TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-346
miRNA Sequence: UGUCUGCCCGCAUGCCUGCCUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1292273 2247 2073 1859 811 741 677 650 79 --1211 --
NM_000084chrX16890 ----25627 773
NM_000109chrX2258 35 --2657 23 --
NM_000168chr732720 913 895 13069 ----
NM_000276chrX31933 1916 35 --11667 --
NM_000555chrX67615 5849 5369 4848 3112 1972 31551 1515 664 1412 --
NM_000633chr1854835 3290 3284 411 99 --13304 --
NM_000807chr41138 1182 ----
NM_000842chr11----1196 --
NM_000875chr1556323 4637 1909 1546 1538 11806 --1920
NM_000901chr422555 2144 11943 12066 --
NM_000933chr2041612 1109 691 231 11222 ----
NM_001003940chr1593417 3345 3310 3296 3142 2429 1483 626 67 11316 13071 --
NM_001004356chr44969 370 87 78 3947 579 431 150 --
NM_001005463chr1032524 898 553 12112 ----
NM_001007226chr17------178
NM_001007271chr1051033 1027 973 817 796 ----2916 102
NM_001008392chr343396 2318 879 329 --12188 --
NM_001010891chr535979 5710 2141 14768 21585 284 --
NM_001010917chr102669 54 11425 --12204
NM_001010984chr132348 687 97 ----11006
NM_001012393chr1151940 1877 1771 1269 200 11046 14685 13767
NM_001014797chr1098239 7645 7477 7015 6710 6189 6169 5773 1990 26557 264 36802 2266 843 --
NM_001017440chr7218042 7404 7306 6353 6284 6229 6128 5589 5327 2583 2401 2300 2217 2209 2126 1816 926 915 641 188 114 36813 5416 84 26974 63 --
NM_001025580chrX2170 40 1856 ----
NM_001031684chr2--11253 21440 1092 --
NM_001031695chr2264948 4295 4263 3637 3484 2167 23354 397 --11174
NM_001031717chr3131 ----2350 187
NM_001033723chr842658 988 678 608 12591 12081 --
NM_001034954chr1021994 687 23165 700 ----
NM_001037331chr182238 101 --1712 --
NM_001039916chr12----11093 --
NM_001040429chr1343218 2904 1038 715 13399 ----
NM_001040624chr832244 762 545 --31978 1792 1033 --
NM_001040709chr182498 2376 2329 2251 2046 722 326 213 ----1139
NM_001042404chr131310 516 220 ------
NM_001042413chr942491 1195 158 145 --13941 --
NM_001042481chr14--21889 1037 ----
NM_001042537chrX3924 784 209 --1160 --
NM_001042599chr2126990 5838 5290 5247 5000 4861 4769 3069 2416 2327 1868 381 ----11065
NM_001106chr3128032 8016 7726 7412 7108 6812 6511 3410 1935 925 556 247 49499 3599 2536 236 37944 6142 3271 --
NM_001148chr422002 497 ------
NM_001167chrX96223 6197 5388 4405 4399 4230 4204 1995 995 26376 6003 26065 1099 --
NM_001222chr1041575 1480 1436 318 11371 11950 --
NM_001290chr4----1687 --
NM_001356chrX31998 913 531 --1773 --
NM_001364chr1162927 2892 1701 1353 821 307 --24360 3671 14262
NM_001412chrX3447 232 117 ------
NM_001584chr111468 ------
NM_001650chr182745 722 126 ----
NM_001660chr32637 114 ----1748
NM_001663chr1442684 1876 456 294 ------
NM_001681chr12--2607 551 ----
NM_001730chr1321225 236 ----1368
NM_001933chr141881 ----21405 101
NM_001962chr5----2390 109 --
NM_001987chr1264057 3021 209 144 126 83 23742 850 --11303
NM_002006chr434027 1698 1358 --1707 --
NM_002009chr1542459 1975 1930 438 ----11126
NM_002166chr22741 523 ------
