TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-345-3p
miRNA Sequence: GCCCUGAACGAGGGGUCUGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000208chr1954491 3601 3594 3149 1272 --13974 14233
NM_000555chrX127234 5888 3049 2360 2183 2143 2097 2034 1878 993 978 903 ------
NM_000633chr1833554 963 180 24071 3815 --13971
NM_001001928chr2286929 5875 5853 5187 2938 2082 1879 1456 11173 18326 17603
NM_001002860chr1474542 3694 3622 2851 1489 661 639 ------
NM_001003652chr1857344 5527 3207 3049 1929 12486 --1983
NM_001003800chr963679 3169 2534 1039 551 435 --22924 2673 --
NM_001008222chrX4540 463 57 40 ----11279
NM_001012393chr1175154 4448 1972 1759 1597 791 517 ----13386
NM_001014380chr1395172 4865 4509 4497 3876 3745 3668 1798 296 1263 14263 --
NM_001014797chr1097620 7378 7184 6833 6126 5449 3236 2019 1028 --37955 7275 2921 16772
NM_001018065chr955046 4866 4860 2078 1562 12085 --24466 3811
NM_001018066chr955046 4866 4860 2078 1562 12085 --24466 3811
NM_001018067chr175218 5058 3851 3639 3565 3280 1620 ------
NM_001018068chr175218 5058 3851 3639 3565 3280 1620 ------
NM_001018069chr175218 5058 3851 3639 3565 3280 1620 ------
NM_001033045chr234456 4404 2828 13445 --1791
NM_001034845chr41952 ----21221 257
NM_001042599chr246488 2520 974 21 11479 47319 2498 2474 996 --
NM_001100108chr152742 2700 2543 2477 2330 16395 67631 7024 5881 2679 2384 475 11344
NM_001204chr297740 7244 6566 6332 6150 5871 5312 4892 2145 ------
NM_001419chr1954460 4212 3899 3694 3103 ----21284 692
NM_002006chr465502 5243 4667 3655 1476 699 --13638 --
NM_002137chr751844 1784 939 348 78 ----1775
NM_002310chr545514 4548 1613 631 ----14577
NM_002545chr1175154 4448 1972 1759 1597 791 517 ----13386
NM_002577chr351044 955 949 815 263 --34059 3232 201 12979
NM_003099chr1565814 5412 1728 789 313 301 ----1617
NM_003108chr2107240 5244 4724 2792 2692 2377 2064 1971 1027 966 --11716 15231
NM_003406chr83794 673 166 ----1192
NM_003468chr282922 2864 2845 2761 1680 822 589 361 1615 12795 --
NM_003644chr17106614 5864 5843 5783 5467 4538 1167 1019 574 395 22264 756 22289 22 1861
NM_003941chr7----11914 2804 796
NM_004612chr954563 4077 3178 482 300 ----24793 4503
NM_004726chrX54796 1771 1370 400 375 --13768 15159
NM_004774chr1762691 2556 2513 2061 813 357 --1657 12749
NM_004985chr1263217 3187 3123 2890 1791 1546 --24057 3728 --
NM_005036chr2286929 5875 5853 5187 2938 2082 1879 1456 11173 18326 17603
NM_005065chr1454900 1758 1234 1117 74 ----1170
NM_005121chr1741096 1063 938 198 12340 1919 11488
NM_005235chr246488 2520 974 21 11479 47319 2498 2474 996 --
NM_005359chr1845913 5505 4573 1971 --14194 14940
NM_005475chr1253033 1069 825 604 518 ----1817
NM_005578chr344988 4629 2006 396 25060 3835 --14901
NM_005688chr3------2245 156
NM_005730chr1243210 2484 2311 142 ----22728 974
NM_005840chrX107078 6329 5214 4894 2778 2557 1404 256 136 108 --1320 --
NM_005901chr1857344 5527 3207 3049 1929 12486 --1983
NM_005955chr153589 1646 1172 579 534 --13442 24581 1726
NM_006252chr197023 6759 4931 2832 2801 2296 2202 930 612 ------
NM_006306chrX44007 1808 1296 123 24852 1074 22228 1135 15189
NM_006544chr1445498 2380 1534 482 ----14294
NM_006624chr1041969 1944 1401 276 --1185 1524
