TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-33b-3p
miRNA Sequence: CAGUGCCUCGGCAGUGCAGCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX23331 168 ------
NM_000068chr192563 235 --11423 --
NM_000070chr153530 343 120 ------
NM_000080chr17--180 ----
NM_000084chrX76553 6408 5461 4560 4246 757 683 ------
NM_000109chrX----12503 --
NM_000125chr663759 3401 1313 1102 883 606 ------
NM_000129chr621016 32 ------
NM_000138chr152157 94 ------
NM_000163chr532280 1647 858 ------
NM_000165chr61103 ------
NM_000168chr753186 2598 672 619 512 ------
NM_000176chr522550 701 13625 12919 --
NM_000192chr12--11203 ----
NM_000210chr22529 49 ------
NM_000217chr1244023 3365 1744 1250 --24172 2129 --
NM_000222chr421830 109 1755 21820 1336 --
NM_000232chr442771 2429 1287 861 --2711 699 --
NM_000240chrX22268 1996 ------
NM_000245chr742199 776 641 290 ------
NM_000248chr332938 2167 485 ------
NM_000256chr11130 ------
NM_000259chr1584723 4186 4013 3892 1228 1192 392 233 14467 --26137 678
NM_000266chrX1763 --1247 --
NM_000267chr1732959 2949 1287 --1581 --
NM_000280chr112272 195 ------
NM_000314chr1032631 2172 276 12384 ----
NM_000321chr13----11273 11208
NM_000332chr652448 1424 317 245 218 16756 21389 404 --
NM_000335chr311670 --1827 --
NM_000337chr534900 4684 1669 --21066 492 --
NM_000346chr1711849 ------
NM_000368chr931723 671 175 1761 13945 --
NM_000389chr63935 472 229 21269 170 11291 --
NM_000393chr21643 ------
NM_000408chr243004 1294 1084 1012 ------
NM_000411chr2162749 2565 2316 957 840 787 --32187 2039 452 --
NM_000428chr1422602 795 12200 21773 1041 --
NM_000430chr1723482 242 1295 13235 --
NM_000435chr191858 ------
NM_000461chr324295 171 ------
NM_000462chr1511641 ------
NM_000484chr2111034 ------
NM_000486chr1242234 1132 1118 865 --21111 337 --
NM_000492chr7--11244 1226 --
NM_000493chr61379 ------
NM_000494chr102823 53 ------
NM_000503chr811415 ------
NM_000522chr72907 129 ------
NM_000533chrX2386 344 ------
NM_000551chr351790 440 249 126 49 --2347 165 --
NM_000555chrX55342 5198 1772 1564 62 --37541 7109 5675 15438
NM_000609chr1012530 --22499 107 --
NM_000610chr112643 436 ------
NM_000612chr1163510 3426 2615 2377 606 495 ------
NM_000618chr1285568 5434 4196 2629 1401 1012 719 598 ------
NM_000618chr1285568 5434 4196 2629 1401 1012 719 598 ------
NM_000627chr21334 ------
NM_000633chr1825182 4566 21717 1581 ----
NM_000679chr52472 179 ------
NM_000682chr241622 1562 1260 749 --2537 517 --
NM_000702chr142252 2014 95 25 --22094 1703 12221
NM_000719chr1296393 5597 5316 4729 4413 2438 2029 240 177 11453 11507 --
NM_000720chr32362 339 ----192
NM_000724chr1021774 410 ------
NM_000725chr124924 388 37 31 197 --1228
NM_000726chr22298 288 ------
NM_000767chr1931298 1172 362 ------
NM_000782chr201197 --177 --
NM_000793chr1444067 1699 1240 176 ------
NM_000813chr553594 2242 1521 638 402 14529 ----
NM_000814chr1533860 3490 1530 --13392 --
NM_000826chr421774 240 ------
NM_000828chrX2515 23 1792 11830 --
NM_000868chrX2370 347 ------
NM_000875chr1596237 5346 4794 2731 1553 1530 747 648 626 --11815 --
NM_000880chr81136 ------
NM_000891chr1743184 1137 963 85 23030 610 ----
NM_000899chr1243822 2839 1131 198 ----12975
NM_000901chr411679 21644 434 ----
NM_000918chr17124 --1795 --
NM_000921chr121165 ------
NM_000940chr7179 ------
NM_000945chr2----11334 --
NM_000965chr311044 ------
NM_001001323chr1212413 ------
NM_001001344chrX42015 934 599 150 --1742 --
NM_001001389chr112643 436 ------
NM_001001390chr112643 436 ------
NM_001001391chr112643 436 ------
NM_001001392chr112689 482 ------
NM_001001481chr822691 671 12639 23446 2482 --
NM_001001484chr1021929 448 ------
NM_001001521chr2----184 --
NM_001001549chr721123 914 --1658 --
NM_001001550chr721123 914 --1658 --
NM_001001555chr721123 914 --1658 --
NM_001001713chr211325 ------
NM_001001787chr11205 ------
NM_001001995chrX----11183 --
NM_001002233chr822024 1716 ------
NM_001002258chr2127 --11480 --
NM_001002265chr102743 182 ------
NM_001002266chr102743 182 ------
NM_001002295chr101343 ------
NM_001002843chr152467 43 ------
NM_001002860chr1464700 4545 2868 1456 858 260 --23682 236 --
NM_001002909chr1742128 1748 655 621 ------
NM_001003406chr2293236 2807 2001 1155 1040 500 409 126 120 --12546 --
NM_001003407chr1034453 4268 1356 ------
NM_001003408chr1034453 4268 1356 ------
NM_001003652chr1877783 7591 6661 6599 1897 1669 1587 18257 ----
NM_001003681chr22--11991 ----
NM_001003688chr42812 351 ------
NM_001003694chr3--2525 420 ----
NM_001003712chr1222691 424 13212 ----
NM_001003760chr61134 13598 1282 --
NM_001003800chr943260 2298 460 130 --22465 1264 --
NM_001003940chr1563732 1317 1268 910 749 29 ------
NM_001003942chr1563732 1317 1268 910 749 29 ------
NM_001003943chr1563736 1321 1272 914 753 33 ------
NM_001004065chr942432 1450 1361 902 --13956 --
NM_001004317chr654547 3087 2880 1495 1212 1543 ----
NM_001004342chr175409 4902 3971 1669 1230 871 219 15678 ----
NM_001005242chr12------11639
NM_001005386chr22471 452 --1263 --
NM_001005404chr1734367 2766 872 ------
NM_001005473chr556019 4722 4551 800 740 ------
NM_001005746chr22298 288 ------
NM_001005747chr22298 288 ------
NM_001005781chr2----1117 --
NM_001005910chr3--1607 1168 --
NM_001005911chr3--1607 1168 --
NM_001006600chr542291 2087 2039 871 ------
NM_001006605chr11873 --11172 --
NM_001006605chr11873 --11172 --
NM_001006610chr162932 62 ------
NM_001006618chr91204 ------
NM_001006657chr232641 623 531 12753 ----
NM_001007023chr1444067 1699 1240 176 ------
NM_001007024chr1723209 2943 ------
NM_001007025chr1723209 2943 ------
NM_001007027chr111179 ------
NM_001007097chr921628 813 ----11598
NM_001007102chr61334 --1193 --
NM_001007156chr1511199 --178 --
NM_001007189chr5----156 --
NM_001007246chr2111436 11636 ----
NM_001007271chr102369 61 ------
NM_001007277chr111840 ------
NM_001007466chr674779 4737 3523 632 350 327 244 ----15080
NM_001007471chr92354 216 ------
NM_001007527chr5----1126 --
NM_001008222chrX4986 554 250 148 ------
NM_001008225chr71216 ------
NM_001008239chr183438 422 109 11179 31495 886 715 --
NM_001008408chr765359 5096 4310 2478 1408 706 11364 24476 2093 14991
NM_001008495chr822038 565 ------
NM_001008540chr21397 ------
NM_001008564chr1321491 691 --11759 --
NM_001008707chr1421336 1253 --21739 407 --
NM_001008726chr141525 ------
NM_001008738chr51413 ------
NM_001008895chr13----1218 --
NM_001009552chr8--1128 ----
NM_001009899chr372612 2252 1629 1604 1501 1470 1059 --25897 4423 --
NM_001009955chr1----136 --
NM_001009955chr1----136 --
NM_001009959chr232554 2111 214 ------
NM_001009993chr274376 4333 3374 3164 1690 1330 575 --23007 1022 --
NM_001009996chr34404 226 211 88 ------
NM_001010852chr61135 ------
NM_001010853chr663257 2426 1053 785 698 73 ------
NM_001010867chr1116529 4979 4753 4370 2526 2207 2123 1046 780 517 185 --15511 --
NM_001010888chrX53573 2857 2829 1184 149 34166 1445 472 13920 --
NM_001010891chr545563 5223 2640 181 --36098 5610 4596 --
NM_001010985chr1124 ------
NM_001011513chr443834 3556 710 193 ------
NM_001011553chr71699 ------
NM_001011666chr745576 4838 1250 69 ------
NM_001011708chr2144 ------
NM_001011713chr1411358 ------
NM_001012264chr143922 719 369 ------
NM_001012393chr1124596 1620 --21871 715 --
NM_001012398chr16--21081 1073 ----
NM_001012420chr1541104 1047 979 968 12904 ----
NM_001012423chr1531104 979 968 12904 ----
NM_001012426chr633416 3089 1317 ------
NM_001012427chr633416 3089 1317 ------
NM_001012968chrX1753 --22273 628 --
NM_001012979chrX----169 --
NM_001013031chr1012339 ------
NM_001013399chr6----1720 --
NM_001013674chr11308 ------
NM_001013693chr142609 2390 706 150 1636 --1250
NM_001013693chr142609 2390 706 150 1636 --1250
NM_001013699chr12123 ------
NM_001014797chr1056987 6887 6307 3126 888 18059 77569 7331 6736 5145 2631 1846 931 --
NM_001014839chr1159 1287 ----
NM_001014841chr1159 1287 ----
NM_001014972chr21195 ------
NM_001015045chr4--1885 1205 12399
NM_001015508chr8----140 --
NM_001015877chrX11116 ------
NM_001017371chr2----1208 --
NM_001017395chr333228 2948 2350 ------
NM_001017415chr1----1267 --
NM_001017416chr1----1267 --
NM_001017424chr151652 1310 1198 763 26 --1708 --
NM_001017425chr151652 1310 1198 763 26 --1708 --
NM_001017963chr141839 ----2747 178
NM_001017969chr9140 ------
NM_001017999chr122299 1846 ------
NM_001017999chr122299 1846 ------
NM_001018000chr122299 1846 ------
NM_001018000chr122299 1846 ------
NM_001018001chr122299 1846 ------
NM_001018003chr82645 55 --1197 --
NM_001018050chr2272883 2807 2344 2206 887 845 704 --1665 --
NM_001018052chr2272883 2807 2344 2206 887 845 704 --1665 --
NM_001018054chr11398 --11158 --
NM_001018064chr911683 1203 ----
NM_001018074chr522550 701 13625 12919 --
NM_001018075chr522550 701 13625 12919 --
NM_001018076chr522550 701 13625 12919 --
NM_001018077chr522550 701 13625 12919 --
NM_001018108chr1552264 2071 1911 1869 112 ------
NM_001020658chr11526 ------
NM_001020658chr11526 ------
NM_001020825chr5125 11100 1394 --
NM_001023567chr1531856 987 977 12296 ----
NM_001023587chr311140 ------
NM_001024094chr522550 701 13625 12919 --
NM_001024401chr1662581 2459 2191 1108 753 537 ------
NM_001024660chr311338 ------
NM_001024808chr1282713 2598 816 717 678 646 628 42 --1924 --
NM_001024855chr31710 ----1253
NM_001024858chr1462899 2335 1983 829 332 291 --12142 --
NM_001024948chr12953 180 --11208 --
NM_001024956chr1121922 139 --11075 1828
NM_001025068chr351482 1472 1153 494 62 ------
NM_001025069chr351482 1472 1153 494 62 ------
NM_001025076chr1045328 2150 1963 388 --11103 --
NM_001025077chr1026686 1746 --12461 --
NM_001025079chr332745 1298 675 1478 13911 --
NM_001025105chr511123 --11075 --
NM_001025242chrX11307 --11019 --
NM_001025243chrX11307 --11019 --
NM_001025252chr822904 539 --12744 --
NM_001025253chr822904 539 --12744 --
NM_001025366chr641231 1159 737 688 ------
NM_001025366chr641231 1159 737 688 ------
NM_001025367chr641231 1159 737 688 ------
NM_001025367chr641231 1159 737 688 ------
