TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-342-5p
miRNA Sequence: AGGGGUGCUAUCUGUGAUUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541848 1783 1363 192 ----1269
NM_000068chr193527 237 90 --148 --
NM_000074chrX3850 783 77 1141 ----
NM_000088chr1741122 496 401 378 --1524 --
NM_000092chr253470 2968 2822 1020 985 11161 24463 2977 11254
NM_000118chr93310 200 89 --2619 210 --
NM_000125chr674257 3817 1477 1456 510 107 96 --21306 485 13902
NM_000135chr16----2796 261 --
NM_000217chr1274958 2058 1669 1536 1334 1252 601 23525 1815 33688 1000 785 --
NM_000238chr71268 ----1291
NM_000245chr751384 790 654 602 233 32020 1670 747 ----
NM_000248chr312577 --1506 --
NM_000278chr10122072 1878 1846 1836 1786 903 438 346 250 231 166 73 32139 133 122 21811 784 --
NM_000322chr611470 1338 --149
NM_000332chr646813 5108 4947 912 25687 2116 25873 248 --
NM_000335chr321468 1397 31709 1577 265 ----
NM_000408chr211201 ----12248
NM_000430chr1722701 47 169 13485 --
NM_000435chr194995 734 214 127 1640 ----
NM_000488chr1----123 --
NM_000530chr16771 406 371 302 251 202 1211 ----
NM_000554chr1942231 837 731 157 ------
NM_000599chr293652 3494 3194 3161 2873 1248 216 40 30 74067 3476 3217 1402 1309 541 76 33633 3514 2989 --
NM_000612chr11113325 3173 2924 2414 1531 858 820 698 504 244 84 1373 32934 874 497 13430
NM_000719chr12216568 6455 6447 6437 6354 5956 5923 5237 5021 5010 4953 4415 4300 4202 2440 2353 2239 1233 554 316 179 16022 22110 300 45908 5387 5266 5257
NM_000723chr1771451 1224 1204 688 681 478 285 2547 160 31073 1057 604 21186 1109
NM_000725chr124809 646 255 188 21011 60 1247 --
NM_000761chr1551381 1362 1023 492 450 ------
NM_000801chr2021014 177 1114 11061 --
NM_000807chr4------1194
NM_000813chr524857 4195 --12039 13677
NM_000817chr2------154
NM_000833chr1611202 21163 578 ----
NM_000876chr61168 --21325 51 --
NM_000883chr7----1175 142
NM_000924chr1231338 878 253 21298 431 ----
NM_000961chr2083299 3073 2928 2687 1217 719 274 260 13772 22436 634 11495
NM_000966chr1241050 760 168 111 ------
NM_000984chr173444 347 168 1177 ----
NM_001001323chr123552 248 167 ----12829
NM_001001433chr2022664 136 21023 979 22707 69 22591 2319
NM_001001481chr811103 1499 ----
NM_001001549chr751049 971 871 548 97 --1404 --
NM_001001560chr225697 181 135 108 84 ------
NM_001001787chr1------1392
NM_001002909chr1721914 270 21622 645 ----
NM_001005271chr1741102 986 183 99 ------
NM_001005415chr193438 370 324 --1395 --
NM_001005505chr3101452 1137 743 536 212 195 76 61 28 22 3644 591 35 --11262
NM_001005782chr21366 ----1103
NM_001005845chr82300 213 --1363 --
NM_001005920chr165991 972 684 108 49 21061 814 1910 --
NM_001006618chr9--1224 1177 --
NM_001006636chr231024 901 309 1197 ----
NM_001007026chr122379 59 1497 2410 53 --
NM_001008220chr5103658 3529 3507 2572 890 878 839 711 697 164 63668 3448 3348 2467 718 175 23860 586 1195
NM_001008495chr832276 2203 1611 --1207 --
NM_001008564chr13------2754 91
NM_001008701chr1962943 2697 2646 674 465 329 22953 2704 21190 1077 --
NM_001009993chr264386 3376 3166 1698 1471 659 --14379 --
NM_001010891chr545730 5334 5225 2278 --25034 346 --
NM_001010908chr10------1104
NM_001011666chr7106603 5577 4779 4772 1614 1441 1414 1280 1003 570 14454 25232 5102 --
NM_001011708chr21484 --1163 12397
NM_001012426chr6233139 2992 2872 2835 2509 2391 2206 1302 1198 1183 1088 1067 934 903 717 688 682 642 547 511 401 376 188 2974 500 12421 --
NM_001012643chr192376 121 2460 82 --193
NM_001012977chrX71313 945 515 509 219 185 71 ------
NM_001013615chr141168 1072 955 788 --21098 1080 --
NM_001013693chr192644 2491 2329 2256 2161 1882 960 888 276 22758 1863 12393 --
NM_001014342chr111322 11695 --11416
NM_001014435chr163613 481 139 --1178 1455
NM_001014797chr10137263 5890 5846 5581 3170 2229 2210 1837 1805 1795 1056 788 50 27885 5553 12513 --
NM_001014809chr45890 762 621 223 54 --1348 --
NM_001014839chr13891 189 161 2856 119 ----
NM_001015877chrX1655 ----11229
NM_001017395chr351319 1094 627 414 391 13362 ----
NM_001017523chr12192 --1244 --
NM_001018108chr1571912 1815 1762 911 515 211 190 21608 247 --11872
NM_001018111chr73606 591 578 2565 55 1887 --
NM_001024226chr12302 25 ----1910
NM_001024463chr153409 119 68 ------
NM_001024947chr5------1818