NM_006731chr925744 1449 14046 14204 1591
NM_006924chr1744178 3680 2922 434 ----13796
NM_007050chr2057018 6462 6230 5921 1741 --26306 486 13040
NM_007249chr1379011 8917 6150 3522 2007 1874 1109 ----17863
NM_012316chr195617 5483 4997 4295 4011 3676 2103 2014 1432 11064 ----
NM_013255chr778712 8487 6521 5588 2448 2133 859 ------
NM_014608chr15------2388 75
NM_014774chr1----23210 795 23200 652
NM_015045chr1041803 466 227 21 --12023 11723
NM_015076chr623908 1134 --13962 1570
NM_015310chr857586 7016 6168 5413 5333 1630 36198 2949 1342 17235
NM_015640chr175218 5058 3851 3639 3565 3280 1620 ------
NM_016032chrX4540 463 57 40 ----11279
NM_016260chr232811 2593 2420 --11625 17542
NM_017637chr943688 1797 1413 1239 --1251 17255
NM_017644chr344844 558 412 306 13203 1629 21778 1493
NM_017902chr1095695 4933 4629 4594 4318 3952 1429 1360 1272 35154 4264 3729 15168 --
NM_018638chr1275591 4962 1321 1128 941 544 517 ------
NM_020122chr274774 4080 4040 1305 979 834 97 11717 12246 12066
NM_020205chr162805 2495 1345 411 197 179 --13317 12969
NM_020853chr12------2973 426
NM_021061chr834122 3556 2985 ----23720 3252
NM_021116chr7128139 7878 6623 6032 3492 3354 2760 2383 1856 1801 712 313 12767 13298 --
NM_022459chr1356261 4725 2329 1819 1192 --22373 974 15227
NM_030674chr1244841 4729 4515 4424 23802 3739 --33946 1050 205
NM_030791chr142719 178 --11560 11734
NM_030806chr1178452 8250 7784 7699 7087 7019 6817 6741 5741 5706 3731 3484 3303 2923 1869 1809 959 17644 11378 26999 3060
NM_031243chr751844 1784 939 348 78 ----1775
NM_032116chr1395172 4865 4509 4497 3876 3745 3668 1798 296 1263 14263 --
NM_033360chr1253338 3308 3244 3011 1667 --24178 3849 --
NM_133170chr2057018 6462 6230 5921 1741 --26306 486 13040
NM_138473chr1284510 4398 3576 3280 1929 1290 1119 803 ----24688 3147
NM_144578chr1414948 15200 --24022 1041
NM_144973chr1235310 3594 932 --11103 14418
NM_145690chr83794 673 166 ----1192
NM_148955chr1565814 5412 1728 789 313 301 ----1617
NM_152409chr531306 554 177 --13276 13385
NM_152529chr234456 4404 2828 13445 --1791
NM_152744chr73736 592 25 ----23466 2614
NM_152826chr1565814 5412 1728 789 313 301 ----1617
NM_173468chr445131 1093 1049 773 23836 943 --15437
NM_173642chr1118637 7999 6128 5760 3434 3374 2744 2066 2039 1712 1356 29001 8189 --1541
NM_173808chr132950 544 537 ----13271
NM_173829chr555778 4183 4005 3903 845 11530 --11745
NM_175056chr351461 716 452 259 251 --12165 --
NM_178151chrX127234 5888 3049 2360 2183 2143 2097 2034 1878 993 978 903 ------
NM_178152chrX127234 5888 3049 2360 2183 2143 2097 2034 1878 993 978 903 ------
NM_178153chrX127234 5888 3049 2360 2183 2143 2097 2034 1878 993 978 903 ------
NM_181521chr1676541 5717 5439 5000 4877 1998 1687 --15053 1928
NM_182970chr2063705 3406 3321 3065 730 436 ----24227 4042
NM_198549chr132924 2237 486 ----1111
NM_201432chr17106614 5864 5843 5783 5467 4538 1167 1019 574 395 22264 756 22289 22 1861
NM_201433chr17106614 5864 5843 5783 5467 4538 1167 1019 574 395 22264 756 22289 22 1861
NM_206854chr643666 3581 1236 166 ----14510
NM_206855chr654631 4546 2201 1131 275 189 --15475
NM_206909chr857586 7016 6168 5413 5333 1630 36198 2949 1342 17235
NM_213589chr284616 3553 1874 1293 976 754 109 76 ------