 1750 1303 35668 4659 4440 --24532 183
NM_001278chr1021028 383 --1226 --
NM_001289chrX41486 1090 593 288 11121 11183 --
NM_001304chr1752994 2694 2634 2332 1488 11217 ----
NM_001315chr612159 --11788 1327
NM_001326chr111440 ------
NM_001331chr1142573 2089 892 400 ------
NM_001332chr531123 557 486 21542 1356 133 --
NM_001344chr14--1235 ----
NM_001351chr321399 1380 ------
NM_001356chrX2363 306 22370 735 ----
NM_001364chr1184418 3555 1293 1017 805 730 133 116 11904 ----
NM_001378chr22149 129 ------
NM_001387chr51146 13194 ----
NM_001391chr1831169 896 57 --1118 --
NM_001396chr2132407 920 519 42693 1758 882 74 ----
NM_001399chrX53784 3725 3534 3507 2844 13149 ----
NM_001400chr111026 --1194 11261
NM_001401chr921431 560 21605 1159 --11588
NM_001412chrX53787 3447 3308 3031 166 32564 215 102 ----
NM_001430chr211999 ------
NM_001432chr4113920 3619 3362 2984 2976 2723 1175 754 290 176 122 33610 1065 487 12949 13151
NM_001438chr143549 2406 1320 720 23582 1150 --1697
NM_001443chr2--145 ----
NM_001448chrX11214 11485 1107 --
NM_001452chr62731 524 ------
NM_001453chr611243 21548 493 11150 --
NM_001465chr551959 1383 506 94 44 ------
NM_001498chr62310 24 --1214 --
NM_001518chr72240 217 1903 --1967
NM_001527chr644104 4028 1853 1538 14870 24691 1156 --
NM_001530chr145947 432 265 186 161 ------
NM_001541chr11----1123 --
NM_001542chr132616 343 255 12487 ----
NM_001543chr574837 4476 3181 3049 1813 1541 1215 ------
NM_001550chr72449 140 --157 --
NM_001554chr12543 192 1570 ----
NM_001584chr112453 425 1950 --11056
NM_001604chr11--1674 1303 --
NM_001608chr21770 2937 69 --1942
NM_001609chr1054370 4071 3605 976 317 23078 1351 --1892
NM_001616chr263502 3012 1341 780 471 261 --12416 --
NM_001620chr11--1795 ----
NM_001621chr772756 2676 2304 1065 973 518 114 ------
NM_001621chr772756 2676 2304 1065 973 518 114 ------
NM_001634chr672039 1938 1765 1532 251 86 74 ------
NM_001650chr1873833 3023 2682 2577 1145 842 623 23534 1423 22843 828 --
NM_001656chr541739 1684 557 103 11444 ----
NM_001660chr31177 ------
NM_001663chr1442213 2123 984 786 32060 1880 691 12790 --
NM_001677chr121106 956 1158 11022 11062
NM_001678chr1741793 1661 1525 593 ------
NM_001681chr122638 509 2577 31 ----
NM_001682chr1252220 871 672 515 134 22428 2197 ----
NM_001683chr332119 333 177 22719 796 --11773
NM_001689chr221654 103 ----1273
NM_001698chr92428 40 ----132
NM_001709chr1131125 768 491 12679 ----
NM_001723chr64823 708 190 37 1716 ----
NM_001742chr71727 41538 612 263 246 --1498
NM_001746chr542764 2451 491 344 1246 1940 --
NM_001748chr13948 432 333 1214 ----
NM_001754chr2173557 1640 1589 891 823 521 348 1456 ----
NM_001755chr1642075 1804 1705 1451 22151 2022 ----
NM_001759chr1254764 4402 4345 765 720 15302 ----
NM_001769chr121432 ------
NM_001777chr314063 11418 --14098
NM_001786chr10--1153 ----
NM_001791chr151359 1341 1224 961 58 ------
NM_001796chr16178 ------
NM_001797chr161649 --1504 --
NM_001806chr1972782 2619 2006 1949 1931 1036 580 12169 12569 --
NM_001827chr9286 42 ------
NM_001830chrX63458 3375 3059 2701 1131 961 11112 ----
NM_001845chr13----1269 1464
NM_001859chr963883 3658 3146 3135 2958 961 ------
NM_001873chr42508 43 1278 1716 --
NM_001880chr21253 ------
NM_001892chr511543 ------
NM_001903chr54637 583 280 189 1686 ----
NM_001918chr1199275 8942 8859 8492 8315 8263 7923 7879 7005 6948 6749 6649 6193 5906 3569 3252 1300 1032 961 21166 757 --17709
NM_001921chr4161 ------
NM_001932chr17--1640 ----
NM_001942chr1841929 1617 650 74 ------
NM_001949chr642576 2040 743 438 33130 2246 484 ----
NM_001951chr81608 191 ----
NM_001957chr462122 1811 1529 906 884 814 ------
NM_001968chr4--1779 ----
NM_001969chr14113915 3778 3576 3558 3341 2461 1414 1242 987 545 35 32886 632 70 ----
NM_001977chr431465 1107 109 21286 1196 ----
NM_001980chr1272130 1563 1468 1409 848 412 128 ------
NM_001981chr131891 490 68 12430 --11883
NM_001987chr1223529 3423 24235 3221 12616 --
NM_001999chr52405 294 --11035 --
NM_002006chr464927 4316 3997 3698 1775 189 35783 4274 1344 ----
NM_002009chr1522190 645 --12620 --
NM_002010chr131132 ------
NM_002015chr1333268 3012 203 --13166 --
NM_002024chrX31556 675 590 41885 1809 1743 1662 ----
NM_002025chrX48562 7787 819 584 39307 1634 361 29286 6478 11447
NM_002033chr1163827 3094 2965 1014 785 686 --33313 1271 284 --
NM_002035chr1863398 2957 2680 729 361 125 --13817 1689
NM_002039chr41589 --1322 --
NM_002045chr31385 ------
NM_002053chr14931 712 358 199 --31045 727 405 --
NM_002054chr2--1318 1448 --
NM_002069chr73277 110 25 21625 95 ----
NM_002082chr51230 ------
NM_002101chr2--1521 ----
NM_002120chr6192 ------
NM_002126chr1743437 2656 1578 838 23539 1306 11486 --
NM_002128chr1342260 2243 906 336 195 ----
NM_002130chr531270 224 216 11502 ----
NM_002136chr121255 ------
NM_002137chr732146 165 96 ----1738
NM_002139chrX2550 464 ------
NM_002140chr91925 1445 ----
NM_002158chr233516 3415 3057 33805 1062 330 ----
NM_002203chr583975 3815 3601 3460 3342 2922 2563 1476 ----11246
NM_002210chr242888 1096 783 336 33181 2818 2324 1259 13194
NM_002211chr1031130 866 119 136 ----
NM_002214chr7105685 5302 4601 4115 2222 1851 1654 760 347 276 35749 4788 1214 13923 --
NM_002245chr12508 132 186 ----
NM_002253chr441413 941 928 550 11330 --1385
NM_002254chr232291 925 354 --22348 2163 --
NM_002264chr354851 4764 3385 1469 1127 21685 910 ----
NM_002268chr351887 681 474 364 316 1244 130 --
NM_002270chr5124797 4782 4546 4509 4178 2086 1864 1463 1372 1167 857 786 11744 ----
NM_002285chr2114083 3824 3703 3519 3104 2987 2769 1070 799 673 371 13579 44000 3851 3096 1174 13584
NM_002293chr142017 1824 573 474 32729 2555 625 ----
NM_002310chr566073 2237 1952 1506 546 164 26508 1702 ----
NM_002332chr12--1115 ----
NM_002336chr1274627 4031 1936 1721 993 955 563 2510 44 ----
NM_002356chr642542 2406 2044 996 21131 1049 ----
NM_002358chr4--125 ----
NM_002373chr151914 ------
NM_002384chr182859 803 1771 ----
NM_002389chr161926 1713 527 488 245 233 1207 ----
NM_002395chr611232 ------
NM_002397chr531365 420 286 --12198 --
NM_002399chr153290 268 212 --1167 1480
NM_002408chr142868 597 --1641 --
NM_002438chr104439 235 199 73 ------
NM_002451chr951409 1153 672 512 428 --13496 --
NM_002467chr8173 3286 137 86 ----
NM_002469chr121387 ------
NM_002480chr1251205 1159 959 603 239 ------
NM_002481chr137825 6134 175 --17010 21762 1043
NM_002482chr1150 ------
NM_002493chr9--1345 ----
NM_002515chr143634 306 139 1124 ----
NM_002520chr5187 ------
NM_002525chr1133 ------
NM_002545chr1194792 4712 4499 4072 3254 2028 1925 1712 414 --23191 473 21443 929
NM_002581chr985039 4626 4428 4168 3584 2044 1467 738 35417 4997 4787 ----
NM_002583chr122239 64 ------
NM_002590chr132507 170 1180 ----
NM_002600chr121850 1564 --21812 1747 --
NM_002618chr2178 ------
NM_002645chr1131934 833 431 12012 22990 2707 --
NM_002655chr895039 4343 3750 1799 1771 1271 1219 869 33 44451 1878 1863 399 14612 --
NM_002657chr2033875 3839 1284 ------
NM_002662chr342176 1925 467 390 22111 768 ----
NM_002670chr331128 394 70 --11082 --
NM_002706chr22682 62 ------
NM_002711chr73726 587 282 2799 545 196 --
NM_002718chr322493 267 22338 552 ----
NM_002719chr1452407 2287 1951 1615 1547 21629 938 ----
NM_002729chr101765 1730 ----
NM_002731chr143004 2813 1986 310 ----13042
NM_002734chr1741916 1829 1449 1407 ----1345
NM_002740chr372841 2717 2482 2117 1065 609 46 22785 429 ----
NM_002742chr143521 503 263 1633 1581 --
NM_002745chr2284095 3238 1646 1621 1301 870 669 309 13283 22916 255 --
NM_002750chr10157 ------
NM_002757chr151355 ------
NM_002763chr1127 ------
NM_002765chrX21343 416 11364 --1982
NM_002806chr14175 ------
NM_002814chrX3722 625 66 ------
NM_002819chr1911265 ------
NM_002825chr73535 488 167 ------
NM_002830chr2167 ------
NM_002834chr1241634 1346 552 125 --23287 248 --
NM_002836chr201189 ------
NM_002837chr12124547 4434 4417 4376 4330 3097 1774 1681 1008 872 691 329 24104 1518 --1671
NM_002839chr963403 3159 2600 2398 1095 576 11241 11294 --
NM_002844chr641222 1008 972 24 ------
NM_002849chr1241065 1057 307 184 ------
NM_002851chr71161 ------
NM_002874chr92860 333 22290 983 2170 38 --
NM_002886chr355169 4860 4517 3531 261 11223 13984 --
NM_002890chr51690 --1760 --
NM_002893chrX--295 35 ----
NM_002902chr154597 418 191 130 ------
NM_002906chr112589 83 ----12282
NM_002912chr63236 155 43 --2901 192 --
NM_002924chr16641 570 453 171 62 26 ------
NM_002941chr341376 1218 1077 549 1461 --197
NM_002942chr321409 1261 1124 21229 1118 2129 81
NM_002956chr1221206 1053 11347 ----
NM_002959chr173944 3385 3344 1750 1407 1290 160 ------
NM_002967chr191120 ------
NM_002968chr164894 847 803 401 3386 220 47 ----
NM_002970chrX----1295 --
NM_002977chr233103 2129 486 12665 31244 517 120 --
NM_003010chr1742249 1635 396 336 1513 12141 --
NM_003011chr951481 1465 1439 1253 358 --11039 --
NM_003017chr61229 21438 1336 11343 --
NM_003042chr362183 1815 1781 1644 1616 313 12161 --1732
NM_003045chr1384443 4223 4147 3910 3619 3090 3053 520 11642 11311 188
NM_003051chr121252 749 12003 11442 195
NM_003068chr84981 808 788 34 3822 759 329 --1880
NM_003070chr92783 728 ------
NM_003081chr202479 314 ------
NM_003099chr1586111 6025 5567 2612 2356 1389 290 86 ------
NM_003101chr151158 1106 576 478 441 ------
NM_003107chr622527 1667 ------
NM_003108chr2107263 7234 7009 6962 6703 6282 5889 5781 4714 721 --26004 1499 --
NM_003111chr231253 1198 296 ----1275
NM_003112chr763079 2309 2150 939 795 577 23198 2440 --12804
NM_003115chr11458 ------
NM_003128chr242625 2455 377 105 --1512 --
NM_003131chr612299 ------
NM_003133chr13713 415 222 3949 375 168 ----
NM_003142chr22259 98 ------
NM_003144chr651909 568 312 162 74 32115 1752 1631 ----
NM_003149chr351371 1298 1095 516 47 11193 --1368
NM_003155chr842399 757 542 407 12736 --12193
NM_003161chr1743234 3042 2977 107 43621 3604 658 589 --12824
NM_003178chr342210 1631 195 116 22030 1934 ----
NM_003182chr72476 386 ------
NM_003182chr72476 386 ------
NM_003184chr8144 ------
NM_003199chr18125347 5225 4800 4382 3895 3745 1652 1484 1362 1102 1081 862 45338 3840 2093 211 1324 15357
NM_003202chr511856 ------
NM_003211chr123677 124 44 ------
NM_003220chr6----21628 1326 --
NM_003242chr332205 1812 282 ------
NM_003247chr651833 1737 1594 678 28 1329 ----
NM_003257chr1551266 1156 956 492 450 ------
NM_003262chr355140 4739 4725 4458 119 11499 34113 590 551 --
NM_003272chr14710 673 282 156 ------
NM_003274chr2142835 2266 1827 43 12984 ----
NM_003291chr132210 88 1752 ----
NM_003298chr396194 6095 5965 5458 5157 4050 1352 439 202 45831 5320 4181 941 16153 --
NM_003299chr12--1190 ----
NM_003330chr1231832 1215 241 --11239 --
NM_003336chrX51126 959 790 233 199 ------
NM_003337chr52600 168 ----1426
NM_003338chr1021265 680 11674 1283 --
NM_003340chr431432 983 292 21385 878 ----
NM_003341chr32253 236 ------
NM_003342chr1763323 2667 2380 2042 335 164 12590 ----
NM_003350chr81191 1718 --178
NM_003352chr21779 ----1308
NM_003360chr41188 ------
NM_003372chrX4930 888 622 607 ------
NM_003373chr1041978 1820 1659 715 11650 ----
NM_003385chr24750 338 235 40 1394 ----
NM_003392chr364185 3204 3116 3096 2894 1681 23837 3063 ----
NM_003405chr22----1588 1584
NM_003406chr851905 1328 1270 706 505 21881 693 ----
NM_003410chrX53094 3070 2472 998 849 12445 ----
NM_003411chrY1576 ------
NM_003413chrX31913 1876 478 ------
NM_003418chr33710 662 219 1838 ----
NM_003421chr1084495 1781 1264 654 528 324 249 148 11699 ----
NM_003423chr1972568 2026 1620 821 712 561 143 4629 501 281 31 ----
NM_003468chr274357 4339 3710 3294 2826 1633 1331 11007 ----
NM_003471chr312268 31558 851 372 2855 791 --
NM_003473chr10152 ------
NM_003478chr1133246 2146 362 33370 2029 435 --1496
NM_003483chr121915 21918 1893 --1269
NM_003489chr2173476 2986 2935 2506 986 588 328 22818 303 ----
NM_003498chr161310 ------
NM_003505chr7--21598 1348 ----
NM_003566chr1252869 1307 384 374 57 33382 338 267 33156 2584 296 --
NM_003569chr6--1450 ----
NM_003576chr1362713 2502 2323 655 319 270 1699 ----
NM_003580chr84473 200 89 45 ------
NM_003583chr1263512 3202 2814 1392 1141 186 1142 ----
NM_003590chr254067 2620 1407 1283 437 31633 1030 1017 ----
NM_003597chr2--12290 ----
NM_003603chr421730 1353 3864 808 691 21500 109 --
NM_003607chr184142 2713 1455 1326 977 610 566 551 31242 667 315 1509 --
NM_003613chr155710 529 287 278 64 1487 ----
NM_003615chr363724 2928 2644 1511 725 442 23525 1122 --13327
NM_003618chr221175 298 1361 ----
NM_003624chr1911440 ------
NM_003626chr112337 328 --2979 974 --
NM_003629chr153343 2934 718 683 384 13511 1981 --
NM_003633chr542576 704 685 287 11989 --11911
NM_003642chr2148 ------
NM_003659chr231124 1070 841 11113 ----
NM_003663chr332777 663 124 ------
NM_003668chr12154 ------
NM_003672chr131295 279 193 ------
NM_003677chr1252079 2052 1961 1912 484 12025 ----
NM_003685chr191942 ------
NM_003688chrX2245 233 ------
NM_003692chr91909 1260 ----
NM_003713chr141425 1296 1279 89 11320 ----
NM_003722chr331908 526 344 21691 400 12390 --
NM_003744chr14--21295 339 ----
NM_003749chr1362385 2343 2093 1557 1510 389 11652 32126 1714 599 11585
NM_003750chr101784 ------
NM_003759chr464084 3936 3417 1334 1240 311 21644 1580 ----
NM_003764chr61237 1788 ----
NM_003772chr111122 21250 1158 ----
NM_003774chr1272874 2313 2199 1353 845 799 201 31145 1009 321 ----
NM_003783chr13964 930 300 3981 486 401 21206 1197 --
NM_003794chr33812 353 154 ------
NM_003797chr112132 62 ------
NM_003800chr662417 1608 1540 1487 187 171 1591 ----
NM_003816chr84557 391 265 186 ------
NM_003822chr143056 2639 722 461 ----12215
NM_003825chr1521215 523 ------
NM_003829chr931217 926 62 ----1854
NM_003850chr132464 199 ------
NM_003858chr144599 583 213 103 1659 ----
NM_003861chr1442205 1961 746 663 ------
NM_003872chr233003 1156 170 ----12986
NM_003877chr122999 49 --1764 --
NM_003887chr222261 117 --11668 --
NM_003895chr2131932 1839 102 21817 632 ----
NM_003899chr1392571 2548 2462 2355 2132 1983 1019 876 364 ------
NM_003902chr14292 253 149 71 --2855 305 --
NM_003913chr674104 1327 849 445 248 241 73 23709 2861 14315 --
NM_003919chr7183 ------
NM_003921chr121160 98 1115 21624 343 1120
NM_003922chr15143 1150 ----
NM_003930chr71405 2203 192 11843 --
NM_003934chr941184 1137 860 220 ------
NM_003939chr1073623 3390 3137 598 467 451 218 22574 768 23948 3776 --
NM_003941chr762505 1920 1689 466 426 328 2971 314 ----
NM_003951chrX284 72 1303 ----