NM_002203chr543538 1479 1399 194 --13795 --
NM_002214chr744573 3926 3839 3497 ------
NM_002247chr1031461 335 206 ------
NM_002264chr3--25010 3635 --11037
NM_002268chr331890 1197 550 1720 ----
NM_002336chr1224116 199 --1105 --
NM_002577chr333751 3496 772 --1366 --
NM_002581chr934345 1839 888 14895 --13665
NM_002655chr855180 3771 1802 1763 820 ------
NM_002698chr1972471 2024 1941 1894 1045 682 279 11109 32558 2048 849 --
NM_002869chr11----12008 --
NM_002906chr11160 171 --11782
NM_003043chr3123482 3154 1708 1428 1146 952 926 884 846 791 439 254 --1567 11583
NM_003107chr641886 1670 799 633 --1593 1267
NM_003108chr2147035 6220 5968 4659 2732 2546 2509 2180 1935 1747 1696 1491 724 398 --12392 --
NM_003112chr742085 1217 330 185 1624 ----
NM_003139chr111114 ----1834
NM_003155chr821888 937 --12052 --
NM_003204chr174716 350 281 254 ----21508 162
NM_003241chr31334 1602 1107 --
NM_003262chr31953 14014 ----
NM_003392chr333228 2741 409 2984 648 ----
NM_003404chr2021275 320 ----1637
NM_003412chr332056 1935 1254 ----11983
NM_003418chr31202 ----188
NM_003463chr61865 11037 ----
NM_003468chr223614 3455 14018 14052 --
NM_003483chr12--1562 12249 --
NM_003489chr211989 --1701 --
NM_003583chr1232783 1000 261 --1282 --
NM_003713chr141299 1165 1141 627 ----11595
NM_003743chr231891 1535 236 --11444 --
NM_003758chr15------11508
NM_003888chr1531374 1219 140 1261 21186 457 --
NM_003913chr673799 3694 1235 619 414 331 204 12973 12857 --
NM_003941chr731764 651 429 1511 ----
NM_004171chr1147038 3161 3033 1245 48175 7075 6773 2554 ----
NM_004200chr11102813 2785 2673 2282 1274 1124 1077 704 642 622 --1305 --
NM_004227chr721929 85 33127 2866 370 32910 2489 2386 --
NM_004249chr4------124
NM_004273chr1094184 3823 3422 1992 1711 1474 794 323 243 1700 21537 253 21051 957
NM_004296chr1453663 3231 1567 1047 38 22647 75 151 --
NM_004311chr1032199 2175 2115 22037 647 11036 22418 554
NM_004331chr82695 286 --12379 --
NM_004342chr732062 1657 730 ----1862
NM_004397chr1124065 1183 33907 915 859 24181 1725 --
NM_004575chr4----2516 305 --
NM_004588chr11134013 3536 2865 2608 2537 2498 1510 1301 864 824 323 317 272 23513 583 ----
NM_004734chr1373031 2249 2108 872 620 525 226 13086 ----
NM_004788chr1122199 549 2530 45 ----
NM_004834chr253326 2390 732 458 121 21271 1097 12342 --
NM_004852chr181313003 12679 12084 9766 5618 5261 5246 4906 4628 4547 1861 1425 923 111663 212242 9414 --
NM_004969chr10----1492 --
NM_004985chr1223461 118 14080 1722 --
NM_005056chr1275246 3719 3661 3603 1278 877 249 15120 143 --
NM_005096chrX1368 ------
NM_005109chr3----12131 --
NM_005254chr1511389 --11172 --
NM_005312chr972464 580 508 495 358 196 93 32666 2050 224 11667 22536 2319
NM_005316chr11188 --1461 --
NM_005358chr131165 134 --1295
NM_005406chr182251 196 179 ----
NM_005436chr1011009 33771 2679 2629 --23106 2858
NM_005458chr93611 162 54 3740 583 562 1586 11657
NM_005587chr151219 ----1238
NM_005596chr954840 4438 1114 329 206 13971 22311 2292 34696 1394 1208
NM_005737chr232351 1973 1819 --1573 --