NM_001024948chr131224 1077 102 ------
NM_001024948chr131224 1077 102 ------
NM_001025077chr1086385 6324 6091 6082 2704 1198 454 438 46131 5555 5374 1178 11334 --
NM_001025108chr241104 1085 842 720 13673 ----
NM_001025579chr173969 386 152 ------
NM_001025580chrX53847 3265 3152 2868 595 --13601 --
NM_001030007chr1642754 1234 262 228 ------
NM_001031695chr2284962 4938 4594 4474 4075 1317 1306 874 22050 734 --15170
NM_001037131chr23173 120 32 1146 21163 96 --
NM_001037331chr181195 --1864 --
NM_001037332chr542079 1029 294 142 42089 1570 314 306 1122 --
NM_001037954chr1133267 2911 42 ------
NM_001039141chr22102577 2376 2047 1883 899 526 418 270 122 95 52279 2250 964 816 805 1245 11977
NM_001039538chr241478 742 645 117 12959 1872 --
NM_001039574chr111053 ------
NM_001039577chr1134474 4221 4144 4138 3905 3854 3391 3012 1403 1320 941 843 725 24124 867 12838 --
NM_001039711chr19920 908 812 744 219 176 165 101 46 ------
NM_001039840chrX2825 201 11711 23906 681 --
NM_001039888chr15788 752 655 515 126 ------
NM_001039937chr1334044 1147 330 --11098 --
NM_001040001chr6--134 11635 --
NM_001040056chr162760 311 2588 45 3751 632 193 --
NM_001040056chr162760 311 2588 45 3751 632 193 --
NM_001040152chr7125050 5004 2046 1915 1621 1143 1084 988 958 752 402 109 2942 572 11716 1240
NM_001040167chr741044 1016 976 288 --134 --
NM_001040214chr631729 946 505 ----1426
NM_001040402chr422711 864 --1715 --
NM_001040613chr8--1158 11576 11594
NM_001040709chr142072 1662 276 53 32228 2205 520 141 --
NM_001040712chr941149 1125 800 425 13343 ----
NM_001042506chrX71151 945 515 509 219 185 71 ------
NM_001042539chr1621063 980 1950 --11052
NM_001042599chr277523 7438 5525 2460 1600 861 55 47793 5599 1760 89 1445 16530
NM_001042603chr1225331 4840 34388 1377 602 11364 --
NM_001042632chr2072178 1659 615 604 494 380 320 --32487 507 361 --
NM_001044305chr611450 1369 11573 --
NM_001077628chr1--1528 1478 --
NM_001080418chr15609 186 123 100 92 2445 106 1225 --
NM_001092chr1752236 2122 2002 1910 730 --1520 2208 107
NM_001095chr1241682 1218 661 103 31623 716 668 21320 1239 --
NM_001106chr369227 3482 2987 1635 707 307 49735 7233 1446 1145 11132 17122
NM_001124chr11----144 --
NM_001163chr95999 875 808 241 102 11037 2214 70 --
NM_001167chrX15000 ----36259 4266 2646
NM_001194chr195651 263 218 204 198 1635 2499 175 --
NM_001204chr256345 5282 5024 4786 115 25128 4813 1105 15073
NM_001222chr1041256 750 705 150 1487 --11623
NM_001292chr152393 212 --1854 --
NM_001300chr102470 182 ----1105
NM_001364chr11104573 4431 3622 3350 3260 2999 1455 969 851 373 1301 ----
NM_001365chr173272 160 106 ----1183
NM_001390chr1853190 1240 331 186 25 12251 12601 12332
NM_001419chr1964049 3327 1813 1737 764 511 23596 3584 1928 1800
NM_001420chr19122936 2750 2718 2673 1235 1160 417 347 337 331 160 26 31132 234 215 22706 494 11105
NM_001429chr221919 --1317 --
NM_001438chr122580 266 --11324 --
NM_001455chr663449 3349 3039 1853 671 298 14321 1281 34710 3864 3253
NM_001478chr124928 175 92 82 --1789 2831 697
NM_001497chr931088 1000 493 2280 257 ----
NM_001654chrX1120 ----1362
NM_001655chr1131827 1769 157 21470 600 1837 --
NM_001663chr1442598 1089 75 21 ----1669
NM_001664chr32977 768 --1230 1797
NM_001668chr131995 750 113 --1126 --
NM_001678chr1751757 1321 666 572 367 21679 85 31616 597 442 --
NM_001755chr161683 ------
NM_001759chr1264903 4855 4165 1153 543 382 13716 24697 4014 13954
NM_001859chr953259 2654 1491 142 84 --13323 23811 759
NM_001964chr52835 251 --1398 --
NM_001975chr123852 821 81 --1875 --
NM_002025chrX77852 7580 1942 1702 1399 907 409 28588 7714 66482 6403 3724 3449 1860 639 18798
NM_002074chr131657 1477 109 1103 21651 1491 --
NM_002103chr193997 823 233 1142 --1179
NM_002136chr12------1276
NM_002137chr722313 2019 ------
NM_002204chr1741292 318 208 119 11106 1132 --
NM_002267chr1311900 --12043 --
NM_002270chr534842 688 75 --1664 1617
NM_002359chr1794185 3831 3673 3350 1527 954 585 391 113 32957 2815 242 --21503 147
NM_002373chr1551357 1283 494 400 34 41144 1126 907 892 1475 --
NM_002382chr141415 31053 335 263 --11025
NM_002442chr1281273 714 670 337 304 237 227 99 31597 1173 287 1323 128
NM_002473chr225516 494 444 143 130 11273 2438 193 --