NM_003955chr1711247 ------
NM_003958chr643729 2853 2747 2565 2959 467 13766 --
NM_003966chr5147356 6796 6777 6758 5877 5533 5347 4797 2945 1220 1053 635 420 113 --27022 3005 14996
NM_003968chr32619 242 ------
NM_003971chr17178 ------
NM_003972chr104860 551 130 97 122 ----
NM_003980chr611163 ------
NM_003985chr171651 1682 ----
NM_003994chr1233481 3009 1408 84212 3538 3287 2949 1616 1053 926 651 11503 --
NM_004028chr1873833 3023 2682 2577 1145 842 623 23534 1423 22843 828 --
NM_004035chr1775027 4356 4181 3870 3248 751 259 33560 238 185 --11177
NM_004040chr21891 ------
NM_004050chr14--12420 ----
NM_004060chr51468 21028 527 11074 11070
NM_004067chr741247 588 553 424 --3483 478 294 --
NM_004075chr12--1223 ----
NM_004077chr1221129 255 11362 ----
NM_004093chr1342888 2494 2100 54 --32946 895 425 --
NM_004094chr1442860 636 383 322 12952 11965 --
NM_004099chr932053 1918 120 1491 22097 2060 11782
NM_004100chr641719 978 440 70 22434 548 --1690
NM_004113chr341539 820 424 197 ------
NM_004114chrX1314 1349 ----
NM_004116chr22446 353 1465 ----
NM_004117chr642204 1434 485 332 190 ----
NM_004124chr1483257 3193 3163 2917 2760 2630 754 88 ------
NM_004133chr812591 --1200 --
NM_004161chr211210 ------
NM_004162chr331274 973 489 --21067 832 --
NM_004170chr941645 1419 733 450 11661 1608 --
NM_004171chr11189548 8998 8713 8168 8137 8080 8053 6937 3090 2999 2739 2558 2020 1928 1369 308 195 97 79413 8942 8437 7228 5872 5858 1417 ----
NM_004187chrX21443 1177 ------
NM_004215chr82374 208 1585 ----
NM_004225chr811310 ------
NM_004229chrX52213 1966 1932 1885 1771 1839 ----
NM_004232chr1873216 1375 1185 728 283 259 241 23332 3171 ----
NM_004253chr91338 ------
NM_004272chr551837 1445 1373 502 328 1287 ----
NM_004275chr611435 ------
NM_004280chr6155 179 ----
NM_004281chr101494 ------
NM_004296chr1463959 3752 3514 3449 3338 1234 11153 13083 --
NM_004304chr2----1325 --
NM_004311chr1031063 994 22 1757 13112 12538
NM_004319chr152937 2771 2302 2043 224 --12616 --
NM_004326chr11155 ------
NM_004329chr1011159 ----1926
NM_004338chr18127049 6279 5510 5385 5161 5069 4734 4680 4630 2469 1381 963 31539 1077 542 1804 26269 987
NM_004342chr752265 2011 1779 884 534 ------
NM_004343chr19--1534 ----
NM_004380chr1622060 454 1442 ----
NM_004384chr552238 2210 2161 1600 783 1740 --1758
NM_004389chr21337 ------
NM_004392chr1322611 223 22559 503 ----
NM_004396chr172235 208 --2270 114 --
NM_004397chr1134077 3911 3556 ------
NM_004407chr42899 59 1345 ----
NM_004411chr71694 ------
NM_004414chr2151318 1294 1166 431 170 --11332 1460
NM_004438chr243060 2626 1082 549 13295 ----
NM_004440chr661707 1651 1377 1358 623 308 1669 ----
NM_004449chr2161337 1330 1159 922 415 314 1352 ----
NM_004456chr71216 ------
NM_004458chrX92583 2554 2536 1851 964 606 367 339 194 193 ----
NM_004464chr454003 2721 2635 385 140 13318 13916 --
NM_004466chr131677 ----191
NM_004474chr111057 ------
NM_004480chr144686 658 228 198 ------
NM_004496chr1431263 1168 974 ----1161
NM_004499chr51450 ------
NM_004500chr143797 760 525 22075 485 1492 --
NM_004501chr143945 1561 1353 1204 1660 ----
NM_004504chr252384 1004 820 658 547 ------
NM_004505chr1741875 1588 781 98 11569 11850 11411
NM_004506chr61210 ------
NM_004516chr191247 ------
NM_004519chr8134 ------
NM_004521chr101131 ------
NM_004523chr1011214 ----1509
NM_004525chr221517 1071 --1195 --
NM_004543chr23340 119 54 ------
NM_004557chr61133 ------
NM_004580chr152509 349 1674 ----
NM_004586chrX105486 4574 4281 4176 3912 3515 1788 659 507 122 53788 2037 1418 1063 644 ----
NM_004592chr121210 ------
NM_004595chrX1159 ------
NM_004598chr543137 2848 2138 1160 --1320 --
NM_004602chr2011457 21313 945 ----
NM_004612chr953300 3149 1570 1401 462 44476 4256 3644 3196 11411 14324
NM_004630chr1111088 ------
NM_004642chr122533 252 1470 1453 --
NM_004654chrY--11189 ----
NM_004660chrY41609 858 687 361 12238 11940 --
NM_004670chr1031293 383 97 21675 683 ----
NM_004684chr41321 ------
NM_004687chr1712082 --1587 --
NM_004709chrX21472 1214 1682 1686 --
NM_004713chr14--1799 ----
NM_004718chr23624 473 160 ------
NM_004719chr1282607 2413 2401 448 370 342 319 290 2396 48 ----
NM_004725chr1041519 1196 1047 182 ----1946
NM_004726chrX65781 5448 4609 3997 1020 850 23567 1164 13720 --
NM_004730chr531996 1647 749 21595 635 1683 --
NM_004734chr1342700 2460 442 214 22578 2241 ----
NM_004738chr2092637 2159 770 726 705 624 268 204 95 1178 ----
NM_004745chr886747 5147 2052 1877 1580 1082 901 790 32601 2172 1895 24741 4550 15617
NM_004768chr14958 903 392 69 ------
NM_004774chr1782990 2714 2570 2069 1041 957 435 383 ------
NM_004779chr51330 ------
NM_004788chr1152590 1965 992 190 41 ------
NM_004789chr91163 1404 ----
NM_004795chr1351769 1319 1215 553 444 1187 --1295
NM_004798chr2063144 3017 2891 1032 654 224 13632 11058 --
NM_004815chr1103751 3623 3615 3405 3129 3114 1388 659 481 307 21836 423 1850 13189
NM_004820chr8--188 ----
NM_004821chr51183 ------
NM_004822chr1753823 3723 3150 2711 1053 --13837 --
NM_004827chr441725 1376 426 419 1442 ----
NM_004834chr293361 3159 3083 2786 2365 2090 1142 981 540 22481 1362 21366 226 --
NM_004855chr152183 142 ------
NM_004859chr1773096 1878 1067 524 477 405 225 ----11968
NM_004866chr564727 4083 1851 1084 789 194 24741 525 14460 --
NM_004869chr1851775 1362 1308 1117 528 ----1416
NM_004871chr1754287 3804 3576 681 656 1120 14086 --
NM_004873chr1453196 2887 913 875 319 12838 ----
NM_004874chr8--1206 ----
NM_004879chr11----1882 --
NM_004902chr203687 547 159 ------
NM_004904chr796162 5881 5428 5201 2496 2109 1936 1381 597 26611 2229 ----
NM_004906chr62632 69 ------
NM_004926chr1421692 1527 31735 1700 1425 ----
NM_004929chr81346 21109 942 ----
NM_004936chr982783 2000 1988 1200 1038 436 422 308 ----11067
NM_004949chr1851977 1487 1318 871 350 2517 507 12006 --
NM_004956chr744123 3755 1104 1098 --22842 1174 --
NM_004966chr101688 ------
NM_004973chr611562 ------
NM_004974chr1142 ------
NM_004985chr1264262 3198 1728 1401 844 221 34530 4243 520 ----
NM_004990chr12158 ------
NM_004992chrX68472 7651 6902 1842 1723 412 26752 2778 21861 1748 --
NM_004992chrX68472 7651 6902 1842 1723 412 26752 2778 21861 1748 --
NM_004995chr1411522 ------
NM_004999chr664464 4286 4141 3771 672 600 11478 ----
NM_005010chr781642 1605 1559 836 724 460 307 193 32095 253 187 1737 --
NM_005016chr12--1277 ----
NM_005032chrX2994 701 --11081 --
NM_005034chr82636 218 1254 ----
NM_005036chr22138309 7820 7424 6085 5703 5124 3118 3001 2899 2485 1724 915 432 22253 1826 1290 --
NM_005045chr71618 ------
NM_005056chr1274246 3426 2089 1231 1118 728 55 13831 ----
NM_005063chr1073497 3171 2429 2391 729 718 81 1572 12765 --
NM_005065chr1495295 5289 4781 3922 3901 3662 2107 1815 214 34964 4623 4503 ----
NM_005066chr11166 ------
NM_005093chr2085305 5220 4017 3651 1621 1413 860 347 25146 3605 ----
NM_005099chr11145 11367 ----
NM_005116chr2063421 3098 2960 1716 1542 1145 13991 ----
NM_005121chr1742605 2504 1208 465 ------
NM_005135chr1553210 1231 866 392 225 1491 ----
NM_005156chr985258 5251 3770 3609 3534 1865 668 631 45211 1583 1543 1359 24761 1289 --
NM_005171chr121992 1924 ----
NM_005180chr1021066 463 ------
NM_005188chr1156946 6480 6236 1101 211 11350 16697 --
NM_005192chr14--1100 ----
NM_005197chr1475678 4625 4036 2018 1974 1350 621 --11251 --
NM_005207chr2273376 2707 1480 1244 1073 624 151 32382 1458 925 12786 --
NM_005214chr24996 773 437 259 11099 ----
NM_005219chr541688 1594 1195 1187 11738 1201 --
NM_005230chr12--1405 ----
NM_005233chr321638 1610 12563 12542 --
NM_005235chr2127122 6860 6586 5548 5435 5226 4858 2854 2786 1077 284 210 47760 1355 276 135 16315 --
NM_005238chr1141131 945 797 476 23446 1388 ----
NM_005243chr221303 ------
NM_005249chr142715 180 ------
NM_005252chr141552 ------
NM_005254chr151187 21071 1053 21150 942 --
NM_005256chr111165 ------
NM_005259chr21399 --1945 --
NM_005277chr451909 1303 715 709 35 21933 293 ----
NM_005302chr71341 194 ----
NM_005308chr101538 ------
NM_005311chr722714 1774 22328 2178 1765 12661
NM_005339chr464338 3278 3074 3029 1084 943 43926 1363 1261 786 ----
NM_005358chr136729 545 536 445 431 218 11223 ----
NM_005359chr1886378 5791 5013 3997 2130 919 532 282 --16221 --
NM_005378chr22835 768 1806 ----
NM_005385chr332679 2587 1761 21793 64 ----
NM_005388chr941552 1499 1363 394 21388 1211 ----
NM_005400chr283042 2911 2304 1190 825 541 218 30 12709 12824 --
NM_005406chr1841532 1145 992 533 1224 ----
NM_005433chr1852675 1004 961 627 180 11751 ----
NM_005435chr71529 ------
NM_005436chr1074154 3789 1525 1318 1085 521 161 --1855 --
NM_005438chr11144 ------
NM_005443chr41198 ------
NM_005450chr172198 174 ------
NM_005455chr11109 31821 1705 694 1146 11249
NM_005458chr942359 2026 1747 1584 12403 ----
NM_005460chr52550 173 ------
NM_005465chr111779 ------
NM_005487chr222707 147 1432 --1294
NM_005497chr1741662 1192 815 413 35960 4747 1002 15431 --
NM_005499chr191509 1501 1256 --
NM_005502chr953247 2505 1202 408 188 12922 --3157 147 142
NM_005504chr12105952 5907 5428 4430 1750 1515 1203 597 128 111 45860 4299 363 244 15407 --
NM_005509chr551163 1157 216 143 98 ----11545
NM_005520chr5--1119 ----
NM_005522chr74961 916 872 445 ------
NM_005523chr731226 495 122 11128 11132 --
NM_005542chr721751 372 21839 1766 ----
NM_005561chr133967 897 120 ----1986
NM_005563chr12223 112 ------
NM_005566chr11--1487 --1512
NM_005578chr342034 1847 1194 525 --24886 1593 --
NM_005593chr122521 490 1535 ----
NM_005596chr965683 5303 5274 4453 1933 51 35610 1300 881 12116 --
NM_005603chr1831998 1725 1688 11947 --11897
NM_005604chr642580 2306 2259 403 --12356 --
NM_005610chr11128 ------
NM_005618chr61565 ------
NM_005627chr62904 708 1887 ----
NM_005639chr1231381 1203 161 ------
NM_005644chr1194 --2130 34 --
NM_005665chr154561 4479 4354 3713 3095 33677 3629 292 ----
NM_005667chr24388 179 105 70 ------
NM_005668chr5104021 4009 3875 3715 3618 3274 1658 1451 588 243 14423 24308 276 --
NM_005685chr7--150 ----
NM_005722chr262101 1978 989 906 310 34 ------
NM_005731chr21336 ------
NM_005732chr5133 31467 1382 1018 --1296
NM_005737chr252923 2087 901 170 132 --12665 --
NM_005738chr751656 1399 643 589 175 ------
NM_005739chr1532369 2337 64 32401 2353 216 ----
NM_005746chr721911 175 1856 ----
NM_005749chr173562 534 34 1616 ----
NM_005756chrX41312 1175 478 71 ------
NM_005759chr273937 3189 2903 1758 1642 575 206 24576 4103 ----
NM_005775chr8--1746 ----
NM_005777chr31114 ------
NM_005779chr543224 3102 2990 2683 12239 1190 --
NM_005786chr1811127 21042 808 11185 --
NM_005800chr13160 1126 ----
NM_005801chr172781 714 1107 ----
NM_005813chr252601 2454 2357 954 92 --1940 --
NM_005819chr163409 2951 2902 2871 2598 551 --22287 407 --
NM_005832chr331302 327 313 21328 139 ----
NM_005840chrX87006 6972 6729 5585 2933 2507 1697 1188 16993 21443 348 1334
NM_005841chr421181 1099 ------
NM_005857chr141511 1202 1065 505 ------
NM_005868chr722306 318 ------
NM_005870chr1321134 116 ------
NM_005882chr41702 1936 ----
NM_005885chr551528 1335 1202 285 111 ------
NM_005895chr1264004 2910 2667 599 297 53 14138 23361 3250 --
NM_005901chr18138284 8156 8116 6949 6226 6166 5850 5766 2578 2096 1965 955 317 48271 2054 1155 39 ----
NM_005902chr1563987 3975 3550 2825 921 472 --33730 762 751 --
NM_005903chr565152 2067 1106 806 323 216 --1763 --
NM_005904chr1841512 1368 1337 1255 11390 ----
NM_005909chr554189 2614 978 961 722 2412 146 22998 1140 --
NM_005935chr465196 4539 1714 1654 1433 24 25254 256 ----
NM_005941chr844220 2689 270 195 23725 3637 33422 2593 1457 13253
NM_005955chr164825 4727 3509 1897 865 61 24701 1598 14849 11084
NM_005964chr1751304 1193 1157 512 49 ------
NM_005966chr252394 2144 1966 484 304 --2638 311 --
NM_005968chr191184 ------
NM_005985chr201584 ------
NM_005986chr1352532 2202 1898 650 451 1860 1684 --
NM_006003chr191236 ------
NM_006007chr962756 1307 1244 276 199 75 64514 4348 3963 2732 938 347 ----
NM_006011chr1553876 1407 1285 1190 867 --11671 --
NM_006024chr71303 ------
NM_006029chr142264 26 ----2519 205
NM_006033chr1822291 1509 ------
NM_006036chr262543 2329 2307 2045 1012 188 11683 ----
NM_006037chr241260 1219 803 736 --11161 --
NM_006038chr2032142 1850 1504 ------
NM_006040chr1661270 463 333 323 311 145 11432 ----
NM_006041chr17170 ------
NM_006047chr2082976 2817 2487 2414 2340 1326 1164 52 13298 ----
NM_006048chr121226 860 ------
NM_006060chr774021 3657 3457 1521 1374 1331 109 13801 13380 --
NM_006064chrX1263 ------
NM_006070chr3127 1398 ----
NM_006076chr762756 1971 1290 1116 973 120 --12428 --
NM_006080chr772771 2615 2552 2211 1034 657 224 42959 2600 2593 70 ----
NM_006089chrX41729 1702 1386 320 21747 1309 ----
NM_006090chr11107 ------
NM_006095chr494386 4121 3451 3249 3107 1273 1193 996 873 33609 643 585 13743 --
NM_006106chr1193345 3311 3137 2931 2592 2576 977 494 177 22695 2172 ----
NM_006134chr21--11444 ----
NM_006136chr71840 1855 ----
NM_006139chr262765 2724 1993 549 221 123 ------
NM_006141chr1672614 2608 2471 1714 1102 616 167 52461 1933 1066 988 951 ----
NM_006154chr1582774 2719 2586 1790 1136 1068 941 427 --12261 --
NM_006158chr831136 268 153 11728 ----
NM_006159chr122512 105 ------
NM_006186chr21334 1385 ----
NM_006194chr1411290 11204 ----
NM_006195chr941338 1202 192 45 21004 374 ----
NM_006196chr2--1272 ----
NM_006197chr842180 465 357 279 195 147 --
NM_006206chr452886 2023 683 495 206 1702 21006 78 12072
NM_006209chr81163 --1293 --
NM_006218chr31226 ------
NM_006224chr1742289 1656 531 494 ------
NM_006226chr21138 ------
NM_006237chr1312019 ------
NM_006241chr351663 957 768 655 104 ------
NM_006247chr19198 ------
NM_006251chr543074 2779 2508 2251 2545 122 11118 12657
NM_006252chr1127340 6955 6904 6357 5650 5459 5370 2303 1496 1202 951 133 37081 6973 3027 15904 26695 323
NM_006267chr211406 21574 119 ----
NM_006281chr8--1803 ----
NM_006281chr8--1803 ----
NM_006283chr854315 4290 3131 1087 223 24143 1251 11196 1162
NM_006290chr641573 1277 589 157 11949 ----
NM_006292chr111169 ------
NM_006298chr683005 2863 2794 2304 1364 956 234 166 ----12237
NM_006300chr1942103 1958 1866 210 12381 ----
NM_006307chrX1300 ------
NM_006310chr1721348 131 1225 1491 --
NM_006313chr1251496 1442 1246 535 470 21627 122 ----
NM_006321chr322212 1383 1438 ----
NM_006323chr43670 545 268 3584 576 110 ----
NM_006330chr851667 1401 1330 1179 537 1264 ----
NM_006343chr21442 1363 ----
