TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-34c-5p
miRNA Sequence: AGGCAGUGUAGUUAGCUGAUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531031 162 95 ------
NM_000038chr541972 1306 1274 526 150 ----
NM_000052chrX63163 2614 1077 764 466 290 122 ----
NM_000055chr31393 ------
NM_000074chrX189 ------
NM_000081chr1--1418 11867 11184
NM_000084chrX66948 6757 4571 4432 2428 1516 45646 2779 2654 1660 26582 1708 25775 2722
NM_000090chr23635 602 290 ------
NM_000094chr31215 --168 --
NM_000109chrX42653 2593 2553 2009 1641 1625 --
NM_000111chr71321 ------
NM_000125chr653745 3561 940 886 659 13855 33775 3026 1177 --
NM_000135chr166971 752 698 313 146 110 --1350 1984
NM_000138chr1522002 457 12604 ----
NM_000147chr1238 31 ------
NM_000158chr3------163
NM_000161chr1421915 800 2230 43 --1262
NM_000163chr531577 603 596 ------
NM_000165chr611648 ------
NM_000167chrX21745 1459 ----1272
NM_000168chr762381 2273 854 808 563 197 ------
NM_000175chr19174 ------
NM_000176chr532404 1329 514 ------
NM_000189chr21774 ------
NM_000208chr1933779 1871 1200 13262 23656 3156 --
NM_000214chr2051786 1282 1216 622 61 --11308 --
NM_000216chrX73745 3256 3120 2911 2776 1483 96 23866 3214 ----
NM_000217chr1265212 4979 4593 3282 1795 1478 24273 138 ----
NM_000232chr463175 2899 2361 2000 713 333 --21068 118 --
NM_000238chr73314 257 50 ------
NM_000245chr762064 1963 1870 1563 786 590 11660 22171 57 --
NM_000248chr353004 2918 533 487 35 12351 22374 2341 --
NM_000252chrX--2510 448 ----
NM_000259chr1585988 4901 4805 4726 4232 1841 1280 648 --11313 12509
NM_000264chr9172 1857 1690 12557
NM_000267chr1743375 3285 1200 184 1329 ----
NM_000276chrX32138 2118 1848 21995 197 1538 --
NM_000289chr121395 1255 ----
NM_000293chr162947 284 1354 ----
NM_000301chr61160 ------
NM_000304chr172985 813 ------
NM_000313chr311095 1971 ----
NM_000314chr1022261 1040 --1644 --
NM_000318chr8102959 2889 2644 2231 2064 723 635 575 513 216 --1117 --
NM_000325chr42695 495 1591 ----
NM_000332chr686525 6483 6284 6132 5507 2372 1253 934 22518 713 ----
NM_000333chr321059 262 ----1432
NM_000335chr321812 1519 21957 1464 21673 500 --
NM_000337chr566207 5556 5533 2254 1225 676 167 15447 1266
NM_000345chr41392 ----1762
NM_000346chr1742021 1653 1502 733 ------
NM_000362chr2233531 2808 1287 1535 ----
NM_000368chr9104642 3758 3425 3051 1239 1061 977 673 524 431 11467 ----
NM_000378chr11155 ----1260
NM_000380chr92481 406 ------
NM_000389chr611149 ------
NM_000393chr211318 --21760 604 --
NM_000399chr101729 --1141 --
NM_000401chr1131142 1086 355 ------
NM_000408chr233087 2437 106 13388 1761 --
NM_000424chr12157 --122 --
NM_000428chr1452625 2374 2216 1940 347 21709 813 32228 861 176 --
NM_000430chr1733468 3437 1487 22300 736 32638 2492 2479 13047
NM_000435chr192847 658 ----1709
NM_000439chr53655 490 299 ------
NM_000442chr1731188 1047 144 ------
NM_000447chr11427 --1470 --
NM_000449chr12463 164 21074 511 ----
NM_000452chr1312069 --11398 --
NM_000454chr21189 ------
NM_000461chr331474 579 154 13265 162 --
NM_000462chr1541814 1739 562 353 1425 ----
NM_000480chr1121045 417 1281 1147 --
NM_000484chr213837 810 45 ------
NM_000489chrX32423 983 607 ------
NM_000495chrX196 ------
NM_000503chr81653 ----11354
NM_000522chr721201 344 1209 11318 --
NM_000527chr1962442 2306 2067 1845 879 844 --21545 93 --
NM_000530chr121043 869 ------
NM_000551chr332060 132 25 ------
NM_000555chrX75909 4980 2934 2903 1787 886 659 --36474 1775 1421 11112
NM_000575chr21999 ------
NM_000594chr62716 556 1708 ----
NM_000596chr71166 ------
NM_000599chr243867 3828 3155 3097 23593 3256 --14119
NM_000601chr7141 ------
NM_000602chr72520 445 ----2966 430
NM_000609chr1062330 2173 1070 883 780 682 12264 11128 22385 111
NM_000610chr1152908 870 438 192 103 11901 32315 910 736 --
NM_000618chr1256070 6058 5746 5366 1233 15018 15326 --
NM_000618chr1256070 6058 5746 5366 1233 15018 15326 --
NM_000625chr173349 336 27 ------
NM_000627chr2282 41 ------
NM_000633chr1855098 4588 3205 1499 1230 2315 209 --25215 1117
NM_000668chr4----1433 --
NM_000681chr101869 21222 186 2936 99 --
NM_000684chr101885 ------
NM_000685chr31827 ----1573
NM_000685chr31827 ----1573
NM_000686chrX31138 392 167 ------
NM_000719chr1285511 5319 4789 2576 2407 2053 944 77 14401 24453 1340 16028
NM_000720chr31497 ------
NM_000721chr122588 266 ----2474 211
NM_000724chr102441 91 1269 21654 1482 --
NM_000726chr221326 1056 ------
NM_000739chr72263 93 1196 ----
NM_000767chr1971430 1418 1105 417 294 253 159 --11386 --
NM_000780chr81511 ------
NM_000800chr531657 1066 262 ------
NM_000806chr521576 88 11737 ----
NM_000807chr4--184 1213 --
NM_000809chr4106912 6466 3529 3507 1841 1515 1475 1087 849 752 12820 19011 --
NM_000810chr153533 493 146 ------
NM_000811chr51311 ------
NM_000812chr43410 149 81 --1379 --
NM_000813chr575440 4814 4720 4164 3709 3645 1895 --15037 --
NM_000814chr1543848 3783 3495 1353 11630 13229 1798
NM_000817chr221202 909 1351 --1448
NM_000824chr41104 ------
NM_000827chr582634 2051 958 752 624 330 241 113 11989 1645 --
NM_000829chr1152211 2199 2002 686 659 ------
NM_000831chr136246 5870 1257 64797 4372 460 366 225 109 21761 568 --
NM_000834chr12----1469 --
NM_000836chr192958 356 ------
NM_000838chr672750 2069 639 154 144 136 126 12146 ----
NM_000841chr61587 --2250 159 --
NM_000844chr31435 ----1217
NM_000860chr431297 615 577 ------
NM_000868chrX22498 608 ----11736
NM_000872chr1011383 --11439 --
NM_000875chr15146985 6281 6123 5711 5659 4495 4289 2490 1028 761 718 439 133 124 1367 22378 580 --
NM_000879chr5155 ------
NM_000891chr1743642 3186 1203 784 42541 2296 1213 524 ----
NM_000899chr1243267 2923 512 22 33928 1536 1468 ----
NM_000902chr372893 2254 1255 1156 1133 222 98 1944 1428 --
NM_000919chr51591 ------
NM_000921chr123558 205 87 ------
NM_000924chr1241190 1082 947 244 1291 ----
NM_000933chr201667 11798 ----
NM_000940chr7181 ------