NM_005836chr8----1494 --
NM_005902chr1563501 3037 1307 1246 533 438 11458 33126 3030 30 --
NM_005909chr52734 302 ----1933
NM_006011chr1564247 3297 1727 821 732 97 --160 1216
NM_006016chr622176 1822 1325 --12232
NM_006141chr1652687 668 407 283 108 --12310 1779
NM_006237chr1312296 --11900 --
NM_006264chr42236 54 ------
NM_006364chr14--1321 1505 --
NM_006520chrX11622 --1173 --
NM_006546chr1786166 6113 4962 2596 1981 1064 890 45 --35050 4168 73 --
NM_006599chr1647117 6783 985 258 1568 1599 --
NM_006601chr12------1100
NM_006618chr1----1535 --
NM_006690chr2041699 882 280 166 1629 42088 1682 557 550 22244 2121
NM_006717chr922979 2628 23291 57 ----
NM_006777chrX21962 46 1570 12026 1734
NM_006802chr121012 1002 --1152 --
NM_006814chr2081841 1658 1649 937 770 640 123 88 1195 ----
NM_006896chr71769 1901 --1410
NM_006943chr2073229 2994 2644 2526 2050 1167 1156 22268 170 ----
NM_007005chr921549 456 ------
NM_007147chr191882 1765 ----
NM_007173chr111526 12113 ----
NM_007191chr12------1280
NM_012134chr12545 457 21851 646 --11154
NM_012154chr82619 188 ----1672
NM_012156chr2072665 2388 2300 2107 795 439 224 32769 868 280 ----
NM_012193chr1165104 3398 3341 1395 949 188 12150 ----
NM_012199chr164088 4019 3977 3841 3084 860 21450 372 ----
NM_012248chr162622 227 --1681 --
NM_012281chr722026 93 11544 ----
NM_012316chr185146 5120 4823 4324 2224 2217 1827 452 15523 24982 4761 25497 299
NM_013396chr2111484 1164 ----
NM_013450chr21228 ------
NM_014112chr854500 4350 3597 2115 465 14263 15159 --
NM_014117chr161789 ------
NM_014283chr11616 ----1222
NM_014294chr821286 486 ------
NM_014319chr1211761 ------
NM_014421chr431640 563 31 11324 ----
NM_014431chr1041108 644 402 45 21468 287 ----
NM_014454chr61834 144 --191
NM_014507chr2251016 369 333 259 225 ----1297
NM_014587chr1661451 549 481 358 312 30 11150 ----
NM_014630chr1541446 1368 658 65 1407 1834 2687 683
NM_014665chr8123545 3249 3165 3147 3105 3021 2969 2820 2655 2510 2450 55 --23576 3421 --
NM_014667chr332236 1644 719 1635 12429 --
NM_014682chr831769 1464 805 ------
NM_014706chr122222 202 11211 2426 51 --
NM_014707chr721965 710 21526 104 ----
NM_014723chr20132855 2538 2469 1252 1241 1157 918 907 854 848 653 507 221 13243 ----
NM_014772chr1852695 1331 572 499 485 --21311 21 2522 122
NM_014787chr152080 1048 454 77 30 ------
NM_014810chr132442 2356 223 13480 ----
NM_014822chr42508 478 ------
NM_014828chr1421901 600 1830 12131 --
NM_014906chr1733042 1385 1096 --13306 173
NM_014912chr1033028 1146 300 --1469 --
NM_015045chr1042199 1930 1453 273 --11761 --
NM_015064chr1283606 3580 2908 2558 2466 959 591 311 1305 13452 --
NM_015074chr174027 3892 3067 1283 1257 839 703 14930 31545 1130 1072 --
NM_015092chr1663868 3838 1726 1700 1568 286 --11139 --
NM_015124chr2231668 262 246 11879 22281 2011 --
NM_015156chr1442510 1496 995 980 21356 346 13678 --
NM_015205chr1364302 4006 3982 3790 3780 1865 44286 1821 967 257 12021 --
NM_015215chr142578 2045 1031 663 ------
NM_015245chr651714 507 498 370 219 22399 1826 22156 1079 --