NM_006346chr131111 ------
NM_006352chr132028 1858 804 ------
NM_006359chrX22278 1743 1994 183 --
NM_006364chr141923 ------
NM_006366chr641220 1110 449 421 ------
NM_006375chrX41817 1662 1648 1302 11260 ----
NM_006379chr742282 2085 2016 441 12051 --11809
NM_006380chr1753820 3158 1467 927 736 2845 618 1998 1675
NM_006393chr1084520 3207 3188 1034 400 330 286 37 11065 ----
NM_006403chr641489 1302 363 306 ------
NM_006434chr1032139 620 597 32575 2220 403 2956 819 --
NM_006449chr221556 1445 11665 12081 --
NM_006451chr52373 124 ------
NM_006457chr433963 3728 3089 --13985 --
NM_006460chr1721645 273 31114 381 57 11778 --
NM_006464chr244657 4524 4429 2911 --14618 --
NM_006482chr1263512 3202 2814 1392 1141 186 1142 ----
NM_006489chr143634 306 139 1124 ----
NM_006496chr151837 1682 1563 1528 1469 ----11848
NM_006504chr1082862 2786 2604 2445 1109 860 398 188 12924 --1474
NM_006519chr6----1118 --
NM_006520chrX31508 1471 220 21258 1199 ----
NM_006526chr2051911 522 470 387 43 ------
NM_006529chr451579 1407 1271 358 282 124 ----
NM_006530chr121466 ------
NM_006538chr273606 2841 2631 1583 1381 1032 771 2749 216 ----
NM_006539chr16--1507 ----
NM_006540chr871401 1368 1192 991 564 330 320 2424 254 ----
NM_006544chr14105698 5539 4963 4671 4315 4139 1996 1219 922 244 24155 1857 13818 --
NM_006546chr1794584 4533 4262 2383 2109 1616 1482 1459 527 26357 518 11442 --
NM_006547chr752098 816 336 192 169 ------
NM_006548chr341698 1141 359 38 ------
NM_006557chr921702 117 11607 ----
NM_006561chr1075776 3905 3888 3768 1358 713 244 12334 1750 --
NM_006572chr1783419 3214 3175 2672 772 691 331 206 ------
NM_006575chr1451205 900 560 505 284 ------
NM_006595chr1121978 1931 22031 372 11443 --
NM_006599chr16107254 7040 6638 6341 5022 3171 2940 2649 1194 187 57314 6246 5989 3261 2667 11462 --
NM_006609chr232992 2966 241 12918 12425 --
NM_006614chr353367 3175 3155 1416 1190 32591 459 230 ----
NM_006620chr694770 4736 4302 3953 1877 1487 467 89 65 --22945 342 24171 3972
NM_006621chr13746 401 354 12004 ----
NM_006624chr1042153 2077 845 165 21424 374 11564 --
NM_006628chr1564626 3961 3485 1758 1355 1079 34513 3178 1364 1183 --
NM_006629chr1882524 1882 1132 1104 1038 955 792 726 22816 864 --12646
NM_006633chr54770 736 596 145 ------
NM_006646chr1362961 2891 2027 1215 288 115 ------
NM_006654chr12114622 4177 4022 3242 3222 3135 3071 2996 405 235 158 33691 3429 58 1367 --
NM_006670chr61624 1179 ----
NM_006675chr1243332 2508 2319 2230 ----22189 503
NM_006681chr44143 125 52 34 ------
NM_006682chr722876 2616 31899 1846 1818 21974 165 1936
NM_006698chr202321 154 ------
NM_006717chr993284 3167 2950 2810 2793 1106 1012 879 44 12184 --22673 343
NM_006722chr353028 2973 2846 580 469 32175 392 371 ----
NM_006726chr41952 2501 84 ----
NM_006727chr51423 ------
NM_006729chrX65153 3955 3730 1726 102 51 11352 35388 4256 1600 --
NM_006746chrX51428 1383 1356 1091 51 21401 1349 ----
NM_006750chr16107984 7774 7645 7569 6625 6179 2011 1652 1126 104 26471 5530 ----
NM_006751chr2129 ------
NM_006763chr132154 2125 2106 ------
NM_006766chr852234 1887 1715 394 362 ------
NM_006775chr692781 2750 2395 1230 985 901 546 456 441 22864 657 1106 --
NM_006777chrX42678 1903 1869 890 ------
NM_006790chr51325 ------
NM_006791chr151556 --1583 --
NM_006805chr521430 1248 11300 ----
NM_006807chr17--11325 ----
NM_006811chr204758 400 164 156 1317 ----
NM_006813chr61582 ------
NM_006823chr831000 337 65 ------
NM_006826chr241120 464 354 280 ------
NM_006827chr1443254 3131 2431 281 22536 884 11358 --
NM_006832chr1461070 917 902 795 386 371 1726 ----
NM_006838chr124532 511 501 456 1168 ----
NM_006851chr1292875 2463 2193 2169 2157 2028 1982 771 620 1880 ----
NM_006852chr1762792 2266 949 682 664 346 12085 ----
NM_006873chr223201 506 --12372 13121
NM_006877chr61345 ------
NM_006885chr1664075 4042 3301 3106 1579 646 22803 487 23957 3721 12721
NM_006886chr201132 ------
NM_006895chr231705 1456 97 11831 ----
NM_006908chr721028 118 21474 204 ----
NM_006910chr16--165 ----
NM_006912chr142530 477 237 38 1269 --11735
NM_006914chr981298 1240 1176 1071 968 427 61 37 1158 ----
NM_006915chrX42361 746 355 102 22082 1762 ----
NM_006916chr221046 538 1199 --184
NM_006918chr1155363 4570 1409 1392 853 1423 ----
NM_006920chr252033 1825 251 135 94 ------
NM_006922chr262550 2408 2151 418 381 129 1713 ----
NM_006924chr1764075 3139 2727 1653 1100 756 13428 1942 13205
NM_006925chr141368 ------
NM_006930chr52797 213 21522 1347 ----
NM_006931chr1252178 1990 1693 1473 1440 11821 ----
NM_006940chr124509 372 342 248 11744 ----
NM_006981chr91300 1610 --12991
NM_006996chr111806 ------
NM_007007chr12114279 4265 3765 3625 3272 3005 1828 1728 1467 850 782 21838 1331 ----
NM_007011chr1545944 5746 4930 447 35506 5117 4791 --16731
NM_007029chr8188 ------
NM_007038chr21155824 5778 4394 4368 4350 2372 2164 2006 1948 1460 1179 1084 1033 760 54 1262 34519 4159 942 --
NM_007050chr20118056 7895 6581 6473 5040 4920 2807 2291 2169 1792 1020 26264 5796 27506 3189 --
NM_007084chr1321346 124 ------
NM_007106chr1342807 2769 2488 247 --11788 --
NM_007114chr342878 1136 707 472 23309 36 12026 --
NM_007118chr54854 810 577 149 ------
NM_007124chr661354 1273 1234 471 297 24 ------
NM_007129chr1321049 721 ------
NM_007137chrX31603 408 180 22048 332 1478 1736
NM_007146chr1731893 1815 502 ------
NM_007158chr12778 198 ------
NM_007174chr1221999 714 ------
NM_007175chr83984 373 326 23167 2860 ----
NM_007187chr133687 347 119 ------
NM_007195chr1843375 2857 962 526 1192 ----
NM_007198chr811518 ------
NM_007203chr953997 3536 2666 1462 1211 22998 100 13461 13964
NM_007212chr162285 2205 1987 1825 1657 602 ------
NM_007217chr31351 ------
NM_007218chr81113 1345 ----
NM_007222chr821493 1144 2570 239 11397 21481 201
NM_007242chr161160 ------
NM_007249chr1398373 7015 6250 6220 5908 3741 2257 2248 986 29147 8300 12933 --
NM_007257chr862830 2408 2226 1980 260 68 --22502 2231 --
NM_007269chr11413 ----191
NM_007287chr352889 2381 2308 1172 233 1735 --1317
NM_007288chr352889 2381 2308 1172 233 1735 --1317
NM_007289chr352889 2381 2308 1172 233 1735 --1317
NM_007292chr1775027 4356 4181 3870 3248 751 259 33560 238 185 --11177
NM_007325chrX31847 596 169 2632 626 --1203
NM_007347chr1543070 3034 2916 438 13213 ----
NM_007353chr741121 1027 510 495 22601 2005 1486 --
NM_007358chr13464 451 161 21768 1607 ----
NM_007363chrX11055 ------
NM_007375chr152783 2640 2243 1834 962 --12114 --
NM_012072chr20114116 3840 3055 3020 1342 1094 1031 951 805 710 277 34347 3235 592 23089 1633 12916
NM_012089chr131115 1079 993 140 --11198
NM_012096chr383743 3591 2968 2859 1066 1006 611 201 23525 961 12492 --
NM_012115chr62599 440 ------
NM_012120chr662765 2571 2297 1982 568 435 22664 2624 ----
NM_012141chr1333072 2662 466 22961 1610 ----
NM_012154chr82696 207 1849 ----
NM_012158chr1341884 1808 1774 41 1371 ----
NM_012161chr431100 1027 283 ------
NM_012164chr957229 5029 1017 530 265 12258 25430 122 14685
NM_012197chr931512 478 102 ------
NM_012199chr174600 4292 3615 1513 796 776 319 ------
NM_012207chr10--1878 ----
NM_012214chr2126196 5952 5367 5350 4550 4165 2013 1747 816 802 602 587 21802 570 ----
NM_012215chr101298 1776 ----
NM_012218chr1973006 2115 1977 1118 511 394 353 ----1577
NM_012219chr342418 844 575 408 1754 12260 --
NM_012234chr343418 3265 2440 728 ------
NM_012238chr1021523 715 1385 ----
NM_012243chr11618 1846 ----
NM_012249chr253560 1423 751 672 524 11074 ----
NM_012250chr111443 ------
NM_012252chr7115352 4528 4490 4406 4251 4033 3258 1911 1390 1338 513 ------
NM_012255chr201426 ------
NM_012262chr155096 4949 4239 3539 3320 34456 4177 1402 ----
NM_012281chr762287 2117 1975 1790 478 99 32310 1587 338 1948 --
NM_012286chrX2544 101 --1571 --
NM_012287chr394498 4441 4378 3124 1817 1285 619 570 48 12856 ----
NM_012294chr793703 3124 2852 1550 1526 1405 917 836 597 23547 1376 1975 --
NM_012297chr452073 1781 1009 474 365 3881 705 385 ----
NM_012300chr51781 42247 1014 281 134 12498 --
NM_012301chr721832 1741 11446 1281 --
NM_012302chr1--11149 ----
NM_012309chr11104828 3515 3049 1971 1878 1777 1457 655 544 532 --34885 4820 363 --
NM_012325chr2031492 1442 137 31504 446 339 11135 --
NM_012330chr1031525 1494 316 1106 1481 --
NM_012333chr111133 ------
NM_012340chr20----1221 --
NM_012343chr52778 32 ----1399
NM_012382chr573795 3351 1800 1400 542 330 300 24137 4096 ----
NM_012399chr222617 30 21939 341 --1429
NM_012406chr1261283 1266 993 957 824 281 137 ----
NM_012416chr91233 1955 ----
NM_012421chr11132 ------
NM_012425chr1062764 2047 2007 895 136 89 31863 1051 622 ----
NM_012426chr161369 ------
NM_012428chr154956 355 324 183 1992 ----
NM_012433chr2127 ------
NM_012434chr641659 1078 629 35 ------
NM_012464chr442583 1941 1908 1057 11887 11961 --
NM_012482chr12632 230 139 --1121
NM_013230chrY2516 78 11242 ----
NM_013231chr1483730 3192 3144 2774 985 651 289 109 34139 3255 509 ----
NM_013233chr211285 11389 ----
NM_013243chr1551295 1247 1192 1181 1010 ------
NM_013255chr7118863 8844 8477 8419 7708 7588 2791 2727 2678 2319 1977 27140 1228 13466 --
NM_013257chr821588 138 22338 517 11845 11609
NM_013261chr452556 1166 1133 652 401 33002 1330 1219 12331 13249
NM_013262chr631282 586 363 ------
NM_013269chr1233271 1444 1084 33759 3068 1228 1837 12756
NM_013281chr2011286 31179 959 432 1117 --
NM_013283chr51791 2828 633 ----
NM_013293chr71244 ------
NM_013296chr12418 398 ----1432
NM_013316chr731031 381 29 2777 149 --1154
NM_013320chr121140 ------
NM_013352chr61362 ------
NM_013372chr1563146 2930 2547 2251 1088 38 42751 2171 2086 573 13031 --
NM_013374chr363149 2107 2014 976 591 118 3897 818 95 ----
NM_013377chr12179 ------
NM_013380chr191723 2285 80 ----
NM_013381chr1242213 530 301 78 ------
NM_013437chr861354 1258 905 438 203 104 ------
NM_013444chrX61159 957 473 307 139 30 11047 ----
NM_013943chr183245 2960 2943 2648 1054 1036 413 353 1948 ----
NM_013986chr221303 ------
NM_013989chr1465001 4284 3768 3148 1512 312 13178 ----
NM_013995chrX62216 2149 969 861 796 588 ------
NM_013996chr72476 386 ------
NM_013996chr72476 386 ------
NM_013997chr72476 386 ------
NM_013997chr72476 386 ------
NM_013998chr72476 386 ------
NM_013998chr72476 386 ------
NM_014000chr1041978 1820 1659 715 11650 ----
NM_014011chr262612 2321 2140 1926 1631 524 1498 21007 734 --
NM_014043chr331572 1561 1032 1183 162 --
NM_014044chr21180 ------
NM_014048chr1655192 3976 3245 1695 768 54905 4625 3742 1345 652 ----
NM_014060chrX186 ------
NM_014079chr33907 833 103 ------
NM_014106chr153620 168 70 ----11928
NM_014109chr841211 1120 1108 996 1500 ----
NM_014112chr8135409 4876 3943 3773 2083 1635 1505 1421 1305 1116 776 767 594 35067 4196 567 14574 25227 3747
NM_014117chr1652722 2206 1871 943 623 22382 779 ----
NM_014141chr773869 3755 3735 2124 959 634 401 24590 4523 11374 11952
NM_014154chr331189 486 315 ----1993
NM_014155chr11127225 7058 6817 6685 6614 6081 5999 5666 2860 2713 2052 208 11038 ----
NM_014166chr13--174 1937 --
NM_014169chr142231 26 ------
NM_014181chr282812 2179 1127 1006 605 571 427 296 12374 2549 360 12379
NM_014191chr1221000 219 --184 1261
NM_014217chr171893 1559 1478 1298 1192 476 236 11752 1332 --
NM_014232chr1721682 1302 ------
NM_014232chr1721682 1302 ------
NM_014250chr222707 147 1432 --1294
NM_014253chrX52447 2176 1680 1552 137 ------
NM_014260chr6--178 ----
NM_014283chr12473 387 ------
NM_014288chr1--1230 --1198
NM_014290chr9157 ------
NM_014294chr82980 922 ------
NM_014309chr2254575 4129 1349 365 270 ----11952
NM_014313chr1182 1511 11308 21354 309
NM_014315chr141175 ------
NM_014317chr101314 ------
NM_014320chr61135 ------
NM_014325chr1221510 380 ----11913
NM_014333chr1152701 2502 2319 2286 570 --12488 --
NM_014372chr152064 1560 685 642 221 ------
NM_014382chr331688 1550 1199 1502 ----
NM_014392chr481460 1335 578 464 327 187 133 26 --11517 --
NM_014393chr81572 ------
NM_014421chr462108 798 234 187 87 53 --1192 --
NM_014423chr5125606 4731 4038 3744 3680 1781 1629 1375 1108 752 405 189 13599 ----
NM_014445chr372416 1854 1752 1746 899 365 191 ------
NM_014447chr4--1185 --21519 1314
NM_014452chr641096 1085 368 163 ----11119
NM_014456chr1031876 1336 624 21840 1371 ----
NM_014458chr12451 162 1989 11063 --
NM_014494chr1632198 1583 457 21530 818 12208 --
NM_014500chrX1248 ----1206
NM_014517chr341776 1391 439 347 ------
NM_014548chr1551216 1147 1055 647 540 --21131 236 --
NM_014572chr1321522 466 1435 ----
NM_014574chr1451499 1488 1324 626 283 11573 ----
NM_014575chr31224 ------
NM_014586chr2154443 3742 3062 2958 1031 14286 ----
NM_014612chr911541 21531 552 11292 --
NM_014615chr1633590 3357 2699 --1217 1180
NM_014618chr91380 1104 ----
NM_014636chr984352 3994 3715 1683 1119 695 415 320 ------
NM_014647chr1631973 868 445 11604 --12069
NM_014655chr1--22340 763 ----
NM_014662chr221450 ------
NM_014666chr521000 943 11179 ----
NM_014667chr372336 1983 1825 815 631 281 236 ------
NM_014670chr231563 1344 1261 21028 283 ----
NM_014674chr343910 3378 3067 2582 13966 23135 1375 --
NM_014676chr111666 11468 1275 --
NM_014679chr1151328 1037 570 382 172 --11063 --
NM_014683chr1751572 1332 861 408 274 22095 1380 ----
NM_014701chr1513433 1945 --1501
NM_014705chr731532 344 334 --3463 399 27 --
NM_014707chr751917 1522 429 163 99 2714 597 ----
NM_014711chr163730 715 470 32055 1825 1446 ----
NM_014717chr191104 1825 ----
NM_014720chr1031736 1550 379 21464 1427 ----
NM_014721chr6107086 5776 4796 2595 1683 1606 463 338 226 202 44747 2197 2100 674 25622 5367 11246
NM_014727chr191316 ------
NM_014732chr16135805 5133 4888 4833 4326 3673 2033 1677 1584 910 761 720 358 ------
NM_014735chrX62005 1883 1858 1792 1522 596 ------
NM_014736chr151212 160 ----
NM_014739chr664004 3952 1417 1338 1251 349 34212 1355 84 ----
NM_014750chr143211 84 43 ------
NM_014751chr851753 697 460 415 312 1446 11944 --
NM_014755chr2114244 4014 3149 3136 2869 1716 1377 1209 818 267 259 33667 3168 773 11633 --
NM_014764chr1221277 867 ----164
NM_014765chr192665 2396 2285 1928 1877 832 744 375 320 22294 2087 ----
NM_014766chr763817 3790 1047 513 500 352 --1184 --
NM_014772chr1832679 2448 1151 13070 ----
NM_014774chr133174 1998 326 12774 ----
NM_014779chr331127 972 469 ------
NM_014782chrX1137 ------
NM_014787chr162824 2739 2231 1934 837 42 12381 ----
NM_014790chr5--1371 ----
NM_014791chr9--1281 ----
NM_014795chr211425 --21321 453 --