NM_000944chr431697 324 291 ------
NM_000945chr23804 713 663 21769 721 ----
NM_000950chrX52733 1066 885 876 325 --12955 12411
NM_000956chr1431082 266 102 ------
NM_000963chr152351 2344 2142 996 804 --1356 1321
NM_000964chr1751042 1013 969 383 192 ------
NM_000965chr33473 166 80 ------
NM_001001132chr212154 130 --170 --
NM_001001323chr1222664 828 12023 12883 --
NM_001001331chr312584 11661 12213 148
NM_001001342chr1011055 --11080 --
NM_001001389chr1152908 870 438 192 103 11901 32315 910 736 --
NM_001001390chr1152908 870 438 192 103 11901 32315 910 736 --
NM_001001391chr1152908 870 438 192 103 11901 32315 910 736 --
NM_001001392chr1152954 916 484 238 149 11947 32361 956 782 --
NM_001001395chr1252686 2474 1795 588 170 --12297 --
NM_001001419chr555047 1537 1134 963 288 --1540 --
NM_001001420chr555047 1537 1134 963 288 --1540 --
NM_001001433chr2092940 2850 2465 2313 718 575 318 231 79 ----21110 1077
NM_001001436chr161730 ------
NM_001001481chr863248 2497 922 592 528 132 1623 1352 --
NM_001001484chr1052118 1797 573 450 72 11728 ----
NM_001001485chr32331 195 131 ----
NM_001001522chr11----1316 --
NM_001001549chr751885 1870 1108 796 648 --1964 --
NM_001001550chr751885 1870 1108 796 648 --1964 --
NM_001001555chr751885 1870 1108 796 648 --1964 --
NM_001001557chr832094 1832 407 11725 11554 --
NM_001001567chr212188 77 ------
NM_001001568chr212188 77 ------
NM_001001571chr212188 77 ------
NM_001001572chr212188 77 ------
NM_001001573chr212188 77 ------
NM_001001574chr212188 77 ------
NM_001001575chr212188 77 ------
NM_001001576chr212188 77 ------
NM_001001577chr212188 77 ------
NM_001001579chr212188 77 ------
NM_001001580chr212188 77 ------
NM_001001581chr212188 77 ------
NM_001001582chr212188 77 ------
NM_001001584chr212188 77 ------
NM_001001585chr212188 77 ------
NM_001001664chr233148 1307 634 --1535 --
NM_001001669chr552750 2488 744 424 211 ----128
NM_001001706chr641162 479 277 228 --1786 --
NM_001001710chr9----1115 --
NM_001001740chr11228 ------
NM_001001740chr11228 ------
NM_001001787chr1--1456 ----
NM_001001791chr1031537 553 502 ------
NM_001001870chr172789 281 ------
NM_001001872chr142478 94 ------
NM_001001890chr2164219 4124 3108 2703 1671 1560 14034 24130 2604 13020
NM_001001974chr1042381 2005 833 112 1445 1700 --
NM_001001994chrX1347 ------
NM_001001995chrX----1120 --
NM_001001996chrX1347 ------
NM_001002026chr332499 614 552 --22122 1734 --
NM_001002032chr172542 22 ------
NM_001002033chr173642 532 122 ------
NM_001002243chr2----1344 --
NM_001002255chr62359 57 ------
NM_001002257chr263262 2508 2210 1422 872 389 1110 ----
NM_001002295chr1041073 790 278 162 2775 433 11111 --
NM_001002762chr1052805 2560 2335 1040 48 12599 1463 12212
NM_001002838chrX2378 202 --21300 658 11471
NM_001002860chr1444346 1226 1219 1076 24041 355 14636 13886
NM_001002909chr1742106 1904 878 623 1296 ----
NM_001002914chr1711289 ------
NM_001003398chr121178 127 193 --
NM_001003407chr1095075 5021 4284 3929 1904 1844 824 430 336 ----15107
NM_001003408chr1095075 5021 4284 3929 1904 1844 824 430 336 ----15107
NM_001003652chr18128558 8341 8033 7356 6461 5818 3365 3138 2308 1483 815 394 1689 27483 7131 --
NM_001003682chr131020 981 220 21264 579 --1483
NM_001003694chr3--1658 164 --
NM_001003698chr621532 701 11278 11499 --
NM_001003699chr621532 701 11278 11499 --
NM_001003712chr1223950 1383 ----13897
NM_001003760chr612252 ----12397
NM_001003792chr311005 ------
NM_001003793chr311005 ------
NM_001003794chr343049 3018 2114 741 12315 ----
NM_001003800chr933281 3159 24 ----12712
NM_001003805chr14----161 --
NM_001003940chr1583717 3628 3221 1232 465 432 222 78 --23577 3116 1762
NM_001003942chr1583717 3628 3221 1232 465 432 222 78 --23577 3116 1762
NM_001003943chr1583721 3632 3225 1236 469 436 226 82 --33581 3120 2347 1766
NM_001004019chr32360 52 ------
NM_001004065chr942941 2927 2884 2418 13772 ----
NM_001004304chr1243056 2674 1068 613 12006 --1865
NM_001004317chr694420 3565 3506 3048 3039 2883 936 746 585 2670 529 --13281
NM_001004342chr1126007 5487 5412 5222 4947 4797 3880 2207 1779 1649 1253 22 24017 196 13715 26115 202
NM_001004360chr222015 1494 ------
NM_001004419chr1244407 3080 2812 1780 11571 --1279
NM_001004441chr52686 571 ------
NM_001005207chr17122 ------
NM_001005360chr193851 797 182 1567 ----
NM_001005361chr193851 797 182 1567 ----
NM_001005362chr193851 797 182 1567 ----
NM_001005366chr1221007 242 1378 144 --
NM_001005375chrY21849 30 ------
NM_001005386chr23485 302 200 22277 56 --1945
NM_001005404chr1763996 2795 1429 964 788 330 ------
NM_001005415chr191420 ------
NM_001005416chr191420 ------
NM_001005417chr12678 37 --1554 1268
NM_001005463chr1042353 1827 780 694 --42494 1984 1928 578 1722
NM_001005473chr555926 4939 4730 4707 771 --35970 5935 5412 --
NM_001005474chr3----1259 140
NM_001005476chr2------1701
NM_001005502chr1264887 4463 3827 1632 231 66 --34755 1665 1068 --
NM_001005505chr341655 1161 337 318 --11423 --
NM_001005732chr21161 ------
NM_001005733chr21161 ------
NM_001005746chr221326 1056 ------
NM_001005747chr221326 1056 ------
NM_001005753chr252049 670 409 377 283 149 21663 726 --
NM_001005781chr2----1222 --
NM_001005782chr21267 --1671 --
NM_001005785chrY21849 30 ------
NM_001005786chrY21849 30 ------
NM_001005910chr31222 ------
NM_001005911chr31222 ------
NM_001006115chr362476 2427 2110 1915 243 40 11103 22773 2120 --
NM_001006600chr51171 ------
NM_001006610chr161838 ------
NM_001006617chr911116 ----1188
NM_001006618chr9157 ------
NM_001006619chr911116 ----1188
NM_001006620chr911116 ----1188
NM_001006621chr911116 ----1188
NM_001006623chr262000 1969 1951 935 535 260 1824 12032 11766
NM_001006626chr72263 93 1196 ----
NM_001006627chr72263 93 1196 ----
NM_001006628chr72263 93 1196 ----
NM_001006629chr72263 93 1196 ----
NM_001006630chr72263 93 1196 ----
NM_001006631chr72263 93 1196 ----