NM_001025368chr641231 1159 737 688 ------
NM_001025368chr641231 1159 737 688 ------
NM_001025369chr641247 1175 753 704 ------
NM_001025369chr641247 1175 753 704 ------
NM_001025370chr641231 1159 737 688 ------
NM_001025370chr641231 1159 737 688 ------
NM_001025580chrX54169 3119 1339 789 181 ------
NM_001025616chr421415 379 ------
NM_001029858chr621334 1131 --1921 --
NM_001029955chr493381 2981 2340 954 681 662 426 387 222 --1592 --
NM_001029989chr151602 --182 --
NM_001030007chr1641495 1151 1096 487 --22602 471 1566
NM_001030055chr1411064 --34667 3672 2899 --
NM_001031692chr7--1268 ----
NM_001031694chr13611 85 48 ----1835
NM_001031694chr13611 85 48 ----1835
NM_001031695chr2225017 4391 25038 1630 11182 11576
NM_001031711chr52524 441 --1486 11275
NM_001031712chr6193 ------
NM_001031716chr22919 216 --1892 --
NM_001031732chr433464 3020 896 12394 11422 --
NM_001031804chr1611074 --23998 1222 --
NM_001031812chr531624 1459 528 --22122 594 --
NM_001032296chr1332401 1058 134 1770 12558 --
NM_001032380chr1021577 119 ------
NM_001033045chr244259 3209 3063 1426 ----11530
NM_001033047chr422333 618 --21856 271 --
NM_001033087chr2073188 2756 2078 1202 1171 635 567 ----1245
NM_001033117chr373985 3943 3224 1889 1265 851 154 ------
NM_001033551chr1723545 64 12919 22999 407 --
NM_001033561chr171195 ------
NM_001033578chr821752 170 12222 ----
NM_001033602chr1392521 2216 1982 1920 1704 1003 591 173 129 ------
NM_001033756chr631165 671 622 ------
NM_001033756chr631165 671 622 ------
NM_001034841chr1665323 4972 4514 4294 3786 941 --31886 441 106 --
NM_001035254chr951929 1747 1585 310 209 ------
NM_001035260chr1021400 62 --1655 --
NM_001037132chr731792 747 715 ----1658
NM_001037133chr731792 747 715 ----1658
NM_001037164chr7--1226 11760 11623
NM_001037172chr311352 --21080 228 --
NM_001037174chr242176 1632 1413 498 1575 ----
NM_001037954chr1163092 2478 1034 785 448 179 ------
NM_001039029chr1251927 1579 313 85 52 ------
NM_001039348chr21158 --128 --
NM_001039349chr21158 --128 --
NM_001039468chr111249 ------
NM_001039469chr112289 118 ------
NM_001039479chr14102155 1993 1943 1789 828 776 638 559 546 435 12025 12258 --
NM_001039538chr232997 2388 40 12410 13609 --
NM_001039547chr3--16743 11527 --
NM_001039570chr22104639 4262 3893 3512 3106 2950 1119 912 341 157 --1482 --
NM_001039571chr22104639 4262 3893 3512 3106 2950 1119 912 341 157 --1482 --
NM_001039590chrX21587 1076 ----13588
NM_001039591chrX21587 1076 ----13588
NM_001039618chr1135647 4424 3655 11191 14378 11277
NM_001039711chr11986 ------
NM_001039712chr11986 ------
NM_001039802chr11316 ------
NM_001039840chrX35755 4415 487 ----11398
NM_001039937chr1324054 2949 ------
NM_001039938chr13----11488 --
NM_001040001chr641632 1400 1302 457 ------
NM_001040100chr3128 ------
NM_001040134chr1931257 1103 444 --1500 --
NM_001040142chr221869 561 11970 ----
NM_001040143chr221869 561 11970 ----
NM_001040152chr734334 3868 1263 ------
NM_001040158chr5--1202 ----
NM_001040169chr52136 102 ------
NM_001040202chr41520 ------
NM_001040272chr92631 328 --12336 --
NM_001040402chr44689 521 352 172 ------
NM_001040409chr21373 ------
NM_001040429chr13129 --123 --
NM_001040446chr532249 495 108 ------
NM_001040653chr352306 2270 1722 871 751 ------
NM_001040708chr81107 ------
NM_001042388chr18158 ------
NM_001042404chr121776 776 ------
NM_001042413chr953640 3598 814 456 400 11421 ----
NM_001042427chr101261 ------
NM_001042453chrX1630 11108 ----
NM_001042473chr1041357 590 561 353 ------
NM_001042492chr1732959 2949 1287 --1581 --
NM_001042533chr33513 263 169 --23123 2260 --
NM_001042537chrX42250 1542 750 532 ------
NM_001042539chr16----127 --
NM_001042555chr1244330 3814 1368 1205 13364 44665 3407 818 169 --
NM_001042599chr257554 6646 5501 5074 4920 --16619 --
NM_001042604chr323146 975 --1147 --
NM_001042663chr141291 1059 942 484 ------
NM_001042664chr141291 1059 942 484 ------
NM_001042665chr141291 1059 942 484 ------
NM_001042669chr421415 379 ------
NM_001042681chr1----22227 1971 --
NM_001042682chr1----22227 1971 --
NM_001042682chr1----22227 1971 --
NM_001042749chrX----1326 --
NM_001042750chrX----1326 --
NM_001042751chrX----1326 --
NM_001042762chr7124 ------
NM_001043318chr1463426 3372 2747 1657 1320 87 12883 11090 --
NM_001043351chr132207 2089 1536 ------
NM_001044305chr621363 1066 --1400 --
NM_001044385chr243745 2591 2562 1248 ------
NM_001044722chr531624 1459 528 --22122 594 --
NM_001044723chr531624 1459 528 --22122 594 --
NM_001045478chr1139 ------
NM_001046chr532679 2283 37 ------
NM_001066chr132171 1637 764 ------
NM_001071775chr131241 ------
NM_001078chr1------1562
NM_001079874chr12842 177 ------
NM_001083620chr421772 239 ------
NM_001094chr171826 ------
NM_001099678chr356218 4768 4740 1502 590 --14585 11467
NM_001106chr3128483 7519 7453 6597 6425 3582 2537 2218 2130 1691 691 650 ------
NM_001117chr1821730 540 --11965 --
NM_001119chr431238 1098 442 --1284 1258
NM_001121chr10--1441 ----
NM_001122631chr112204 59 --1434 --
NM_001124chr112537 132 ------
NM_001128chr1641495 1151 1096 487 --22602 471 1566
NM_001148chr431757 304 134 ------
NM_001149chr1011282 --1548 --
NM_001152chrX137 ------
NM_001163chr92851 251 --1747 --
NM_001167chrX66723 6018 5618 5416 1698 933 ------
NM_001173chr1411064 --34667 3672 2899 --
NM_001174chrX1331 --173 --
NM_001186chr2122988 768 ------
NM_001189chr451062 703 211 104 56 ------
NM_001200chr2011159 ------
NM_001201chr433453 3420 2656 --21509 1078 12590
NM_001204chr275540 4962 4775 2938 805 567 431 ------
NM_001219chr712274 ------
NM_001222chr1021512 525 --11880 --
NM_001237chr4----1936 --
NM_001237chr4----1936 --
NM_001241chr221803 712 --1821 --
NM_001241chr221803 712 --1821 --
NM_001254chr174847 821 379 42 11155 ----
NM_001256chr1722570 2004 ------
NM_001259chr786393 5046 4274 2519 1583 1133 392 341 --25086 542 --
NM_001261chr931061 184 76 ------
NM_001284chr5----1127 --
NM_001289chrX21241 341 --11393 --
NM_001290chr421016 240 ------
NM_001310chr12----1798 --
NM_001315chr6----11659 --
NM_001332chr5----1311 --
NM_001346chr342519 2083 645 528 12378 --12245
NM_001356chrX11896 ------
NM_001357chr1150 ------
NM_001358chr4----1422 --
NM_001383chr171302 --1151 --
NM_001390chr1823323 2329 ------
NM_001396chr2132807 607 510 --1359 --
NM_001397chr14699 532 210 76 12675 1237 --
NM_001400chr11926 ------
NM_001401chr911511 11101 ----
NM_001408chr11162 11597 ----
NM_001419chr1943758 1675 733 662 --13396 --
NM_001421chrX31701 1145 1080 11755 ----
NM_001423chr12----11420 --
NM_001430chr221844 765 21836 1752 ----
NM_001438chr111340 ------
NM_001447chr531107 519 233 --1889 --
NM_001448chrX41827 587 245 46 ------
NM_001451chr16----1927 --
NM_001493chrX1602 ------
NM_001498chr611175 --11016 --
NM_001518chr7--1830 ----
NM_001527chr633651 3450 3040 14627 ----
NM_001539chr9132 ------
NM_001546chr611288 ------
NM_001569chrX11307 --11019 --
NM_001584chr112928 916 ------
NM_001604chr112272 195 ------
NM_001617chr211242 ------
NM_001655chr112835 629 --21703 796 1820
NM_001664chr31976 --1378 1251
NM_001677chr11843 ------
NM_001682chr1222127 1085 ------
NM_001689chr2127 --11480 --
NM_001709chr11--12802 ----
NM_001730chr133411 369 321 ------
NM_001730chr133411 369 321 ------
NM_001731chr121951 ------
NM_001743chr2----1440 --
NM_001744chr5138 ------
NM_001755chr16--32083 1472 304 --1152
NM_001759chr1244570 3892 1329 881 --11435 --
NM_001769chr12------1292
NM_001777chr332745 1298 675 1478 13911 --
NM_001788chr71699 ------
NM_001791chr11316 ------
NM_001792chr181299 11031 ----
NM_001794chr201214 --1234 --
NM_001830chrX63331 1504 1204 1019 811 638 --1186 --
NM_001833chr91176 ------
NM_001843chr12----1164 --
NM_001854chr11122 ------
NM_001858chr633593 1116 875 15072 21633 1298 1132
NM_001866chrX--193 ----
NM_001892chr511123 --11075 --
NM_001918chr167178 7043 3662 2509 2497 131 --22936 1023 17227
NM_001931chr11--1149 ----
NM_001944chr181104 ------
NM_001964chr51441 ------
NM_001968chr41348 ------
NM_001981chr112357 12134 1952 --
NM_001993chr11873 2923 207 1993 --
NM_001999chr51942 1288 ----
NM_002015chr1323073 2430 13046 ----
NM_002017chr1121133 563 ------
NM_002023chr14558 115 44 21 ------
NM_002025chrX58794 7920 7112 5919 714 16376 --19269
NM_002028chr141130 --11241 11043
NM_002039chr41820 ------
NM_002040chr2111133 --1719 1966
NM_002051chr101343 ------
NM_002062chr611609 ------
NM_002063chrX1392 ------
NM_002086chr1712092 ------
NM_002094chr161340 ------
NM_002105chr112742 289 --11039 --
NM_002107chr11117 ------
NM_002126chr1744065 3776 3642 108 ------
NM_002128chr1322403 1981 ------
NM_002130chr5------1348
NM_002140chr911177 ------
NM_002146chr1731305 553 486 ------
NM_002149chr23790 758 269 --1719 --
NM_002154chr5--1216 ----
NM_002156chr2----1303 --
NM_002158chr2--11195 --12975
NM_002160chr91106 ------
NM_002192chr7----2553 446 --
NM_002210chr21585 1124 23143 431 --
NM_002214chr744106 1439 1304 313 --15675 --
NM_002222chr321307 523 ------
NM_002232chr111201 ------
NM_002233chr111377 ------
NM_002239chr2------122
NM_002247chr101254 ------
NM_002267chr1312403 ------
NM_002268chr3124 ------
NM_002293chr112740 ------
NM_002310chr5177 12028 ----
NM_002313chr1034453 4268 1356 ------
NM_002336chr1221577 335 --13141 --
NM_002356chr612801 --172 --
NM_002359chr1753946 3878 3177 338 45 11548 ----
NM_002372chr52727 651 ------
NM_002374chr232997 2388 40 12410 13609 --
NM_002382chr1421193 361 11012 ----
NM_002384chr181923 --2742 49 --
NM_002387chr521938 124 1887 ----
NM_002390chr1771775 1760 1725 1604 1456 200 87 ------
NM_002397chr531469 539 520 --1125 --
NM_002428chr1611194 --21263 968 --
NM_002473chr221172 --11150 --
NM_002480chr1211230 ------
NM_002486chr92443 279 1151 ----
NM_002499chr1552041 1629 369 247 159 ------
NM_002500chr2--189 ----
NM_002522chr1752645 1535 1176 1142 232 ------
NM_002545chr1124596 1620 --21871 715 --
NM_002546chr8--1132 2590 74 --
NM_002556chr111392 --1470 --
NM_002570chr151803 --31016 344 32 --
NM_002572chr11--162 189 --
