TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-342-3p
miRNA Sequence: UCUCACACAGAAAUCGCACCCGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000719chr12105473 5338 4187 4082 2477 2056 1734 1439 1190 1087 21963 1295 --16637
NM_001106chr379717 6095 5977 2924 2908 2860 2288 59198 7807 6353 3823 2704 12124 26836 2752
NM_004293chr933481 2782 1316 1805 13213 12957
NM_015205chr1384777 4407 4052 3603 3368 3250 1902 198 23899 630 13199 21492 186
NM_017848chrX53544 3487 1733 874 424 --53705 1578 914 899 893 --
NM_025090chr1771429 1131 369 163 124 101 91 --4608 351 291 169 3363 247 218
NM_138473chr1243478 3169 1679 1670 --34948 1834 1186 13262
NM_144973chr1285077 4990 4765 4439 4032 3900 1247 1012 25371 708 --13846