NM_001006632chr72263 93 1196 ----
NM_001006634chr162556 126 ------
NM_001006636chr221029 959 ------
NM_001006658chr1269 31 ----1200
NM_001006665chr12314 224 1125 ----
NM_001006938chrX1556 ------
NM_001006944chr112288 105 --2672 253 --
NM_001006946chr221814 336 --11290 --
NM_001007024chr1793349 2741 1701 1129 605 527 508 383 86 2513 399 12716 --
NM_001007025chr1793349 2741 1701 1129 605 527 508 383 86 2513 399 12716 --
NM_001007027chr111266 ------
NM_001007097chr964514 3980 1672 1171 1074 83 54457 4447 3225 1068 58 --1622
NM_001007098chr13627 239 106 --1376 --
NM_001007102chr651147 554 546 371 196 ------
NM_001007156chr1531704 1314 214 ------
NM_001007189chr5125 ------
NM_001007226chr1731385 217 52 160 ----
NM_001007227chr1731385 217 52 160 ----
NM_001007228chr1731385 217 52 160 ----
NM_001007229chr1731385 217 52 160 ----
NM_001007230chr1731385 217 52 160 ----
NM_001007237chr152640 2584 2537 772 164 ------
NM_001007246chr2111244 1603 ----
NM_001007257chr12244 150 1569 ----
NM_001007267chr25954 760 684 284 147 1909 ----
NM_001007271chr104722 402 321 267 1432 1198 --
NM_001007277chr111112 ----1941
NM_001007466chr644678 3660 3178 648 --34897 3947 3138 --
NM_001007553chr11805 ------
NM_001007559chr1852037 1692 656 597 62 ------
NM_001008220chr522505 860 23171 778 1334 32722 743 320
NM_001008222chrX----21097 524 --
NM_001008225chr7----1689 --
NM_001008239chr1863630 3311 2571 2422 1497 30 33143 2874 324 ----
NM_001008391chr111195 --1503 --
NM_001008392chr373324 2238 1133 1056 1043 604 312 1843 11412 21084 1010
NM_001008405chr71242 1472 ----
NM_001008407chr721729 1386 1518 --1394
NM_001008408chr7156277 6037 5733 5344 5079 2242 1655 1579 1572 1342 1064 952 613 65 42 23957 1707 21794 908 --
NM_001008410chr251857 1553 1461 1433 839 --22072 1753 --
NM_001008491chr241967 1642 1352 205 --11858 11900
NM_001008492chr241967 1642 1352 205 --11858 11900
NM_001008539chr885367 5354 4600 4203 4068 3783 812 366 15048 --14653
NM_001008541chr1022238 719 1701 11712 --
NM_001008541chr1022238 719 1701 11712 --
NM_001008564chr1352093 1761 1576 748 427 12038 ----
NM_001008566chr222322 117 ----132
NM_001008567chr9----2244 28 --
NM_001008660chr1131157 350 83 ------
NM_001008701chr1952625 2410 1038 895 455 11916 11251 --
NM_001008707chr1441321 543 357 70 ------
NM_001008723chr101410 ------
NM_001008738chr532089 1877 317 --22354 985 --
NM_001008783chr62842 684 1878 ----
NM_001008800chr1178 ------
NM_001008801chr1941746 1534 820 509 ------
NM_001008883chr1178 ------
NM_001008938chr111411 ------
NM_001009185chr52690 37 1217 ----
NM_001009555chr411783 ------
NM_001009571chr731678 1225 414 1589 1426 --
NM_001009880chr2264832 3806 3048 1014 416 208 24762 56 14152 --
NM_001009894chr1211656 11182 1550 --
NM_001009955chr1138 ------
NM_001009955chr1138 ------
NM_001009958chr72459 51 ------
NM_001009993chr274559 3806 2871 1024 582 415 218 ------
NM_001009997chr10----1331 --
NM_001010854chr141540 1511 ----
NM_001010861chr131807 318 26 ------
NM_001010867chr1126442 6240 5869 5732 5513 5347 4706 4607 2217 2055 1378 457 36171 5542 4728 35353 2653 2449 --
NM_001010888chrX114655 4528 3634 3261 2966 2859 1692 1172 699 486 295 ----1228
NM_001010898chr153390 3297 2802 616 323 11231 32739 2558 1082 --
NM_001010924chr103821 480 128 2877 41 ----
NM_001010932chr7141 ------
NM_001010934chr71275 --1224 --
NM_001010942chr121840 21253 263 ----
NM_001010971chr111015 ------
NM_001011537chr332300 1950 1716 ------
NM_001011553chr71649 1373 --1703
NM_001011663chr101864 ------
NM_001011666chr7106580 6227 6062 2587 1610 1404 1367 1290 764 691 15540 ----
NM_001011708chr222951 2391 ------
NM_001011713chr1411026 ------
NM_001012329chr142208 2200 710 605 --1906 --
NM_001012393chr1194730 4722 4158 3444 1873 1667 1298 1020 65 14326 ----
NM_001012398chr162993 80 21122 117 ----
NM_001012420chr1512913 22692 349 ----
NM_001012423chr1512913 22692 349 ----
NM_001012426chr693014 2831 2615 2578 2458 2255 2159 587 274 13366 ----
NM_001012427chr693014 2831 2615 2578 2458 2255 2159 587 274 13366 ----
NM_001012643chr192522 219 ------
NM_001012732chr43988 980 154 ----1357
NM_001012751chr1021968 74 ------
NM_001012753chr1921236 421 ------
NM_001012755chrX64770 3528 3455 1970 1257 122 14486 2751 479 11759
NM_001012968chrX32015 885 195 --1692 --
NM_001012977chrX41204 1009 333 278 --11132 --
NM_001012979chrX--145 ----
NM_001012989chrX1500 --1558 1180
NM_001013031chr1032904 679 94 1474 13005 --
NM_001013415chr411402 ----1570
NM_001013620chr12108423 7781 7663 6735 6298 6036 3111 2805 2787 2129 1763 --16352
NM_001013622chr47465 404 280 221 157 95 33 1343 2416 169 --
NM_001013635chr121826 --1889 --
NM_001013690chr1232222 1986 1801 ------
NM_001013693chr152554 2216 846 750 614 12709 ----
NM_001013693chr152554 2216 846 750 614 12709 ----
NM_001013699chr122394 177 ------
NM_001013839chr172720 586 12423 1307 --
NM_001013843chr151764 ------
NM_001014283chr1371679 1519 1489 1474 1422 1382 424 ------
NM_001014286chr131106 ------
NM_001014380chr1355693 2320 1604 834 718 24546 1761 --14042
NM_001014765chr141762 633 418 48 ----1643
NM_001014797chr1067535 7259 7221 7100 2825 933 47108 6216 5817 248 ----
NM_001014831chr191608 --1733 --
NM_001014832chr191608 --1733 --
NM_001014834chr191608 --1733 --
NM_001014835chr191608 --1733 --
NM_001014839chr11367 ----1862
NM_001014841chr11367 ----1862
NM_001015045chr451776 1565 508 350 51 --1156 1515
NM_001015053chr1721586 460 --1137 --
NM_001015508chr81516 ------
NM_001015877chrX82548 2407 2397 2055 981 135 106 69 ------
NM_001015880chr1041646 1545 1158 267 ------
NM_001015882chr931095 1029 87 ------
NM_001015887chr341609 1364 1239 297 ----11648
NM_001017368chr1721014 721 --1493 --
NM_001017369chr42702 68 ------
NM_001017371chr211217 ------
NM_001017395chr3103630 3564 3413 3277 3189 2643 2501 2326 1009 642 ------
NM_001017415chr11749 ------
