TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-345-5p
miRNA Sequence: GCUGACUCCUAGUCCAGGGCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000439chr51260 ----21990 393
NM_000809chr479072 6520 3278 3016 2992 1106 149 1226 --15860
NM_001001928chr2298317 7012 6867 6658 5106 2916 1877 1697 658 16912 26921 6615 12208
NM_001003674chr1846300 2387 2142 889 35874 1472 533 --25420 4581
NM_001003675chr1846300 2387 2142 889 35874 1472 533 --25420 4581
NM_001009899chr374973 4556 2367 2258 796 777 519 35803 5567 2318 15143 --
NM_001040402chr452855 1152 577 504 28 12659 --12423
NM_001106chr3149340 8183 8078 8050 6617 6150 6015 3351 3161 2785 2606 2279 1896 1265 ------
NM_002214chr755664 4535 4262 2283 2075 24910 941 11483 --
NM_002745chr2221722 458 ----33453 1815 1180
NM_002959chr121505 1423 21697 1559 23587 1682 13757
NM_003983chr1674071 3727 3371 3009 1422 1199 487 ----2829 646
NM_004124chr1462810 2754 2329 996 820 436 ----1595
NM_004171chr1168587 8542 7881 6507 3541 808 16288 38671 1886 156 16149
NM_004338chr1846300 2387 2142 889 35874 1472 533 --25420 4581
NM_004501chr172737 2532 1582 923 825 381 375 ------
NM_004774chr1752783 2761 857 774 486 1757 22892 2186 187
NM_005036chr2298317 7012 6867 6658 5106 2916 1877 1697 658 16912 26921 6615 12208
NM_005504chr1255920 4437 4081 1564 907 34187 4171 2222 --14875
NM_005840chrX97670 6796 6583 5651 2412 1420 1338 1262 106 26630 6432 26784 2776 --
NM_007038chr2185178 5128 5086 4956 4603 3726 1138 220 25543 1402 ----
NM_007249chr1388812 8495 6099 5965 5887 3148 2271 945 13335 11283 --
NM_012164chr977292 5898 5449 1786 1562 617 251 ----12998
NM_013255chr797426 7281 6835 6076 3360 3134 1170 748 40 27460 2263 18485 --
NM_014616chr383206 3138 2962 2569 2141 657 454 134 ------
NM_014906chr1753546 1345 871 346 333 32784 1268 608 12908 --
NM_014946chr233005 2331 720 1248 --12360
NM_015115chr452855 1152 577 504 28 12659 --12423
NM_016260chr222509 978 ----22760 2642
NM_017635chr11------31259 569 226
NM_017637chr998082 7176 7030 6541 6222 2794 1295 943 68 48567 2975 2860 1980 16422 --
NM_017933chr221530 1241 ----21143 1052
NM_018313chr322188 1955 ----31727 755 740
NM_018844chr731618 1525 476 11851 --21291 504
NM_020177chr552661 1289 1143 988 300 ----13164
NM_020727chr2164037 3614 3307 2818 885 723 ----11391
NM_021728chr14------2809 90
NM_021961chr1187515 6922 6321 6023 4848 1801 1542 1238 --25513 2388 16398
NM_024989chr255155 3127 3011 2109 1524 ----15074
NM_031427chr1495494 5018 4645 4201 4001 1265 1202 694 663 24724 1136 15467 --
NM_031844chr172737 2532 1582 923 825 381 375 ------
NM_033224chr777018 6953 6914 5870 5157 4913 850 27907 3095 15147 --
NM_033656chr2135643 4845 4240 22167 733 15027 15850
NM_053016chr957677 6941 2278 1805 1464 ----16516
NM_172337chr14------2809 90
NM_173468chr442357 1772 953 370 34025 1821 1507 1940 --
NM_174902chr1121583 1221 --41157 1151 1145 539 --
NM_181481chr1846300 2387 2142 889 35874 1472 533 --25420 4581
NM_181482chr1846300 2387 2142 889 35874 1472 533 --25420 4581
NM_181483chr1846300 2387 2142 889 35874 1472 533 --25420 4581
NM_181521chr1676648 6145 5227 5032 2188 432 384 26794 5063 --16756
NM_199436chr233005 2331 720 1248 --12360
NM_213589chr255540 5100 3837 945 232 1544 34614 2082 1384 --