NM_014803chr1052916 2049 1882 571 74 12795 11124 --
NM_014804chr1741133 225 197 138 21269 205 1209 --
NM_014810chr12366 150 43334 3236 1461 388 1719 13563
NM_014819chr531886 941 935 32431 2402 372 1207 --
NM_014826chr184142 2713 1455 1326 977 610 566 551 31242 667 315 1509 --
NM_014827chr111638 ------
NM_014829chr5--32356 1494 231 175 --
NM_014832chr1341827 1485 1363 438 22080 1670 ----
NM_014835chr201375 1576 ----
NM_014836chr1051687 1633 1529 1440 703 1536 ----
NM_014839chr132491 2452 300 ----1193
NM_014844chr1464180 2597 1384 1340 1031 1002 13318 ----
NM_014848chr1552445 1035 1000 280 56 31139 832 322 12489 --
NM_014850chr374545 4259 3607 3559 3108 3026 1179 14097 23992 1812 13067
NM_014859chr17----11223 --
NM_014862chr1583416 3134 1202 466 422 340 57 34 14187 ----
NM_014873chr194777 4460 4015 1934 1252 948 849 741 726 24710 3631 11913 --
NM_014877chr17157782 7758 7272 5823 5795 5350 3017 2571 1898 1091 838 545 442 339 87 --16977 --
NM_014888chr761399 1254 628 599 290 239 11379 ----
NM_014892chr61617 ------
NM_014893chrY41768 902 615 497 1127 12132 152
NM_014900chr23988 143 78 ------
NM_014904chr10114017 3845 3730 3481 3434 2980 2717 2634 2581 2527 1314 23573 623 ----
NM_014905chr241621 638 628 260 ------
NM_014906chr1773318 3182 3176 2628 1400 1093 422 23290 131 1373 --
NM_014912chr1043303 3132 912 191 23535 3448 1938 --
NM_014918chr1531050 630 235 ------
NM_014920chr663448 3067 1465 871 391 188 33183 2722 379 --11312
NM_014932chr321753 471 11564 ----
NM_014936chr622609 735 ------
NM_014942chr622586 136 ----12292
NM_014946chr243118 2648 1152 782 2299 186 --2901 180
NM_014947chr192926 2692 2628 2328 2297 1049 963 781 111 12763 ----
NM_014950chr1451672 1661 1297 1145 458 11628 ----
NM_014962chr2052159 2130 171 93 38 42911 2860 2246 1024 12867 1603
NM_014969chr141080 958 292 174 3782 400 395 1316 --
NM_014978chr1041849 1730 1509 227 --1677 1549
NM_014982chr1431951 1265 480 35080 3989 3457 1577 --
NM_014988chr452832 1959 1851 828 466 62812 2608 2422 528 412 338 12334 --
NM_014989chr611493 ------
NM_014990chr1421195 101 ------
NM_014991chr442440 2028 1177 901 23260 3219 12988 12984
NM_014992chr143233 170 146 1761 ----
NM_014996chr33348 156 100 ------
NM_015000chr1242698 2599 1089 177 12350 ----
NM_015002chr1242204 1857 1447 186 1747 ----
NM_015008chr352914 2593 1035 806 43 2788 248 12522 --
NM_015018chr6--140 ----
NM_015020chr1633419 2449 832 32759 869 158 13062 --
NM_015024chr861046 920 574 517 431 424 ------
NM_015025chr252239 2088 1696 565 334 --1940 --
NM_015026chr1274343 4139 1596 1171 1051 700 536 ------
NM_015032chr1352221 2168 1023 775 95 1923 --12664
NM_015039chr164397 3545 3437 1352 1000 251 13813 11322 --
NM_015045chr1061927 1449 1411 1388 814 34 21687 350 11982 --
NM_015046chr972581 2190 2006 1886 659 307 129 ------
NM_015051chr932585 1087 158 12907 --12291
NM_015054chr12--2444 338 ----
NM_015055chr1142789 2533 2461 1148 11840 --12869
NM_015056chr2162354 2170 2027 943 333 46 ------
NM_015057chr132675 538 3627 574 505 --1134
NM_015059chr1553558 1252 1032 1017 195 --11216 --
NM_015071chr546320 5978 2272 97 15317 15765 --
NM_015074chr155009 4703 3196 1372 1063 --24926 4782 --
NM_015076chr654417 4065 2787 1705 450 31436 1409 85 ----
NM_015087chr1342696 2680 2625 107 ------
NM_015092chr1674601 4523 4250 3334 936 760 457 34182 832 103 14487 13439
NM_015100chr141408 1344 690 424 ------
NM_015115chr442944 2821 828 328 ------
NM_015130chr41350 41026 997 433 141 2985 184 --
NM_015137chr821959 826 32629 2606 308 ----
NM_015144chr1674006 2935 2712 2451 1371 511 156 --1268 1570
NM_015149chr142127 2079 1506 239 ----12003
NM_015155chr10113351 2806 2077 1080 644 569 507 484 406 237 70 21199 327 ----
NM_015156chr1463837 3481 2584 1493 1246 713 22667 564 33283 1191 992 --
NM_015172chr151378 1030 288 266 68 11097 ----
NM_015180chr143624 332 22 2702 646 ----
NM_015184chr31154 1478 ----
NM_015186chr92177 69 1389 ----
NM_015192chr2052934 2895 1038 394 219 --1564 --
NM_015196chr4125 ------
NM_015199chr352934 2059 622 267 122 23030 848 ----
NM_015200chr472616 2340 2062 1966 744 327 189 32458 2176 890 ----
NM_015206chr1543843 3273 1364 42 33652 3605 228 --11122
NM_015213chr111108 ------
NM_015215chr142688 2080 684 29 1610 ----
NM_015216chr551502 1493 1466 306 168 11425 11101 --
NM_015225chr943111 2967 2837 1252 1790 ----
NM_015231chr111747 1763 ----
NM_015236chr431380 583 403 21086 931 ----
NM_015247chr1685384 4695 4685 3955 1687 1593 1142 273 24443 352 ----
NM_015251chr1652128 2089 2058 273 108 --11670 --
NM_015256chr52667 298 ----1241
NM_015265chr232560 2294 881 1948 32405 923 806 --
NM_015271chr473871 3823 3762 1481 1149 752 724 2808 141 166 1602
NM_015272chr1622089 577 31420 1412 323 ----
NM_015277chr1821277 251 ------
NM_015278chr622878 2463 21308 66 12158 12117
NM_015282chr252990 2597 2018 757 637 22655 177 ----
NM_015288chr563735 3711 3632 2894 787 666 1294 1758 12985
NM_015294chr171324 2752 222 1237 --
NM_015308chr111716 1165 ----
NM_015310chr8138401 7604 6864 6488 6106 5623 3242 3200 3078 3034 2527 507 216 16376 ----
NM_015313chr1164675 4421 4124 1618 275 86 ------
NM_015315chr523482 1056 13334 1143 --
NM_015335chr1242212 1898 1693 240 12396 1570 --
NM_015336chr1272189 1661 761 607 581 479 398 21858 878 --12121
NM_015344chr861910 783 578 483 316 83 21337 336 21957 1952 1536
NM_015347chr1252602 2233 2161 1899 1150 11025 --1618
NM_015349chr621934 956 ------
NM_015355chr1741718 1284 1227 725 21355 566 ----
NM_015358chr211460 1242 ----
NM_015359chr832502 322 261 11094 21027 83 1356
NM_015360chr51195 ------
NM_015375chr143780 3712 3074 1670 14800 --11225
NM_015379chr7--152 ----
NM_015384chr5142 157 ----
NM_015385chr1032139 620 597 32575 2220 403 2956 819 --
NM_015387chr252112 1439 1374 235 22 1545 ----
NM_015393chr453714 3696 3647 2634 1471 ------
NM_015397chr941962 1916 1879 1255 ------
NM_015423chr1131489 495 276 ----11258
NM_015429chr32910 836 ------
NM_015435chr881489 1398 1124 937 534 514 203 118 21478 332 ----
NM_015446chr161652 1591 1255 470 255 23 11486 ----
NM_015449chr1148 --1682 --
NM_015455chr553951 3907 3485 3085 1550 32922 2600 816 ----
NM_015458chr874965 4906 4736 4698 877 781 274 1131 ----
NM_015460chr341405 699 445 55 11887 1126 --
NM_015461chr182547 90 ------
NM_015464chr721058 667 1216 ----
NM_015481chr12----11043 --
NM_015497chr153887 816 741 ------
NM_015508chr33543 382 283 ------
NM_015511chr2011163 ------
NM_015534chr1--1688 ----
NM_015550chr793427 2400 2284 2190 1371 1071 581 203 156 13399 23198 2707 --
NM_015553chr664085 3914 3217 1968 395 134 ----12053
NM_015554chr1562818 2210 2133 1902 212 190 32917 2587 644 12640 --
NM_015555chr62549 105 ------
NM_015564chr543292 825 257 196 1620 ----
NM_015565chr21--1144 12063 --
NM_015567chr1311204 --1967 1907
NM_015569chr154740 1789 631 447 131 14007 ----
NM_015570chr71134 31842 1659 472 1147 --
NM_015571chr662540 2469 1876 1769 731 683 1567 --12589
NM_015576chr382662 1905 724 563 493 265 107 98 --22903 774 --
NM_015602chr131565 1305 230 31451 1209 402 ----
NM_015716chr17----1724 --
NM_015725chr191468 --1491 --
NM_015844chr182859 803 1771 ----
NM_015845chr183637 581 189 1549 ----
NM_015846chr182859 803 1771 ----
NM_015847chr182859 803 1771 ----
NM_015852chr773648 3310 2839 2659 2233 1247 675 23548 983 23002 2652 --
NM_015878chr841600 1482 877 201 32070 526 493 ----
NM_015879chr18168616 8555 8216 7651 6800 6297 3193 3014 2966 2675 2247 2142 2112 2064 700 183 28526 8107 1773 11575
NM_015886chr8155723 5489 5175 4885 4848 4270 4055 4013 3575 1619 960 820 758 640 257 33642 1667 1504 ----
NM_015888chr132715 2514 227 23225 2427 ----
NM_015891chr63713 362 72 21402 422 ----
NM_015902chr82132 91 1301 1659 --
NM_015906chr184759 4338 4311 4002 3798 3137 3072 1692 --1507 --
NM_015912chr862016 1981 1716 839 400 31 1901 ----
NM_015975chrX41534 613 108 24 ------
NM_015986chr1731454 426 167 1335 ----
NM_015990chr431099 287 263 ----1357
NM_016018chr852725 2591 787 623 261 ------
NM_016023chr861853 1439 740 503 425 317 ----1377
NM_016066chr1154 ------
NM_016072chr1242214 1808 443 290 21856 848 ----
NM_016073chr1541060 979 794 401 11175 ----
NM_016075chr1352579 2052 1282 408 233 32198 2093 612 12286 2123 118
NM_016083chr693798 3613 3412 3361 1336 912 548 430 326 1364 13857 13889
NM_016087chr721375 1074 11501 ----
NM_016096chr831336 728 182 2771 413 ----
NM_016100chr201404 ------
NM_016103chr51192 ------
NM_016106chr14--150 ----
NM_016107chr541332 340 308 149 ------
NM_016120chrX21057 746 197 1931 --
NM_016121chr131054 926 389 ------
NM_016125chr172202 122 ------
NM_016131chr251962 927 662 236 199 ------
NM_016132chr1532418 794 623 --12984 --
NM_016141chr31670 2688 45 ----
NM_016144chr5--1514 ----
NM_016166chr151153 ------
NM_016173chr394239 4201 4133 3704 3296 3081 1820 1421 31 24167 2883 ----
NM_016192chr2--1211 ----
NM_016195chr103569 331 80 ------
NM_016203chr75951 355 333 252 97 2963 856 ----
NM_016206chr398811 8042 7437 7134 6671 6287 3319 1118 939 15625 1647 --
NM_016217chr673665 2414 1323 1218 1071 456 259 2695 429 ----
NM_016220chr732170 661 329 42358 2164 1663 646 --1146
NM_016224chr631551 734 161 11620 --158
NM_016227chr12473 387 ------
NM_016231chr173615 247 36 --11699 --
NM_016248chr1383886 3437 3318 3149 3141 3076 972 655 ------
NM_016255chr663379 2829 2569 805 631 120 ------
NM_016257chr153408 2726 2526 1395 245 ------
NM_016260chr297602 7518 7346 7167 6544 5984 2523 2448 2044 26247 6041 ----
NM_016263chr1912618 ------
NM_016269chr4--2803 270 ----
NM_016272chr2232088 1781 87 12280 12535 --
NM_016275chr332340 2210 176 2538 214 --1160
NM_016277chr671511 1123 1075 593 520 160 147 --143 --
NM_016279chr51489 ------
NM_016289chr262270 2088 596 386 372 284 ------
NM_016302chr3------1808
NM_016308chr13795 709 460 ------
NM_016315chr251826 594 527 408 99 2620 511 ----
NM_016319chr121174 ------
NM_016322chr922649 993 13096 ----
NM_016328chr7--150 ----
NM_016351chr71401 ------
NM_016352chr711496 ------
NM_016353chr852454 2357 1905 122 44 11512 ----
NM_016359chr153731 673 665 1655 ----
NM_016376chr1784257 3920 3806 3169 1683 1313 778 669 ------
NM_016395chr15----1334 178
NM_016396chr1572665 2506 2152 1991 1925 1201 41 22192 230 11131 --
NM_016410chr91613 ------
NM_016422chr1162739 2683 2077 767 430 65 --1951 --
NM_016424chr172812 543 --189 11326
NM_016448chr14616 580 188 160 ------
NM_016453chr31628 ------
NM_016454chr151220 --1360 --
NM_016463chr5138 ------
NM_016472chr142994 88 11486 --1984
NM_016478chr71302 ------
NM_016485chr652063 2020 1947 1588 747 31960 1421 400 ----
NM_016507chr17--11229 ----
NM_016513chr663448 3067 1465 871 391 188 33183 2722 379 --11312
NM_016516chr21564 ------
NM_016531chr453621 1191 911 507 361 1279 --13841
NM_016542chrX21471 73 --1615 --
NM_016548chr94647 471 105 91 ------
NM_016603chr552011 1920 1686 1557 463 1330 ----
NM_016604chr521238 1146 ------
NM_016605chr532444 1992 754 --12282 --
NM_016607chrX41617 1561 351 130 ------
NM_016613chr432357 2087 788 ----1854
NM_016620chr11928 1914 ----
NM_016626chr1831362 521 422 1663 ----
NM_016631chr21147 ------
NM_016644chr51381 ------
NM_016645chr152417 58 ------
NM_016654chr151187 21071 1053 21150 942 --
NM_016656chrX1263 ------
NM_016824chr1051906 1871 1806 1528 35 21751 1326 11679 11397
NM_016830chr122549 85 ------
NM_016929chr664201 2963 1437 1263 1092 617 14508 ----
NM_016950chr411481 ------
NM_016953chr2115701 5630 5476 5469 5317 5222 4869 2069 968 115 66 25330 1600 23976 3917 --
NM_017410chr12--11232 11222 --
NM_017413chrX42432 2060 1652 464 ------
NM_017420chr1463638 3107 2805 695 336 253 1637 12602 11481
NM_017437chr1431733 1637 708 22041 1595 --2656 308
NM_017452chr2011457 21313 945 ----
NM_017453chr2011457 21313 945 ----
NM_017454chr2011457 21313 945 ----
NM_017455chr154956 355 324 183 1992 ----
NM_017482chr231507 1424 103 ------
NM_017510chr51656 ------
NM_017519chr641352 1233 1008 262 ------
NM_017540chr522296 451 23034 2035 11990 12265
NM_017544chrX1961 1947 ----
NM_017545chr202515 436 ------
NM_017546chr25872 745 589 307 97 ------
NM_017548chr331722 1545 1504 --1103 12170
NM_017549chr751508 1177 301 256 123 ------
NM_017569chr131322 ------
NM_017580chr1032152 863 163 21620 279 ----
NM_017582chr1101815 1803 1754 1586 1465 1340 1220 709 683 420 ------
NM_017610chr1582102 2053 1708 1396 1311 586 437 143 --1658 --
NM_017615chr101112 ------
NM_017628chr474587 1520 950 415 303 183 74 13682 11402 --
NM_017629chr171939 1441 1429 1276 707 250 225 ------
NM_017632chr41332 ------
NM_017633chr663881 3572 3411 3225 3093 1553 33240 687 679 --13366
NM_017635chr1111604 --11022 11004
NM_017637chr9159374 8535 8519 8073 7744 7564 6702 6619 6367 3256 2912 2823 1924 1554 678 27808 7048 --17267
NM_017640chr61717 ------
NM_017643chr1722440 2363 2772 372 ----
NM_017644chr364250 3716 1878 1722 438 428 31586 1412 543 ----
NM_017650chr7125138 5089 4994 4754 4241 2323 1273 1044 771 488 168 108 26081 3807 11186 --
NM_017657chr21157 1204 ----
NM_017658chr1484334 3645 3219 1823 1074 846 803 393 34676 3204 3107 ----
NM_017672chr15--21048 904 --11027
NM_017709chr144239 3012 2987 208 34067 1659 712 --14262
NM_017741chr452759 2549 1862 1010 83 --1320 --
NM_017742chr1841252 633 308 148 1169 21555 493 --
NM_017747chr51377 ------
NM_017748chr172580 563 --1803 --
NM_017752chrX1102 11957 1140 --
NM_017753chr9177 ------
NM_017754chr655065 4954 4566 1502 84 34708 4007 3366 ----
NM_017761chr151517 1375 1073 559 430 1102 --1159
NM_017768chr11246 ------
NM_017769chr1463269 3057 2788 2475 1266 1214 23016 2987 32316 1083 705 --
NM_017770chr632238 441 136 --22074 448 --
NM_017776chrX61193 1046 561 415 332 164 31090 632 498 11319 --
NM_017778chr821284 322 ------
NM_017779chr172547 2382 1888 1721 1685 151 67 ------
NM_017780chr83839 672 261 1910 1190 --
NM_017786chr82532 30 --1605 --
NM_017798chr202808 781 1257 ----
NM_017813chr875018 1885 1463 1336 1279 1072 748 21992 164 13603 --
NM_017824chr1051835 1720 508 323 75 32227 473 291 ----
NM_017830chr42303 192 ------
NM_017831chr1894438 3688 1359 1312 442 408 322 145 103 23367 3153 24107 1545 --
NM_017847chr11386 12269 11985 --
NM_017850chr141448 1325 990 116 21262 984 ----
NM_017864chr81186 ------
NM_017869chr161645 ------
NM_017890chr82632 374 21670 1171 --11806
NM_017902chr10105741 5719 5137 4118 4081 3922 1857 1798 1694 430 --13866 --