NM_001017416chr11749 ------
NM_001017424chr121275 710 ------
NM_001017425chr121275 710 ------
NM_001017440chr7157834 6306 6061 5721 5256 5112 4979 3058 2654 2416 1946 1936 1635 614 23 58167 7726 2588 758 633 11991 --
NM_001017523chr1271722 1680 1472 686 659 126 118 --2281 268 1755
NM_001017923chr14--11241 --11226
NM_001017926chr841585 669 391 176 ------
NM_001017979chr45252 245 145 138 36 ------
NM_001017989chr19135 21249 900 180 --
NM_001017992chr52942 62 ------
NM_001017999chr12421 25 --1748 --
NM_001017999chr12421 25 --1748 --
NM_001018000chr12421 25 --1748 --
NM_001018000chr12421 25 --1748 --
NM_001018001chr12421 25 --1748 --
NM_001018004chr151524 1219 --1101
NM_001018005chr152186 137 ------
NM_001018006chr151524 1219 --1101
NM_001018007chr151524 1219 --1101
NM_001018009chr341021 979 799 114 ------
NM_001018020chr151524 1219 --1101
NM_001018025chrX3165 125 75 1265 ----
NM_001018050chr2262885 2501 2145 1222 676 185 --32810 891 668 1709
NM_001018052chr2262885 2501 2145 1222 676 185 --32810 891 668 1709
NM_001018054chr121444 275 ------
NM_001018056chr9--1482 ----
NM_001018064chr9175 ------
NM_001018065chr965749 4693 1698 1636 431 36 16077 ----
NM_001018066chr965749 4693 1698 1636 431 36 16077 ----
NM_001018067chr144837 4208 4040 1953 23953 108 14233 --
NM_001018068chr144837 4208 4040 1953 23953 108 14233 --
NM_001018069chr144837 4208 4040 1953 23953 108 14233 --
NM_001018072chr1271722 1680 1472 686 659 126 118 --2281 268 1755
NM_001018074chr532404 1329 514 ------
NM_001018075chr532404 1329 514 ------
NM_001018076chr532404 1329 514 ------
NM_001018077chr532404 1329 514 ------
NM_001018100chr152661 238 ------
NM_001018108chr1521933 330 ------
NM_001018676chr81447 ------
NM_001018677chr81447 ------
NM_001020658chr13535 304 226 11478 ----
NM_001020658chr13535 304 226 11478 ----
NM_001020818chr1941403 1316 432 356 --11491 1658
NM_001020819chr1941403 1316 432 356 --11491 1658
NM_001020820chr1941403 1316 432 356 --11491 1658
NM_001020821chr1941403 1316 432 356 --11491 1658
NM_001022chr19129 ------
NM_001023567chr1532305 719 496 22079 848 11597 --
NM_001023587chr341088 902 96 58 ------
NM_001024094chr532404 1329 514 ------
NM_001024226chr141161 1088 266 91 ------
NM_001024227chr141161 1088 266 91 ------
NM_001024228chr141161 1088 266 91 ------
NM_001024401chr1652690 2381 1873 858 711 22666 2261 42529 2345 1842 930 --
NM_001024455chrX32245 816 226 21983 69 1779 --
NM_001024463chr1531026 776 38 --1451 --
NM_001024649chr531861 876 863 --11973 --
NM_001024668chr126971 947 831 788 752 744 ------
NM_001024808chr1241026 830 388 218 1518 32392 857 267 --
NM_001024809chr1751042 1013 969 383 192 ------
NM_001024912chr192283 155 --1294 1688
NM_001024947chr53749 710 81 ------
NM_001024948chr182944 2919 2838 2285 2278 2166 1035 384 12199 ----
NM_001024956chr1145781 5193 3759 932 34722 2267 914 24231 143 --
NM_001025068chr341729 1589 363 296 ------
NM_001025069chr341729 1589 363 296 ------
NM_001025070chr5138 ------
NM_001025071chr5138 ------
NM_001025076chr1085598 4687 4325 4206 4020 2430 487 256 22112 1484 25697 5252 14768
NM_001025077chr10116956 6045 5683 5564 5378 1845 1614 1358 911 882 239 12842 37055 6610 423 26126 102
NM_001025079chr343873 1478 851 93 13338 1375 --
NM_001025081chr1831555 217 50 ----1383
NM_001025090chr1831555 217 50 ----1383
NM_001025092chr1831555 217 50 ----1383
NM_001025101chr1831555 217 50 ----1383
NM_001025105chr551521 1305 1170 1138 358 11146 ----
NM_001025108chr263799 3333 2706 2554 890 66 1458 13159 --
NM_001025266chr344916 3250 1617 534 11385 14559 13789
NM_001025356chr1252276 1985 1959 985 732 22707 119 ----
NM_001025366chr621637 487 --198 --
NM_001025366chr621637 487 --198 --
NM_001025367chr621637 487 --198 --
NM_001025367chr621637 487 --198 --
NM_001025368chr621637 487 --198 --
NM_001025368chr621637 487 --198 --
NM_001025369chr621653 503 --1114 --
NM_001025369chr621653 503 --1114 --
NM_001025370chr621637 487 --198 --
NM_001025370chr621637 487 --198 --
NM_001025389chr1121045 417 1281 1147 --
NM_001025390chr1121045 417 1281 1147 --
NM_001025579chr1731041 457 73 ------
NM_001025580chrX2776 736 23389 1678 ----
NM_001025595chr421243 583 ----1629
NM_001025603chr12463 164 21074 511 ----
NM_001025616chr421844 1523 1196 21542 711 --
NM_001025777chr231167 409 88 --21020 341 --
NM_001025780chr931476 1195 987 1302 ----
NM_001029851chr52292 44 ------
NM_001029852chr52292 44 ------
NM_001029853chr52292 44 ------
NM_001029854chr52292 44 ------
NM_001029858chr643324 3270 1266 557 1375 1694 --
NM_001029863chr632855 2770 1254 ----12227
NM_001029875chr542648 2582 779 177 ------
NM_001029891chrX123 ------
NM_001029989chr153949 303 246 1308 ----
NM_001029998chr41921 1199 ----
NM_001030006chr1732037 1070 396 1476 1200 --
NM_001030007chr1683994 3735 3129 3056 595 193 148 122 ------
NM_001030055chr1444549 3331 1213 1034 ------
NM_001031677chr5----1372 --
NM_001031690chr732648 571 534 ----13040
NM_001031692chr71304 ------
NM_001031695chr2285444 4318 3891 3726 3597 3314 2013 1379 --35413 1457 1291 15002
NM_001031716chr2--1396 ----
NM_001031723chr41367 ------
NM_001031803chr171289 ------
NM_001031804chr1664177 3303 1384 1342 1178 1094 1279 ----
NM_001031812chr51925 11775 22289 584 --
NM_001032221chr951576 1426 357 134 125 --1688 --
NM_001032280chr651678 1589 172 121 108 21660 185 21106 142 --
NM_001032282chr821146 77 ------
NM_001032288chr2011084 1488 21602 234 --
NM_001032289chrX194 ----1621
NM_001032293chr17----1623 --
NM_001032296chr1372751 2532 2439 1159 565 487 164 22640 2484 1886 12819
NM_001032363chr152245 1523 546 400 237 2298 86 1563 --
NM_001032363chr152245 1523 546 400 237 2298 86 1563 --
NM_001032380chr1021302 217 ------
NM_001033044chr141477 1280 1192 620 11420 1273 --
NM_001033045chr264411 3550 3299 1457 963 591 11721 13009 --
NM_001033047chr422673 2538 2921 522 ----