NM_002577chr342628 1604 1235 688 ------
NM_002579chr1931257 1103 444 --1500 --
NM_002588chr531090 626 598 ------
NM_002590chr131144 ------
NM_002613chr1634188 3732 789 --24497 4361 --
NM_002628chr3--11043 1477 --
NM_002649chr73242 165 107 --11625 --
NM_002655chr844231 3790 791 681 ----12099
NM_002656chr61347 --1749 --
NM_002658chr103347 169 25 ------
NM_002662chr311691 --3724 622 431 --
NM_002670chr311600 ------
NM_002710chr121149 ------
NM_002715chr5--1803 ----
NM_002716chr111308 --13068 --
NM_002719chr141657 ------
NM_002731chr132487 1141 180 ------
NM_002734chr17----11413 --
NM_002745chr2222960 448 14295 21823 1780 --
NM_002748chr1511026 1768 ----
NM_002760chrY24182 1823 1365 24439 2356 --
NM_002763chr11107 ------
NM_002813chr12----2281 178 --
NM_002837chr1224344 3365 --14567 11178
NM_002840chr111323 --1215 --
NM_002841chr3121 --1448 --
NM_002843chr1143279 2164 1017 58 ------
NM_002844chr61360 ------
NM_002848chr1221205 487 --1448 --
NM_002858chr111204 --11004 1886
NM_002868chr1251619 1611 654 283 149 ------
NM_002893chrX----177 --
NM_002912chr61651 ------
NM_002941chr31343 ----11261
NM_002945chr171561 ------
NM_002968chr16--1340 ----
NM_002970chrX1307 ------
NM_002972chr221224 ------
NM_002973chr12----1189 --
NM_002998chr841697 1685 827 115 ------
NM_003009chr192337 308 ------
NM_003011chr91567 ------
NM_003014chr7158 --21194 1128 --
NM_003017chr631362 1107 199 ----11029
NM_003028chr933712 2876 2379 1120 ----
NM_003030chr331283 199 41 --11315 11461
NM_003031chr162932 62 ------
NM_003042chr321607 450 ------
NM_003048chr21455 22845 409 ----
NM_003051chr11657 ------
NM_003068chr8----179 --
NM_003069chrX1238 ------
NM_003070chr9----189 --
NM_003074chr31715 --1844 1512
NM_003081chr201280 ------
NM_003106chr311049 ------
NM_003108chr262914 2635 2515 2405 2067 1400 --21031 445 --
NM_003111chr2----1208 --
NM_003112chr732743 2711 780 ------
NM_003115chr1--1390 ----
NM_003137chr642219 2091 1675 821 ------
NM_003144chr611502 11789 ----
NM_003150chr1751736 1487 447 161 42 ------
NM_003155chr821975 1795 ------
NM_003164chr11191 --122 --
NM_003173chrX11358 --1914 --
NM_003181chr6181 ------
NM_003189chr143293 3064 453 369 --1223 --
NM_003192chr6--1384 ----
NM_003205chr1511606 ------
NM_003216chr2253151 2840 2743 320 28 ------
NM_003221chr611066 --11478 --
NM_003234chr31868 1128 ----
NM_003236chr222933 2891 --11076 --
NM_003239chr14--1826 1908 --
NM_003246chr151371 1530 1615 --
NM_003250chr17----1461 --
NM_003255chr171886 ----1225
NM_003257chr15----1122 --
NM_003262chr344686 4550 3364 85 1173 21754 1048 --
NM_003269chr6------11201
NM_003270chrX----2769 389 --
NM_003286chr20----11064 --
NM_003291chr13175 ------
NM_003292chr131750 661 270 ------
NM_003295chr13----1152 --
NM_003298chr366046 5858 4645 2142 951 575 16201 ----
NM_003304chr311589 --11022 --
NM_003317chr142732 341 ------
NM_003326chr12263 31 1404 11704 --
NM_003330chr1221446 730 ----11857
NM_003338chr1011932 ------
NM_003339chr511071 --11229 1251
NM_003342chr1732817 2454 62 ------
NM_003348chr12----11197 --
NM_003350chr81421 --1220 --
NM_003358chr91144 ------
NM_003360chr41224 ------
NM_003367chr19----1338 --
NM_003368chr1----1267 --
NM_003374chr51167 --1299 --
NM_003376chr641231 1159 737 688 ------
NM_003376chr641231 1159 737 688 ------
NM_003400chr2----1232 --
NM_003404chr2031794 475 208 ------
NM_003405chr221172 --1250 --
NM_003406chr831584 1304 414 ------
NM_003407chr191684 ------
NM_003410chrX32833 2243 324 ------
NM_003411chrY1309 ------
NM_003413chrX1206 ------
NM_003442chr11--1603 ----
NM_003458chr383988 3599 3232 1330 1254 433 303 289 ------
NM_003467chr21397 ------
NM_003471chr31928 1298 1310 --
NM_003474chr1022366 1937 --3866 245 186 --
NM_003477chr111490 ------
NM_003478chr111179 ------
NM_003483chr122902 421 ------
NM_003488chr17157 ------
NM_003489chr2133265 353 289 12582 ----
NM_003505chr721713 641 ------
NM_003559chr1733022 2544 1466 --11016 --
NM_003576chr1332401 1058 134 1770 12558 --
NM_003583chr1243350 3183 2965 1423 --23270 2983 --
NM_003589chr13----1218 --
NM_003597chr2--1358 ----
NM_003607chr163772 3713 2649 1407 1359 837 --13056 --
NM_003615chr31195 ------
NM_003620chr17--1745 ----
NM_003629chr13704 73 35 1166 --12711
NM_003631chr102831 781 ------
NM_003670chr321367 121 --2568 420 --
NM_003672chr1----11380 --
NM_003677chr1242191 575 411 292 ------
NM_003679chr122818 2512 12587 ----
NM_003702chr82804 314 ------
NM_003705chr22555 92 ------
NM_003714chr542378 2257 2145 1994 ------
NM_003722chr332670 2252 380 12237 ----
NM_003725chr121417 ------
NM_003735chr531090 626 598 ------
NM_003736chr531090 626 598 ------
NM_003749chr1362043 1855 1817 604 209 159 --1859 --
NM_003759chr411211 --1688 --
NM_003760chr1----1172 --
NM_003787chr1811372 ------
NM_003796chr19----1441 --
NM_003822chr132877 858 152 ------
NM_003831chr1821802 635 ------
NM_003850chr132648 121 ------
NM_003861chr1452607 2251 1112 883 101 1993 1835 --
NM_003872chr222102 2095 ------
NM_003887chr222042 1430 ------
NM_003895chr212884 28 166 1438 --
NM_003901chr1042659 2157 2042 866 ------
NM_003913chr643331 1617 1042 665 --11293 --
NM_003916chrX2964 34 11045 ----
NM_003927chr181862 ------
NM_003939chr1043873 3733 3306 2765 ------
NM_003947chr321309 331 ------
NM_003958chr662943 2775 1041 756 234 21 --13711 --
NM_003972chr1011218 1981 ----
NM_003980chr621315 328 ------
NM_003983chr1644011 3037 1279 412 --13167 --
NM_003994chr1243822 2839 1131 198 ----12975
NM_003998chr41468 ------
NM_004006chrX----12503 --
NM_004007chrX----12503 --
NM_004009chrX----12503 --
NM_004010chrX----12503 --
NM_004011chrX----12503 --
NM_004012chrX----12503 --
NM_004013chrX----12503 --
NM_004014chrX----12503 --
NM_004015chrX----12503 --
NM_004016chrX----12417 --
NM_004017chrX----12503 --
NM_004018chrX----12417 --
NM_004020chrX----12503 --
NM_004021chrX----12417 --
NM_004022chrX----12417 --
NM_004023chrX----12417 --
NM_004040chr231237 449 165 --11140 --
NM_004050chr1462577 1096 883 387 285 222 ------
NM_004067chr71144 --1351 --
NM_004077chr12--11028 21012 113 --
NM_004087chr311774 ------
NM_004093chr1311055 --1907 --
NM_004105chr21158 --128 --
NM_004112chr1741729 1460 538 299 ------
NM_004124chr1411178 ------
NM_004133chr812103 127 ----
NM_004134chr52592 539 ------
NM_004156chr8--1128 ----
NM_004161chr211331 ------
NM_004162chr31902 ------
NM_004200chr1142520 2314 2162 878 --1220 --
NM_004229chrX12036 ------
NM_004274chr1422477 1295 ----12776
NM_004296chr1463704 3132 2853 996 410 60 --32861 2459 548 --
NM_004302chr1242796 2787 809 330 --11795 --
NM_004319chr132814 2411 360 ------
NM_004329chr101314 ------
NM_004331chr81537 --1174 --
NM_004342chr721809 610 ------
NM_004346chr43424 112 66 ------
NM_004370chr62855 711 --12195 --
NM_004378chr151206 ------
NM_004380chr16165 ------
NM_004384chr531624 1459 528 --22122 594 --
NM_004385chr51171 ------
NM_004392chr131949 11618 ----
NM_004393chr352125 1875 1811 1606 926 ------
NM_004397chr1123382 902 ------
NM_004411chr71712 ------
NM_004419chr101799 1960 ----
NM_004420chr1152243 1500 928 581 556 --21959 632 --
NM_004426chr1231973 1237 624 --11644 1784
NM_004432chr921974 217 --12223 --
NM_004434chr1421336 1253 --21739 407 --
NM_004437chr121442 531 --23514 837 --
NM_004447chr12--140 ----
NM_004449chr21----11082 --
NM_004482chr2162 ------
NM_004485chr194371 3484 3180 3045 2841 1621 1185 695 160 --11246 --
NM_004491chr19124237 3904 3020 1453 1233 1088 801 555 541 194 179 56 --23221 1305 --
NM_004497chr194724 699 215 172 ------
NM_004501chr134112 3983 3216 --11303 --
NM_004503chr121579 ------
NM_004506chr6177 ------
NM_004514chr1752249 1130 1118 465 286 --12450 --
NM_004529chr9----1920 --
NM_004567chr31620 --135 --
NM_004575chr411367 ------
NM_004586chrX35249 5165 4595 --14448 13765
NM_004598chr542876 1204 1083 85 ------
NM_004599chr22--1672 ----
NM_004600chr1----1506 --
NM_004612chr933997 3885 974 1872 ----
NM_004626chr112539 119 ------
NM_004631chr11398 --11158 --
NM_004634chr3--2525 420 ----
NM_004637chr31330 --11110 --
NM_004654chrY11200 ------
NM_004655chr171194 ------
NM_004660chrY32306 1931 1827 --1637 --
NM_004663chr1531416 1078 597 --21428 1141 --
NM_004687chr1721285 347 --1510 --
NM_004690chr61256 ------
NM_004696chr12547 269 ------
NM_004717chr731498 1489 338 ------
NM_004719chr1242493 2330 2022 1902 ------
NM_004726chrX31971 1263 531 --34863 3988 1485 --
NM_004730chr521436 470 --1574 --
NM_004733chr3------1421
NM_004734chr1332654 2074 1125 12316 ----
NM_004736chr11356 22271 1490 32243 479 329 --
NM_004742chr32394 346 ------
NM_004745chr825048 2070 --11962 1430
NM_004748chr1553888 3537 3138 1611 484 --11347 --
NM_004758chr171336 ------
NM_004760chr722094 197 --11583 --
NM_004768chr11293 ------
NM_004772chr521475 645 ------
NM_004774chr171157 ------
NM_004775chr1811957 ------
NM_004798chr2062966 2473 2221 970 548 179 ------
NM_004822chr1772673 2613 1265 1205 983 893 397 --11107 --
NM_004824chr621160 497 ------
NM_004830chr62882 298 ------
NM_004840chrX42184 1722 1518 192 ------
NM_004850chr211514 --11273 --
NM_004857chr1464337 3827 1755 1621 120 68 ----13805
NM_004866chr541452 1056 600 303 11034 ----
NM_004869chr181195 ------
NM_004871chr1723209 2943 ------
NM_004879chr111718 ------
NM_004888chr9133 197 ----
NM_004893chr5--1202 ----
NM_004896chr1011315 --1570 --
NM_004898chr432072 1981 738 --11073 1329
NM_004904chr745576 4838 1250 69 ------
NM_004905chr1--1149 ----
NM_004921chr12363 146 --1968 --
NM_004922chr102653 298 ------
NM_004954chr111249 ------
NM_004965chr211619 ------
NM_004969chr101542 ------
NM_004976chr1134622 3526 1232 11723 ----
NM_004985chr1233247 485 29 --13502 13434
NM_004992chrX88209 7938 7683 7625 3106 2159 1934 317 37713 2671 775 11533 --
NM_004992chrX88209 7938 7683 7625 3106 2159 1934 317 37713 2671 775 11533 --
NM_004995chr1451441 1138 1051 428 185 ------
NM_004999chr623542 45 --13577 31776 629 442
NM_005009chr16------1287
NM_005010chr731792 747 715 ----1658