NM_002501chr19204062 3941 3745 3670 3537 3529 3459 3421 3338 3225 3123 3115 2706 1229 943 937 471 450 444 370 63662 3380 3013 977 757 665 43681 3216 3002 2982 13635
NM_002515chr1441356 1258 705 600 146 11371 11530
NM_002524chr12281 58 1291 1225 --
NM_002544chr17----135 --
NM_002569chr1551414 1376 582 460 433 --31302 453 217 1204
NM_002576chr112822 312 1441 1125 --
NM_002634chr173782 727 218 186 122 --
NM_002653chr53910 337 153 1760 2942 676 --
NM_002655chr824417 1707 ------
NM_002698chr1942720 2711 1121 641 --22743 111 --
NM_002709chr243098 2246 723 97 ----1288
NM_002710chr121696 2267 187 ----
NM_002745chr2264401 3859 3549 1372 704 258 ----13615
NM_002779chr102558 37 --1186 --
NM_002829chr941110 305 294 42 --1118 --
NM_002841chr31634 --1182 --
NM_002849chr12----1198 --
NM_002855chr11143666 3548 2869 2280 2272 1294 1279 1122 541 439 357 77 70 59 62829 2689 1395 975 892 85 1324 --
NM_002859chr1221377 176 31704 1557 273 144 1314
NM_002886chr343631 2069 165 51 --11030 --
NM_002896chr11164 ----177
NM_002906chr11------188
NM_002966chr1----1210 --
NM_002971chr3----1273 1392
NM_003011chr91210 ----11461
NM_003013chr4194 --1152 --
NM_003026chr91516 3351 327 87 ----
NM_003028chr9143773 3593 3123 3032 2868 1223 1041 1018 899 752 484 386 230 224 1213 23797 3680 --
NM_003047chr181239 1111 1068 1010 963 524 503 184 1147 11263 --
NM_003076chr1291361 1355 1328 1198 677 616 423 235 193 1179 ----
NM_003088chr74993 408 158 24 1723 2847 287 --
NM_003107chr621932 200 --2523 400 --
NM_003108chr287211 5497 2905 2745 2517 1863 1851 683 27259 6820 55994 4496 2754 2615 2408 16697
NM_003131chr641922 1915 1423 327 41897 878 215 151 ----
NM_003155chr842099 2000 295 241 22432 1048 22315 1135 --
NM_003165chr961650 1481 708 603 130 115 2137 39 11940 --
NM_003179chrX91233 1215 1193 1129 1119 391 236 94 73 1184 21286 255 11106
NM_003216chr2242507 1068 307 120 1405 22530 650 2462 40
NM_003221chr6113467 3405 3397 3119 3092 2884 2841 2657 2538 1427 502 32678 1222 483 12808 --
NM_003342chr1753029 776 707 557 77 ----13244
NM_003344chr721222 152 ----11582
NM_003347chr2241944 584 375 64 11782 --12015
NM_003390chr11----1726 --
NM_003405chr22142 --1133 --
NM_003406chr811211 1459 11587 11608
NM_003455chr1131137 1123 251 ------
NM_003458chr3143462 3270 3204 3003 2983 2972 2965 2740 2620 2564 2538 1484 964 775 32673 2648 1495 --1797
NM_003468chr263256 3243 1165 1065 954 704 13323 ----
NM_003482chr12122656 2640 2498 2417 2372 2043 669 618 501 495 489 175 22406 763 12665 --
NM_003557chr141364 1310 1138 511 21339 241 1231 --
NM_003621chr111336 --3362 129 30 177
NM_003624chr1961259 928 387 378 319 66 2114 73 ----
NM_003644chr17196493 6384 6342 5997 5975 4924 4078 4007 2515 2331 2154 2140 2132 2034 1036 930 774 475 89 15350 36335 6149 1249 15262
NM_003673chr17----1407 --
NM_003679chr112237 22702 874 --12498
NM_003688chrX------140
NM_003705chr2------1329
NM_003737chr112381 136 --1284 --
NM_003743chr232023 1630 1498 22014 483 42301 1784 1472 574 --
NM_003822chr112112 --1514 --
NM_003913chr624156 3495 ------
NM_003969chr192337 329 --147 --
NM_003988chr10142149 1955 1923 1913 1863 1442 515 423 327 308 243 150 43 28 32216 210 199 21888 861 --
NM_004040chr21895 3328 317 182 21173 175 1383
NM_004093chr133908 354 127 22368 552 --1534
NM_004094chr1432940 1968 347 11960 1307 --
NM_004100chr662634 2359 2320 1660 919 443 --1999 --
NM_004124chr141250 ----1750
NM_004200chr11132948 2071 1213 1203 1109 1101 1086 880 770 460 382 361 181 32934 2541 1000 12568 12349
NM_004229chrX1735 1493 ----
NM_004272chr52342 118 ----11467
NM_004302chr1272622 2577 2526 2507 2383 256 161 22553 840 12718 --
NM_004311chr1072891 2546 2531 2498 2266 2048 683 32018 1175 670 --22998 2832
NM_004316chr122431 388 ----1261
NM_004419chr101694 ----1281
NM_004422chr171412 --1398 --
NM_004427chr151168 1135 1011 915 791 --1149 --
NM_004429chrX81263 957 933 926 920 323 73 65 11294 21220 246 --
NM_004430chr852369 949 628 401 101 31029 612 371 ----
NM_004433chr151423 546 426 402 193 --1470 --
NM_004438chr242667 2441 897 343 ------
NM_004443chr31531 --1481 1180
NM_004474chr12861 749 --136 --
NM_004504chr233018 2893 61 ----11046
NM_004529chr911311 1514 1504 --
NM_004535chr20----11754 11230
NM_004583chr173613 537 179 1624 ----
NM_004588chr1143229 2628 852 156 13769 --12559
NM_004612chr923771 975 --11415 14020