NM_001033049chr212897 274 --11965 --
NM_001033056chr141477 1280 1192 620 11420 1273 --
NM_001033057chr341514 1444 1366 1310 1415 ----
NM_001033059chr651634 1269 705 696 105 1434 ----
NM_001033085chr21227 ------
NM_001033087chr2023204 2799 23150 2451 12769 --
NM_001033112chr53624 94 47 1823 --1114
NM_001033117chr324348 1183 13414 24464 670 11288
NM_001033507chr111656 ------
NM_001033551chr1783792 3335 2625 1602 1313 795 751 321 2783 611 33578 3548 1390 23969 3372
NM_001033554chr172203 99 ------
NM_001033557chr221077 47 1580 ----
NM_001033566chr171983 ------
NM_001033568chr171983 ------
NM_001033578chr831506 837 481 12323 ----
NM_001033602chr134633 341 276 159 1980 ----
NM_001033756chr631571 724 421 --132 --
NM_001033756chr631571 724 421 --132 --
NM_001033925chr101356 12193 ----
NM_001034837chr52733 584 1189 2686 271 --
NM_001034838chr52733 584 1189 2686 271 --
NM_001034841chr1674754 4446 4091 3364 1888 729 546 1126 13527 --
NM_001034845chr42385 275 ------
NM_001034850chr51241 1660 ----
NM_001034954chr1063199 2079 631 492 462 341 13128 1523 --
NM_001034955chr1063199 2079 631 492 462 341 13128 1523 --
NM_001034956chr1063199 2079 631 492 462 341 13128 1523 --
NM_001034957chr1063199 2079 631 492 462 341 13128 1523 --
NM_001035chr13845 417 393 2436 104 --1266
NM_001035003chr421334 1276 --1993 --
NM_001035004chr421334 1276 --1993 --
NM_001035005chr182640 487 ------
NM_001035254chr96981 822 533 525 312 215 --42484 768 668 162 --
NM_001035511chr122098 1747 --1312 --
NM_001035512chr122205 1854 --1419 --
NM_001035513chr122205 1854 --1419 --
NM_001035534chr951466 1346 1005 499 21 1335 2438 270 --
NM_001037174chr2--11950 ----
NM_001037317chr131807 318 26 ------
NM_001037324chr33571 565 219 --1492 --
NM_001037331chr18----1684 --
NM_001037332chr522576 2266 12368 21673 842 --
NM_001037333chr522576 2266 12368 21673 842 --
NM_001037334chr1862331 1711 860 358 321 201 ------
NM_001037339chr111763 ------
NM_001037340chr111763 ------
NM_001037341chr111763 ------
NM_001037341chr111763 ------
NM_001037582chr431077 582 277 --11106 --
NM_001037631chr2----21100 937 --
NM_001037637chr52147 69 ------
NM_001037738chr51205 ------
NM_001037954chr1193477 3366 3277 3234 2907 2721 643 590 477 ----11284
NM_001038702chr511713 42032 1040 510 97 1284 --
NM_001039111chr31164 ------
NM_001039348chr21418 --11052 --
NM_001039349chr21418 --11052 --
NM_001039350chr711325 11376 1638 --
NM_001039459chr72738 360 --1212 1270
NM_001039479chr1461949 1753 567 532 465 361 1581 11652 --
NM_001039547chr3137617 6997 6688 6186 5721 3043 2687 2324 2294 1900 1066 942 136 --1611 --
NM_001039570chr22114578 4120 3895 3244 3059 3028 1594 1002 795 557 51 24406 167 --13807
NM_001039571chr22114578 4120 3895 3244 3059 3028 1594 1002 795 557 51 24406 167 --13807
NM_001039574chr1--21014 409 ----
NM_001039577chr184172 3511 3117 3096 1786 925 248 217 ----14163
NM_001039590chrX43596 3542 574 351 --2595 136 --
NM_001039591chrX43596 3542 574 351 --2595 136 --
NM_001039690chr1622324 1614 12054 11970 159
NM_001039693chr21553 22633 425 ----
NM_001039711chr1161 ------
NM_001039712chr1161 ------
NM_001039762chr1062337 2074 1696 943 735 672 ------
NM_001039771chr143916 874 829 ------
NM_001039772chr111179 125 --182
NM_001039840chrX44146 1469 566 318 33709 701 635 16016 --
NM_001039935chr51305 ------
NM_001039937chr1343971 3151 1662 1648 --21226 691 --
NM_001040001chr641910 1434 768 459 1194 1216 --
NM_001040002chr1741233 1153 291 140 21383 314 ----
NM_001040057chr731295 239 152 11151 ----
NM_001040092chr81150 ------
NM_001040100chr321005 30 1415 ----
NM_001040101chr42487 158 21117 476 1200 --
NM_001040110chr721865 571 --1224 --
NM_001040113chr162941 909 ------
NM_001040142chr211871 1374 1238 --
NM_001040143chr211871 1374 1238 --
NM_001040144chr1622324 1614 12054 11970 159
NM_001040146chr1622324 1614 12054 11970 159
NM_001040151chr1174417 4051 3865 1285 1072 952 402 14489 23021 2964 13527
NM_001040152chr765117 4578 3557 1711 813 431 34925 1505 1405 35042 673 444 --
NM_001040153chr136755 651 395 257 191 124 --1970 --
NM_001040157chr472700 2666 2538 275 189 96 88 ------
NM_001040158chr51219 ------
NM_001040181chr3--2812 29 ----
NM_001040182chr3--2812 29 ----
NM_001040183chr3--2812 29 ----
NM_001040199chr3--2812 29 ----
NM_001040200chr3--2812 29 ----
NM_001040202chr421706 172 ----12068
NM_001040214chr621968 336 ----1638
NM_001040272chr941957 813 797 641 ------
NM_001040284chr1675691 4343 2321 2069 1267 98 23 24326 2022 15413 --
NM_001040402chr492695 2645 2602 2350 2324 1063 244 105 32 12889 --1453
NM_001040424chr2152216 917 865 829 101 --12327 --
NM_001040429chr1332892 2217 372 --1165 --
NM_001040436chr121613 ------
NM_001040439chr1671333 1294 1255 1170 1117 512 391 --11300 --
NM_001040441chr195250 4695 4256 3791 3545 3327 2093 1873 1019 ------
NM_001040445chr2105234 4143 4097 3586 2191 1547 1326 1016 940 727 1133 14983 1768
NM_001040450chr1552888 2338 2252 921 247 12332 ----
NM_001040453chr1552888 2338 2252 921 247 12332 ----
NM_001040619chr121518 442 ------
NM_001040633chr74987 881 748 256 ------
NM_001040665chr744352 2005 1853 1286 44229 1786 759 25 24694 4591 --
NM_001040697chr111115 ------
NM_001040708chr8--1931 ----
NM_001040712chr963087 2545 2492 2443 526 440 22682 348 13031 --
NM_001040876chr43555 542 408 11660 ----
NM_001042355chr1675190 5024 4858 4510 4412 924 514 33366 1469 729 24568 90 --
NM_001042357chr102578 76 ------
NM_001042358chr102578 76 ------
NM_001042360chr102578 76 ------
NM_001042363chr102578 76 ------
NM_001042368chr94664 645 343 139 --1198 --
NM_001042388chr182346 126 ------
NM_001042389chr102578 76 ------
NM_001042390chr102578 76 ------
NM_001042392chr102578 76 ------
NM_001042395chr102578 76 ------
NM_001042404chr111748 ------
NM_001042406chr62836 359 11012 ----
NM_001042410chr21170 ------