NM_005014chr91606 ----1592
NM_005023chr5----11356 --
NM_005032chrX1216 --11101 --
NM_005044chrX--1182 12958 14173
NM_005045chr71342 ------
NM_005056chr1231173 1031 722 ------
NM_005063chr1033488 2501 1020 ------
NM_005065chr1433863 3528 109 1869 15086 --
NM_005079chr822904 539 --12744 --
NM_005080chr221980 ------
NM_005095chr1----11518 --
NM_005116chr2074047 3734 1725 817 770 628 38 23556 460 14176 --
NM_005119chr13460 159 149 --21130 43 --
NM_005120chrX----1155 --
NM_005121chr1733197 1066 786 --11136 --
NM_005126chr3--11738 --1618
NM_005134chr18158 ------
NM_005140chrX3779 650 413 ------
NM_005144chr861148 887 448 144 133 62 185 ----
NM_005154chr151204 ------
NM_005156chr945161 4865 4341 3549 ------
NM_005159chr1511760 ----12208
NM_005160chr2266736 6072 5800 4902 4415 76 --25575 673 --
NM_005168chr231352 1170 450 ------
NM_005180chr10--2674 616 11131 --
NM_005190chr6----1720 --
NM_005197chr1476071 6029 4890 1087 549 477 390 --14030 --
NM_005222chr71867 ------
NM_005230chr12--1207 ----
NM_005233chr3------22276 2031
NM_005235chr257554 6646 5501 5074 4920 --16619 --
NM_005238chr1122420 2201 11097 ----
NM_005241chr32872 291 --11310 --
NM_005244chr20------1686
NM_005254chr15176 --1907 --
NM_005256chr111609 ------
NM_005259chr221051 172 ------
NM_005277chr4--11529 --11848
NM_005284chr61175 ------
NM_005308chr10----1452 --
NM_005311chr721123 914 --1658 --
NM_005312chr952537 1074 642 592 85 ------
NM_005329chr1632089 350 293 --11849 --
NM_005339chr433873 127 101 --12744 --
NM_005342chrX32156 1049 323 --32105 304 254 --
NM_005348chr141839 ----2747 178
NM_005349chr41415 ------
NM_005359chr1844519 1389 785 203 ------
NM_005374chr1742164 859 349 187 ------
NM_005375chr6----1371 --
NM_005384chr9127 ------
NM_005387chr111148 --1710 --
NM_005402chr711757 --11465 --
NM_005407chr142476 352 ------
NM_005414chr3----1111 --
NM_005415chr21490 ------
NM_005433chr1811111 12096 ----
NM_005435chr71566 ------
NM_005436chr1033772 3531 2518 ------
NM_005443chr4174 ------
NM_005458chr95727 602 567 140 105 --42340 1823 988 273 21894 344
NM_005465chr161996 1248 732 527 394 98 ------
NM_005487chr22--11991 ----
NM_005497chr1795647 5311 4972 4229 3888 1753 1213 315 194 --14186 25882 5755
NM_005499chr19--1486 ----
NM_005501chr1721131 122 ------
NM_005502chr922061 699 --12287 --
NM_005521chr103712 584 542 ------
NM_005539chr102508 432 ----11228
NM_005552chr143523 430 406 ------
NM_005561chr132793 79 ------
NM_005565chr51539 --1421 --
NM_005587chr152271 255 --1189 --
NM_005596chr966269 6109 6043 5802 5578 1979 11014 --11025
NM_005600chr12278 94 ------
NM_005613chr131549 1458 877 --11358 --
NM_005614chr7--1264 1755 --
NM_005618chr61200 --1526 --
NM_005639chr121125 ----1482
NM_005647chrX23312 901 --11371 --
NM_005652chr163871 361 227 ------
NM_005668chr533519 1023 799 ------
NM_005677chr331385 1006 507 --2436 204 --
NM_005693chr11--1132 ----
NM_005700chr11--1118 ----
NM_005715chr652322 2072 1933 715 244 --32464 2346 1053 --
NM_005722chr22471 452 --1263 --
NM_005730chr123870 484 476 ------
NM_005738chr7--1226 11760 11623
NM_005746chr712355 --1672 --
NM_005748chr1232842 493 71 ------
NM_005749chr17--1281 ----
NM_005756chrX21043 965 ------
NM_005759chr243528 3305 864 378 --14275 --
NM_005765chrX1710 ------
NM_005775chr82645 55 --1197 --
NM_005776chr14------1797
NM_005779chr563384 3336 2261 1009 927 506 ----11175
NM_005786chr181267 --1467 --
NM_005789chr1722023 477 --11648 --
NM_005813chr21161 --22244 532 --
NM_005828chr1764942 4390 1108 1064 747 604 ------
NM_005839chr11284 ------
NM_005840chrX34879 1878 418 --15309 17403
NM_005842chr132673 94 ------
NM_005845chr13----136 --
NM_005857chr121221 215 ------
NM_005859chr51626 ------
NM_005895chr1253450 3223 1509 1227 1182 ------
NM_005898chr1121039 685 1818 1901 --
NM_005900chr42812 351 ------
NM_005901chr1877783 7591 6661 6599 1897 1669 1587 18257 ----
NM_005902chr1534123 1482 851 ------
NM_005906chr621520 125 21509 648 --11713
NM_005909chr51808 11074 2538 308 --
NM_005920chr123102 559 --12650 --
NM_005924chr7----1124 --
NM_005937chr1773567 3242 2618 1010 861 534 79 ------
NM_005941chr843488 3170 1512 1330 ------
NM_005955chr164645 4202 1985 1443 56 49 ------
NM_005964chr171168 ------
NM_005985chr201726 ------
NM_006003chr191231 ------
NM_006007chr933769 3522 1694 ----11287
NM_006011chr1544166 2662 2611 1304 ------
NM_006037chr264382 3597 3147 1050 842 359 ----14469
NM_006043chr161692 ------
NM_006060chr733475 3434 1411 --11455 --
NM_006076chr772998 2984 2960 2678 2202 384 85 ------
NM_006080chr712294 197 ----
NM_006094chr822421 403 ------
NM_006095chr4----1677 --
NM_006106chr111618 --13398 --
NM_006113chr12842 177 ------
NM_006135chr11409 ------
NM_006141chr1622514 1891 --1747 --
NM_006159chr121520 ------
NM_006164chr21395 1452 ----
NM_006166chr12------12222
NM_006180chr911683 1203 ----
NM_006186chr22841 217 ------
NM_006194chr14--11278 ----
NM_006202chr1911372 ------
NM_006206chr432746 1923 1013 1534 1527 --
NM_006212chr144955 3956 3821 534 --15271 --
NM_006224chr172598 579 --11720 --
NM_006226chr2--1945 ----
NM_006237chr1311553 --150 11808
NM_006254chr31154 ------
NM_006256chr111908 ------
NM_006258chr10--1149 ----
NM_006268chr1121050 881 ------
NM_006278chr114495 444 419 205 ------
NM_006282chr203475 433 230 --11842 --
NM_006298chr622821 2656 1883 --11269
NM_006306chrX64090 4010 3683 3677 2176 1138 --2478 127 25247 793
NM_006313chr1221300 1083 ------
NM_006321chr331924 1530 399 ------
NM_006345chr411049 1913 ----
NM_006352chr111719 ------
NM_006359chrX42250 1542 750 532 ------
NM_006363chr201212 ------
NM_006366chr61166 ----1953
NM_006367chr11766 ------
NM_006369chr11325 --1182 --
NM_006371chr323947 353 --44558 3311 1345 1080 --
NM_006380chr1723937 913 ------
NM_006382chr171194 ------
NM_006386chr2242391 1879 1824 1729 ------
NM_006390chr1221658 1557 1130 11512 --
NM_006393chr1044332 1522 623 140 --24023 3093 --
NM_006405chr141102 ------
NM_006411chr6--1913 ----
NM_006421chr8127 ------
NM_006457chr443834 3556 710 193 ------
NM_006469chr131424 266 61 --11116 --
NM_006482chr1243350 3183 2965 1423 --23270 2983 --
NM_006516chr1----21625 1099 --
NM_006517chrX----11561 1900
NM_006519chr61107 ------
NM_006526chr2032046 1545 708 ------
NM_006527chr42562 65 ------
NM_006534chr2033171 250 87 --21262 919 --
NM_006538chr213982 ------
NM_006540chr811219 --11335 --
NM_006544chr1444645 4453 1312 572 ------
NM_006546chr1756065 4765 1093 1077 612 --1246 --
NM_006559chr11417 ------
NM_006561chr1045328 2150 1963 388 --11103 --
NM_006572chr1742871 2173 503 280 ----11078
NM_006595chr1121282 21 ------
NM_006598chr551855 1701 1519 35 22 --1531 --
NM_006599chr1667059 6577 5763 5180 478 285 --11805 --
NM_006603chrX----1326 --
NM_006609chr222719 2542 --21158 486 --
NM_006614chr31975 --13140 --
NM_006618chr12387 94 --1289 --
NM_006621chr131704 328 302 ------
NM_006624chr1032087 1646 828 ----1483
NM_006626chr91174 1447 ----
NM_006628chr1544055 3711 1853 996 ------
NM_006636chr21373 ------
NM_006654chr1244330 3814 1368 1205 13364 44665 3407 818 169 --
NM_006660chr15----187 --
NM_006696chr51108 ------
NM_006698chr201167 --152 --
NM_006713chr51285 ------
NM_006717chr921046 608 ------
NM_006718chr61347 --1749 --
NM_006720chr1034453 4268 1356 ------
NM_006722chr332938 2167 485 ------
NM_006731chr955747 5251 1377 752 431 15765 --1579
NM_006734chr621496 218 ------
NM_006738chr1544002 3136 989 600 ----1734
NM_006751chr2----181 --
NM_006759chr2----184 --
NM_006763chr121525 478 ------
NM_006765chr8126 ------
NM_006766chr8----1491 11699
NM_006771chr171255 ------
NM_006775chr61754 --1121 --
NM_006783chr131280 ------
NM_006790chr51348 ------
NM_006791chr15----1490 --
NM_006802chr12324 142 --11083 --
NM_006807chr1711289 ------
NM_006813chr61313 --1345 --
NM_006815chr122916 526 ------
NM_006827chr1433333 101 76 12544 12336 --
NM_006852chr1712641 ----1535
NM_006874chr41861 ------
NM_006884chr331283 199 41 --11315 11461
NM_006885chr1633807 3676 1270 ----1268
NM_006888chr1413514 ------
NM_006902chr123191 1053 ------
NM_006912chr121985 1625 12300 12357 --
NM_006914chr921211 330 ------
NM_006915chrX21852 866 11643 1579 --
NM_006918chr1121922 139 --11075 1828
NM_006924chr1712779 22916 1176 ----
NM_006930chr52663 313 --1637 --
NM_006948chr2122339 241 ------
NM_006981chr91470 --1223 --
NM_006988chr211354 1255 ----
NM_007011chr15126217 4949 4943 4322 2505 2438 1950 1861 1692 1453 224 125 --34871 2579 614 --
NM_007023chr2--1787 ----
NM_007033chr11171 --11637 --
NM_007034chr1----138 --
NM_007036chr51927 ------
NM_007039chr1471642 1518 1422 925 732 535 112 ------
NM_007064chr311338 ------
NM_007067chr172467 279 1358 ----
NM_007073chr663895 3557 1540 1483 974 708 --11416 --
NM_007084chr13157 ------
NM_007096chr91176 ------
NM_007114chr323013 979 ------
NM_007137chrX45250 4844 1858 1253 --24306 3564 --
NM_007146chr1722596 2051 --1911 --
NM_007173chr111227 12141 21605 548 --
NM_007174chr1261950 1588 1535 915 535 217 ------
NM_007191chr121554 ------
NM_007200chr1544002 3136 989 600 ----1734
NM_007203chr942432 1450 1361 902 --13956 --
NM_007204chr1198 ------
NM_007212chr132194 2172 2105 174 ----
NM_007214chr61546 ------
NM_007236chr1521751 981 31968 1944 181 12344 --
NM_007249chr1389367 8598 8057 6780 1250 839 545 145 12322 1246 --
NM_007271chr61742 1603 ----
NM_007278chr172406 118 ------
NM_007325chrX2515 23 1792 11830 --
NM_007341chr211325 ------
NM_007345chr181437 ----1232
NM_007347chr1542648 2368 1204 87 --13159 --
NM_007358chr1149 ------
NM_007359chr171621 11246 11468 --
NM_007375chr132673 2507 814 ------
NM_012081chr522610 2269 13519 ----
NM_012095chr1033301 3137 69 ------
NM_012096chr33680 581 564 --12798 --
NM_012097chr242176 1632 1413 498 1575 ----
NM_012099chr191183 ------
NM_012102chr1----22227 1971 --
NM_012124chr111113 ------
NM_012141chr1324054 2949 ------
NM_012153chr1111580 1360 ----
NM_012156chr2032815 2373 24 --11320 --
NM_012158chr131741 11294 1750 --