NM_017919chr975453 5225 4055 3618 3586 374 219 1567 --14460
NM_017933chr251607 1317 588 274 159 ------
NM_017944chr1183069 2947 2206 1138 890 431 207 153 22711 867 ----
NM_017953chr131105 807 150 1340 ----
NM_017954chr741265 1053 383 143 ------
NM_017964chr21164 ------
NM_017987chr1032150 359 189 ------
NM_017994chr752545 1887 1080 904 194 21103 854 11944 --
NM_017998chr91980 1530 ----
NM_018000chr251855 1809 1531 1521 436 1139 ----
NM_018014chr241063 945 450 328 ------
NM_018015chrX11079 21181 835 ----
NM_018017chr1042184 2161 2100 159 11942 ----
NM_018030chr183442 212 192 1318 ----
NM_018036chr14104419 3765 3673 3482 3220 3104 1330 1066 832 769 ----21379 739
NM_018051chr71336 ------
NM_018054chr162630 618 ----1661
NM_018061chr161651 1558 1308 616 251 210 --1481 --
NM_018070chr11236 ------
NM_018084chr273144 2974 2777 2073 1178 485 400 31197 913 596 ----
NM_018086chr281840 1794 1712 1666 1213 732 713 169 21926 27 11475 11353
NM_018098chr331033 884 33 1934 ----
NM_018121chr1052569 1064 742 227 107 12723 ----
NM_018126chr42534 125 11276 ----
NM_018131chr102635 316 ----1795
NM_018144chr102361 239 ------
NM_018151chr23718 688 583 ------
NM_018157chr1233089 2047 689 ------
NM_018159chrX31542 1401 1055 ------
NM_018171chr122293 200 1125 ----
NM_018179chr12--1220 ----
NM_018181chr1831940 1378 414 --1129 --
NM_018182chr1741987 1679 1471 897 ------
NM_018184chr341974 603 541 530 ------
NM_018191chr1352098 2071 1628 1426 669 22024 847 ----
NM_018211chr161872 1446 598 388 261 213 12097 ----
NM_018222chr11--11255 11892 --
NM_018225chr963467 1764 1486 900 760 437 15111 15389 13449
NM_018227chr432551 872 52 22190 355 ----
NM_018243chr443874 3832 1296 437 13340 ----
NM_018247chr683034 2866 2527 2208 2176 1041 617 277 12622 ----
NM_018287chr1031293 1213 351 --170 --
NM_018296chr161106 ------
NM_018299chr872858 2589 2553 2159 1390 412 222 ------
NM_018300chr193637 163 88 3568 482 247 ----
NM_018302chr462317 1804 782 268 72 55 --1105 1911
NM_018307chr171731 ------
NM_018312chr1111481 1616 ----
NM_018315chr42574 338 11601 1641 --
NM_018318chr122927 814 1389 --1845
NM_018321chr5157 ------
NM_018323chr421194 459 21317 138 ----
NM_018328chr22401 21 1362 ----
NM_018330chr1041274 1264 1146 605 11180 ----
NM_018335chr14----1124 --
NM_018340chr1683809 3492 3269 1959 958 872 596 276 1967 24503 3715 --
NM_018351chr1264638 3880 3221 2883 781 467 23128 67 ----
NM_018362chr1173741 849 502 313 255 173 78 1786 --1584
NM_018364chr174089 4020 3890 3555 2679 1514 1082 ----11289
NM_018367chr1141879 393 269 133 ------
NM_018368chr62263 30 ------
NM_018374chr754412 3536 1353 1011 721 ------
NM_018394chr32500 34 2396 156 ----
NM_018403chr363785 3247 2571 1364 1276 1169 23755 3310 21033 645 --
NM_018409chr462993 2405 2113 2020 49 33 11189 --12282
NM_018425chr1052474 2287 2267 1747 598 --12249 --
NM_018434chr51134 ------
NM_018440chr8148442 8040 7447 7423 7147 6513 5674 2882 2862 2484 1525 1124 1092 351 26262 1044 --11537
NM_018444chr822339 1986 1624 ----
NM_018452chr6_random43866 3857 1335 381 11193 1127 --
NM_018454chr153731 673 665 1655 ----
NM_018475chr42651 615 ----1685
NM_018482chr821591 975 2548 405 2609 375 --
NM_018489chr152143 2059 1846 773 248 22023 1916 ----
NM_018490chr11--1200 1215 --
NM_018534chr21236 ------
NM_018557chr251590 1390 669 234 33 11573 ----
NM_018566chr1125083 4941 4813 4352 4304 4258 4085 3793 3160 1021 762 102 1830 13767 --
NM_018569chr441484 1390 1044 62 1182 ----
NM_018584chr11445 1919 11231 --
NM_018638chr1295642 5260 5209 4673 3698 1696 1504 453 38 45284 5228 2129 1948 ----
NM_018640chr1282670 2079 1732 1115 1054 1006 299 215 1325 ----
NM_018650chr152174 439 324 74 64 21684 126 ----
NM_018685chr711115 ------
NM_018703chr16--165 ----
NM_018710chr831340 1179 23 ------
NM_018717chr452500 2483 1031 1012 501 22837 1042 ----
NM_018723chr16129 ------
NM_018834chr52856 293 1661 1644 --
NM_018841chr133925 3618 2639 21138 664 ----
NM_018844chr731502 117 88 1453 ----
NM_018847chr961817 1666 1329 670 175 162 11976 ----
NM_018890chr721028 118 21474 204 ----
NM_018898chr532250 1930 809 21531 1489 ----
NM_018899chr532250 1930 809 21531 1489 ----
NM_018900chr532250 1930 809 21531 1489 ----
NM_018901chr532250 1930 809 21531 1489 ----
NM_018902chr532250 1930 809 21531 1489 ----
NM_018903chr532250 1930 809 21531 1489 ----
NM_018904chr532250 1930 809 21531 1489 ----
NM_018905chr532250 1930 809 21531 1489 ----
NM_018906chr532250 1930 809 21531 1489 ----
NM_018907chr532250 1930 809 21531 1489 ----
NM_018908chr532250 1930 809 21531 1489 ----
NM_018909chr532250 1930 809 21531 1489 ----
NM_018910chr532250 1930 809 21531 1489 ----
NM_018911chr532250 1930 809 21531 1489 ----
NM_018945chr652921 2623 2314 908 171 1446 1585 --
NM_018947chr784974 4845 3071 1812 1502 934 909 476 14534 2976 955 --
NM_018970chr762551 2056 978 920 800 294 12672 ----
NM_018976chr1252694 1890 848 136 109 1901 22879 1108 --
NM_018979chr1211697 1840 12478 1327
NM_019001chr394799 4743 4029 3693 1907 1612 1441 306 88 24066 3113 14046 --
NM_019002chr2--194 ----
NM_019003chrX141 ------
NM_019004chr74807 776 504 297 22264 898 1932 --
NM_019027chr431944 1051 811 32474 2015 524 --11040
NM_019035chr441938 1689 1557 665 12092 --1166
NM_019044chr2104487 4279 3556 3540 3372 3274 1486 1047 757 102 14251 24700 1204 14156
NM_019045chrX2860 642 1753 ----
NM_019049chr15697 522 300 272 158 ----146
NM_019050chr421870 1418 11720 ----
NM_019063chr232124 1452 456 1537 1727 --
NM_019084chr1062517 2039 1986 1648 991 154 21997 757 --1916
NM_019087chr551503 1491 1201 1082 617 ------
NM_019095chr20169 --1196 --
NM_019098chr821250 615 1460 --11847
NM_019114chr952376 1843 1748 1712 826 ------
NM_019117chrX32674 2403 1211 22981 814 ----
NM_019555chr351371 1199 707 627 577 1620 11187 1609
NM_019556chrX31457 1208 128 11369 11110 --
NM_019590chr1031084 234 115 21216 85 ----
NM_019593chr2072538 2372 1085 1069 677 642 434 12476 1753 --
NM_019605chr14707 290 229 133 ------
NM_019606chr71521 ------
NM_019891chr131282 909 436 ------
NM_019903chr1051906 1871 1806 1528 35 21751 1326 11679 11397
NM_020039chr121426 ------
NM_020119chr773614 3113 2763 2574 998 590 303 33873 2626 1389 12897 --
NM_020122chr2115575 4649 4489 4312 4050 2235 1961 1153 1038 199 25 32035 1541 1298 25125 211 --
NM_020132chr2174429 4152 4101 4015 3695 725 74 23738 2040 ----
NM_020135chr61346 1381 ----
NM_020150chr1042182 1696 1663 193 1363 12042 --
NM_020159chr471716 1695 1615 524 465 406 298 ------
NM_020192chr7--1164 ----
NM_020193chr112979 190 21178 1009 ----
NM_020194chr22687 119 ------
NM_020199chr52439 418 ------
NM_020225chr41309 ------
NM_020232chr18--1176 ----
NM_020245chr6134903 4723 4630 3460 1945 1889 991 701 451 367 295 88 30 31995 1148 610 24730 3917 --
NM_020307chr31296 ------
NM_020337chr463008 2927 2861 2680 873 255 ----1180
NM_020338chr1033058 2309 1115 --23444 184 13503
NM_020341chr2021697 426 ------
NM_020342chr242617 2411 2288 2161 1927 ----
NM_020346chr111368 31600 1328 164 21533 1332 --
NM_020348chr1032474 1914 302 1829 22387 2065 --
NM_020354chr101934 ------
NM_020382chr1211540 ------
NM_020390chr364181 3644 3270 1257 969 848 14540 24196 349 13069
NM_020403chr1331498 1296 149 ------
NM_020432chr741636 742 484 349 22193 1661 ----
NM_020440chr143292 2843 2458 2068 12756 13346 --
NM_020443chr1107001 6763 6603 6468 6201 4997 2515 2457 2065 1720 --1794 --
NM_020445chr71670 ------
NM_020449chrX1269 ------
NM_020455chr662211 607 457 417 251 66 22779 556 ----
NM_020463chr241489 1207 326 41 ------
NM_020465chr16--11772 ----
NM_020466chr643928 3685 3493 3105 33426 1105 709 13324 --
NM_020474chr1871922 1807 1706 1556 1474 1261 823 ------
NM_020526chr1------11287
NM_020529chr141441 ------
NM_020640chr361675 1522 643 586 342 25 22062 1414 ----
NM_020647chr862299 2292 1968 1962 476 367 --12192 --
NM_020686chr1633018 2903 105 12215 1626 13058
NM_020699chr184606 1932 1835 1588 1418 1393 577 84 ------
NM_020708chr2022468 208 22521 2182 --12253
NM_020711chr242540 2075 314 307 11665 ----
NM_020718chr1686435 5822 4973 4172 2079 1984 1820 992 46602 6064 6011 4396 --11254
NM_020727chr2183726 3708 3620 3378 3359 3073 2567 1348 12635 ----
NM_020728chr753023 2508 899 844 81 --13176 --
NM_020732chr641352 1233 1008 262 ------
NM_020734chr1263280 2701 2372 2188 667 78 13383 1698 --
NM_020740chr172280 141 --1365 --
NM_020747chr52906 334 1657 ----
NM_020748chr1752108 1935 1665 822 802 2524 414 11940 1509
NM_020749chr852112 1741 826 456 44 12013 ----
NM_020752chr103514 461 273 --12515 --
NM_020754chr331134 509 456 1542 ----
NM_020762chr122320 257 1140 ----
NM_020766chrX34600 526 125 34312 1695 697 ----
NM_020772chr1788386 8161 7117 6494 6443 5718 2566 1923 32089 864 306 15314 12625
NM_020774chr18105512 5282 5216 4821 4759 4156 2017 971 140 34 15468 ----
NM_020782chr1264625 3700 3457 3322 891 282 ----13353
NM_020792chr352382 2227 1866 1029 447 1192 --11805
NM_020794chr131231 581 119 ------
NM_020800chr331188 447 349 11512 ----
NM_020801chr532335 2291 337 12484 ----
NM_020805chr1831474 1258 1224 21907 1495 182 11586
NM_020808chr12842 289 2238 214 ----
NM_020813chr1931839 895 100 32270 311 92 12410 11808
NM_020818chr14------1411
NM_020819chr651179 1095 75 60 47 2986 919 ----
NM_020828chr1941253 391 287 187 3562 435 114 ----
NM_020830chr223297 2700 1140 ----
NM_020841chr12113961 3929 3395 3263 3135 3017 2554 2522 1608 662 128 ------
NM_020844chr8107121 6816 6595 5799 5669 5449 5318 2265 2055 1897 37350 7241 2899 27261 637 --
NM_020858chr151801 1811 1344 --
NM_020860chr4--21141 101 ----
NM_020861chr651146 991 513 379 186 ------
NM_020870chr442093 1888 783 465 --11749 --
NM_020871chrX92560 2531 2406 2127 1015 862 804 641 297 ----12574
NM_020872chr321152 69 1727 ----
NM_020873chr33844 307 290 1678 ----
NM_020918chr1073653 3270 3126 2534 2391 433 348 12677 12829 --
NM_020920chr141146 ------
NM_020921chr1443255 2975 2336 964 12446 12873 --
NM_020922chrX41597 1531 1522 634 ------
NM_020925chr1----1511 11379
NM_020926chrX1124 ------
NM_020940chr1032495 2253 309 ------
NM_020948chr173690 2845 2620 2332 2255 1427 1299 13698 ----
NM_020960chr994883 4374 3755 3735 3561 1788 1314 761 140 --14330 --
NM_020964chr1864554 3677 3364 3110 741 110 23422 129 ----
NM_020977chr432250 2218 1430 11743 21999 552 --
NM_020988chr1611019 ------
NM_021007chr2112139 2091 1930 1884 1814 1791 1763 1710 774 136 120 12315 ----
NM_021032chr341539 820 424 197 ------
NM_021033chr1333433 90 40 12245 1472 13492
NM_021038chr331174 928 305 23117 539 ----
NM_021069chr421730 1353 3864 808 691 21500 109 --
NM_021072chr562507 2367 2241 903 704 550 31935 865 145 --12257
NM_021097chr222925 1170 1424 11088 --
NM_021102chr191407 ------
NM_021111chr931305 1087 946 11361 1993 --
NM_021116chr799027 8574 7160 6586 5510 3540 2627 1941 1060 --11734 27280 338
NM_021148chr742441 1850 520 264 2885 769 ----
NM_021151chr72211 136 --1373 2299 223
NM_021165chr11765 1283 ----
NM_021167chr722777 2260 ----12759
NM_021183chrX62416 829 605 463 383 157 22393 2311 ----
NM_021190chr1144 11337 ----
NM_021204chr4--1877 ----
NM_021229chr1231152 832 126 --21040 893 --
NM_021239chr1431182 540 356 21305 483 ----
NM_021240chr93685 643 489 ----1610
NM_021255chr1463498 3279 3140 2650 1441 85 --1398 --
NM_021572chr64935 852 367 280 ------
NM_021629chr354632 1674 897 295 50 1927 ----
NM_021637chrX1320 1115 ----
NM_021638chr454090 4082 1787 1312 142 14697 14853 --
NM_021644chr10--1878 ----
NM_021647chr464480 3837 3528 2980 404 349 14402 ----
NM_021723chr71401 ------
NM_021813chr664950 4728 4508 4390 3878 3712 45558 5316 4714 4360 35572 5103 4702 --
NM_021814chr631566 389 70 21133 376 11382 --
NM_021911chr585392 4758 4169 4022 3910 3622 1830 429 15420 15337 --
NM_021914chr1432307 645 300 --1285 --
NM_021952chr11200 ------
NM_021954chr1372372 1040 1003 913 897 169 67 ----13428
NM_021956chr641501 1095 351 286 41161 551 546 514 11528 --
NM_021960chr142759 2312 1829 681 12093 ----
NM_021961chr11117278 6002 5423 5093 4871 4657 1956 1309 1226 878 396 57337 1904 1018 545 471 25491 2261 14542
NM_021964chr386543 6414 6382 4732 4601 4476 859 845 26170 2161 31551 219 104 --
NM_021977chr6123875 3755 3697 3447 3184 2675 2488 1525 1145 580 185 77 13631 13731 13611
NM_021979chr141429 2444 438 ----
NM_021994chr741070 874 767 174 1460 ----
NM_021998chrX--21263 1189 ----
NM_022037chr21261 --1113 196
NM_022045chr81185 ------
NM_022048chr15105765 5059 4703 4155 3968 3949 3926 1474 796 154 13995 ----
NM_022075chr12833 32 ------
NM_022090chr51500 ------
NM_022091chr632245 683 414 21999 210 ----
NM_022114chr154756 4715 4655 4463 3071 24744 4278 ----
NM_022118chr132238 66 ------
NM_022123chr141422 ------
NM_022129chr10--51179 1135 989 534 66 ----
NM_022130chr5--11270 ----
NM_022138chr641445 1040 569 262 1116 1207 --
NM_022154chr42469 455 1915 11276 --
NM_022173chr21261 --1113 196
NM_022351chr883818 3630 2714 2633 1123 469 217 128 137 ----
NM_022456chr1266136 5541 2509 2418 1162 335 35897 1867 226 14725 --
NM_022457chr1------1213
NM_022458chr793010 2959 2827 2401 2156 451 396 219 125 1465 1881 --
NM_022459chr13106242 5333 4910 2496 1807 1651 1337 772 310 45 ------
NM_022469chr123217 314 33315 2417 2236 11078 --
NM_022474chr1422478 811 12680 ----
NM_022476chr162279 179 ----1880
NM_022484chr771438 1295 996 887 370 331 221 ------
NM_022491chr1223129 708 23227 886 1404 --
NM_022648chr244575 3998 1371 27 34381 1661 129 24630 724 --
NM_022650chr51690 --1760 --
NM_022658chr1251298 1218 1180 1047 413 1523 ----
NM_022716chr152681 2665 2055 936 274 13119 --1642
NM_022726chr621224 1092 ------
NM_022728chr71560 --1728 --
NM_022763chr333125 664 31 21047 167 11031 --
NM_022771chr121869 ------
NM_022780chr22116 78 --1252 --
NM_022781chr953336 3254 3163 2619 409 13271 1554 --
NM_022782chr12147 ------
NM_022810chrX284 72 1303 ----
NM_022826chr22834 297 ------
NM_022828chr531625 334 57 21746 618 ----
NM_022831chr111210 --11197 1140
NM_022841chr1532557 2133 1010 32651 2035 751 ----
NM_022845chr1642029 1758 1659 1405 22105 1976 ----
NM_022893chr242740 2183 633 262 12421 22867 2344 --
NM_022894chr241380 1164 289 54 11662 11132 --
NM_022898chr1464758 4044 3826 3704 1174 384 33759 3478 1645 13847 13234
NM_022910chr16--11772 ----
NM_022912chr233061 2008 993 42339 2333 2055 448 ----
NM_022913chr51272 ------