NM_004667chr151509 ------
NM_004687chr171847 --1512 --
NM_004706chr195295 289 281 101 68 ------
NM_004745chr8106782 6245 6009 5794 5424 2424 2195 1645 623 418 36099 1687 1465 1130 1411
NM_004774chr1732370 2292 2232 22165 1157 --11060
NM_004815chr144913 3862 1968 743 14112 1311 13385
NM_004824chr611289 1588 11143 --
NM_004852chr181814208 14148 14134 14105 13690 12490 12313 11738 10426 9402 5349 4809 3751 2966 2433 1694 1515 33 21115 356 --25420 269
NM_004860chr171182 1201 2385 135 --
NM_004922chr101300 1760 --152
NM_004939chr2------1171
NM_004947chr33946 128 112 51800 1741 739 89 56 ----
NM_004973chr611111 --21672 537 --
NM_004992chrX188497 8143 7833 7788 7488 5876 5765 5752 3380 2705 1564 1542 1402 1300 633 454 445 391 27741 7367 1320 --
NM_004995chr144456 380 155 25 1561 11278 1432
NM_005022chr171160 --147 --
NM_005080chr222755 125 --199 --
NM_005095chr121642 60 ------
NM_005109chr311955 --32256 613 203 --
NM_005116chr20104187 3956 3692 3025 2792 1810 760 695 680 354 --1975 1113
NM_005121chr1743326 1502 1460 302 ------
NM_005161chr1142180 2041 2012 29 ------
NM_005184chr1971429 1420 1338 1318 1007 77 62 21327 649 21087 89 --
NM_005206chr1741056 927 553 434 ------
NM_005256chr111632 ----1382
NM_005276chr1241722 1449 657 158 31611 1257 39 ----
NM_005281chr12897 94 2937 848 ----
NM_005342chrX2545 255 22693 914 1199 --
NM_005413chr23165 106 47 1172 --1390
NM_005418chr113620 585 132 --1689 --
NM_005458chr951621 989 777 178 141 --12424 11767
NM_005465chr141544 152 135 100 2185 112 ----
NM_005502chr912894 12577 12968 --
NM_005529chr14917 771 365 159 3760 687 40 --1227
NM_005552chr141600 --1145 --
NM_005576chr15----1113 --
NM_005584chr133275 159 89 ------
NM_005587chr152832 327 --1247 --
NM_005596chr945882 5563 1282 582 25905 5797 12120 --
NM_005607chr81782 --1747 --
NM_005667chr2----1372 --
NM_005678chr154882 744 694 279 --1712 --
NM_005704chr151008 734 236 102 23 ----1390
NM_005736chr1061532 399 393 387 339 23 11394 21500 1368 1536
NM_005746chr722479 2315 ----1787
NM_005768chr122618 254 --167 --
NM_005822chr641821 706 540 317 ----1459
NM_005898chr1121012 257 21192 132 ----
NM_005902chr15124538 4283 4175 3553 3461 2910 2862 1795 681 508 362 135 32968 527 519 14556 --
NM_005909chr554086 3984 3150 1595 1143 32695 885 237 ----
NM_005920chr1153694 3669 3514 3314 3191 3083 2651 2518 2367 1485 1246 1194 1127 877 222 23205 393 31211 647 237 11260
NM_005933chr1162801 2413 2396 2192 809 718 --22126 562 1863
NM_005955chr154356 4053 3404 160 22 24320 151 23892 2172 --
NM_005969chr112890 450 --1298 --
NM_006133chr11152341 2197 2124 2102 2086 2018 1774 1707 956 906 770 724 669 451 58 52234 2169 1986 889 820 3997 312 155 --
NM_006148chr1782384 2302 2123 1945 792 606 123 49 12710 ----
NM_006194chr142451 297 182 153 --
NM_006201chrX5748 424 307 219 50 41105 893 339 155 ----
NM_006265chr82986 517 ----1228
NM_006289chr92380 159 1300 1103 --
NM_006298chr661359 1062 1044 848 710 696 ----31203 1089 622
NM_006306chrX84477 4470 4320 4092 2282 1516 581 259 22037 1268 24531 459 --
NM_006375chrX----31918 1591 165 --
NM_006458chr116288 267 259 152 146 124 3383 354 317 ----
NM_006465chr1561729 1723 903 731 701 290 21762 1493 ----
NM_006526chr201710 ----1397
NM_006557chr921110 265 1453 11202 --
NM_006559chr1----1420 1930
NM_006624chr1031720 1540 25 ------
NM_006690chr20102010 1967 1481 934 831 470 400 350 317 207 32230 841 477 22051 370 --
NM_006736chr231492 1184 739 1150 ----
NM_006772chr6111705 1567 1425 1323 509 355 349 285 266 193 144 41658 1595 1414 444 21198 371 145
NM_006833chr71345 --1120 --
NM_006856chr1241066 287 247 222 21150 774 ----
NM_006885chr1633413 1564 1110 1359 33100 1353 726 --
NM_006896chr751097 424 260 161 151 --1335 --
NM_006943chr20202836 2384 2033 1073 1017 983 973 936 797 710 587 526 508 350 325 276 233 198 135 29 21009 177 41265 478 449 303 195
NM_006946chr115503 497 401 374 236 1524 ----
NM_007011chr15165400 5328 4408 4401 4172 2439 2171 1862 1207 1084 987 951 762 434 127 60 34955 4216 2129 --25629 4915
NM_007040chr193302 256 240 1114 11102 --
NM_007245chr167652 611 597 385 377 50 36 ------
NM_007245chr167652 611 597 385 377 50 36 ------
NM_007249chr1377673 7032 3250 2334 2167 547 52 46634 1099 404 110 ----