NM_015275chr12----1859 --
NM_015286chr152819 704 --2883 495 --
NM_015313chr1174158 4131 1321 1229 988 942 504 33574 1348 766 ----
NM_015347chr1222895 430 --22712 91 --
NM_015375chr193660 1946 1920 1630 1471 903 877 747 146 11742 21729 296 --
NM_015475chr21271 --1111 1108
NM_015530chr2--1980 ----
NM_015554chr1552863 2643 2136 469 409 1280 ----
NM_015568chr2054162 3979 3231 808 639 ----12958
NM_015609chr152742 2396 2360 2080 686 22613 2191 12958 183
NM_015635chr93556 133 30 --11410 --
NM_015657chr22759 389 1409 --1800
NM_015906chr141639 1579 804 510 14435 11005 --
NM_016073chr152797 274 ------
NM_016100chr20------127
NM_016221chr531830 1643 743 12394 2401 22 --
NM_016275chr31534 21908 743 1129 --
NM_016396chr1522549 757 ------
NM_016467chr25955 899 396 225 158 --1234 --
NM_016470chr201208 --169 --
NM_016530chr1512949 24001 3260 11120 --
NM_017548chr332021 1557 106 ----11743
NM_017599chr12----1180 --
NM_017628chr435253 4802 1445 --14017 --
NM_017629chr131942 643 587 11962 ----
NM_017637chr948304 7248 1811 1226 16005 1516 11428
NM_017672chr151355 --11017 --
NM_017848chrX53839 3609 3457 3443 570 --23289 697 --
NM_017873chr993019 2596 2528 2430 2418 2357 986 139 58 ----12207
NM_017915chr12----2846 387 --
NM_018328chr2------1112
NM_018448chr12------1475
NM_018489chr1------11455
NM_018566chr134945 4191 3849 ----1621
NM_018644chr11----11918 --
NM_018682chr7----1240 --
NM_018834chr51781 ------
NM_018977chrX2242 141 188 ----
NM_019116chr1683507 3257 3239 2838 2611 1381 984 954 22352 925 13289 --
NM_020159chr41512 ------
NM_020432chr7----12261 --
NM_020440chr153183 3035 2973 2908 2362 33254 2203 168 ----
NM_020456chr1311431 12157 --1685
NM_020655chr1681420 500 486 404 374 315 239 37 ------
NM_020699chr154414 3866 3694 564 509 14887 ----
NM_020768chr52382 184 --1466 --
NM_020778chr1563457 3215 403 375 140 38 23556 1929 24210 1354 --
NM_020796chr532846 549 115 31842 613 38 11845 --
NM_021038chr31397 ----12124
NM_021064chr61186 21504 378 ----
NM_021190chr13916 406 182 11283 ----
NM_021728chr141941 ----1996
NM_021813chr615071 41240 1119 1048 828 34937 4586 1604 --
NM_021961chr1157001 1510 1319 631 341 16677 --17443
NM_021964chr312295 --12353 --
NM_022048chr1544511 4477 2393 2189 15008 34375 793 468 --
NM_022166chr1686090 5571 5444 5421 4162 2506 1996 1534 --15258 --
NM_022719chr2253771 3052 2433 1342 1118 23676 2858 12716 --
NM_022758chr642627 2137 847 87 12427 12613 12664
NM_024046chr33205 38 27 1507 3986 361 195 --
NM_024052chr17102531 2524 2169 2111 1106 700 529 442 182 117 ------
NM_024430chr18------1155
NM_024834chr1011967 --11456 11237
NM_024946chr1631361 207 41 --21669 1436 11331
NM_025010chr3128 --22264 2072 12586
NM_025134chr16--11032 ----
NM_025154chr711056 ----21317 394
NM_030627chr522587 714 23461 2654 ----
NM_030640chr12----1219 --
NM_030761chr12389 310 1533 12027 2727 160
NM_032373chr1034616 4076 3942 1602 23750 1793 --
NM_032457chr411534 --1861 --
NM_032580chr17142 ----1422