NM_001042412chr1675190 5024 4858 4510 4412 924 514 33366 1469 729 24568 90 --
NM_001042413chr953987 3262 2610 235 80 --1926 --
NM_001042424chr421020 181 22898 490 ----
NM_001042425chr651678 1589 172 121 108 21660 185 21106 142 --
NM_001042430chr141487 189 --1411
NM_001042479chrX31536 513 305 --11400 11566
NM_001042480chrX31536 513 305 --11400 11566
NM_001042481chr1442499 2325 2161 487 --11774 --
NM_001042486chr201311 ------
NM_001042492chr1743375 3285 1200 184 1329 ----
NM_001042494chr1573556 3176 3057 2802 2454 2441 401 --23032 529 --
NM_001042495chr1573556 3176 3057 2802 2454 2441 401 --23032 529 --
NM_001042496chr1573556 3176 3057 2802 2454 2441 401 --23032 529 --
NM_001042497chr1573556 3176 3057 2802 2454 2441 401 --23032 529 --
NM_001042498chrX1231 ----1758
NM_001042506chrX51214 1141 1009 333 278 ------
NM_001042510chr831365 542 46 1641 ----
NM_001042511chr831365 542 46 1641 ----
NM_001042537chrX32155 626 465 ------
NM_001042555chr1264567 4272 4086 1889 1249 373 ----13904
NM_001042599chr267766 7156 6648 5677 1596 288 16298 15504 --
NM_001042601chr33650 372 124 ------
NM_001042603chr1254603 1850 1820 467 254 --11676 14854
NM_001042604chr364435 3270 1626 1394 1008 661 23168 593 ----
NM_001042616chr41210 ------
NM_001042632chr2041739 682 259 151 2111 25 22529 164 --
NM_001042633chr2041739 682 259 151 2111 25 22529 164 --
NM_001042646chr321737 1464 11538 1571 21864 253
NM_001042669chr421844 1523 1196 21542 711 --
NM_001042681chr132481 934 349 ------
NM_001042682chr132481 934 349 ------
NM_001042682chr132481 934 349 ------
NM_001042692chr22568 25 ------
NM_001042749chrX41670 1654 1631 772 1663 ----
NM_001042750chrX41670 1654 1631 772 1663 ----
NM_001042751chrX41670 1654 1631 772 1663 ----
NM_001043318chr1473933 3512 3388 3026 2679 779 394 11312 13915 --
NM_001043351chr142234 1469 723 164 ------
NM_001044305chr651349 1068 502 456 241 ------
NM_001044385chr232538 1272 1189 32923 2521 1427 ----
NM_001044722chr51925 11775 22289 584 --
NM_001044723chr51925 11775 22289 584 --
NM_001045556chr841588 685 332 56 ------
NM_001045557chr841588 685 332 56 ------
NM_001046chr553018 2439 2158 1953 832 11167 1455 --
NM_001066chr152156 1951 1352 854 460 1211 ----
NM_001068chr32235 204 ------
NM_001071775chr132243 91 ------
NM_001076778chr332157 1602 661 31686 1560 1547 128 --
NM_001077628chr11259 --1122 --
NM_001080418chr1176 ------
NM_001092chr1792287 2232 1808 1681 1631 828 663 598 181 22376 414 1611 --
NM_001095chr124501 272 252 69 1346 11294 --
NM_001096chr172607 21 2827 290 ----
NM_001099678chr3116432 5919 4977 3894 2348 2200 2100 1793 1681 498 409 25783 378 ----
NM_001100108chr1148315 8102 8093 7707 7497 7121 7000 6503 6288 5653 2831 2014 1527 518 38266 7903 2955 36919 3342 2960 45835 2717 2615 1695
NM_001106chr377408 7245 6643 2594 2186 2133 1163 28392 6592 --28176 6765
NM_001107chr141166 ------
NM_001113490chrX33071 2766 1282 23334 955 --11183
NM_001117chr1821943 963 22087 1929 ----
NM_001121chr10143 1325 ----
NM_001122679chr531031 162 95 ------
NM_001126chr11342 1208 ----
NM_001128chr1683994 3735 3129 3056 595 193 148 122 ------
NM_001144chr165946 450 260 213 25 --1109 --
NM_001146chr831551 266 240 21470 56 ----
NM_001148chr451719 801 708 286 178 --2763 602 --
NM_001149chr103888 504 113 3949 439 40 1551 --
NM_001153chr23882 142 123 ----173
NM_001167chrX95539 5418 4896 4461 4260 2199 2159 1926 1835 --35892 2249 1315 --
NM_001172chr14199 --1739 --
NM_001173chr1444549 3331 1213 1034 ------
NM_001186chr2122797 2479 ------
NM_001187chr212535 30 ----1409
NM_001191chr201401 11077 --177
NM_001197chr22----2142 49 --
NM_001198chr621883 947 1591 ----
NM_001201chr453745 3265 2879 1511 421 33309 3038 162 --194
NM_001202chr141107 ------
NM_001204chr232909 1204 84 12635 ----
NM_001206chr922996 2080 --22134 122 --
NM_001207chr52147 69 ------
NM_001220chr7153 ------
NM_001232chr121138 234 1244 ----
NM_001233chr751914 1902 1516 757 74 ------
NM_001241chr22813 74 1204 1209 --
NM_001241chr22813 74 1204 1209 --
NM_001253chr62291 39 ------
NM_001256chr171739 1511 ----
NM_001259chr732272 1074 375 2317 288 36243 4994 1094 --
NM_001260chr13129 ------
NM_001265chr13----1283 --
NM_001270chr52199 70 --1282 --
NM_001271chr1563242 2725 2544 2038 743 656 13010 23171 691 --
NM_001277chr112398 84 ------
NM_001282chr1732037 1070 396 1476 1200 --
NM_001286chr162794 2763 2587 2001 727 30 12144 12729 --
NM_001290chr4------127
NM_001304chr1753706 1246 1229 864 70 ----11273
NM_001305chr71811 ------
NM_001310chr1262250 1145 1105 417 323 102 1232 ----
NM_001315chr622032 37 ------
NM_001321chr121161 ------
NM_001331chr1182492 1828 1813 1052 708 270 143 114 1107 ----
NM_001343chr5----1144 --
NM_001344chr141173 ------
NM_001351chr311828 ------
NM_001356chrX52437 2392 2218 718 217 ------
NM_001362chr1421040 202 ------
NM_001364chr1174559 3033 1717 1580 1437 655 200 1367 13604 --
NM_001365chr172754 70 ------
NM_001382chr11181 ------
NM_001383chr17--1817 1608 --
NM_001386chr83960 394 384 --12359 --
NM_001387chr532969 2793 2588 --12149 --
NM_001389chr21--1105 ----
NM_001390chr1863414 2909 2518 2499 1149 529 --13305 12452
NM_001391chr182405 42 ------
NM_001396chr2122264 361 12157 11749 --
NM_001397chr151683 576 363 312 78 --2911 703 12512
NM_001400chr111237 194 ----
NM_001401chr951495 1374 1257 1073 471 21083 71 ----
NM_001406chr1711447 21696 1205 1177 --
NM_001407chr31637 ------
NM_001408chr121324 217 --1594 --
NM_001412chrX33750 2612 278 12789 12898 --
NM_001416chr171520 ------
NM_001417chr12--2512 201 ----
NM_001418chr112471 74 1302 ----
NM_001418chr112471 74 1302 ----
NM_001419chr1954908 3183 1099 785 323 --24407 1913 --
NM_001423chr1241422 1360 408 361 2310 169 1290 --
NM_001426chr22759 490 ------
NM_001427chr721779 1638 --11600 --
NM_001429chr2211061 1737 ----
NM_001438chr183693 3379 2764 1390 1283 946 794 641 33242 1366 1348 ----
NM_001448chrX21425 697 ------