NM_022918chr1141978 1558 747 513 31936 1416 571 ----
NM_022965chr431350 992 24 1303 31515 295 90 --
NM_022970chr1021385 369 --1479 --
NM_022977chrX92583 2554 2536 1851 964 606 367 339 194 193 ----
NM_023012chr121753 1640 ----
NM_023016chr262765 2308 2176 1099 355 264 3531 415 25 ----
NM_023033chr121510 ------
NM_023925chr122317 236 ------
NM_023927chr541077 877 426 82 --11051 --
NM_023929chr822104 1827 ------
NM_024007chr582986 2304 1929 1265 983 733 670 191 12492 1575 32266 2111 617
NM_024016chr171720 ------
NM_024052chr1773120 2817 2521 2211 1080 840 567 ----1622
NM_024090chr451553 1510 509 348 204 --21186 720 --
NM_024122chrX2218 109 ------
NM_024311chr17--1285 ----
NM_024336chr161305 ------
NM_024345chr976103 4822 4670 4113 4053 4032 1381 24873 4420 14100 --
NM_024422chr1841769 1279 663 142 2309 299 11798 --
NM_024423chr1864189 3457 3183 3162 1669 225 ----1819
NM_024429chr75951 355 333 252 97 2963 856 ----
NM_024491chr32617 96 ------
NM_024501chr2--1651 ----
NM_024503chr1--1415 ----
NM_024511chr462912 2352 2142 886 366 176 33219 3023 261 12962 --
NM_024523chr751187 387 266 167 134 ------
NM_024524chr362972 2766 2572 2560 2196 501 ------
NM_024539chrX31072 969 872 21261 446 --1458
NM_024561chr1351402 1387 1261 1084 952 ------
NM_024563chr541923 1695 718 203 ------
NM_024565chr511042 ------
NM_024583chr21851 ------
NM_024594chr531561 1233 635 21538 219 11850 --
NM_024602chr11655 ------
NM_024613chr8--165 ----
NM_024624chr221395 1326 ------
NM_024627chr2254767 3714 3304 628 24 24536 644 14982 --
NM_024638chr342474 2240 1530 804 --1509 1663
NM_024665chr353961 3597 1757 584 504 33467 1106 819 ----
NM_024670chr1041358 1253 153 143 2570 330 ----
NM_024676chr12904 86 ------
NM_024680chr113551 123 57 ------
NM_024704chr2061089 997 903 788 258 35 --162 --
NM_024713chr1531047 572 233 21343 315 ----
NM_024721chr882543 2411 1679 963 894 853 203 189 21728 1673 ----
NM_024744chr232691 2590 379 11819 12607 --
NM_024759chr81597 --1785 --
NM_024811chr1111731 ------
NM_024834chr1011853 11405 --11583
NM_024835chr172393 114 ------
NM_024885chrX2831 188 ------
NM_024913chr741593 1252 507 354 21538 1423 ----
NM_024920chr411435 ------
NM_024921chrX1753 ------
NM_024941chr521298 1270 31447 1291 1180 11332 --
NM_024944chr2131234 899 226 --1266 1361
NM_024947chr399216 8630 8101 7809 1823 1282 1186 812 709 23215 1398 --18126
NM_024949chr484698 4682 3722 3194 3147 1819 924 490 14861 11274 --
NM_024953chr1232548 2067 116 1979 22692 735 --
NM_024989chr287842 7360 6243 2902 2727 2540 2228 332 37107 2127 740 27938 7818 1615
NM_024991chr1032139 620 597 32575 2220 403 2956 819 --
NM_024993chr221358 1162 ------
NM_025054chr894010 3609 3488 3092 2906 1339 1309 1052 639 43086 987 571 503 1135 14057
NM_025058chr11593 ------
NM_025073chr184536 3912 1877 1318 1208 1055 816 708 34401 4364 2944 ----
NM_025074chr432696 2523 2488 --1825 --
NM_025129chr19--1220 ----
NM_025135chr181524 ------
NM_025146chr341992 1866 1695 1007 ------
NM_025147chr21993 ----21179 1153
NM_025154chr731324 443 101 11437 11458 --
NM_025160chr164060 3521 2671 864 828 416 ------
NM_025191chr163484 3428 610 514 436 234 13033 ----
NM_025208chr1122339 156 22459 2126 22003 791 21708 112
NM_025211chr9172 ------
NM_025221chr421418 195 ------
NM_025235chr1031614 315 172 ------
NM_025238chr1521335 542 --1584 --
NM_025244chr24195 112 104 78 ------
NM_030579chr1683690 3627 3213 3098 3046 2625 1013 28 ------
NM_030613chr51187 187 169 --
NM_030621chr1474073 3951 3027 3018 2638 1179 501 23994 2652 ----
NM_030625chr1052570 2318 2251 37 24 ------
NM_030627chr572650 2572 1361 904 793 590 43 43556 3239 2804 760 13086 13123
NM_030647chr796312 5920 5678 5516 3961 2517 1711 785 566 25209 4523 ----
NM_030648chr464316 4205 4145 1826 938 460 25505 3498 45053 2111 1384 974 25602 388
NM_030664chr1041854 1778 896 428 1806 ----
NM_030665chr171952 ------
NM_030674chr1284212 3754 3617 1964 1866 879 169 109 15712 --15137
NM_030751chr1051924 1790 1594 749 537 11502 ----
NM_030751chr1051924 1790 1594 749 537 11502 ----
NM_030758chr2241408 1339 1320 60 ------
NM_030763chrX1766 ------
NM_030780chr84544 328 234 157 ------
NM_030806chr1118696 8114 7807 7691 7345 3374 3171 3005 1840 1795 686 39062 8922 5898 27118 2607 --
NM_030809chr1232490 2420 980 22518 540 ----
NM_030816chr153607 1328 1303 1240 938 4683 559 489 226 12254 --
NM_030820chr62966 863 1718 ----
NM_030920chr122020 1602 ----11596
NM_030935chr7121 ------
NM_030939chr62302 38 1408 ----
NM_030949chr611467 1206 ----
NM_030953chr54607 374 86 26 --11073 --
NM_030958chr81476 ------
NM_030964chr543726 2802 2498 24 21221 861 2687 246 --
NM_030978chr91134 ------
NM_030979chr131184 2165 108 ----
NM_031157chr121255 ------
NM_031203chr191184 ------
NM_031243chr732146 165 96 ----1738
NM_031262chr91868 1388 ----
NM_031263chr91925 1445 ----
NM_031266chr51450 ------
NM_031296chr422647 834 11802 12669 --
NM_031305chr461812 1477 1282 733 188 158 1560 1747 --
NM_031314chr143797 760 525 22075 485 1492 --
NM_031362chr242775 1957 1121 1070 22660 2480 ----
NM_031365chr222911 2093 22796 2616 ----
NM_031366chr222911 2093 22796 2616 ----
NM_031372chr441499 1440 509 209 1323 ----
NM_031411chr532250 1930 809 21531 1489 ----
NM_031418chr1142634 1093 1060 131 ----22331 729
NM_031419chr321364 588 198 ----
NM_031427chr1475612 3667 2397 1140 1001 745 185 22261 1188 ----
NM_031442chrX22935 2192 1519 12902 12867
NM_031443chr71385 ------
NM_031445chr222118 868 13410 22312 2179 13345
NM_031461chr862133 825 689 439 378 127 31503 636 45 ----
NM_031468chr778073 6092 5727 2697 2570 2033 213 46159 1114 239 153 --16777
NM_031469chr641513 988 76 30 --11066 --
NM_031483chr2053486 2895 1383 693 47 1431 ----
NM_031844chr143945 1561 1353 1204 1660 ----
NM_031849chr532250 1930 809 21531 1489 ----
NM_031857chr532250 1930 809 21531 1489 ----
NM_031860chr532250 1930 809 21531 1489 ----
NM_031892chrX1683 21003 339 --1270
NM_031911chr432628 259 227 1793 1840 --
NM_031935chr111025 ------
NM_031938chr113418 322 271 1839 ----
NM_031942chr241197 1146 1138 254 ------
NM_031989chr12--1277 ----
NM_031990chr1911265 ------
NM_031991chr1911265 ------
NM_032012chr965120 5020 4638 917 827 408 --1518 --
NM_032021chr1111188 ------
NM_032041chr872272 2014 1036 1002 922 798 758 --12381 --
NM_032042chr522363 2037 42408 2267 597 170 ----
NM_032116chr1375610 5063 4434 2297 1773 812 153 ------
NM_032131chr6--1223 ----
NM_032138chr132507 45 ------
NM_032143chr22323 254 ------
NM_032145chr641532 554 499 77 11627 ----
NM_032146chr3--1473 ----
NM_032148chr122462 345 ------
NM_032149chr41150 ------
NM_032153chr342128 1903 1734 149 22700 2443 ----
NM_032154chr1021099 175 182 ----
NM_032156chr122317 236 ------
NM_032160chr1853661 3558 3326 1576 1134 --11223 --
NM_032186chr11928 1914 ----
NM_032189chr1364758 3644 3429 1860 598 472 34734 4470 1803 ----
NM_032199chr1022908 2479 1854 1455 1451
NM_032208chr293560 3374 3307 3280 2924 2441 590 338 131 --12385 12348
NM_032217chr431444 1350 386 11413 1991 --
NM_032221chr2021957 1749 ------
NM_032228chr11103425 3306 2461 1207 1077 978 960 589 67 51 22634 61 --1384
NM_032231chr151318 ------
NM_032236chr11784 ------
NM_032239chr421449 1081 ------
NM_032246chr1531151 981 264 ----11043
NM_032288chr341972 661 446 171 12204 1483 --
NM_032291chr151919 1639 1231 503 365 31819 678 225 ----
NM_032320chr115701 559 215 111 100 ------
NM_032324chr11175 ------
NM_032352chr1431415 1366 75 151 ----
NM_032373chr10125796 4796 4786 4420 2196 1990 1519 1505 1075 876 787 674 45280 5172 4574 2220 ----
NM_032383chr331211 897 819 1235 ----
NM_032433chr1931339 273 233 --21392 84 --
NM_032437chr11172 ------
NM_032439chr1021176 261 11405 ----
NM_032457chr463824 1474 1305 1294 1165 458 12652 21282 186 11510
NM_032458chrX43306 2475 2277 954 12429 --22532 725
NM_032471chr61258 1372 1834 --
NM_032491chr1231124 1017 160 ------
NM_032505chr372687 2680 2457 2417 2402 1984 22 1204 ----
NM_032532chr61548 ------
NM_032547chr431250 368 202 ------
NM_032557chr44919 170 131 22 1340 ----
NM_032558chr911481 11320 ----
NM_032582chr1731887 1611 98 11592 11862 11434
NM_032590chr12--1735 ----
NM_032594chr1461090 820 397 360 345 143 1173 ----
NM_032626chr16172 ------
NM_032682chr333107 960 592 11362 ----
NM_032689chr193459 224 88 1161 ----
NM_032717chr421013 995 ----1419
NM_032787chr31289 --1103 --
NM_032793chr12327 268 ------
NM_032804chr10--32589 924 791 12053 --
NM_032810chr1021091 403 ------
NM_032812chr101296 ------
NM_032813chr132970 176 3877 851 226 ----
NM_032815chr1682492 2353 2220 2150 964 927 888 796 ------
NM_032826chr785061 3930 3800 3631 1270 366 101 84 14699 1591 --
NM_032833chr131965 1645 541 42617 2492 1059 113 12433 --
NM_032838chr194949 813 327 94 1791 ----
NM_032842chr72431 142 21342 159 ----
NM_032859chr1363621 3542 3449 1068 688 447 23814 2768 --1482
NM_032869chr821940 1700 ------
NM_032873chr1194522 4006 3305 2928 2833 1645 1479 1297 1049 ------
NM_032875chr171326 1635 ----
NM_032876chr1452150 1711 601 464 87 ------
NM_032900chr1053547 3471 1174 301 290 ------
NM_032949chr132507 170 1180 ----
NM_032968chrX53932 1600 1434 1207 906 33376 1167 722 --13154
NM_032969chrX53932 1600 1434 1207 906 33376 1167 722 --13154
NM_032973chrY53924 1599 1434 1207 906 33371 1167 722 --13149
NM_032978chr1831169 896 57 --1118 --
NM_032979chr1831169 896 57 --1118 --
NM_032981chr1831169 896 57 --1118 --
NM_032999chr72240 217 1903 --1967
NM_033000chr72240 217 1903 --1967
NM_033001chr72240 217 1903 --1967
NM_033020chr184759 4338 4311 4002 3798 3137 3072 1692 --1507 --
NM_033030chr211414 11469 ----
NM_033055chr121065 117 11119 ----
NM_033081chr2021199 499 11349 ----
NM_033089chr2011330 11467 ----
NM_033118chr201878 ------
NM_033125chr6149 ------
NM_033132chr1331889 730 73 --11858 1333
NM_033133chr1743771 3741 557 186 --12492 --
NM_033135chr1122339 156 22459 2126 22003 791 21708 112
NM_033136chr521452 1360 --11777 --
NM_033137chr521452 1360 --11777 --
NM_033138chr752265 2011 1779 884 534 ------
NM_033139chr752265 2011 1779 884 534 ------
NM_033140chr752265 2011 1779 884 534 ------
NM_033143chr454334 3052 2966 716 471 13649 14247 --
NM_033157chr752265 2011 1779 884 534 ------
NM_033181chr693798 3613 3412 3361 1336 912 548 430 326 1364 13857 13889
NM_033211chr51419 ------
NM_033222chr921069 569 ------
NM_033224chr787894 7755 7703 5744 5084 2786 1913 742 37996 5381 566 11313 --
NM_033225chr873176 3045 2977 2324 642 300 140 13039 11103 1346
NM_033254chr31139 ------
NM_033274chr553643 3469 2366 2290 160 ------
NM_033276chr12--2364 88 ----
NM_033285chr883820 3589 2724 1690 777 648 631 179 12941 12896 --
NM_033290chrX53396 3219 2621 2507 2380 13437 12537 23347 3255
NM_033305chr931178 1149 578 --11220 --
NM_033360chr1274383 3319 2836 1849 1522 965 342 34651 4364 641 ----
NM_033379chr10--1153 ----
NM_033387chr911072 12734 12633 --
NM_033389chr1774862 4377 4269 3718 3370 1930 1860 11090 ----
NM_033394chr2----1995 --
NM_033429chr1543204 798 557 496 --12637 --
NM_033430chr411620 1706 21178 649 13790
NM_033437chr411620 1706 21178 649 13790
NM_033495chrX4822 366 208 45 ------
NM_033505chr2126693 4651 4330 2712 2476 2269 1648 1639 820 777 280 227 14206 36541 5995 4194 --
NM_033535chr431100 1027 283 ------
NM_033551chr523482 1056 13334 1143 --
NM_033624chr1242204 1857 1447 186 1747 ----
NM_033631chr173558 3312 3240 1244 1149 1032 766 12524 1222 --
NM_033632chr42574 338 11601 1641 --
NM_033637chr1073623 3390 3137 598 467 451 218 22574 768 23948 3776 --
NM_033642chrX1314 1349 ----
NM_033644chr51781 42247 1014 281 134 12498 --
NM_033645chr51781 42247 1014 281 134 12498 --
NM_033656chr2185922 4357 4012 1662 1475 1109 699 544 13729 ----
NM_052832chr852786 2719 2373 1993 1864 12237 12962 12080
NM_052851chr1341715 1560 333 115 1158 22252 2205 --
NM_052879chr1232558 1339 1145 21644 599 1780 --
NM_052885chr1294949 4689 4609 3783 1559 1381 1357 350 249 23921 833 ----
NM_052900chr841732 1696 1581 1282 --155 21810 1805
NM_052905chr241729 1430 1324 599 4701 523 512 279 1365 --
NM_052907chr1284107 4033 3882 1603 1487 1050 914 438 ----1266
NM_052910chr1331462 470 297 1731 1792 11891
NM_052911chr1811002 1300 1156 --
NM_052917chr242318 1301 996 589 22404 352 ----
NM_052918chr1053725 3680 3456 3213 2417 ------
NM_052932chr1172278 2151 1865 681 456 422 126 ------
NM_052937chr852205 2115 2094 948 54 2517 250 ----
NM_052940chr11178 ------
NM_052961chr62372 33 ------
NM_053016chr9157734 7717 7541 5427 5398 5086 2991 2868 2299 2251 2146 1670 1195 1017 650 26392 846 1617 --
NM_053023chr1112338 13095 13071 --
NM_053025chr341682 1123 335 219 --11795 11381
NM_053026chr341682 1123 335 219 --11795 11381
NM_053027chr341682 1123 335 219 --11795 11381
NM_053028chr341682 1123 335 219 --11795 11381
NM_053031chr341682 1123 335 219 --11795 11381
NM_053032chr341682 1123 335 219 --11795 11381
NM_053043chr776338 5001 4917 3995 840 693 498 --2422 283 --
NM_053053chr12936 746 1648 ----
NM_053056chr1153010 2710 2665 2070 332 ------
NM_053274chr11114 ------
NM_054016chr141980 815 365 83 ------
NM_054016chr141980 815 365 83 ------
NM_054016chr141980 815 365 83 ------
NM_054026chr81171 --1872 --
NM_057157chr10194 ------
NM_057159chr921431 560 21605 1159 --11588
NM_057168chr721375 1074 11501 ----
NM_057175chr452123 2062 1811 790 500 1778 --1733
NM_058237chr1431013 812 244 1926 ----
NM_058241chr242102 1684 832 480 22320 1912 --1693
NM_058241chr242102 1684 832 480 22320 1912 --1693
NM_078469chr1061295 1289 1271 555 528 344 ----11422
NM_078483chr583481 2934 1258 1216 1088 972 888 598 13343 12918 --
NM_079837chr161645 ------
NM_080392chr1--161 ----
NM_080422chr181238 ------
NM_080423chr181238 ------
NM_080597chr183442 212 192 1318 ----
NM_080618chr2031173 905 550 ------
NM_080666chr1431100 447 247 1471 ----
NM_080723chr611339 ------
NM_080759chr1322611 223 22559 503 ----
NM_080760chr1322611 223 22559 503 ----
NM_080794chr21133 ------
NM_080836chr2063875 1476 557 320 282 148 --11740 --
NM_080840chr201189 ------
NM_080841chr201189 ------
NM_080872chr884072 4059 3972 3496 2963 2607 341 314 13179 13197 --
NM_080927chr393331 3224 2780 2127 790 622 316 273 86 23080 2507 ----
NM_130385chr1141064 761 611 23 12472 12199 12082
NM_130391chr963403 3159 2600 2398 1095 576 11241 11294 --
NM_130392chr963403 3159 2600 2398 1095 576 11241 11294 --