NM_012161chr421054 974 ------
NM_012164chr947218 6150 4941 2721 ------
NM_012197chr9--1602 11323 --
NM_012199chr143991 3578 3233 719 ----1712
NM_012214chr255823 5535 4121 2459 347 15488 36266 4285 1265 --
NM_012236chr13611 85 48 ----1835
NM_012238chr101517 ----1227
NM_012242chr101222 ------
NM_012247chr10------1326
NM_012249chr222910 236 --12428 --
NM_012252chr754759 3938 3624 1305 264 --1946 11532
NM_012261chr201509 ------
NM_012262chr135189 3550 167 --1192 --
NM_012281chr732000 538 175 ------
NM_012286chrX----1478 --
NM_012287chr343537 1376 330 130 --13719 --
NM_012288chr675111 1600 1507 1223 809 596 287 --1630 --
NM_012296chr1151383 1125 1047 1030 186 ------
NM_012297chr42585 486 ------
NM_012301chr721862 112 ------
NM_012306chr1252996 2967 2620 2213 406 --2796 460 --
NM_012308chr1141750 1586 787 259 11708 ----
NM_012309chr1131154 1068 1020 --24327 3531 --
NM_012316chr1105545 5086 4763 4618 4529 4285 3469 1893 1848 443 34127 3852 3624 12018 --
NM_012319chr1831015 986 159 ------
NM_012329chr1721513 48 ------
NM_012333chr131432 364 292 11031 ----
NM_012334chr584676 4080 3822 3233 3031 1618 1189 400 ------
NM_012384chr2042456 2392 1919 936 --1677 --
NM_012417chr171413 ------
NM_012428chr151169 ------
NM_012464chr412686 --12873 --
NM_013254chr12--2492 61 ----
NM_013255chr743188 2451 1920 1197 16488 25562 1080 --
NM_013256chr191264 ------
NM_013257chr821752 170 12222 ----
NM_013262chr611134 ------
NM_013272chr152264 111 --1307 --
NM_013281chr2011526 ------
NM_013283chr5156 ------
NM_013309chr1512651 ------
NM_013323chr1721188 71 --21053 982 --
NM_013341chr2144 ------
NM_013374chr322087 1265 12161 1443 --
NM_013381chr1221787 657 22265 440 ----
NM_013390chr921527 66 --11738 --
NM_013436chr2--1658 ----
NM_013989chr1444067 1699 1240 176 ------
NM_013995chrX32223 751 498 1811 ----
NM_014011chr21293 --2617 585 --
NM_014016chr321542 428 ------
NM_014034chr621293 1008 ------
NM_014038chr7----1318 --
NM_014044chr21156 ------
NM_014048chr1621669 454 --24679 4652 11688
NM_014057chr91400 ------
NM_014069chr63321 43 33 ------
NM_014080chr151415 ------
NM_014089chr1321491 691 --11759 --
NM_014106chr1522071 844 --2231 116 --
NM_014112chr865196 4920 4355 4316 4168 972 --14237 --
NM_014117chr161760 ------
NM_014141chr744893 3964 3358 3263 --11851 2684 281
NM_014154chr3165 ------
NM_014155chr1176788 6781 5910 5422 1389 864 852 ------
NM_014157chr1683572 3153 2898 2640 894 758 401 214 --13966 --
NM_014171chr2164 ------
NM_014181chr222796 1960 12807 ----
NM_014189chr431238 1098 442 --1284 1258
NM_014190chr421590 1450 --1636 1610
NM_014217chr151652 1310 1198 763 26 --1708 --
NM_014223chr12292 68 ------
NM_014238chr171685 197 ----
NM_014240chr373679 3651 2864 2819 1103 875 762 ----11077
NM_014250chr22--11991 ----
NM_014253chrX1958 ------
NM_014268chr181388 ------
NM_014278chr4----1434 --
NM_014283chr1----1111 --
NM_014284chr1159 1287 ----
NM_014294chr81150 11437 ----
NM_014309chr2225007 4381 25028 1620 11172 11566
NM_014319chr1221736 1514 ------
NM_014368chr942170 1660 1581 1525 --11737 1726
NM_014372chr11417 --12042 --
NM_014382chr3----1429 --
NM_014386chr51200 ------
NM_014391chr10252 42 ------
NM_014393chr82564 466 ------
NM_014423chr535238 4909 637 --25315 5154 --
NM_014445chr322063 953 --1425 --
NM_014447chr421363 1240 ------
NM_014454chr61668 ----168
NM_014456chr1031571 1437 1171 --1117 --
NM_014470chr122730 58 ----1219
NM_014488chr11----2523 240 --
NM_014497chr21195 ------
NM_014504chr741446 488 284 122 --1823 --
NM_014517chr341868 671 366 252 ------
NM_014547chr15--1728 ----
NM_014547chr15--1728 ----
NM_014575chr3----1196 --
NM_014586chr2194395 4370 3881 3267 1712 1302 927 903 322 14610 14737 --
NM_014588chr202215 55 ------
NM_014602chr3----165 --
NM_014614chr22236 59 ------
NM_014615chr1611333 ------
NM_014616chr321187 282 ------
NM_014621chr2----1100 --
NM_014630chr1553889 1205 772 688 380 --1716 11570
NM_014646chr1822843 2637 --1974 --
NM_014647chr1621543 236 --11566 --
NM_014665chr8123406 3305 3126 3107 3054 2642 2631 1473 1032 682 526 138 --33268 2959 445 --
NM_014667chr331731 1593 738 ------
NM_014671chr7----21050 487 --
NM_014676chr11526 ------
NM_014682chr811580 ------
NM_014683chr171646 --11652 --
NM_014702chr633077 2984 2454 --1493 --
NM_014703chr341222 925 487 285 ------
NM_014717chr191723 ------
NM_014720chr1011364 ------
NM_014729chr811594 --11873 --
NM_014730chr1254570 3674 3298 3277 416 --11947 --
NM_014730chr1254570 3674 3298 3277 416 --11947 --
NM_014731chr20121 ----11668
NM_014733chr521825 1753 ------
NM_014736chr151627 --1107 --
NM_014739chr624180 1078 ----13815
NM_014746chr253472 3254 3102 468 304 ------
NM_014747chr134325 3575 1278 --11579 11603
NM_014752chr111584 --11937 --
NM_014755chr263854 3398 1700 1247 783 437 ----1486
NM_014759chr81143 ------
NM_014764chr12----1147 --
NM_014765chr132479 2021 393 ------
NM_014788chr932861 379 32 ------
NM_014802chr121149 ------
NM_014810chr12833 825 --13354 --
NM_014812chr121776 776 ------
NM_014822chr42181 136 ------
NM_014826chr163772 3713 2649 1407 1359 837 --13056 --
NM_014829chr51139 ------
NM_014836chr1021577 119 ------
NM_014838chr2232504 2065 575 --2385 112 --
NM_014839chr1----1772 11703
NM_014840chr1262829 2408 933 287 228 119 --23220 710 --
NM_014850chr373985 3943 3224 1889 1265 851 154 ------
NM_014873chr164150 3583 1624 1343 697 601 1942 ----
NM_014877chr1757445 6607 6179 6045 642 --27140 630 15817
NM_014883chr4--1885 1205 12399
NM_014897chr1732604 2318 2229 ------
NM_014899chr51388 --1855 --
NM_014904chr1043954 3817 515 269 ------
NM_014906chr172943 853 1468 ----
NM_014912chr1053011 2162 1031 217 62 ------
NM_014915chr10----11447 --
NM_014916chr73684 618 293 ------
NM_014918chr151539 ------
NM_014920chr623212 1539 --23194 500 --
NM_014923chr1341436 167 104 91 ------
NM_014925chr121164 1394 ----
NM_014927chrX140 ------
NM_014932chr32544 286 ------
NM_014934chr1333411 3207 3056 13951 1284 --
NM_014939chr1811417 11102 ----
NM_014947chr133135 2741 755 ------
NM_014949chr1--1862 ----
NM_014952chr1541420 511 230 59 ------
NM_014953chr1373934 3911 3569 3522 3023 1672 695 --11095 --
NM_014978chr101162 --11170 --
NM_014990chr14--11212 ----
NM_014991chr4----23273 75 --
NM_014999chr122375 195 --11644 --
NM_015000chr1212172 1825 1237 --
NM_015008chr333228 2948 2350 ------
NM_015009chr31786 ------
NM_015011chr1311154 ------
NM_015017chr121024 364 1143 ----
NM_015020chr1633327 552 247 --167 --
NM_015025chr211928 ------
NM_015026chr1254261 3780 3036 1687 438 ------
NM_015032chr1332851 1984 552 ------
NM_015035chr2086696 6327 5071 5027 1659 1522 509 115 12377 12646 14914
NM_015037chr101244 ------
NM_015039chr123189 160 --12812 --
NM_015042chr1553900 2943 668 285 219 ------
NM_015045chr1032027 715 166 ------
NM_015051chr943108 2381 2208 692 --12617 --
NM_015054chr12--1179 ----
NM_015068chr753186 2720 1087 984 115 ------
NM_015071chr566244 5876 4710 1909 410 291 14390 34433 2066 453 --
NM_015074chr185000 4611 3699 3327 1620 1434 1079 416 1945 11948 --
NM_015076chr623146 2878 ------
NM_015079chr1562848 1259 853 608 567 536 ------
NM_015090chr194911 4904 4562 4298 1720 1588 1024 909 834 --11118 --
NM_015092chr1631518 1223 71 ------
NM_015093chr61501 ------
NM_015094chr2294361 3652 1585 1363 1013 753 727 517 504 --21419 899 --
NM_015097chr3----12051 --
NM_015115chr44689 521 352 172 ------
NM_015129chrX31764 1243 187 ------
NM_015132chr72735 710 ------
NM_015144chr1643705 3448 3120 2616 --13195 --
NM_015155chr1033185 2824 559 --13378 --
NM_015156chr1431091 1028 126 ------
NM_015163chr14----1778 --
NM_015170chr831475 550 286 ------
NM_015172chr131516 1231 453 ------
NM_015185chrX1252 --21917 724 --
NM_015193chr811157 --11167 --
NM_015196chr41106 ------
NM_015199chr3--1142 21111 66 1415
NM_015203chr1----122 --
NM_015209chr122299 1846 ------
NM_015216chr511364 ------
NM_015230chr4--11578 1136 --
NM_015233chr1392521 2216 1982 1920 1704 1003 591 173 129 ------
NM_015236chr431239 1070 283 ----11202
NM_015238chr5----191 --
NM_015245chr632644 635 231 1871 ----
NM_015265chr222364 763 ------
NM_015270chr125725 507 444 89 45 11504 11968 11750
NM_015271chr443041 2867 1534 987 ------
NM_015275chr122754 511 --11428 --
NM_015284chr141818 738 589 270 ------
NM_015285chr1832346 1650 197 ------
NM_015288chr563402 3374 3290 3195 3116 3091 1364 ----
NM_015291chr1----23492 2574 --
NM_015305chr1421682 427 --1633 --
NM_015313chr1144580 4500 3261 919 --21099 768 --
NM_015317chr212033 ----12402
NM_015318chr1961696 1220 624 500 370 251 ------
NM_015326chr111032 ------
NM_015327chr12903 300 ------
NM_015329chr1951828 1112 989 367 65 1497 22437 227 --
NM_015332chr721246 954 --13462 --
NM_015335chr122668 146 ------
NM_015336chr121960 ------
NM_015339chr20187 ------
NM_015347chr1222676 864 ------
NM_015349chr642004 819 709 637 --1283 --
NM_015355chr17----1106 --
NM_015361chr2--1121 ----
NM_015365chrX54169 3119 1339 789 181 ------
NM_015387chr22668 194 11648 ----
NM_015397chr9----2484 138 --
NM_015423chr11----11587 --
NM_015435chr8----1148 --
NM_015443chr17--144 ----
NM_015475chr2----1691 --
NM_015483chr711127 11021 ----
NM_015497chr152796 133 ------
NM_015530chr22716 108 ------
NM_015549chr14----1549 --
NM_015550chr713482 ------
NM_015554chr1531869 199 77 ------
NM_015557chr133485 3439 451 --12574 --
NM_015564chr533397 2538 774 --13380 --
NM_015565chr211551 --149 --
NM_015567chr131208 --1851 --
NM_015575chr213471 ------
NM_015576chr32849 315 ------
NM_015577chr5--21332 474 ----
NM_015601chr10------194
NM_015604chr141227 ------
NM_015608chr10------1588
NM_015627chr12612 261 ------
NM_015635chr921645 1373 1465 1122 --
NM_015642chr3--177 ----
NM_015678chr1321368 1274 --11107 --
NM_015718chr6----125 --
NM_015844chr181923 --2742 49 --
NM_015846chr181923 --2742 49 --
NM_015847chr181923 --2742 49 --
NM_015850chr842185 989 744 323 --1285 12388
NM_015874chr41415 ------
NM_015886chr821894 1235 --34572 4333 734 --
NM_015888chr122998 2114 ------