NM_007256chr1131596 1047 383 11277 1543 --
NM_007327chr991189 1035 1004 785 751 455 425 332 177 2410 259 21090 118 --
NM_012104chr1172457 1473 894 403 218 88 45 43472 2795 2786 247 --33428 702 105
NM_012234chr332687 1501 911 --2174 79 --
NM_012281chr721525 722 --1978 --
NM_012304chr571835 931 773 758 383 364 348 --11850 --
NM_012308chr1131792 615 106 2739 648 11636 --
NM_012316chr1105088 4196 3648 3637 1895 1869 1863 329 148 109 13569 1169 14859
NM_012465chr1033071 693 72 --12486 11188
NM_012478chr175685 357 322 47 28 --2989 268 --
NM_013260chr1721194 1072 --21378 554 --
NM_013261chr442882 2319 1365 389 1591 --13071
NM_013272chr15------1268
NM_013372chr152891 461 23363 277 1225 --
NM_013397chr62254 248 --1151 1780
NM_014023chr1032249 880 247 --1851 --
NM_014048chr1624000 3657 11419 25126 3333 --
NM_014112chr843347 750 664 511 ----24457 2015
NM_014141chr7145205 4722 4079 3966 3801 3795 3618 3232 1865 1377 1272 1014 642 405 --24191 72 --
NM_014154chr3----1505 --
NM_014190chr431539 670 97 31732 750 539 1312 --
NM_014212chr123936 866 296 --2929 786 1148
NM_014232chr1781666 1183 485 390 258 236 94 67 11642 ----
NM_014238chr1731631 383 116 11520 31404 655 528 --
NM_014240chr3103574 3075 2979 2671 1609 1589 1495 1474 1369 888 13371 23920 665 --
NM_014289chrX31240 566 40 21270 314 ----
NM_014488chr111195 ----1243
NM_014515chr12----1102 --
NM_014623chr6167 ----1228
NM_014630chr1563796 1497 1207 1149 639 116 22750 952 ----
NM_014636chr974120 3825 3014 3008 2708 1016 297 2409 152 ----
NM_014647chr1611544 ------
NM_014661chr1063837 3052 2692 1219 1210 967 43419 2537 1193 1079 33475 3358 1027 33878 2907 2584
NM_014730chr1265219 4959 4606 4545 3624 660 35236 906 828 14537 --
NM_014755chr263870 3846 2901 2774 1380 1249 11492 33448 3401 85 --
NM_014770chr12101028 919 494 219 176 129 89 80 29 23 1110 2946 104 --
NM_014783chr15----11100 --
NM_014807chr115615 187 127 63 49 --1781 --
NM_014829chr51900 --1168 --
NM_014841chr6------1855
NM_014847chr13174 168 114 1129 ----
NM_014903chr1221995 704 32174 490 395 22441 96 --
NM_014905chr242030 1702 1506 495 --11597 --
NM_014912chr10----12440 --
NM_014926chr32806 764 --1895 --
NM_014935chr183187 2814 2768 2719 2592 594 485 101 32966 925 507 43742 3477 1510 122 22571 1259
NM_014945chr571909 1612 1499 790 492 469 459 --11484 --
NM_014969chr1------2915 274
NM_015000chr1232377 337 260 11898 --1674
NM_015026chr1213637 --1393 --
NM_015032chr1322611 338 1670 1555 --
NM_015042chr15124267 4046 3702 3107 2835 2745 2670 1479 1034 450 406 160 14136 1505 23203 2947
NM_015052chr7147 11256 --1391
NM_015071chr5136114 5285 4973 4741 4646 3996 2323 1349 1105 644 454 293 277 2948 465 34712 2108 1953 24426 4005
NM_015075chrX181840 1822 852 834 828 815 803 748 739 584 565 538 514 383 365 44 38 32 41773 781 342 330 1619 --
NM_015080chr114830 638 168 67 1973 ----
NM_015094chr22184339 4252 3841 3832 3671 3254 1868 1862 1855 1638 1631 1510 1338 1241 777 673 383 23 64304 4124 3610 3563 3277 226 34503 1357 729 --
NM_015107chrX102157 1823 890 488 437 317 281 195 35 27 --171 --
NM_015125chr192456 149 --137 --
NM_015134chr171576 2441 56 ----
NM_015155chr1052772 2762 2569 859 581 2674 624 ----
NM_015176chr111586 --11210 --
NM_015178chr872663 2525 2190 720 490 373 55 177 12047 --
NM_015227chr21123086 2947 2816 2772 2747 2736 2723 2717 2651 880 690 245 12762 11114 --
NM_015236chr431272 1241 284 ----1210
NM_015271chr454086 3379 1651 1221 662 ------
NM_015288chr5113292 2829 2528 2481 1131 1111 634 626 399 251 116 33016 1159 452 23867 3377 --
NM_015299chr1453397 3189 2984 1277 308 23032 768 2819 105 --
NM_015305chr1421309 108 21723 199 ----
NM_015313chr1134821 4353 550 1616 24093 705 11401
NM_015326chr182698 2534 2200 2089 2054 1127 805 790 ----12619
NM_015327chr12861 75 31303 1196 87 ----
NM_015338chr203507 398 114 ------
NM_015355chr1711876 11769 ----
NM_015361chr2--1180 1361 --
NM_015396chr331299 1129 21 --11386 133
NM_015481chr1212937 926 893 802 751 698 280 258 214 123 76 38 2424 193 191 --
NM_015526chr1961339 1134 511 425 225 75 21086 293 ----
NM_015537chr971071 775 755 463 334 174 39 1831 2411 294 1128
NM_015564chr5--22888 399 1215 --
NM_015567chr133505 405 394 1470 --11164
NM_015578chr19----11842 --
NM_015635chr941827 1788 1590 1535 --1371 --