NM_032682chr343061 2641 396 325 12545 ----
NM_033092chr11----1308 --
NM_033105chr81167 --1308 --
NM_033224chr725866 5260 15483 25397 870 17003
NM_033259chr32366 201 --1726 1627
NM_033285chr844154 4120 3737 3101 1689 --13803
NM_033656chr2145105 4717 4269 4170 14960 1227 35672 1547 1437
NM_052906chr22144669 3565 3225 1893 1828 1452 1327 959 859 717 469 426 126 88 --23193 931 13207
NM_052971chr5----1133 --
NM_053023chr113797 699 297 --1316 1230
NM_058172chr42454 270 1628 ----
NM_078487chr94786 403 114 74 11079 11082 13128
NM_080626chr12----1362 --
NM_130808chr3----1431 --
NM_138300chr141693 1055 326 117 ----21293 162
NM_138316chr10----1108 --
NM_138444chr1324439 533 33835 3309 1050 ----
NM_138959chr1106258 5373 5035 4558 2673 2504 1358 1341 958 372 35663 2529 1321 1120 26169 4821
NM_139207chr121882 --1100 --
NM_144571chr414401 --14457 --
NM_144635chr351171 987 925 173 53 --11080 1266
NM_145166chr3102850 1978 914 908 848 704 621 558 527 169 12938 1177 2816 652
NM_145206chr1022541 2412 12368 22739 1055 --
NM_145257chr121215 363 ----1193
NM_145808chr7------12316
NM_145912chr22113961 3579 3156 2996 1683 1532 1351 1107 725 649 524 --23247 238 24468 1245
NM_152253chr22103819 3786 3590 3519 3488 3355 1648 1523 1310 1244 12825 34096 3266 3071 --
NM_152424chrX41884 1872 943 67 ----13765
NM_152624chr535859 5089 802 1725 11804 26677 5713
NM_152739chr7----1431 --
NM_152745chr7------1816
NM_153020chr61432 11653 ----
NM_153035chr182814 2519 2496 2416 2378 2321 1021 33 22918 138 23143 3049 13046
NM_153260chr1541311 1244 1129 1103 --1975 1972
NM_153261chr161253 ----11104
NM_153607chr5----1328 --
NM_170665chr1253431 3027 2899 1640 347 34442 4386 320 33398 3163 1425 --
NM_172070chr2----1817 --
NM_172071chr152853 2845 2650 2387 1878 27381 5745 16712 --
NM_173469chr1531518 1462 1375 165 ----
NM_173495chrX4841 591 407 353 22069 1652 --11868
NM_173563chr6----1254 --
NM_173595chr12125175 4594 4551 4432 4088 3897 3845 3496 1118 799 177 115 14804 25058 388 --
NM_175733chr1151845 1449 643 566 449 12057 21812 1533 12082
NM_175736chr12147823 5733 4825 2899 2279 2217 2047 2009 1607 1065 716 636 596 379 34958 2611 1261 33117 2602 1560 11251
NM_176792chr1041066 1004 164 52 1244 21079 88 --
NM_176824chr41351 --1985 --
NM_178554chr372996 2964 2542 979 830 765 209 ----22464 1323
NM_178815chr1022257 428 11792 ----
NM_181704chr2111228 21286 946 21139 960 --
NM_181844chr1791971 1950 1938 1898 1771 1738 1610 464 53 --1163 --
NM_182485chr423026 1004 2688 677 ----
NM_182501chr263032 2871 2432 1197 772 480 --13053 1160
NM_182765chr1021812 222 --1356 --
NM_182970chr2094135 3634 2944 1642 1339 1148 1041 292 286 --1744 --
NM_182975chr1--1794 1179 --
NM_198859chr364883 2070 1215 1190 1179 224 34334 4172 3527 14994 11019
NM_201263chr112131 --1290 --
NM_206854chr645197 4204 2081 900 11149 ----
NM_207303chr1031526 1191 593 --23735 91 --
NM_207577chr1121975 1021 --1194 22711 291
NM_207645chr1131348 1295 932 ------
NM_213566chr192421 2395 2358 2042 2016 1884 936 658 78 --1879 11598