NM_015898chr1951858 772 556 407 342 --11881 --
NM_015905chr7----1582 --
NM_015906chr154343 4234 3830 3029 116 --23902 2983 --
NM_015913chr1--1745 ----
NM_015916chr101230 135 ----
NM_015938chr31887 --1275 --
NM_015948chr6----199 --
NM_015980chr521319 241 1566 11210 --
NM_015999chr12737 239 ------
NM_016018chr8------1668
NM_016019chr73924 877 363 ------
NM_016022chr1--1829 ----
NM_016032chrX4986 554 250 148 ------
NM_016038chr72250 57 ------
NM_016072chr1222442 1579 --1373 --
NM_016083chr623054 1360 --1172 --
NM_016107chr51894 ------
NM_016125chr17167 ------
NM_016131chr212114 22333 1996 ----
NM_016152chr311044 ------
NM_016156chr1132206 1816 1508 ------
NM_016173chr373770 1242 1007 801 411 92 65 ------
NM_016206chr377875 7661 2633 2624 2483 1054 102 12309 17143 11082
NM_016221chr51302 --32321 607 155 --
NM_016227chr1----1111 --
NM_016231chr1711642 ------
NM_016247chr31136 --1490 --
NM_016248chr1321562 291 --12431 --
NM_016258chr11766 ------
NM_016260chr266846 5260 1907 1553 721 278 12335 12457 --
NM_016270chr193419 351 113 ------
NM_016272chr2242585 1974 1753 145 --12136 --
NM_016277chr62553 492 ------
NM_016287chr121811 415 --1155 --
NM_016289chr231719 316 190 --167 --
NM_016308chr111795 1631 ----
NM_016320chr112889 77 ------
NM_016322chr932970 734 517 ------
NM_016333chr16----1478 --
NM_016351chr71487 --1249 --
NM_016374chr131205 1128 141 ------
NM_016374chr131205 1128 141 ------
NM_016422chr11178 1186 ----
NM_016424chr1741375 1303 452 195 --2719 706 --
NM_016436chr2061054 587 444 395 42 29 --12651 --
NM_016441chr222324 630 --1831 --
NM_016472chr14----11089 --
NM_016485chr6----1778 --
NM_016507chr1721953 717 --1871 --
NM_016513chr623212 1539 --23194 500 --
NM_016530chr1533447 2559 1342 ------
NM_016531chr411067 12880 ----
NM_016542chrX1630 11108 ----
NM_016545chr11101 1262 ----
NM_016577chr364243 4124 3649 3088 2849 2756 --13761 --
NM_016603chr532222 2207 78 11479 1100 --
NM_016607chrX21660 639 ------
NM_016617chr1311769 --181 --
NM_016620chr1--1470 ----
NM_016626chr1831105 389 51 1397 ----
NM_016628chr102800 663 --1649 --
NM_016654chr15176 --1907 --
NM_016824chr10--1441 ----
NM_016830chr121530 ------
NM_016936chr1641367 365 295 145 ------
NM_017412chr821265 181 ------
NM_017416chrX1114 ------
NM_017420chr1442951 1022 911 421 ----1716
NM_017423chr431900 1775 781 ------
NM_017443chr9134 ------
NM_017455chr151169 ------
NM_017483chr211242 ------
NM_017490chr111249 ------
NM_017522chr11398 --11158 --
NM_017548chr322155 1988 ------
NM_017553chr1521024 317 ------
NM_017563chr365698 4994 3933 1861 743 220 --21702 417 --
NM_017580chr1042337 434 367 33 ------
NM_017582chr1135 --1254 --
NM_017592chr1952407 2242 2225 1879 885 --32571 2185 914 --
NM_017610chr15153 ------
NM_017628chr444239 4008 1535 544 --24280 1886 --
NM_017633chr622404 1007 ------
NM_017634chr841709 691 319 287 ------
NM_017637chr957934 6919 3773 3578 953 --21443 1209 --
NM_017643chr1722024 550 ------
NM_017644chr364257 1883 1162 869 561 404 ------
NM_017650chr755300 4112 3761 1756 616 14845 35954 5484 3733 --
NM_017651chr681557 1514 1461 1389 1298 633 483 243 --11439 --
NM_017658chr1443161 1501 514 145 13322 ----
NM_017661chr152467 43 ------
NM_017671chr2042229 1651 845 48 --11701 --
NM_017680chr911022 ------
NM_017681chrX2719 46 ------
NM_017709chr133410 3143 2615 --21259 86 --
NM_017714chr201889 --136 --
NM_017719chr321817 830 ------
NM_017737chr11487 1643 ----
NM_017739chr1133 ------
NM_017752chrX2822 329 --11811 11758
NM_017768chr11917 ------
NM_017772chr6----21587 528 --
NM_017778chr81128 11449 ----
NM_017780chr81734 1331 ----
NM_017784chr32205 85 ------
NM_017786chr82259 180 ------
NM_017787chr1052764 2523 2255 202 164 ------
NM_017824chr10----22392 934 1401
NM_017848chrX23312 1390 ----13423
NM_017849chr253005 2633 2554 2417 1157 ------
NM_017866chr81725 ------
NM_017902chr1085673 5537 4941 4863 4851 2043 1275 170 ------
NM_017910chr2190 ------
NM_017913chr91343 ------
NM_017934chr6143 ------
NM_017938chrX21773 1473 ------
NM_017943chr14----1138 --
NM_017958chr272910 2288 899 661 570 213 69 --2481 286 --
NM_017994chr742958 2806 2653 2529 --12883 --
NM_018003chr15----11702 --
NM_018013chr652957 2820 2643 2101 1221 ------
NM_018060chr1----1395 --
NM_018063chr10----1350 --
NM_018070chr1----136 --
NM_018073chr1121351 1043 ------
NM_018084chr243214 2624 1031 784 ------
NM_018086chr231870 1605 109 ------
NM_018092chr16159 --1512 --
NM_018098chr3176 ------
NM_018114chr34404 226 211 88 ------
NM_018115chr4----1313 --
NM_018116chr11516 ------
NM_018120chr811495 ------
NM_018124chr164496 440 212 26 ------
NM_018126chr4155 ------
NM_018131chr103775 610 66 ------
NM_018150chr12626 296 --1893 1199
NM_018155chr311346 ------
NM_018157chr121398 12252 1183 --
NM_018159chrX21485 449 --11100 --
NM_018202chr1----147 --
NM_018211chr142236 2079 1783 895 ------
NM_018240chr13570 307 79 ------
NM_018241chr42869 128 ------
NM_018246chr842762 2735 2499 1764 --12114 --
NM_018287chr1021004 420 ------
NM_018293chr322753 2556 ------
NM_018299chr822691 671 12639 23446 2482 --
NM_018330chr1031743 1481 692 ------
NM_018334chr71212 ------
NM_018362chr1133081 2855 1393 --12848 --
NM_018364chr143194 3026 2551 1122 ------
NM_018374chr735038 4833 988 --13780 14707
NM_018388chrX11008 ------
NM_018424chr931855 1812 1690 --11359 --
NM_018429chr512749 --12191 11109
NM_018433chr21126 1469 ----
NM_018440chr896280 5560 2727 2292 1285 826 685 225 176 --28680 6914 --
NM_018452chr6_random43821 3063 1495 654 --13400 --
NM_018462chr31859 --1220 --
NM_018482chr851829 1746 599 348 70 ------
NM_018486chrX2447 180 ------
NM_018489chr131784 667 292 --2355 140 --
NM_018490chr11------1513
NM_018584chr121046 418 --1959 --
NM_018638chr1211132 ------
NM_018650chr12631 50 ------
NM_018667chr1662504 2431 2101 1960 749 515 ------
NM_018674chr21720 ------
NM_018682chr71714 --175 --
NM_018695chr542291 2087 2039 871 ------
NM_018710chr8----1987 --
NM_018712chr1121436 1139 1215 ----
NM_018717chr421996 566 ------
NM_018837chr20138 --1793 --
NM_018840chr201380 ------
NM_018912chr531090 626 598 ------
NM_018913chr531090 626 598 ------
NM_018914chr531090 626 598 ------
NM_018915chr531090 626 598 ------
NM_018916chr531090 626 598 ------
NM_018917chr531090 626 598 ------
NM_018918chr531090 626 598 ------
NM_018919chr531090 626 598 ------
NM_018920chr531090 626 598 ------
NM_018921chr531090 626 598 ------
NM_018922chr531090 626 598 ------
NM_018923chr531090 626 598 ------
NM_018924chr531090 626 598 ------
NM_018925chr531090 626 598 ------
NM_018926chr531090 626 598 ------
NM_018927chr531090 626 598 ------
NM_018928chr531090 626 598 ------
NM_018929chr531090 626 598 ------
NM_018931chr51278 1271 ----
NM_018945chr622611 872 ------
NM_018947chr744539 3505 3472 3216 --24609 558 --
NM_018955chr17--141 ----
NM_018970chr732499 2098 1148 --12922 --
NM_018976chr1241849 1019 889 603 --11877 --
NM_018979chr121532 ------
NM_018981chr21946 ------
NM_018983chr41225 ------
NM_018999chr1034666 4340 3890 ----13787
NM_019001chr323146 975 --1147 --
NM_019009chr1161734 1016 876 410 366 56 12493 1990 --
NM_019016chr17185 ------
NM_019027chr4--2604 564 ----
NM_019035chr421844 86 --1341 --
NM_019042chr731115 878 788 ------
NM_019046chr101668 ------
NM_019057chr51263 ------
NM_019071chr71303 ------
NM_019080chr1311452 ------
NM_019087chr51704 1184 ----
NM_019091chr2--1967 ----
NM_019593chr2033060 2708 2673 ------
NM_019594chr921473 486 ------
NM_019596chr2162573 2566 2550 885 876 430 ------
NM_019605chr11173 ------
NM_019606chr71455 --1464 --
NM_019610chr111690 ------
NM_019842chr6124 --1356 --
NM_019891chr121288 1114 ------
NM_019903chr10--1441 ----
NM_020066chr11919 ------
NM_020116chr41622 ------
NM_020123chr102402 113 ----1235
NM_020144chr711883 --31310 603 419 --
NM_020148chr1843041 2313 2122 411 23062 1987 12630 --
NM_020150chr101280 --21656 1578 --
NM_020154chr15123 ------
NM_020159chr41559 ----1628
NM_020177chr532850 2218 1087 ------
NM_020193chr11--1524 ----
NM_020194chr21680 --1533 --
NM_020199chr5190 ------
NM_020205chr122314 244 --12874 --
NM_020245chr674685 4643 3429 538 256 233 150 ----14986
NM_020317chr1199 ------
NM_020319chr71655 --1694 --
NM_020336chr2033694 3478 2514 ------
NM_020341chr2021595 179 ------
NM_020346chr111606 --11261 --
NM_020354chr101340 1748 ----
NM_020357chr31508 ------
NM_020374chr1242006 1996 1969 1415 --1330 11642
NM_020384chrX41906 1489 700 462 ------
NM_020390chr344652 3817 1197 636 --13592 --
NM_020403chr1321424 1307 ------
NM_020432chr711797 ------
NM_020440chr142387 431 204 132 --22295 1023 --
NM_020449chrX1562 ------
NM_020466chr643849 3589 1748 1239 1817 34486 3382 1536 --
NM_020474chr1811976 ------
NM_020526chr161728 1713 1160 455 232 173 ------
NM_020529chr141464 ------
NM_020630chr101458 --1276 1140
NM_020631chr141291 1059 942 484 ------
NM_020640chr31912 12104 11485 --
NM_020647chr81321 ------
NM_020651chr221271 333 ------
NM_020654chr311451 21353 1077 ----
NM_020663chr14187 --1552 --
NM_020699chr133382 1522 683 --11712 --
NM_020711chr232554 2111 214 ------
NM_020713chr2062755 920 840 425 389 191 --32178 2076 1951 --
NM_020717chrX34554 1397 462 14199 ----
NM_020718chr1635764 2558 2481 ------
NM_020727chr2123552 3537 1916 ----
NM_020734chr1243029 2359 2154 962 --13072 --
NM_020739chr1553888 3537 3138 1611 484 --11347 --
NM_020747chr51615 ------
NM_020755chr6--1559 11112 --
NM_020760chr221856 571 --11646 --
NM_020762chr123997 412 172 ------
NM_020772chr1752783 2050 1481 685 256 23310 2756 --18289
NM_020773chr412517 --22533 2493 --
NM_020774chr1845726 4437 4309 3848 ------
NM_020779chr232641 623 531 12753 ----
NM_020786chr1611429 ------
NM_020791chr17--193 ----
NM_020796chr532623 1134 157 ------
NM_020801chr532259 2088 1058 ----12352
NM_020803chr422185 44 ------
NM_020805chr18----1544 --
NM_020818chr142300 99 ------
NM_020830chr242312 1150 1132 159 1466 ----
NM_020841chr1222691 424 13212 ----