NM_015678chr13------1374
NM_015686chrX82376 2229 2003 1829 1808 308 148 134 62214 2206 1869 612 410 155 --12167
NM_015872chr151796 1326 1236 714 379 21783 579 31754 1501 1469 --
NM_015898chr19112439 2264 2141 2022 1840 1817 1629 823 803 344 73 42355 1853 644 264 72507 2337 1861 1717 1698 815 541 --
NM_015906chr133491 3376 1374 11362 1119 --
NM_015912chr8----12186 --
NM_015982chr17284 72 1326 ----
NM_015995chr15105346 4899 4847 3593 3546 2037 681 324 288 34 24253 124 54388 3887 3707 3557 665 1624
NM_016022chr12312 296 2920 118 1870 1380
NM_016124chr11469 ----11236
NM_016147chr1121102 92 1902 2929 133 --
NM_016223chr11137 --1344 --
NM_016269chr431079 957 360 ----1454
NM_016396chr1522198 1116 --1105 --
NM_016486chr1----134 --
NM_016588chr62701 28 2283 44 ----
NM_016626chr18----168 --
NM_016628chr10----1763 --
NM_017519chr6------1474
NM_017582chr111516 21154 498 ----
NM_017596chr1144333 4325 3758 3730 3459 2887 1741 1511 1455 1013 749 375 278 178 64128 1616 953 573 558 515 43967 1729 1591 494 33312 2993 357
NM_017602chrX4892 251 163 156 2232 64 ----
NM_017607chr193351 343 23 --157 --
NM_017633chr673918 3781 3310 2729 2722 2405 1364 1428 ----
NM_017637chr9109179 8242 7988 6450 6012 5919 2267 1505 1141 393 27997 6828 1268 --
NM_017644chr364898 4467 3940 3897 3874 3751 14129 --1976
NM_017672chr15------139
NM_017739chr11171 --142 --
NM_017744chr121556 760 31685 849 613 11534 --
NM_017778chr811492 123 1528 --
NM_017790chr9--180 156 --
NM_017880chr24377 341 51 45 ------
NM_017893chr10101474 1327 1144 983 582 560 528 400 97 83 21334 104 ----
NM_017902chr10105387 4943 4615 4212 3551 2049 1674 1549 1348 222 11269 13710 35253 1778 173
NM_017907chr114506 354 330 94 253 42 --1392
NM_017922chr14----1546 --
NM_018013chr642822 2153 279 97 22381 345 13010 1819
NM_018026chr1131262 1104 187 --31202 553 94 11225
NM_018031chr32532 518 1498 ----
NM_018061chr111657 11746 193 --
NM_018181chr181143 ----21424 565
NM_018206chr16--1217 1146 --
NM_018240chr14369 336 247 156 ------
NM_018312chr111101 21945 1873 21683 1537 11423
NM_018486chrX------1184
NM_018553chr173485 121 94 1236 1405 --
NM_018571chr2----1640 --
NM_018667chr1652268 1884 1857 994 52 32160 1125 201 32104 777 394 --
NM_018700chr511139 1103 ----
NM_018704chr11697 ----1220
NM_018977chrX4347 315 179 125 2913 133 11101 --
NM_018999chr1054291 1105 996 529 254 ----1610
NM_019071chr71657 --1200 --
NM_019096chr6--1851 1401 --
NM_019106chr2293195 3016 2392 2371 2192 2121 1224 1000 619 42809 2520 2241 52 12958 --
NM_019106chr2293195 3016 2392 2371 2192 2121 1224 1000 619 42809 2520 2241 52 12958 --
NM_019116chr1643425 2721 2308 1446 --2842 73 --
NM_020214chr153231 206 26 136 ----
NM_020310chr17102521 2230 1973 1962 1941 1834 1815 1723 177 117 32509 1821 709 ----
NM_020338chr10132824 2765 2731 2556 2379 1041 765 273 232 224 97 40 24 2631 47 22352 1331 --
NM_020348chr10102688 2672 2638 2355 2221 2157 1718 1020 136 63 42695 2198 1851 1034 ----
NM_020418chr3186 --1130 2483 63
NM_020432chr7----1522 --
NM_020673chr20106578 6511 6107 5327 2296 1946 1934 1271 984 675 --11463 16877
NM_020699chr1145304 3896 3875 3827 3801 3785 3766 3415 3409 3402 3370 1336 1165 181 44119 1899 1831 954 12037 21452 634
NM_020703chr11225 --150 --
NM_020708chr20122378 1851 1664 1601 993 781 766 729 474 371 124 35 12043 31623 179 67 1975
NM_020713chr20113101 3095 2611 2467 2241 631 625 468 427 105 98 1377 2495 392 --
NM_020752chr1022531 640 ----22866 467
NM_020795chr17101350 1333 702 598 571 550 428 416 347 51 11983 --1396
NM_020845chr12112327 2263 2252 2216 2032 1883 1782 502 373 367 348 22362 2272 1638 --
NM_020850chr16113065 3014 2932 2837 2813 2790 2659 2389 2378 176 114 2857 589 1515 1712
NM_020897chr131220 912 51 --11183 --
NM_020899chr1751689 1613 817 259 39 ------
NM_020919chr21423 ----1993
NM_020971chr194735 622 616 223 1230 2760 540 1160
NM_021003chr14136 --1707 --
NM_021038chr333107 2607 462 13171 --12601
NM_021103chr22242 23 ------
NM_021132chr102265 258 --11331 --
NM_021174chr82582 46 --2609 238 --
NM_021202chr20112793 1152 910 857 435 299 280 201 195 188 138 33002 1101 1045 22915 1950 --
NM_021222chr1--11243 21166 237 --
NM_021224chr9----1301 --
NM_021639chr11357 ------
