TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-34c-3p
miRNA Sequence: AAUCACUAACCACACGGCCAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000461chr334617 3599 1683 24461 3414 --24477 3726
NM_001001481chr853243 1383 809 692 451 12770 --13307
NM_001003652chr1898321 7797 6423 5734 5667 3080 2601 1409 1185 22855 2523 27814 7242 27314 6685
NM_001013620chr12127674 7619 7148 6330 5987 3395 3174 2601 2507 2375 1087 106 27249 483 ----
NM_001014797chr1096982 6088 5462 5420 3112 2247 2198 1859 475 18170 47142 1566 954 186 --
NM_001025580chrX83987 3623 3547 2900 1569 650 621 127 --13560 13978
NM_001029863chr652615 2486 1174 586 475 11296 --23184 2312
NM_001106chr3118938 8344 6781 6570 6091 6018 3755 2301 1965 1153 538 48481 7961 6205 1214 ----
NM_001918chr1117137 6953 6611 3599 3435 3246 2457 2015 1714 1581 395 29105 3623 --12614
NM_002092chr485045 4205 3864 3744 3395 1913 440 160 11242 53983 3435 3342 3310 3273 --
NM_003108chr286872 6140 5825 4728 4695 2483 2248 1661 --46685 573 74 71 11243
NM_004171chr1198807 8431 8398 7282 3781 3664 2451 2325 160 11232 27224 1781 17581
NM_004866chr554786 4464 4195 3123 276 15036 24899 1375 1806
NM_004999chr693977 3928 3103 2724 1674 1644 1287 805 142 --1855 24173 2969
NM_005056chr12115550 5468 4925 4878 4825 4727 4386 1338 1115 316 77 14207 11254 --
NM_005504chr1275441 4946 4741 4604 1506 1026 142 11537 26263 1923 12103
NM_005901chr1898321 7797 6423 5734 5667 3080 2601 1409 1185 22855 2523 27814 7242 27314 6685
NM_006283chr873534 3511 3440 3148 1546 1315 421 --11836 24436 1458
NM_007249chr1398863 8160 7597 3572 2840 2800 2350 1669 1229 --39124 8641 7047 27824 2107
NM_012294chr753405 3222 2510 552 160 ----22990 1039
NM_013255chr7118801 7800 6896 6545 3438 3203 3007 2380 1599 834 94 21063 554 17722 --
NM_014155chr11107134 6969 6814 5987 5688 4978 4746 1485 1302 840 16435 25461 2073 --
NM_014331chr467198 5671 5561 2565 2482 1754 17608 27156 6673 1102
NM_014423chr575383 5162 4145 3427 3411 2143 1832 ----14604
NM_014906chr1754057 3901 1028 968 318 1555 22687 2570 13220
NM_015365chrX83987 3623 3547 2900 1569 650 621 127 --13560 13978
NM_017919chr9105818 5269 5248 5114 4657 1863 539 463 404 105 2994 656 24879 3707 --
NM_018299chr853243 1383 809 692 451 12770 --13307
NM_018364chr153316 3044 1583 988 215 12884 12590 12494
NM_018374chr744302 2014 1971 1334 1785 1576 1342
NM_020466chr651575 1019 660 397 307 13521 1952 24449 116
NM_020766chrX94410 4243 3240 2880 2800 827 473 140 44 --33064 785 621 --
NM_020772chr17108082 7542 6691 6677 6633 6274 6215 5507 1374 311 1440 15439 --
NM_020918chr1063132 2864 2560 2495 2305 120 --21285 427 11193
NM_021116chr7128741 7764 7671 7125 6655 6338 3392 2519 1929 1739 1588 1231 26569 1104 1646 18604
NM_022473chr15114195 4157 4026 3990 3743 3631 3149 1528 656 111 90 12703 13699 1258
NM_024947chr3139547 8287 7536 7356 6842 6195 6174 6147 6139 3719 1341 663 303 25841 903 ----
NM_024989chr276877 6644 6320 3275 2278 1365 886 152 35280 1332 245 --
NM_025191chr182582 1191 1031 895 566 524 499 346 --1113 13422
NM_030674chr1275743 3783 3693 3567 2067 1537 687 --15076 34278 3574 2211
NM_033224chr786830 6648 6380 5174 2623 2407 1301 90 12853 12866 17599
NM_080867chr1464565 1934 1746 1685 1374 99 34437 1309 1223 13221 1156
NM_080927chr343300 730 127 110 13209 --2496 69
NM_138782chr542025 1828 869 584 11573 --12224
NM_152622chr553365 3311 3083 2725 115 ----13054
NM_152624chr587165 5587 5410 5383 4614 543 466 361 36478 2407 1328 14638 12778
NM_152903chr1362880 2473 2264 1904 875 624 ----11942
NM_173468chr465500 3703 2031 1909 1364 805 11656 1529 15191
NM_177538chr2138353 7169 6654 6610 6417 6337 2311 1948 1602 1428 1347 892 527 12501 18712 --
NM_182503chr6105429 5262 5131 5096 4344 4298 4148 3479 1253 853 11840 24123 3915 13753
NM_194247chr264267 4034 3874 3236 3020 1020 ----23281 349
NM_194283chr573280 2835 2791 2645 1206 925 91 24188 529 33064 2826 183 --
NM_199421chr1464565 1934 1746 1685 1374 99 34437 1309 1223 13221 1156