NM_020845chr123962 335 79 ----11567
NM_020850chr1632812 2657 537 13218 13107 --
NM_020854chr181358 --11507 --
NM_020856chr194991 362 329 57 --11201 --
NM_020918chr1033402 868 56 --23559 1106 --
NM_020919chr2----11290 --
NM_020920chr14--1394 ----
NM_020924chr92325 312 ------
NM_020925chr111194 --11274 --
NM_020935chr234554 1110 234 1600 ----
NM_020940chr1022663 1131 --1364 11809
NM_020948chr113168 --12646 --
NM_020951chr1931904 1775 1602 1861 ----
NM_020952chr92354 216 ------
NM_020956chr1984124 3899 3744 3699 1844 1766 1256 426 ------
NM_020962chr151501 --22476 2017 --
NM_020977chr431757 304 134 ------
NM_020983chr125725 507 444 89 45 11504 11968 11750
NM_020987chr1011282 --1548 --
NM_020993chr1282713 2598 816 717 678 646 628 42 --1924 --
NM_021005chr151994 ------
NM_021007chr221869 561 11970 ----
NM_021020chr873046 2861 2210 1169 1026 856 38 12659 13116 --
NM_021033chr1342404 951 285 237 --11073 --
NM_021072chr522334 1704 ------
NM_021096chr2293236 2807 2001 1155 1040 500 409 126 120 --12546 --
NM_021097chr242372 990 703 201 ------
NM_021101chr322196 1610 --11676 --
NM_021120chrX42966 2389 735 418 1627 ----
NM_021132chr102883 505 ------
NM_021144chr91216 1182 ----
NM_021145chr72361 40 ------
NM_021159chr41142 1298 ----
NM_021189chr11959 --1858 --
NM_021191chr1222011 542 ------
NM_021202chr2072656 2073 1919 1037 759 633 603 1425 ----
NM_021213chr1721087 477 ------
NM_021229chr12129 ------
NM_021238chr1221667 627 ------
NM_021239chr142461 217 ------
NM_021627chr3----1113 --
NM_021629chr354806 3194 537 406 184 --14403 --
NM_021722chr71446 --1208 --
NM_021723chr71487 --1249 --
NM_021728chr141134 --174 --
NM_021785chrX----169 --
NM_021813chr623605 69 --24439 1242 --
NM_021814chr6------11587
NM_021911chr553594 2242 1521 638 402 14529 ----
NM_021912chr1533860 3490 1530 --13392 --
NM_021914chr1432262 1589 404 ------
NM_021935chr3------1214
NM_021940chr621363 1066 --1400 --
NM_021945chr693317 2837 2651 1431 1395 1373 1308 1187 48 1855 ----
NM_021947chr171380 --1347 --
NM_021949chrX42310 1860 894 445 --11037 --
NM_021961chr1146362 5622 2915 2251 --27140 7080 --
NM_021964chr321154 33 12567 22101 2069 --
NM_021998chrX11134 ------
NM_021999chr131535 ------
NM_022037chr21956 ------
NM_022048chr1546329 6084 5879 2316 11335 24449 2057 11668
NM_022062chr112544 21 ------
NM_022079chr10------194
NM_022091chr632416 711 192 ------
NM_022114chr164533 4332 3217 960 719 41 11482 ----
NM_022116chr7124 ------
NM_022123chr14257 47 ------
NM_022130chr51224 ------
NM_022143chr721321 988 ------
NM_022154chr4----136 --
NM_022165chr19163 ------
NM_022173chr21956 ------
NM_022351chr81545 ------
NM_022361chr6----1407 --
NM_022369chr15143 --1404 --
NM_022459chr1365061 3996 2096 1987 1370 289 11189 ----
NM_022462chr1963807 3423 3411 3349 2895 2303 --13602 --
NM_022465chr1222430 551 1518 2663 54 --
NM_022469chr132651 1117 330 ------
NM_022473chr1533706 3143 125 1774 ----
NM_022475chr4139 --1713 --
NM_022476chr16--21081 1073 ----
NM_022484chr721038 347 --11094 --
NM_022494chr101351 ------
NM_022497chr31622 13473 --23130 2511
NM_022719chr2273801 2489 1487 1284 1074 431 257 --53691 2860 2702 716 171 --
NM_022726chr621595 674 ------
NM_022730chr24958 418 142 23 ------
NM_022745chr141137 609 437 183 --12677 --
NM_022749chr841397 1148 446 68 ----11038
NM_022751chr181262 ------
NM_022753chr122450 1960 --11050 1622
NM_022755chr942498 2276 2267 1991 ------
NM_022763chr332872 2561 731 ------
NM_022776chr321144 143 --1547 --
NM_022817chr2137 ------
NM_022824chr521640 561 --1436 --
NM_022828chr521604 1245 ------
NM_022832chr44922 827 618 612 --21793 1021 1951
NM_022841chr1522015 726 1383 1762 --
NM_022845chr16--32037 1426 258 --1106
NM_022893chr2----12995 12281
NM_022898chr1431516 787 132 24284 1532 24630 269 11332
NM_022901chr921246 578 --1101 --
NM_022918chr1111652 32163 1518 1475 ----
NM_023016chr252711 1859 1052 732 716 12797 --1502
NM_023037chr131860 ------
NM_023071chr12------11104
NM_023072chr193863 271 84 ------
NM_023074chr19--1993 ----
NM_023079chr1731478 245 192 --180 --
NM_023105chr842185 989 744 323 --1285 12388
NM_023106chr842185 989 744 323 --1285 12388
NM_023110chr842185 989 744 323 --1285 12388
NM_023111chr842185 989 744 323 --1285 12388
NM_024007chr522521 892 ------
NM_024063chr151178 ------
NM_024344chr153530 343 120 ------
NM_024416chr91400 ------
NM_024490chr151133 --1538 --
NM_024496chr141309 ------
NM_024524chr333151 2955 2746 191 ----
NM_024529chr121093 932 ------
NM_024532chr2130 ------
NM_024551chr1222525 50 ------
NM_024551chr1222525 50 ------
NM_024557chr1111365 --11571 --
NM_024581chr6------1179
NM_024595chr121023 289 ------
NM_024613chr8------11542
NM_024639chr612467 ------
NM_024665chr344634 3678 1340 869 ------
NM_024674chr163157 2436 2361 2229 791 100 ------
NM_024713chr1511281 ------
NM_024721chr8----1870 --
NM_024725chr111160 ------
NM_024740chr1173808 3383 3204 3068 987 971 353 --11089 --
NM_024743chr4--1533 ----
NM_024749chr132291 843 182 ----1598
NM_024753chr22672 538 ------
NM_024759chr81658 ------
NM_024770chr275948 5940 5878 5372 2066 783 22 --26685 6438 --
NM_024795chr221383 573 ------
NM_024824chr141329 --21555 478 --
NM_024834chr1011931 1663 ----
NM_024837chr1511497 11950 ----
NM_024850chr51218 ------
NM_024854chr1221447 1154 ------
NM_024881chr1963812 3212 3076 1056 849 762 --13445 --
NM_024884chr1431064 890 180 12933 ----
NM_024887chr141886 1681 1582 80 ------
NM_024900chr421474 854 11843 --12273
NM_024900chr421474 854 11843 --12273
NM_024969chr21168 --146 --
NM_024971chr92354 216 ------
NM_024979chr1361511 632 467 391 250 90 --11571 --
NM_145259chr255998 5925 4885 1454 842 25079 724 ----
NM_145260chr23707 238 153 --194 --
NM_145263chr422083 924 --1246 --
NM_145307chr1034194 3544 3309 --12878 164
NM_145313chr103649 426 164 ------
NM_145320chr713482 ------
NM_145321chr713482 ------
NM_145322chr713482 ------
NM_145341chr1031571 1437 1171 --1117 --
NM_145690chr831584 1304 414 ------
NM_145695chr71595 ------
NM_145698chr1041357 590 561 353 ------
NM_145716chr1----136 --
NM_145733chr221343 ------
NM_145799chrX43095 2574 2137 1208 ------
NM_145861chr111325 ------
NM_145891chr1611129 ------
NM_145892chr1611129 ------
NM_145893chr1611251 ------
NM_147147chr663895 3557 1540 1483 974 708 --11416 --
NM_147150chr942432 1450 1361 902 --13956 --
NM_147175chrX31550 806 771 --1761 --
NM_148177chr8166 ------
NM_152244chr1721188 71 --21053 982 --
NM_152253chr22104136 4027 3759 3603 3149 3112 3089 2826 1372 952 ------
NM_152261chr1222383 49 --1472 --
NM_152264chr111797 --1966 --
NM_152265chr121086 1071 ------
NM_152280chr11367 --13131 1209
NM_152282chr311352 --21080 228 --
NM_152309chr1041932 1857 779 177 ------
NM_152313chr11----1621 --
NM_152363chr192962 220 ------
NM_152388chr243745 2591 2562 1248 ------
NM_152407chr552606 1184 404 259 198 --192 --
NM_152409chr532615 509 193 1592 ----
NM_152417chr8----164 --
NM_152418chr82670 651 ------
NM_152424chrX34239 3370 1301 --13720 --
NM_152495chr131026 949 216 ------
NM_152515chr2192 ------
NM_152523chr2----1499 --
NM_152529chr244259 3209 3063 1426 ----11530
NM_152556chr722330 259 ------
NM_152588chr123389 269 166 21724 1672 1739 --
NM_152594chr152529 300 ------
NM_152622chr54906 805 790 464 ------
NM_152629chr953640 3598 814 456 400 11421 ----
NM_152636chr1132797 2484 441 --1397 --
NM_152641chr1242807 2761 2063 1965 --1808 --
NM_152678chr362065 1947 1811 915 713 318 --22713 230 --
NM_152695chrX12203 --11521 --
NM_152699chr342960 2645 2619 611 22635 442 ----
NM_152722chr1161503 734 598 428 120 27 1672 11431 --
NM_152739chr71748 1261 ----
NM_152754chr72819 113 1615 ----
NM_152756chr5--14316 ----
NM_152758chr822581 283 ------
NM_152787chrX43647 3483 3277 632 --13893 --
NM_152835chr142288 1923 1073 642 --12415 --
NM_152924chr15126217 4949 4943 4322 2505 2438 1950 1861 1692 1453 224 125 --34871 2579 614 --
NM_152994chr2----1439 --
NM_153040chr151101 ------
NM_153042chr621710 1464 --21595 1325 --
NM_153182chr33513 263 169 --23123 2260 --
NM_153183chrX11260 ------
NM_153184chr311364 ------
NM_153207chr1253353 3204 1383 1156 239 ------
NM_153208chr161940 ------
NM_153218chr13----1321 --
NM_153226chr101333 ------
NM_153246chr63354 346 317 --11967 --
NM_153261chr161185 ------
NM_153332chr81172 --1521 --
NM_153335chr1721183 165 ------
NM_153347chr1111024 --1112 --
NM_153354chr52368 218 ------
NM_153365chr442337 1948 758 86 ------
NM_153367chr1053925 1101 659 648 591 --12772 --
NM_153487chr641351 1305 1190 588 --23093 174 --
NM_153607chr532866 856 255 --13142 --
NM_153619chr1531124 798 46 --1933 --
NM_153649chr132207 2089 1536 ------
NM_153693chr121579 ------
NM_153702chr41195 ------
NM_153756chr141660 1271 657 620 ------
NM_170587chr82804 314 ------
NM_170606chr711517 ------
NM_170665chr12--11192 11604 11025
NM_170706chr123189 160 --12812 --
NM_170709chr821752 170 12222 ----
NM_170731chr11--12802 ----
NM_170732chr11--12802 ----
NM_170733chr11--12802 ----
NM_170734chr11--12802 ----
NM_170735chr11--12802 ----
NM_170739chr111270 ------
NM_170750chrX1334 ------
NM_170751chr621160 497 ------
NM_170752chr621160 497 ------
NM_171998chrX32156 820 508 --2897 219 --
NM_172058chr811415 ------
NM_172059chr811415 ------
NM_172060chr811415 ------
NM_172069chr212165 ------
NM_172071chr135558 2336 1634 --16027 15175
NM_172110chr20------1686
NM_172111chr20------1686
NM_172112chr20------1686
NM_172113chr20------1686
NM_172159chr31928 1298 1310 --
NM_172160chr31928 1298 1310 --
NM_172169chr1021512 525 --11880 --
NM_172170chr1021512 525 --11880 --
NM_172171chr1021512 525 --11880 --
NM_172173chr1021512 525 --11880 --
NM_172206chr1731594 1211 431 ------
NM_172240chr1231328 163 121 ------
NM_172337chr141134 --174 --
NM_172344chr2197 ----1318
NM_172373chr13----1216 --
NM_173054chr71342 ------
NM_173065chr193664 3051 2599 1276 1100 811 492 397 211 1684 12425 --
NM_173078chrX2434 97 ------
NM_173083chr1----1131 --
NM_173087chr153530 343 120 ------