NM_021813chr671509 1489 1081 983 290 204 33 34662 1879 1468 35325 5164 735 --
NM_021961chr1196417 5278 4989 2421 2078 1746 1118 737 135 25938 2601 ----
NM_021998chrX----11089 --
NM_022006chr192312 254 2127 118 4299 276 267 148 --
NM_022048chr1595609 5179 4350 4194 3877 2356 2209 1924 925 31133 556 361 16159 --
NM_022171chr331082 338 123 11574 ----
NM_022463chr1721572 1404 --1165 --
NM_022469chr162723 2653 987 713 394 37 ----1385
NM_022473chr1544119 1681 977 130 12932 24296 3524 11519
NM_022574chr7102138 2127 2111 1940 1934 1794 834 494 284 148 ------
NM_022719chr22113660 3059 2835 1509 1489 1476 701 662 527 432 172 1191 13276 13348
NM_022733chr14837 248 143 68 21107 213 ----
NM_022823chr22134 112 1394 ----
NM_022898chr14114364 3850 3800 3204 3180 2980 1069 695 328 93 27 14082 2100 21 2791 135
NM_022918chr11------11701
NM_023033chr12----1467 158
NM_023079chr176676 649 641 304 261 226 164 ----
NM_023927chr521200 374 1324 21164 86 --
NM_024050chr191115 1616 180 --
NM_024090chr4--1751 1208 --
NM_024297chr172513 377 1163 ----
NM_024501chr2159 ----1497
NM_024503chr1--2339 79 1428 --
NM_024541chr1011218 --1362 --
NM_024590chr4--2471 134 --1621
NM_024665chr3----23364 165 --
NM_024670chr10--1376 --1534
NM_024686chr1------1149
NM_024721chr81699 --12415 1306
NM_024769chr1111060 ----11118
NM_024779chr1251525 1334 1310 1172 1065 ----1607
NM_024811chr1161886 1644 1638 1354 756 194 187 --11666
NM_024887chr12722 55 11428 31584 611 83 --
NM_024939chr161271 --21068 78 --
NM_025074chr442568 2262 2228 792 22479 742 --12853
NM_025134chr16--172 --1777
NM_025160chr163788 3372 3305 1519 914 591 ------
NM_025182chr93709 411 173 2928 916 1883 --
NM_030621chr1464189 3211 2617 1346 1090 559 1915 11511 --
NM_030627chr533309 514 46 ------
NM_030762chr123683 229 197 1208 --11727
NM_030806chr1159266 8909 8699 8507 8358 7981 7948 7756 6671 6340 3468 3318 2622 2107 1388 78896 8365 7146 6580 1950 136 56 28877 3293 28947 7350
NM_030964chr5133539 3336 3253 2895 2846 2723 2276 1376 1001 377 167 130 123 63588 3550 2494 2283 563 518 33086 2966 1107 --
NM_031407chrX1508 ------
NM_031412chr1221127 31 ------
NM_031417chr1972167 2062 1117 860 795 536 483 2789 376 1238 --
NM_031445chr252879 851 693 375 28 21152 668 ----
NM_031475chr14755 611 599 140 153 1628 1731
NM_031866chr104941 675 418 94 ------
NM_031890chr22102946 2626 2544 1952 1879 1159 966 579 511 285 32085 2053 235 32691 756 145 13012
NM_032120chr7----1110 --
NM_032153chr342544 1946 1018 338 11100 31855 781 52 1861
NM_032160chr182790 201 --22715 1027 --
NM_032181chr21206 1579 ----
NM_032268chr1652438 2432 1083 804 230 --32171 119 46 --
NM_032294chr1781749 1709 452 123 117 82 64 43 ------
NM_032420chr52812 84 --1303 --
NM_032452chr144556 548 221 49 1234 ----
NM_032457chr42365 258 22587 1374 ----
NM_032458chrX2985 259 ------
NM_032512chrX31135 752 293 --1264 1846
NM_032547chr42978 383 --11372 --
NM_032558chr93964 105 63 --11217 --
NM_032595chr17121478 1411 1365 1337 1167 1001 995 553 544 415 301 124 51270 588 333 133 75 ----
NM_032968chrX1909 --1230 --
NM_032973chrY1909 --1230 --
NM_032983chr7113380 2780 2607 2574 2295 1344 823 805 784 770 150 12252 1278 --
NM_032995chr2101563 1366 1248 1192 1180 675 539 470 456 277 --1640 --
NM_033055chr1254 35 ----1743
NM_033102chr161076 1059 1001 961 475 137 1868 11222 --
NM_033133chr1783595 3566 3516 2683 2607 2355 1512 796 32661 819 375 --12446
NM_033224chr7107761 7525 6564 5794 5122 1316 461 399 76 43 47265 3197 2998 1545 28022 5716 15322
NM_033285chr83868 829 822 --13570 --
NM_033310chr11------1235
NM_033315chr1742078 1952 773 489 22045 407 21875 135 --
NM_033449chr592031 1841 1477 785 327 315 175 126 120 1346 11439 --
NM_052874chr164127 100 68 59 4672 656 269 78 ----
NM_052875chr114554 323 234 31 --2589 43 --
NM_052897chr125288 209 201 188 84 ------
NM_052910chr1392001 1768 1726 1436 1360 1354 596 562 88 21736 1368 21624 65 --
NM_052951chr20----1150 --
NM_052953chr3----1201 --
NM_054033chr24176 95 80 69 --138 --
NM_057175chr422288 69 ------
NM_078471chr1721161 122 31084 762 33 158 --
NM_080415chr174939 702 329 120 ----1260
NM_080430chr22----171 --
NM_080616chr201144 1137 2682 608 --
NM_133265chrX21090 469 1475 --22806 2728
NM_133445chr911404 1649 22348 503 --
NM_133510chr141291 ----1308
