TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-340-3p
miRNA Sequence: UCCGUCUCAGUUACUUUAUAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000618chr1232625 1416 121 15772 45479 5312 4367 4315 --
NM_000618chr1232625 1416 121 15772 45479 5312 4367 4315 --
NM_000875chr1586713 6593 5077 4945 4763 4517 2232 997 26032 4386 --1490
NM_001007278chr1345301 5167 1329 591 ----1384
NM_001010867chr131323 304 257 --56641 5564 5335 2166 309 24798 2002
NM_001010898chr163471 3128 2707 924 485 393 43323 1463 1421 525 --11401
NM_001012756chr191314 --22655 502 32522 2356 777
NM_001040284chr1645449 1920 1578 1415 ----14478
NM_001042355chr1655355 3563 3323 1494 477 ----1890
NM_001042412chr1655355 3563 3323 1494 477 ----1890
NM_001042599chr285783 2852 2396 2329 1680 1654 383 132 ------
NM_001438chr123461 2527 ----22825 572
NM_001527chr654762 4440 4381 1563 621 11942 34239 3383 3085 11928
NM_001759chr1264352 3732 1834 1307 1001 30 55279 3986 1974 1625 810 ----
NM_001918chr126000 1294 27640 2898 17087 16918
NM_002033chr1123123 2887 --2323 170 24166 2542
NM_003236chr232808 602 83 1623 12760 2794 258
NM_004171chr1178927 7803 7530 5937 2128 1869 1651 11309 17839 16273
NM_004748chr1552731 1345 1100 1020 969 1114 --11658
NM_004845chrX53821 3766 2746 1675 1620 --23774 3149 12983
NM_005235chr285783 2852 2396 2329 1680 1654 383 132 ------
NM_005497chr1745653 4407 1804 835 --1149 26112 5679
NM_005668chr521494 586 1419 11093 1845
NM_005798chr1345301 5167 1329 591 ----1384
NM_007050chr2097037 6363 6045 2289 2203 2036 1087 403 191 --26103 1071 --
NM_007249chr1328743 2780 1515 12630 26244 978
NM_012069chrX32364 2255 802 1104 --11841
NM_014117chr1612379 11096 --21922 882
NM_014772chr1851296 1071 151 71 23 164 32848 2767 433 1662
NM_014935chr153234 2576 1372 973 264 13708 42696 2675 1027 626 2836 434
NM_015020chr16--11356 1293 23248 127
NM_015247chr1655355 3563 3323 1494 477 ----1890
NM_017637chr9108614 8580 8395 8100 7757 6785 6432 3590 3344 41 ------
NM_020739chr1552731 1345 1100 1020 969 1114 --11658
NM_020956chr19104608 3905 2965 1867 1789 1711 1633 626 406 158 --54235 3914 1814 1736 1658 --
NM_021061chr883391 3116 3032 2995 2943 2882 1621 1083 ----1825
NM_021945chr643102 914 774 321 1484 22507 382 12960
NM_024770chr266380 5959 5939 5240 2146 1181 --11610 46354 1968 1436 855
NM_030806chr1109025 8694 7895 7136 6942 6935 3521 3086 1793 1154 23218 692 21658 507 1464
NM_052811chr1345301 5167 1329 591 ----1384
NM_133170chr2097037 6363 6045 2289 2203 2036 1087 403 191 --26103 1071 --
NM_138468chr275948 5139 4619 4444 4017 2393 144 11413 11590 21569 1433
NM_144571chr496729 5793 2277 1843 1747 1034 968 579 24 ------
NM_152253chr22103870 3225 2726 2665 1693 847 832 739 716 322 1976 1869 13439
NM_152699chr343597 2374 982 46 ----22703 569
NM_173642chr188631 7874 7543 6662 6366 3674 1891 987 26499 2056 28993 2756 11213
NM_181358chr133750 2935 2634 --13653 11402
NM_182762chr751732 1663 1520 1228 246 --26007 2029 12190
NM_198268chr133750 2935 2634 --13653 11402
NM_198269chr133750 2935 2634 --13653 11402
NM_206594chr123461 2527 ----22825 572
NM_206595chr123461 2527 ----22825 572
NM_213590chr1345301 5167 1329 591 ----1384