NM_173088chr153530 343 120 ------
NM_173089chr153530 343 120 ------
NM_173090chr153530 343 120 ------
NM_173171chr22841 217 ------
NM_173172chr221149 525 --11024 --
NM_173173chr22841 217 ------
NM_173198chr91470 --1223 --
NM_173200chr91470 --1223 --
NM_173214chr1667059 6577 5763 5180 478 285 --11805 --
NM_173354chr21----11436 --
NM_173355chr22883 84 --1384 --
NM_173359chr32525 351 ------
NM_173468chr445727 2260 1096 469 15508 --15857
NM_173473chr1042088 1942 1762 1037 1725 12618 --
NM_173478chr171710 --1298 --
NM_173495chrX22533 365 --1114 --
NM_173508chr121182 878 ------
NM_173510chr2212737 ------
NM_173511chr242724 2717 2431 1543 ------
NM_173515chr61334 ------
NM_173552chr32341 334 ------
NM_173559chr61121 ------
NM_173563chr6------189
NM_173582chr1145500 4099 1387 449 ------
NM_173595chr1254840 4231 955 475 80 --24021 1207 --
NM_173602chr1223308 1013 ------
NM_173642chr158840 8618 7479 5727 120 35804 2998 2315 29041 277 --
NM_173653chr331367 1313 314 ------
NM_173812chr1211519 ------
NM_173825chr322910 2653 ------
NM_173829chr512193 15126 ----
NM_173848chr8----1276 --
NM_173851chr863970 3782 3562 3037 1353 1346 --23176 168 21553 1535
NM_174911chr822473 290 --1847 --
NM_175038chr12----1164 --
NM_175061chr72686 354 ------
NM_175069chr91926 ------
NM_175607chr3--1148 ----
NM_175610chr15----1122 --
NM_175612chr3--1148 ----
NM_175736chr1286969 6273 5666 4858 2881 1733 978 296 1164 36722 5901 1263 17367
NM_175748chr1432083 1516 391 1722 --11906
NM_175852chr142893 540 173 128 --12683 --
NM_175854chr131142 ------
NM_175856chr51616 ------
NM_175866chr12441 173 --1100 --
NM_175884chr7----11132 --
NM_175907chr185901 858 774 647 44 11096 ----
NM_175921chr544078 3082 2758 2671 --23955 598 --
NM_176801chr421590 1450 --1636 1610
NM_176814chr711161 195 1189 --
NM_176863chr1722023 477 --11648 --
NM_176871chr863299 3189 2349 909 807 584 12443 32184 713 171 --
NM_177424chr1--1516 ----
NM_177438chr1423384 3074 --21345 1311 --
NM_177553chr111609 ------
NM_177947chrX21660 639 ------
NM_177948chrX21660 639 ------
NM_177967chr133728 316 229 ------
NM_177968chr21227 ------
NM_177985chr242176 1632 1413 498 1575 ----
NM_177990chr2021595 179 ------
NM_177996chr2032815 2373 24 --11320 --
NM_177999chr973653 3480 3200 3178 966 869 785 ------
NM_178123chr22925 167 ------
NM_178140chr522341 477 ------
NM_178151chrX55342 5198 1772 1564 62 --37541 7109 5675 15438
NM_178152chrX55342 5198 1772 1564 62 --37541 7109 5675 15438
NM_178153chrX55342 5198 1772 1564 62 --37541 7109 5675 15438
NM_178314chr122743 557 ------
NM_178423chr71129 1183 11183 --
NM_178425chr71129 1183 11183 --
NM_178450chr52720 486 ------
NM_178505chr1033234 3096 2956 ------
NM_178554chr342589 2364 2337 1224 ----13003
NM_178566chr951784 1700 1264 558 118 ------
NM_178585chr4----23273 75 --
NM_178586chr141657 ------
NM_178812chr811377 --11146 --
NM_178818chr1652391 2070 2055 1922 1622 ------
NM_180989chr131784 --12292 1770
NM_181054chr141843 ------
NM_181340chr141227 ------
NM_181358chr153332 3121 1516 939 250 ------
NM_181442chr20187 ------
NM_181486chr12--11203 ----
NM_181504chr51538 --22809 2557 --
NM_181521chr16117172 6851 6836 6703 6403 6164 4575 2876 2806 2590 415 ----11054
NM_181523chr51538 --22809 2557 --
NM_181524chr51538 --22809 2557 --
NM_181534chr17------155
NM_181659chr2033171 250 87 --21262 919 --
NM_181659chr2033171 250 87 --21262 919 --
NM_181671chr174724 658 589 65 ------
NM_181672chrX3824 812 379 ------
NM_181673chrX3824 812 379 ------
NM_181784chr232206 2193 142 --11945 --
NM_181825chr222175 141 --129 --
NM_181832chr2293120 2986 1493 1236 909 792 659 645 370 13489 ----
NM_181838chr511071 --11229 1251
NM_182503chr643454 2033 457 407 ------
NM_182511chr1811258 ------
NM_182557chr1121404 140 --11888 --
NM_182580chr172361 2170 2151 960 809 699 448 --1714 1771
NM_182643chr822421 403 ------
NM_182663chr142008 1897 712 690 ------
NM_182664chr142138 2027 842 820 ------
NM_182665chr142008 1897 712 690 ------
NM_182691chr7----1135 --
NM_182692chr7----1135 --
NM_182729chr1221446 730 ----11857
NM_182742chr1221446 730 ----11857
NM_182743chr1221446 730 ----11857
NM_182765chr1031625 425 165 --1293 --
NM_182796chr5156 ------
NM_182830chr1422289 461 --140 --
NM_182847chr21720 ------
NM_182898chr745576 4838 1250 69 ------
NM_182899chr745576 4838 1250 69 ------
NM_182918chr21----11082 --
NM_182931chr71714 --175 --
NM_182944chr14125 ----1341
NM_182948chr132487 1141 180 ------
NM_182972chr122303 816 --11963 --
NM_182975chr12753 76 ------
NM_183078chr652849 2681 947 662 140 --13617 --
NM_183227chr62553 492 ------
NM_183377chr171826 ------
NM_183416chr12709 474 11412 ----
NM_183419chr8----1148 --
NM_183425chr2051157 441 330 270 247 --11668 --
NM_194247chr243901 3143 2839 604 ------
NM_194249chr52424 23 ------
NM_194272chr153919 867 62 ------
NM_194278chr1463426 3372 2747 1657 1320 87 12883 11090 --
NM_194282chr443035 2010 1218 576 1763 12158 --
NM_194285chr1142549 2446 394 106 ----13443
NM_194301chr14--11040 ----
NM_194314chr135323 3634 1810 24083 719 33537 1841 1587 --
NM_194317chr221923 1068 ----11834
NM_197941chr563042 2368 2139 2131 1145 1103 --12280 --
NM_197970chr211075 ------
NM_198042chr82323 21 ------
NM_198056chr311670 --1827 --
NM_198066chr1432753 2184 1920 1937 ----
NM_198123chr811565 --1500 --
NM_198124chr811565 --1500 --
NM_198158chr332938 2167 485 ------
NM_198159chr332938 2167 485 ------
NM_198177chr332938 2167 485 ------
NM_198178chr332938 2167 485 ------
NM_198181chr1541875 1123 1064 985 12669 ----
NM_198225chr1021577 119 ------
NM_198268chr153332 3121 1516 939 250 ------
NM_198269chr153332 3121 1516 939 250 ------
NM_198270chrX--13217 ----
NM_198324chr12--11028 21012 113 --
NM_198391chr2011526 ------
NM_198399chr351482 1472 1153 494 62 ------
NM_198402chr31276 1259 ----
NM_198463chr31419 --130 --
NM_198465chrX22131 369 --1201 12547
NM_198485chr341818 1755 1738 1019 ------
NM_198503chr11176 ------
NM_198504chr31379 ------
NM_198513chr81241 1200 1653 --
NM_198597chr102653 298 ------
NM_198679chr952537 1074 642 592 85 ------
NM_198681chr141291 1059 942 484 ------
NM_198793chr332741 1294 671 1474 13907 --
NM_198834chr1772077 1907 1691 1619 281 120 89 --1514 --
NM_198836chr1772077 1907 1691 1619 281 120 89 --1514 --
NM_198837chr1772077 1907 1691 1619 281 120 89 --1514 --
NM_198838chr1772077 1907 1691 1619 281 120 89 --1514 --
NM_198839chr1772077 1907 1691 1619 281 120 89 --1514 --
NM_198859chr354665 4255 3119 1815 1753 23445 960 ----
NM_198892chr4--126 ----
NM_198900chr1286969 6273 5666 4858 2881 1733 978 296 1164 36722 5901 1263 17367
NM_198968chr1333411 3207 3056 13951 1284 --
NM_198973chr1------170
NM_199000chr711882 11636 ----
NM_199054chr1941710 1590 421 236 --1846 1122
NM_199129chr2031202 403 129 ------
NM_199160chr942111 1601 1522 1466 --11678 1667
NM_199168chr103535 432 132 --11203 11013
NM_199324chr41190 13092 ----
NM_199355chr161193 ----11193
NM_199421chr1443837 1866 1585 311 --1332 --
NM_199440chr2----1303 --
NM_199453chr52239 205 ------
NM_199454chr164533 4332 3217 960 719 41 11482 ----
NM_199461chr1022859 870 --2381 289 --
NM_199478chrX2386 344 ------
NM_199482chr22668 194 11648 ----
NM_199483chr201208 ------
NM_199511chr32781 678 ------
NM_199512chr32781 678 ------
NM_201266chr222102 2095 ------
NM_201269chr1--1470 ----
NM_201278chr1132206 1816 1508 ------
NM_201279chr222102 2095 ------
NM_201281chr1132206 1816 1508 ------
NM_201413chr2111034 ------
NM_201414chr2111034 ------
NM_201516chr71917 ------
NM_201570chr1021774 410 ------
NM_201571chr1021774 410 ------
NM_201572chr1021774 410 ------
NM_201590chr1021774 410 ------
NM_201591chr4--11529 --11848
NM_201592chr4--11529 --11848
NM_201593chr1021774 410 ------
NM_201596chr1021774 410 ------
NM_201597chr1021774 410 ------
NM_201624chr121024 364 1143 ----
NM_201634chr541499 324 285 45 11732 ----
NM_201999chr41861 ------
NM_203283chr41415 ------
NM_203284chr41415 ------
NM_203305chr951929 1747 1585 310 209 ------
NM_203327chr2074047 3734 1725 817 770 628 38 23556 460 14176 --
NM_203342chr121442 531 --23514 837 --
NM_203343chr121442 531 --23514 837 --
NM_203364chr1121185 836 --11253 --
NM_203406chr521934 356 ----12157
NM_203446chr212838 665 1876 ----
NM_203463chr244223 3175 1830 196 --14548 --
NM_203487chr1321424 1307 ------
NM_203504chr42585 486 ------
NM_203505chr42585 486 ------
NM_203506chr1712092 ------
NM_205768chr111719 ------
NM_205842chr2--1658 ----
NM_205860chr132877 858 152 ------
NM_205861chr141886 1681 1582 80 ------
NM_206594chr111340 ------
NM_206595chr111340 ------
NM_206839chr15----1490 --
NM_206853chr61778 --1434 --
NM_206854chr622039 914 --21695 787 --
NM_206855chr621879 682 --11752 --
NM_206866chr2122988 768 ------
NM_206886chr1146 ------
NM_206914chr1241669 1531 1495 349 ------
NM_206943chr21334 ------
NM_206944chr92354 216 ------
NM_206945chr92354 216 ------
NM_206946chr92354 216 ------
NM_206947chr92354 216 ------
NM_207009chr101353 ------
NM_207012chr1033301 3137 69 ------
NM_207036chr1511606 ------
NM_207037chr1511606 ------
NM_207038chr1511606 ------
NM_207040chr1511606 ------
NM_207123chr41820 ------
NM_207291chr19----1338 --
NM_207311chr1221260 923 --1349 --
NM_207325chr1951810 1706 1329 674 308 ------
NM_207337chr121977 ------
NM_207371chr10----11326 --
NM_207391chr19--21029 213 1831 --
NM_207396chr141586 536 232 43 --11288 --
NM_207422chrX----2946 246 --
NM_207645chr11----2395 162 --
NM_207660chr141329 --21555 478 --
NM_207661chr141329 --21555 478 --
NM_207662chr141329 --21555 478 --
NM_212460chr7--1226 11760 11623
NM_212464chr1542094 1907 1684 161 ------
NM_212465chr153530 343 120 ------
NM_212471chr17----11413 --
NM_212472chr17----11413 --
NM_212535chr161101 ------
NM_212539chr31154 ------
NM_212558chr92356 161 1598 12949 --
NM_213589chr254170 3954 2059 585 298 ------
NM_213594chr122817 421 --11048 --
NM_213651chr121549 600 --11341 --
NM_213654chr3165 ------
NM_213662chr1751830 1581 541 255 136 ------