NM_134268chr171926 1959 136 --
NM_138357chr1021593 1512 11141 1523 1357
NM_138473chr1284994 4628 3620 3163 1234 904 168 40 1282 1701 --
NM_138795chr181412 1255 1141 526 288 217 95 72 11526 ----
NM_138799chr2162 --1236 12077
NM_139014chr641511 873 86 54 1511 ----
NM_139057chr15122810 2428 2282 2255 2080 2040 2021 1884 1164 868 379 86 1946 1275 --
NM_139058chrX197 2365 50 3184 36 25 --
NM_144578chr1485233 5083 4489 3862 1678 1387 970 926 21007 933 1126 --
NM_144582chr2122637 2626 2491 2294 2082 1627 987 963 707 145 139 93 --11659 --
NM_145008chr112350 94 1594 1158 1185
NM_145253chr167702 696 686 568 538 290 79 --196 --
NM_145296chr191668 1130 1807 --
NM_145307chr1012902 ----13193
NM_147161chr141180 280 148 31 138 1467 --
NM_152237chr2281527 1466 1457 1416 1302 557 487 98 --1624 1432
NM_152247chr22----1220 1359
NM_152253chr2252697 1493 1485 1467 1374 62764 1201 1015 901 649 272 43606 3183 3092 2627 23745 1337
NM_152263chr1126122 5844 5318 4650 4162 2426 1638 1162 600 572 204 158 32383 2248 165 --13728
NM_152277chr54614 353 330 31 --1686 --
NM_152341chr1621413 1203 21171 370 11117 11465
NM_152345chr1751115 1006 834 828 433 3953 875 391 ----
NM_152346chr173456 362 236 --3985 739 86 178
NM_152384chr2111723 1706 1666 1629 1531 1453 1405 1356 1278 797 735 ------
NM_152424chrX64610 4158 3278 1437 604 448 64530 4312 3329 1659 1240 667 41895 1644 1421 1279 1232
NM_152493chr171671 1378 1276 1099 549 273 213 21030 22 1570 --
NM_152520chr2--1244 2888 95 --
NM_152553chr61506 --2404 204 --
NM_152756chr521599 459 --1357 --
NM_152787chrX21583 493 --23606 1290 --
NM_152860chr1251376 1347 1332 1035 333 290 25 41341 1164 347 256 1993
NM_153040chr152213 81 1458 ----
NM_153335chr1731040 516 382 --1253 --
NM_153340chr1----142 --
NM_153487chr6174783 4723 4630 4341 4093 3760 3350 3322 3154 1646 1597 1192 590 367 318 278 21 64750 4621 4314 3702 766 648 1701 --
NM_153619chr1582743 2634 2303 1125 1027 934 868 593 1463 ----
NM_153620chr771788 1541 1170 1151 636 282 155 --1179 --
NM_170600chr9----1139 178
NM_170707chr15979 841 593 384 67 157 1938 --
NM_171998chrX42149 780 736 643 ------
NM_172375chr14--1846 1854 1813
NM_173078chrX------1300
NM_173485chr201291 ------
NM_173492chr9----1120 --
NM_173595chr12275135 4879 4734 4479 4334 4218 4133 3728 3635 3349 3249 2069 2000 1987 1702 1528 1516 1427 1085 1068 733 656 593 584 487 443 150 --55192 5079 4872 4234 219 21294 204
NM_173653chr31542 --11120 --
NM_173674chr6----127 --
NM_173681chr761835 1553 1515 473 452 264 22032 595 1739 11525
NM_173833chr841534 1472 105 83 11353 41612 1236 54 43 1139
NM_175736chr12197649 6424 6414 6367 6275 6040 5585 5397 5378 5263 4929 4800 3142 2364 1978 1743 1681 819 31 57684 4963 2774 1378 120 27672 2471 --
NM_175854chr1312169 ------
NM_175898chr1531463 327 272 21417 418 1288 --
NM_178011chr1011319 13027 ----
NM_178423chr72285 67 161 ----
NM_178557chr431633 599 25 --1548 11713
NM_178835chr44813 765 642 72 2736 94 1797 --
NM_181671chr174277 256 167 148 --197 --
NM_181807chr111122 ------
NM_182485chr423068 2414 22516 113 ----
NM_182515chr1955183 5171 4150 2634 1031 1456 --14792
NM_182527chr2281961 1871 1848 1692 1360 258 240 229 2805 51 1364 --
NM_182553chr113444 401 164 --2564 54 --
NM_182557chr11112092 1938 1824 1815 829 531 459 438 316 306 251 11725 1299 11605
NM_182691chr7----1488 --
NM_182830chr14--21625 603 11996 --
NM_182970chr20124083 3793 3556 3158 2784 1712 1516 1275 1260 957 179 161 --12814 13949
NM_194282chr421929 380 12264 --12845
NM_194286chr1286098 4820 2352 1076 1059 1046 764 399 21566 1254 11393 35948 3786 2433
NM_194317chr232172 2089 754 12283 11817 --
NM_198334chr113683 303 192 1202 ----
NM_198513chr821939 1281 ----1245
NM_198560chr383438 3313 2704 2559 1171 1140 960 580 33702 991 71 31496 1080 390 --
NM_198859chr354143 3295 1267 846 730 23800 3597 --11818
NM_198993chr1781562 1527 1504 562 548 501 392 30 21188 90 --1282
NM_199129chr2031168 284 142 1974 --1133
NM_199141chr195921 718 343 184 60 4807 637 613 173 ----
NM_199245chr12112499 2441 2328 2322 2071 1669 947 739 564 420 330 ------
NM_199320chr432845 2502 1153 ------
NM_203382chr51255 1247 1230 --
NM_206914chr1222140 379 1520 1274 --
NM_207371chr102313 97 11274 ----
NM_207372chr1042290 2250 1564 549 1181 ----