NM_130393chr963403 3159 2600 2398 1095 576 11241 11294 --
NM_130395chr61346 1381 ----
NM_130434chr15--1454 ----
NM_130435chr1082862 2786 2604 2445 1109 860 398 188 12924 --1474
NM_130436chr2132407 920 519 42693 1758 882 74 ----
NM_130438chr2132984 1096 76 43270 2335 2248 651 ----
NM_130798chr1521215 523 ------
NM_130809chr553156 2844 2710 2576 317 11202 ----
NM_130811chr202479 314 ------
NM_130838chr1531681 1622 1521 1555 ----
NM_130839chr1531681 1622 1521 1555 ----
NM_130846chr1241065 1057 307 184 ------
NM_130847chr1175163 5105 4600 3871 3773 450 292 35387 4471 193 ----
NM_133170chr20118056 7895 6581 6473 5040 4920 2807 2291 2169 1792 1020 26264 5796 27506 3189 --
NM_133265chrX43562 3155 2959 300 --1142 --
NM_133334chr496344 5890 5796 5678 5468 3918 2467 2270 1522 1943 24729 245 --
NM_133367chr652975 2691 2340 2168 757 22918 2349 ----
NM_133368chr16151 ------
NM_133370chr443700 3435 416 255 12489 ----
NM_133372chr532904 2798 668 32712 1855 1171 ----
NM_133445chr973584 2559 2379 1167 716 154 67 22360 794 22504 1280 --
NM_133468chr731645 567 489 ------
NM_133474chr431635 1471 352 31626 468 293 ----
NM_133482chr5133 31467 1382 1018 --1296
NM_133486chrX----1147 --
NM_133496chr173464 1801 1396 1055 726 640 620 13951 ----
NM_133507chr121278 1882 ----
NM_133631chr341376 1218 1077 549 1461 --197
NM_133638chr53513 360 147 --11337 --
NM_133646chr275373 4338 4205 3718 3440 1574 846 23475 2072 ----
NM_133647chr1553210 1231 866 392 225 1491 ----
NM_138270chrX52704 1246 1010 849 843 ------
NM_138288chr1421779 745 22122 314 1812 --
NM_138348chr5126608 6519 6487 6375 6124 5783 5271 5030 4185 2407 1576 43 41739 1525 1145 202 ----
NM_138357chr1041543 661 292 254 --11836 11702
NM_138370chr21164 ------
NM_138391chr12759 103 2990 201 ----
NM_138423chr1552261 1942 1437 264 150 1461 ----
NM_138426chr762336 864 675 547 484 192 12114 --1444
NM_138437chrX1107 ------
NM_138444chr1384842 4786 3663 3623 3487 1234 915 397 64753 4695 4402 1626 1135 845 23831 1691 14621
NM_138459chr653572 2874 2589 2548 774 43510 3434 3412 2863 ----
NM_138468chr276237 4818 4365 4077 2549 1792 756 35818 2055 609 ----
NM_138473chr1254560 1562 454 185 111 33186 1586 57 15158 --
NM_138494chr752685 2030 1074 745 249 22667 421 ----
NM_138559chr241053 935 440 318 ------
NM_138576chr1464758 4044 3826 3704 1174 384 33759 3478 1645 13847 13234
NM_138612chr16----160 --
NM_138621chr273606 2841 2631 1583 1381 1032 771 2749 216 ----
NM_138638chr1432307 645 300 --1285 --
NM_138643chr18161 ------
NM_138644chr18161 ------
NM_138694chr641218 869 362 223 13436 12958 --
NM_138701chr71290 ------
NM_138713chr16107254 7040 6638 6341 5022 3171 2940 2649 1194 187 57314 6246 5989 3261 2667 11462 --
NM_138714chr16107254 7040 6638 6341 5022 3171 2940 2649 1194 187 57314 6246 5989 3261 2667 11462 --
NM_138731chr1484221 4077 4016 3647 3118 1389 917 568 21353 647 1509 --
NM_138782chr542189 2014 1748 717 22384 621 12331 --
NM_138811chr721111 303 11164 ----
NM_138927chr211121 --1203 --
NM_138959chr166136 5609 4275 2509 2299 560 15225 34121 2430 1966 12371
NM_139012chr612159 --11788 1327
NM_139045chr92783 728 ------
NM_139046chr10157 ------
NM_139048chr31481 1120 ----
NM_139078chr12154 ------
NM_139126chr62703 647 1325 ----
NM_139136chr122821 778 11085 ----
NM_139167chr81499 ------
NM_139168chr5130 21493 479 1639 --
NM_139239chr19192 ------
NM_139244chr63947 867 812 ------
NM_139321chr2053501 2757 2721 2670 1644 1633 --13343
NM_144498chr201375 1576 ----
NM_144563chr2188 1581 ----
NM_144563chr2188 1581 ----
NM_144567chr152574 2441 1770 528 291 159 ----
NM_144571chr465581 5569 2491 2373 2231 1654 15832 --11043
NM_144574chr141409 1105 1116 --
NM_144578chr1485455 5405 4904 4644 3845 1481 1459 64 ------
NM_144590chr1052986 2349 2331 1839 1831 32307 2301 1891 ----
NM_144595chr134863 846 773 303 ------
NM_144599chr15133959 3761 3568 2191 2149 2136 1690 1509 1064 879 840 775 661 34362 1587 731 ----
NM_144600chr1661354 1272 1221 270 83 71 --21693 597 --
NM_144632chr212078 1752 ----
NM_144636chr31711 ------
NM_144642chr341172 909 530 93 1111 --11041
NM_144643chr4--1463 ----
NM_144645chr41231 ------
NM_144664chr1141822 860 778 270 ----137
NM_144684chr1942803 870 566 23 32475 2336 99 ----
NM_144721chr432704 446 414 ------
NM_144726chr51214 11071 1198 --
NM_144778chr1332276 1758 345 12331 22751 1890 --
NM_144949chr262612 2321 2140 1926 1631 524 1498 21007 734 --
NM_144963chr822166 2017 22407 2288 --1102
NM_144973chr1265200 4979 3261 1291 488 434 55124 4223 1145 1057 382 ----
NM_144977chr1----1670 --
NM_145037chr361523 556 484 405 200 161 ------
NM_145049chr53942 343 330 ------
NM_145055chr1853612 3060 2949 2464 1050 11070 13559 --
NM_145160chr151355 ------
NM_145176chr652902 2627 1421 1378 710 22486 610 32578 887 67 --
NM_145203chr13--1743 ----
NM_145251chr142518 301 2361 73 ----
NM_145259chr277051 6628 5195 4902 4468 1870 1492 36112 4692 435 ----
NM_145263chr471791 1687 1533 793 704 57 31 ------
NM_145268chr731006 384 354 ------
NM_145290chr4--1252 ----
NM_145305chrX41297 266 59 23 11154 --1402
NM_145307chr1074517 4412 4245 3083 2985 2896 1110 44619 3511 3282 193 ----
NM_145313chr1031648 676 281 ------
NM_145320chr793427 2400 2284 2190 1371 1071 581 203 156 13399 23198 2707 --
NM_145321chr793427 2400 2284 2190 1371 1071 581 203 156 13399 23198 2707 --
NM_145322chr793427 2400 2284 2190 1371 1071 581 203 156 13399 23198 2707 --
NM_145341chr1031876 1336 624 21840 1371 ----
NM_145686chr293361 3159 3083 2786 2365 2090 1142 981 540 22481 1362 21366 226 --
NM_145687chr293361 3159 3083 2786 2365 2090 1142 981 540 22481 1362 21366 226 --
NM_145690chr851905 1328 1270 706 505 21881 693 ----
NM_145693chr252125 747 450 260 77 32568 2523 2017 132 --
NM_145698chr101760 21932 426 ----
NM_145716chr11236 ------
NM_145753chr311070 11555 ----
NM_145756chr1811180 21081 1054 --199
NM_145800chrX--1331 ----
NM_145802chrX--1280 ----
NM_145808chr783041 2294 2135 2038 1950 1213 1189 474 11907 ----
NM_145810chr241197 1146 1138 254 ------
NM_145859chr31351 ------
NM_145860chr31351 ------
NM_145911chr16137 ------
NM_147150chr953997 3536 2666 1462 1211 22998 100 13461 13964
NM_147156chr1031511 1260 287 2583 302 ----
NM_147175chrX12028 ----21369 741
NM_147181chr421418 195 ------
NM_147182chr421418 195 ------
NM_147183chr421418 195 ------
NM_147189chr872343 2318 2086 1783 1611 583 118 12120 ----
NM_148174chr841600 1482 877 201 32070 526 493 ----
NM_148894chr42884 286 21200 304 ----
NM_148955chr1586111 6025 5567 2612 2356 1389 290 86 ------
NM_152230chr10176 ------
NM_152263chr115192 --14755 --
NM_152265chr121201 131 ----11627
NM_152280chr123320 2536 32557 2487 277 22936 2350 22685 602
NM_152298chr1150 ------
NM_152330chr1482053 1899 855 739 648 610 254 205 --12059 --
NM_152332chr1472782 2500 2240 1959 1868 418 135 21836 165 12050 --
NM_152360chr191144 ------
NM_152388chr263764 3617 2814 1431 544 62 ------
NM_152400chr442099 1766 1685 770 21655 651 ----
NM_152409chr553404 2347 1369 773 170 --13338 --
NM_152417chr841365 1347 1258 320 ------
NM_152424chrX84685 4455 3508 3319 2889 1851 575 196 --14559 --
NM_152455chr1552657 1790 767 255 41 1477 11869 --
NM_152519chr231624 522 33 21554 548 ----
NM_152520chr231239 1011 115 11004 ----
NM_152523chr21758 1215 --1185
NM_152527chr241832 1564 651 187 1543 12001 --
NM_152529chr284348 3955 3915 3151 2903 1763 1364 735 23021 836 --1749
NM_152546chr511077 ------
NM_152553chr63578 503 184 ------
NM_152556chr732524 449 113 11634 --1813
NM_152564chr82632 374 21670 1171 --11806
NM_152570chr9137 ------
NM_152581chrX1575 31134 562 380 ----
NM_152608chr142413 1974 1591 530 12223 11721 --
NM_152622chr542612 1031 454 439 13104 1488 --
NM_152624chr5187441 6873 6843 5210 5031 2914 2097 1901 1789 1652 1149 1107 718 408 302 177 114 102 16033 24541 2586 --
NM_152629chr931485 1038 337 2669 446 ----
NM_152636chr1173106 3004 2777 2135 1907 1180 952 11104 ----
NM_152647chr15136 ------
NM_152665chr141210 1138 978 436 1502 ----
NM_152685chr52425 368 ------
NM_152688chr62949 867 ------
NM_152695chrX42062 2000 1928 906 21951 1769 ----
NM_152699chr373007 2733 2397 1128 919 839 541 1388 11335 --
NM_152724chr1062764 2047 2007 895 136 89 31863 1051 622 ----
NM_152725chr102150 31 1436 ----
NM_152727chr161254 ------
NM_152733chr6126496 6406 6086 5748 4845 4674 4243 4133 4090 1146 697 653 16279 ----
NM_152734chr675456 5412 5250 5198 3637 1345 659 12162 14278 --
NM_152737chr642080 1563 1553 1352 21866 1749 ----
NM_152745chr721159 1058 --11023 --
NM_152753chr62817 520 ------
NM_152754chr743832 3794 3066 801 33861 3589 935 ----
NM_152756chr584369 4033 3580 3094 1443 1095 780 671 33879 3733 3461 ----
NM_152758chr842775 2101 777 663 22063 303 ----
NM_152785chr342017 866 855 668 22374 1659 ----
NM_152787chrX83743 3242 3137 2989 2976 880 754 262 1892 ----
NM_152793chr7114826 4135 3975 3838 1973 1824 1221 737 410 343 327 1509 13537 --
NM_152826chr1586111 6025 5567 2612 2356 1389 290 86 ------
NM_152838chr2082976 2817 2487 2414 2340 1326 1164 52 13298 ----
NM_152857chr61710 1157 ----
NM_152858chr61710 1157 ----
NM_152860chr121988 ------
NM_152862chr21336 ------
NM_152910chr132598 510 1588 ----
NM_152924chr1545944 5746 4930 447 35506 5117 4791 --16731
NM_152945chr21188 ------
NM_152989chr124509 372 342 248 11744 ----
NM_152991chr113662 592 86 --160 --
NM_152995chr4175 125 ----
NM_152998chr71216 ------
NM_152999chr774024 1982 1601 1254 1180 557 431 13640 ----
NM_153020chr621649 1096 ------
NM_153038chr2--1712 ----
NM_153042chr631798 1747 702 31541 264 141 ----
NM_153184chr35432 327 273 249 195 11757 ----
NM_153188chr5124797 4782 4546 4509 4178 2086 1864 1463 1372 1167 857 786 11744 ----
NM_153207chr1233121 1170 1133 1881 ----
NM_153226chr1041151 1109 450 322 11174 ----
NM_153235chr651667 1573 673 592 558 --1607 --
NM_153261chr165648 358 352 318 176 ------
NM_153262chr123055 2743 21273 599 1799 --
NM_153267chr95629 611 351 322 269 ------
NM_153333chrX--1572 ----
NM_153354chr52917 168 ------
NM_153358chr19------1101
NM_153362chr63640 200 162 ------
NM_153365chr442307 1970 1751 979 12560 1892 --
NM_153377chr121290 ------
NM_153456chr1376081 5583 5451 3941 809 770 229 24353 1977 ----
NM_153605chr3--11207 ----
NM_153607chr582899 2767 2145 2113 2026 991 765 743 32982 2209 926 ----
NM_153610chr52547 504 ------
NM_153616chr151801 1811 1344 --
NM_153617chr151801 1811 1344 --
NM_153618chr151801 1811 1344 --
NM_153620chr731352 1307 1263 ------
NM_153634chr1251465 1051 623 378 53 11295 1290 --
NM_153689chr242357 932 441 248 ------
NM_153698chr9156 ----1424
NM_153712chr243325 1428 802 208 23080 2680 ----
NM_153748chr122821 778 11085 ----
NM_153757chr441136 835 398 112 11174 1439 --
NM_153769chr18161 ------
NM_153825chr421742 326 --1634 --
NM_153827chr17----1724 --
NM_170663chr17----1724 --
NM_170665chr12124473 4344 4212 4193 3629 3249 3024 2839 1299 1221 1016 755 24412 3866 ----
NM_170674chr153290 268 212 --1167 1480
NM_170675chr15------1156
NM_170676chr15------1156
NM_170677chr153290 268 212 --1167 1480
NM_170706chr164397 3545 3437 1352 1000 251 13813 11322 --
NM_170709chr821588 138 22338 517 11845 11609
NM_170724chr611038 1711 ----
NM_170731chr1131125 768 491 12679 ----
NM_170732chr1131125 768 491 12679 ----
NM_170733chr1131125 768 491 12679 ----
NM_170734chr1131125 768 491 12679 ----
NM_170735chr1131125 768 491 12679 ----
NM_170750chrX3868 771 212 ------
NM_172070chr252123 1811 1462 407 244 1476 1306 --
NM_172071chr162888 2245 1149 893 185 134 ------
NM_172103chr641719 978 440 70 22434 548 --1690
NM_172105chr641719 978 440 70 22434 548 --1690
NM_172109chr20153 ------
NM_172127chr45348 183 171 142 57 1408 11494 --
NM_172128chr44304 139 127 98 1364 11450 --
NM_172159chr312268 31558 851 372 2855 791 --
NM_172160chr312268 31558 851 372 2855 791 --
NM_172164chr1150 ------
NM_172240chr123505 195 54 ------
NM_172315chr153290 268 212 --1167 1480
NM_172316chr153290 268 212 --1167 1480
NM_172350chr171808 1595 696 409 370 127 115 189 ----
NM_172354chr161926 1713 527 488 245 233 1207 ----
NM_172359chr171812 1599 700 413 374 131 119 193 ----
NM_172373chr1321278 1180 1422 ----
NM_173054chr71618 ------
NM_173082chr61423 ------
NM_173083chr161289 1246 1142 922 911 208 ------
NM_173091chr20----1121 --
NM_173171chr21334 1385 ----
NM_173172chr21642 ------
NM_173173chr21334 1385 ----
NM_173198chr91300 1610 --12991
NM_173200chr91300 1610 --12991
NM_173214chr16107254 7040 6638 6341 5022 3171 2940 2649 1194 187 57314 6246 5989 3261 2667 11462 --
NM_173353chr12163 ----1549
NM_173354chr2152160 2036 1850 1343 277 --11515 12058
NM_173468chr4106069 5992 5756 5699 5378 2389 1667 895 718 644 14919 ----
NM_173469chr15----11533 --
NM_173471chr331030 270 97 --11072 153
NM_173510chr2222409 2204 22003 1862 ----
NM_173511chr252914 2747 635 441 192 23830 1453 ----
NM_173514chr51610 ----1589
NM_173519chr851752 747 711 402 386 21922 233 11623 --
NM_173531chr19133810 3635 3373 3361 3250 3090 2922 2698 2486 1351 1245 357 183 42718 1031 695 490 ----
NM_173533chr11252 ------
NM_173545chr232128 1472 453 42072 2030 1961 1354 11883 --
NM_173552chr341794 1614 891 537 --11574 --
NM_173561chr611110 ------
NM_173563chr6126 ------
NM_173576chr1022199 506 ------
NM_173591chr1221031 987 ------
NM_173602chr1233245 2756 306 --23489 2402 --
NM_173642chr1119163 7868 6404 6033 5697 3676 3039 1920 1509 1132 749 11749 ----
NM_173647chr22373 104 1961 ----
NM_173658chr31274 ------
NM_173666chr511142 ------
NM_173694chrX21832 993 12343 1545 12149
NM_173802chr121260 196 ----
NM_173808chr164346 3198 1181 1112 437 106 ----11305
NM_173809chr10--11104 ----
NM_173827chr472859 2651 2118 1031 726 495 54 12822 ----
NM_173829chr5105257 4786 4639 2132 1855 1505 1330 642 540 527 12303 ----
NM_173830chr61149 ------
NM_175061chr732028 1926 116 32183 1846 1394 --1863
NM_175607chr32546 326 --2684 211 --
NM_175610chr1551266 1156 956 492 450 ------
NM_175612chr32546 326 --2684 211 --
NM_175623chr1266136 5541 2509 2418 1162 335 35897 1867 226 14725 --
NM_175624chr1266231 5636 2604 2513 1257 430 35992 1962 321 14820 --
NM_175625chr1266231 5636 2604 2513 1257 430 35992 1962 321 14820 --
NM_175736chr1267714 7162 6916 5351 5056 879 16870 12623 --
NM_175768chr651705 1299 1082 555 490 11365 11732 --
NM_175847chr1911265 ------
NM_175854chr1332293 2049 390 ------