NM_001451chr1631244 171 72 ------
NM_001453chr621316 583 ------
NM_001454chr172253 56 1157 1211 --
NM_001458chr71655 --1597 --
NM_001463chr2157 1605 ----
NM_001482chr151813 ------
NM_001494chr101757 ------
NM_001497chr962263 1930 1856 1735 529 520 12607 11784 --
NM_001498chr631129 973 290 ------
NM_001527chr684772 4750 4127 3794 3182 2972 1715 778 ------
NM_001530chr143917 236 107 ------
NM_001542chr152640 2584 2537 772 164 ------
NM_001543chr5134403 4349 4204 4118 3527 3312 2936 1461 1422 1381 1001 323 308 34857 1589 854 21822 657 23799 381
NM_001546chr621428 247 ------
NM_001554chr11244 1163 ----
NM_001560chrX3756 101 29 ------
NM_001584chr1111044 148 ----
NM_001587chrX32138 2118 1848 21995 197 1538 --
NM_001616chr262600 1267 1082 681 167 69 23396 374 21129 173 --
NM_001620chr112278 100 ------
NM_001621chr732983 2213 534 2226 74 1704 12762
NM_001621chr732983 2213 534 2226 74 1704 12762
NM_001626chr1993482 3348 3103 1284 1269 684 432 392 371 ----137
NM_001634chr651634 1269 705 696 105 1434 ----
NM_001642chr1111052 175 21129 422 192
NM_001650chr1874089 3589 2690 1478 1389 1112 44 --22604 538 --
NM_001658chr141161 1088 266 91 ------
NM_001659chr1222354 646 154 32120 2072 564 --
NM_001663chr142839 513 187 ----
NM_001664chr31929 1642 1207 --
NM_001668chr162098 850 485 339 219 45 ------
NM_001677chr11315 21094 88 ----
NM_001679chr34762 634 196 180 1297 ----
NM_001681chr122677 566 ------
NM_001682chr1222378 542 --12597 --
NM_001683chr312584 11661 12213 148
NM_001686chr12124 ------
NM_001690chr352539 2482 882 694 346 ------
NM_001693chr8--1170 ----
NM_001695chr854067 2943 2774 2716 384 --11522 21643 497
NM_001699chr1951657 1520 699 486 443 ----151
NM_001701chr92541 165 21136 92 ----
NM_001703chr1124 ------
NM_001704chr61455 ------
NM_001706chr3------1198
NM_001709chr113511 455 333 --1940 --
NM_001726chr11118 ------
NM_001731chr12----1633 --
NM_001742chr721132 206 --11391 1367
NM_001743chr21463 2165 98 ----
NM_001744chr52388 167 ------
NM_001746chr531861 876 863 --11973 --
NM_001753chr741635 1379 472 367 1497 ----
NM_001754chr2164219 4124 3108 2703 1671 1560 14034 24130 2604 13020
NM_001755chr1652198 1539 559 93 73 1199 ----
NM_001759chr1295201 4837 3958 3948 3783 3243 1807 1697 729 ------
NM_001769chr121132 ------
NM_001773chr131543 1382 483 --1177 --
NM_001777chr343873 1478 851 93 13338 1375 --
NM_001788chr71649 1373 --1703
NM_001792chr181392 ------
NM_001794chr201271 --1192 --
NM_001797chr162604 539 ------
NM_001800chr19----198 --
NM_001802chr162115 37 ------
NM_001810chr202515 198 --1187 --
NM_001823chr142164 49 ------
NM_001826chr12150 129 ------
NM_001830chrX52904 1594 1515 727 244 22993 1625 ----
NM_001839chr11130 ------
NM_001845chr1311362 11336 2412 99 --
NM_001855chr91307 1564 ----
NM_001858chr684145 4076 3950 1636 1622 720 470 433 ------
NM_001859chr973805 3351 2650 1434 1358 1342 753 12838 13330 --
NM_001860chr93939 171 76 --21122 787 --
NM_001862chr2167 ------
NM_001874chr1264887 4463 3827 1632 231 66 --34755 1665 1068 --
NM_001892chr551521 1305 1170 1138 358 11146 ----
NM_001893chr171339 ------
NM_001894chr222866 44 1242 1223 1783
NM_001903chr52589 55 ------
NM_001904chr3--1723 ----
NM_001918chr199095 8674 6976 6408 2819 2597 2551 1864 146 16555 28253 5647 --
NM_001921chr43988 980 154 ----1357
NM_001923chr114605 491 116 54 1525 ----
NM_001927chr2----152 --
NM_001933chr141138 --1923 --
NM_001935chr2--1650 --175
NM_001936chr711325 11376 1638 --
NM_001938chr131844 713 175 ------
NM_001939chrX53817 3400 2699 2550 320 23809 941 ----
NM_001944chr1831944 663 82 --1378 --
NM_001945chr5--138 ----
NM_001949chr622123 2044 2828 553 --12737
NM_001951chr8------1431
NM_001957chr431969 1427 621 11827 ----
NM_001962chr5171 ------
NM_001964chr521170 221 ------
NM_001967chr3--1571 ----
NM_001969chr1433831 3493 714 ------
NM_001977chr41125 ------
NM_001978chr81999 ------
NM_001981chr112116 ----11560
NM_001991chr1752015 1639 1432 168 89 1690 269 43 12195
NM_001992chr532208 1935 697 22140 220 ----
NM_001993chr13447 43 24 ------
NM_001995chr42516 460 --1172 --
NM_001998chr32360 52 ------
NM_001999chr5--11009 ----
NM_002006chr484414 4031 2155 1717 1702 1498 1015 513 23612 1371 14785 --
NM_002009chr1531799 1038 175 ------
NM_002015chr1342868 2275 2206 1160 12183 ----
NM_002017chr1111200 11363 ----
NM_002024chrX21667 215 11515 ----
NM_002025chrX58916 3630 3003 2282 1896 29281 8933 ----
NM_002027chr81447 ------
NM_002028chr1421266 77 --1352 --
NM_002031chr61182 --1218 --
NM_002036chr1----142 --
NM_002040chr2112846 23084 2990 ----
NM_002045chr31296 ------
NM_002046chr12----159 --
NM_002051chr1041073 790 278 162 2775 433 11111 --
NM_002056chr21847 ------
NM_002061chr131941 1466 78 1720 ----
NM_002063chrX1897 11036 ----
NM_002065chr141477 1280 1192 620 11420 1273 --
NM_002069chr71552 ------
NM_002074chr141697 1280 1232 1138 ------
NM_002076chr1262673 2369 2354 1284 1188 265 2851 733 13256 --
NM_002077chr942102 686 366 93 --11780 --
NM_002078chr33196 97 82 ------
NM_002080chr163875 638 309 ------
NM_002083chr141124 --185 --
NM_002086chr1731872 1687 74 --1236 --
NM_002092chr474847 4598 3577 1521 1319 725 239 33187 1183 105 ----
NM_002094chr161285 ------
NM_002111chr483855 3592 2869 2809 1272 1167 985 897 43725 3612 2850 1507 23699 2524 --
NM_002114chr61349 ------
NM_002126chr1743146 2912 2794 757 1629 33503 810 713 --
NM_002128chr1321698 1033 1942 ----
NM_002130chr5----11634 1686
NM_002135chr12--1433 ----
NM_002137chr731760 1747 31 ------
NM_002139chrX1201 ------
NM_002140chr91360 1981 ----
NM_002141chr71561 1249 ----
NM_002156chr22279 176 ------
NM_002158chr222722 779 33663 3525 3411 ----
NM_002166chr21652 ------
NM_002181chr2132 ------
NM_002193chr2--11496 ----
NM_002199chr42650 395 --1281 --
NM_002202chr54875 698 336 175 --1416 --
NM_002204chr172910 405 --1441 --
NM_002205chr122916 194 --1867 --