NM_175861chr1285859 5822 3722 2406 1860 1799 767 159 24848 1322 ----
NM_175863chr641352 1233 1008 262 ------
NM_175873chr521338 1150 1472 ----
NM_175884chr721013 995 --1121 --
NM_175887chr75417 405 393 204 132 ------
NM_175910chr1962489 2442 2354 2232 2174 102 22168 1672 ----
NM_176823chr1103800 3522 3009 1053 969 948 704 544 334 273 --22673 984 --
NM_176824chr451287 1010 374 318 150 ------
NM_176871chr882928 2595 2505 2146 1196 1110 316 304 1979 ----
NM_177414chr141425 1296 1279 89 11320 ----
NM_177438chr1474073 3951 3027 3018 2638 1179 501 23994 2652 ----
NM_177454chr21694 1236 ----
NM_177531chr821143 130 1867 ----
NM_177553chr111165 ------
NM_177937chr94647 471 105 91 ------
NM_177947chrX41617 1561 351 130 ------
NM_177948chrX41617 1561 351 130 ------
NM_177949chrX1137 ------
NM_177968chr222255 298 21580 782 11669 --
NM_177969chr22682 62 ------
NM_177974chr1552261 1942 1437 264 150 1461 ----
NM_177976chr3--1473 ----
NM_177990chr2021697 426 ------
NM_178006chr1341715 1560 333 115 1158 22252 2205 --
NM_178007chr1341715 1560 333 115 1158 22252 2205 --
NM_178009chr132561 473 1551 ----
NM_178010chr124509 372 342 248 11744 ----
NM_178011chr102985 307 22153 754 12049 11062
NM_178012chr6--1307 ----
NM_178140chr542100 648 641 236 22677 1111 11021 11888
NM_178151chrX77467 6902 6642 4957 2816 1219 1086 26452 255 16579 --
NM_178152chrX77467 6902 6642 4957 2816 1219 1086 26452 255 16579 --
NM_178153chrX77467 6902 6642 4957 2816 1219 1086 26452 255 16579 --
NM_178154chr144686 658 228 198 ------
NM_178155chr144686 658 228 198 ------
NM_178156chr144686 658 228 198 ------
NM_178157chr144686 658 228 198 ------
NM_178161chr10--278 72 ----
NM_178234chr8------1261
NM_178496chr3--21487 605 --1549
NM_178505chr1073504 3261 2705 833 444 429 407 23153 2511 ----
NM_178509chr1743580 3043 2582 782 24096 3974 14136 --
NM_178585chr442440 2028 1177 901 23260 3219 12988 12984
NM_178586chr1452407 2287 1951 1615 1547 21629 938 ----
NM_178812chr851395 1200 603 454 284 1517 ----
NM_178815chr1022477 137 1212 1784 --
NM_178868chr33255 218 73 ------
NM_180989chr1352278 2133 1949 466 311 21676 48 ----
NM_181054chr1451093 411 332 307 76 ------
NM_181077chr1521978 1577 22321 2071 22226 1928 --
NM_181291chr14------2657 272
NM_181302chr141409 1105 1116 --
NM_181308chr141409 1105 1116 --
NM_181310chr621442 160 41848 1710 411 354 ----
NM_181351chr1162755 2620 2496 2049 1938 1885 ------
NM_181354chr811458 ------
NM_181358chr194247 4183 4060 3927 3462 2937 1644 1455 1161 --14263 --
NM_181361chr331302 327 313 21328 139 ----
NM_181443chr2052159 2130 171 93 38 42911 2860 2246 1024 12867 1603
NM_181457chr231343 1311 329 2427 114 ----
NM_181458chr241476 1444 954 462 2560 247 ----
NM_181460chr231289 1257 275 2373 60 ----
NM_181481chr18127049 6279 5510 5385 5161 5069 4734 4680 4630 2469 1381 963 31539 1077 542 1804 26269 987
NM_181482chr18127049 6279 5510 5385 5161 5069 4734 4680 4630 2469 1381 963 31539 1077 542 1804 26269 987
NM_181483chr18127049 6279 5510 5385 5161 5069 4734 4680 4630 2469 1381 963 31539 1077 542 1804 26269 987
NM_181504chr5124174 3981 3569 3025 2672 1280 1230 1193 1103 958 852 346 22592 293 ----
NM_181523chr5124174 3981 3569 3025 2672 1280 1230 1193 1103 958 852 346 22592 293 ----
NM_181524chr5124174 3981 3569 3025 2672 1280 1230 1193 1103 958 852 346 22592 293 ----
NM_181527chr201404 ------
NM_181528chr201459 ------
NM_181571chr1031089 354 248 1224 ----
NM_181575chr21121 ------
NM_181656chr173938 930 897 --1204 --
NM_181670chr1231465 1277 1208 1501 ----
NM_181705chr532289 1530 76 55683 5061 4354 748 371 --11037
NM_181714chr661901 1625 1379 446 265 86 21810 796 1134 --
NM_181723chr852090 1699 898 306 180 ------
NM_181746chr12833 32 ------
NM_181762chrX51126 959 790 233 199 ------
NM_181777chrX51126 959 790 233 199 ------
NM_181782chr662294 1761 578 443 388 111 1297 ----
NM_181783chr1241996 1989 1715 580 1619 --1283
NM_181794chr61258 1372 1834 --
NM_181795chr61258 1372 1834 --
NM_181839chr831000 337 65 ------
NM_181872chr91203 1108 ----
NM_181886chr431432 983 292 21385 878 ----
NM_181887chr431432 983 292 21385 878 ----
NM_181888chr431432 983 292 21385 878 ----
NM_181889chr431432 983 292 21385 878 ----
NM_181890chr431432 983 292 21385 878 ----
NM_181891chr431432 983 292 21385 878 ----
NM_181892chr431479 1030 339 21432 925 ----
NM_181893chr431432 983 292 21385 878 ----
NM_181897chr322493 267 22338 552 ----
NM_182314chrX41817 1662 1648 1302 11260 ----
NM_182485chr462445 2402 958 737 684 93 32995 1262 1211 ----
NM_182503chr645584 3605 567 273 45487 1244 1162 948 ----
NM_182511chr1821346 1184 ----11434
NM_182515chr19125802 5316 4728 4471 2245 2087 1349 1270 619 600 440 192 22101 2081 ----
NM_182551chr273534 3142 2885 2643 2620 2417 74 1189 ----
NM_182557chr11274 33 ------
NM_182569chr171145 ------
NM_182646chr462445 2402 958 737 684 93 32995 1262 1211 ----
NM_182659chrY--1122 ----
NM_182666chr32253 236 ------
NM_182691chr72484 427 11230 1993 --
NM_182692chr72484 427 11230 1993 --
NM_182718chr1031089 354 248 1224 ----
NM_182719chr1031089 354 248 1224 ----
NM_182724chr1031089 354 248 1224 ----
NM_182725chr1031089 354 248 1224 ----
NM_182729chr1231832 1215 241 --11239 --
NM_182742chr1231832 1215 241 --11239 --
NM_182743chr1231832 1215 241 --11239 --
NM_182757chr653494 3418 2629 1174 689 23437 724 ----
NM_182762chr765899 5863 5404 4887 4416 711 1929 ----
NM_182765chr1031987 1723 476 22346 1793 ----
NM_182769chr1031089 354 248 1224 ----
NM_182770chr1031089 354 248 1224 ----
NM_182771chr1031089 354 248 1224 ----
NM_182772chr1031089 354 248 1224 ----
NM_182789chr52373 124 ------
NM_182796chr51791 2828 633 ----
NM_182830chr1451992 1938 1872 1716 506 --11489 --
NM_182835chr14--150 ----
NM_182850chr1031089 354 248 1224 ----
NM_182898chr796162 5881 5428 5201 2496 2109 1936 1381 597 26611 2229 ----
NM_182899chr796162 5881 5428 5201 2496 2109 1936 1381 597 26611 2229 ----
NM_182907chr632393 595 453 12421 ----
NM_182910chr143624 332 22 2702 646 ----
NM_182911chr24195 112 104 78 ------
NM_182913chr143624 332 22 2702 646 ----
NM_182914chr143624 332 22 2702 646 ----
NM_182918chr2161337 1330 1159 922 415 314 1352 ----
NM_182948chr143004 2813 1986 310 ----13042
NM_182972chr141881 1865 734 102 --22369 1840 --
NM_182975chr11975 21112 1061 ----
NM_182977chr52778 32 ----1399
NM_182978chr18--1735 ----
NM_183004chr14113915 3778 3576 3558 3341 2461 1414 1242 987 545 35 32886 632 70 ----
NM_183060chr1031089 354 248 1224 ----
NM_183061chr32357 33 ------
NM_183078chr643635 2759 2653 2471 2865 373 13672 --
NM_183227chr671511 1123 1075 593 520 160 147 --143 --
NM_183234chr152509 349 1674 ----
NM_183235chr152509 349 1674 ----
NM_183236chr152509 349 1674 ----
NM_183238chr1263712 3457 2852 1108 71 23 1439 12920 --
NM_183323chr52373 124 ------
NM_183353chrX21057 746 197 1931 --
NM_183376chr1542403 2314 1665 702 22561 251 --11765
NM_183416chr141677 1484 661 327 --32075 1713 754 --
NM_183419chr881489 1398 1124 937 534 514 203 118 21478 332 ----
NM_184231chr31628 ------
NM_184234chr203687 547 159 ------
NM_194071chr785190 4773 3635 1396 995 875 786 410 24403 598 ----
NM_194247chr294491 1683 1675 1457 1247 644 441 219 95 54298 3711 1750 774 236 1240 --
NM_194283chr553841 3515 3179 371 288 1326 13915 --
NM_194285chr1172601 2397 2316 507 209 195 123 13027 13182 --
NM_194301chr1411023 1406 ----
NM_194314chr175085 4491 4466 2175 1992 1966 203 1615 15202 --
NM_194324chrX----1379 --
NM_194328chr953336 3254 3163 2619 409 13271 1554 --
NM_194329chr953336 3254 3163 2619 409 13271 1554 --
NM_194330chr953336 3254 3163 2619 409 13271 1554 --
NM_194332chr953336 3254 3163 2619 409 13271 1554 --
NM_194356chr1262253 1686 1591 1532 535 251 ------
NM_194463chrX31072 969 872 21261 446 --1458
NM_197941chr562722 2363 731 393 101 49 12422 1693 --
NM_197962chr1154 ------
NM_197970chr211414 11469 ----
NM_198066chr1432810 871 35 12015 ----
NM_198086chr1452150 1711 601 464 87 ------
NM_198120chr82374 208 1585 ----
NM_198123chr841732 1696 1581 1282 --155 21810 1805
NM_198124chr841732 1696 1581 1282 --155 21810 1805
NM_198158chr353028 2973 2846 580 469 32175 392 371 ----
NM_198159chr353028 2973 2846 580 469 32175 392 371 ----
NM_198177chr353028 2973 2846 580 469 32175 392 371 ----
NM_198178chr353028 2973 2846 580 469 32175 392 371 ----
NM_198181chr1542633 2064 1936 1008 32701 2450 2376 ----
NM_198195chr32619 242 ------
NM_198225chr1051687 1633 1529 1440 703 1536 ----
NM_198240chr1221206 1053 11347 ----
NM_198261chr121753 1640 ----
NM_198262chr121753 1640 ----
NM_198268chr194247 4183 4060 3927 3462 2937 1644 1455 1161 --14263 --
NM_198269chr194247 4183 4060 3927 3462 2937 1644 1455 1161 --14263 --
NM_198273chr553057 886 605 347 284 33073 2290 2268 --12436
NM_198321chr522296 451 23034 2035 11990 12265
NM_198324chr1221129 255 11362 ----
NM_198336chr721663 284 21751 1678 ----
NM_198353chr42489 41 ------
NM_198391chr2011286 31179 959 432 1117 --
NM_198399chr341559 1459 1193 180 --11784 --
NM_198400chr1582774 2719 2586 1790 1136 1068 941 427 --12261 --
NM_198465chrX72927 2839 2771 2732 218 161 133 ------
NM_198503chr121520 161 21996 1559 ----
NM_198504chr31855 ------
NM_198513chr841908 1878 1515 731 ------
NM_198549chr152676 2082 359 243 97 12616 ----
NM_198569chr652078 474 324 284 118 22646 423 ----
NM_198581chr2105189 4638 4564 1899 1448 1361 1278 763 446 314 32049 1667 467 ----
NM_198595chr454090 4082 1787 1312 142 14697 14853 --
NM_198715chr1126155 5896 5651 4547 4373 3864 2471 1974 1697 1614 495 488 25479 4976 --15474
NM_198793chr314059 11414 --14094
NM_198794chr1451205 900 560 505 284 ------
NM_198829chr721028 118 21474 204 ----
NM_198859chr334955 3571 1375 3787 420 47 23538 1902 1425
NM_198889chr431444 1350 386 11413 1991 --
NM_198900chr1267714 7162 6916 5351 5056 879 16870 12623 --
NM_198904chr542010 1828 1416 579 31856 673 343 ----
NM_198965chr122292 103 ------
NM_198966chr122292 103 ------
NM_198991chr182738 578 1241 ----
NM_198995chr182522 452 ------
NM_199039chr431099 287 263 ----1357
NM_199044chr132020 89 52 --23046 2276 2559 385
NM_199132chr1962036 1914 1511 808 537 290 3781 697 613 ----
NM_199136chr7--161 ----
NM_199141chr191625 ------
NM_199185chr5187 ------
NM_199188chr1232558 1339 1145 21644 599 1780 --
NM_199189chr52856 293 1661 1644 --
NM_199190chr1232558 1339 1145 21644 599 1780 --
NM_199229chr231765 647 538 1199 --184
NM_199246chr51468 21028 527 11074 11070
NM_199320chr442551 2536 2147 943 12320 ----
NM_199320chr442551 2536 2147 943 12320 ----
NM_199324chr4133698 3373 3128 2859 2839 2365 1311 873 856 796 637 474 456 ------
NM_199327chr421181 1099 ------
NM_199436chr243118 2648 1152 782 2299 186 --2901 180
NM_199454chr154756 4715 4655 4463 3071 24744 4278 ----
NM_199461chr1073353 2690 1416 1338 1125 661 655 13296 ----
NM_199462chr143780 3712 3074 1670 14800 --11225
NM_199478chrX31407 1333 60 ------
NM_199482chr252112 1439 1374 235 22 1545 ----
NM_201266chr233003 1156 170 ----12986
NM_201267chr21236 ------
NM_201269chr11928 1914 ----
NM_201279chr233003 1156 170 ----12986
NM_201280chr641597 1580 615 463 11430 1606 --
NM_201453chr91143 ------
NM_201548chr24451 296 259 27 1939 ----
NM_201570chr1041672 1290 656 321 11762 ----
NM_201571chr1041672 1290 656 321 11762 ----
NM_201572chr1041672 1290 656 321 11762 ----
NM_201590chr1041672 1290 656 321 11762 ----
NM_201591chr451909 1303 715 709 35 21933 293 ----
NM_201592chr451909 1303 715 709 35 21933 293 ----
NM_201593chr1041672 1290 656 321 11762 ----
NM_201596chr1041672 1290 656 321 11762 ----
NM_201597chr1041672 1290 656 321 11762 ----
NM_201632chr511856 ------
NM_201995chr111659 ------
NM_201998chr111724 ------
NM_203301chr1431725 1368 612 11095 2410 195 --
NM_203327chr2063421 3098 2960 1716 1542 1145 13991 ----
NM_203349chr1551884 1798 836 535 113 11991 ----
NM_203350chr1--31716 1600 589 141 11144
NM_203364chr111481 21166 1142 ----
NM_203399chr12223 112 ------
NM_203401chr12223 112 ------
NM_203406chr532850 2312 450 42704 2212 1983 712 ----
NM_203417chr2151318 1294 1166 431 170 --11332 1460
NM_203418chr2151318 1294 1166 431 170 --11332 1460
NM_203437chr21157 1204 ----
NM_203446chr2152742 2649 2047 912 217 12627 ----
NM_203458chr152938 2438 1005 840 139 11149 13699 12534
NM_203459chr142109 750 381 168 21951 147 22493 2339 --
NM_203463chr2114446 3550 3166 3097 1186 915 765 483 383 139 72 33918 1920 1017 11001 21782 435
NM_203487chr1331498 1296 149 ------
NM_203504chr452073 1781 1009 474 365 3881 705 385 ----
NM_203505chr452073 1781 1009 474 365 3881 705 385 ----
NM_205768chr132028 1858 804 ------
NM_205860chr143056 2639 722 461 ----12215
NM_206594chr143549 2406 1320 720 23582 1150 --1697
NM_206595chr143549 2406 1320 720 23582 1150 --1697
NM_206839chr151556 --1583 --
NM_206853chr653963 3775 2506 863 578 44025 2719 911 564 ----
NM_206854chr6105224 5036 3767 3640 3306 2124 1839 1145 1128 55 35286 3980 1825 ----
NM_206855chr686189 6001 4732 4605 4271 2110 2093 1020 26251 4945 ----
NM_206866chr21113239 2903 2837 2614 2316 2107 1040 966 911 450 225 ----13129
NM_206907chr543074 2779 2508 2251 2545 122 11118 12657
NM_206909chr8138401 7604 6864 6488 6106 5623 3242 3200 3078 3034 2527 507 216 16376 ----
NM_206933chr12934 769 137 12829 --
NM_207015chr312369 2660 149 11745 --
NM_207043chr151583 818 535 255 146 12315 ----
NM_207044chr151583 818 535 255 146 12315 ----
NM_207047chr151583 818 535 255 146 12315 ----
NM_207123chr41589 --1322 --
NM_207171chr141408 1344 690 424 ------
NM_207292chr331174 928 305 23117 539 ----
NM_207293chr331174 928 305 23117 539 ----
NM_207294chr331174 928 305 23117 539 ----
NM_207295chr331174 928 305 23117 539 ----
NM_207296chr331174 928 305 23117 539 ----
NM_207297chr331199 953 330 23142 564 ----
NM_207299chr9177 ------
NM_207303chr1093819 3508 3174 1566 1489 967 590 513 357 ------
NM_207304chr1332163 1645 232 12218 22638 1777 --
NM_207343chr111159 ------
NM_207413chr8130 174 ----
NM_207506chr851220 1171 1123 395 52 ------
NM_212460chr751656 1399 643 589 175 ------
NM_212471chr1741916 1829 1449 1407 ----1345
NM_212472chr1741916 1829 1449 1407 ----1345
NM_212558chr973879 3486 3287 3240 1595 367 268 1984 ----
NM_213589chr295314 5207 4426 3974 3799 2203 1387 1078 633 14017 15155 11612
NM_213594chr1231124 1017 160 ------
NM_213648chr511856 ------
NM_213654chr331189 486 315 ----1993