NM_002210chr232517 2239 103 12564 ----
NM_002211chr1011031 186 ----
NM_002214chr785616 5355 5007 4925 2091 1594 1236 812 24528 738 ----
NM_002221chr142514 1068 1048 369 1401 22484 196 --
NM_002223chr1223105 644 --33730 1349 898 --
NM_002224chr61759 --2534 68 --
NM_002226chr143827 724 326 1183 1855 --
NM_002227chr12894 161 1393 ----
NM_002232chr111034 ------
NM_002233chr11----123 --
NM_002240chr211522 1610 ----
NM_002241chr183095 3062 1968 1128 921 600 542 337 --22240 182 12042
NM_002247chr103903 279 22 --12316 --
NM_002252chr21134 ------
NM_002254chr262390 893 459 330 260 21 12311 --11507
NM_002264chr354749 3231 3104 1996 1918 11407 ----
NM_002268chr331741 1295 411 ------
NM_002270chr585090 3623 2029 1939 1766 1479 1394 180 --15685 --
NM_002271chr132967 690 ------
NM_002272chr12128 ------
NM_002283chr125840 784 722 514 54 --1799 --
NM_002285chr263799 3333 2706 2554 890 66 1458 13159 --
NM_002290chr61957 ------
NM_002293chr131781 1751 122 32610 2311 1023 ----
NM_002296chr131413 698 387 147 1545 --
NM_002298chr1331607 1431 47 ------
NM_002310chr535036 1876 1249 31646 1171 51 ----
NM_002312chr132420 48 ------
NM_002313chr1095075 5021 4284 3929 1904 1844 824 430 336 ----15107
NM_002336chr1264535 3546 1350 892 741 26 ------
NM_002345chr121624 1254 ----
NM_002356chr6----12565 1460
NM_002359chr1783914 3317 1644 1569 1509 814 683 63 ------
NM_002360chr742631 2607 2006 340 --1474 --
NM_002373chr1531386 973 62 11180 1882 2554 280
NM_002375chr392324 2004 1996 1804 1561 716 688 393 91 --2618 402 --
NM_002376chr141542 1420 ----
NM_002381chr2--183 1940 --
NM_002382chr1451277 1070 442 194 33 ------
NM_002385chr1831555 217 50 ----1383
NM_002390chr1731973 687 62 1290 31716 1607 255 --
NM_002397chr532112 265 154 ----12030
NM_002398chr211426 ------
NM_002401chr175975 592 517 315 23 1678 11733 --
NM_002419chr115459 374 144 91 34 ------
NM_002427chr1111176 ------
NM_002429chr1221426 516 --11151 --
NM_002430chr2232343 946 528 --1483 --
NM_002442chr122170 130 --11339 11269
NM_002444chrX21876 1794 --1387 --
NM_002460chr663134 569 441 264 197 119 23620 424 --11182
NM_002467chr81143 ------
NM_002473chr221100 --11038 --
NM_002480chr1221413 1209 21217 102 ----
NM_002481chr147750 3153 2289 47 --25945 849 --
NM_002499chr1582298 2064 1881 1875 704 633 579 480 12101 22353 1519 --
NM_002500chr25907 150 93 58 42 ------
NM_002501chr1984086 3986 3406 2955 1668 1011 490 348 --11090 --
NM_002504chr95848 778 415 266 117 ------
NM_002507chr1741630 1211 434 233 ----1297
NM_002508chr131266 594 150 ------
NM_002515chr1431288 803 533 11254 22018 422 --
NM_002519chr1121408 329 ------
NM_002536chrX21505 248 11312 2429 168 --
NM_002537chr152914 320 --1301 2747 365
NM_002539chr2--180 ----
NM_002541chr741033 940 178 51 --3197 90 30 --
NM_002544chr17------1329
NM_002545chr1194730 4722 4158 3444 1873 1667 1298 1020 65 14326 ----
NM_002546chr81247 2594 203 ----
NM_002552chr221273 135 ------
NM_002553chr72452 30 ------
NM_002568chr8194 ------
NM_002572chr111287 ------
NM_002577chr364021 3516 3098 2804 2774 2560 13738 22690 1238 --
NM_002581chr955647 5057 4644 4270 3978 32118 674 486 13717 --
NM_002582chr164901 400 195 78 ------
NM_002583chr12--1461 --1560
NM_002586chr6--21468 1245 11399 --
NM_002588chr52702 235 11441 11315 --
NM_002589chr4----1108 --
NM_002590chr131366 1355 ----
NM_002594chr2032056 588 477 ----1141
NM_002595chr1281791 1574 1520 1290 739 430 335 317 --1115 --
NM_002597chr11317 ------
NM_002600chr111763 ------
NM_002603chr8127 ------
NM_002606chr212188 77 ------
NM_002607chr7--21126 109 11064 --
NM_002608chr2271502 1268 1028 999 475 380 59 --11221 --
NM_002628chr32158 31 1806 ----
NM_002634chr173908 853 97 1235 ----
NM_002636chr61342 ------
NM_002641chrX11885 21852 1692 ----
NM_002645chr1182735 2152 2115 2082 1074 550 394 217 ------
NM_002646chr131851 1465 631 ------
NM_002648chr641145 958 259 167 ------
NM_002651chr1----1268 --
NM_002655chr855243 4836 4086 3226 1759 --13909 1223
NM_002656chr61701 --1350 --
NM_002657chr2052560 1325 832 657 383 --23171 473 --
NM_002660chr2041166 1123 738 328 21186 964 --1781
NM_002667chr61829 ----1328
NM_002669chr42163 137 ------
NM_002670chr331375 1255 487 ------
NM_002687chr1451168 1086 465 355 90 ------
NM_002697chr1--259 22 1231 --
NM_002698chr1932664 517 96 ----1649
NM_002703chr411844 ------
NM_002709chr253137 2594 1112 177 71 22704 1123 11020 --
NM_002710chr1231028 733 438 ------
NM_002711chr71822 ------
NM_002716chr1163656 2978 2943 1325 698 296 --23555 3352 --
NM_002717chr82487 178 ------
NM_002718chr332585 2162 81 12420 --1483
NM_002720chr16150 ------
NM_002729chr102795 207 --1148 --
NM_002731chr132966 2912 517 42840 1210 404 136 11145 --
NM_002733chr12----150 --
NM_002734chr1732168 233 64 ------
NM_002738chr16------2329 84
NM_002742chr143283 132 32 2640 85 ----
NM_002745chr2293569 1599 1412 1265 1171 1136 1008 700 263 24474 1186 24202 1329 --
NM_002748chr1521205 871 ------
NM_002752chr51153 ------
NM_002753chr4--2730 628 ----
NM_002755chr151170 --1320 1580
NM_002758chr171194 ------
NM_002760chrY115941 5781 5257 5047 4963 4487 4221 4097 3749 1825 391 ------
NM_002763chr11178 1432 ----
NM_002788chr14181 ------
NM_002821chr62808 126 ------
NM_002822chr122625 234 ------
NM_002830chr23139 57 39 1306 ----
NM_002833chr1511299 1183 ----
NM_002835chr72241 211 ------
NM_002836chr202403 35 ------
NM_002837chr1243807 827 451 41 --14358 --
NM_002839chr963087 2545 2492 2443 526 440 22682 348 13031 --
NM_002840chr151617 1568 1029 418 217 1539 1513 --
NM_002841chr33619 450 245 ------
NM_002843chr1122969 1324 ----12297
NM_002844chr6--21375 1143 ----
NM_002849chr121733 21086 427 ----
NM_002851chr71497 1812 ----
NM_002855chr1132485 1001 114 43544 3386 3265 2386 53403 3391 3343 864 809 --
NM_002858chr131006 493 286 1536 1925 --
NM_002859chr123696 574 228 --11226 --
NM_002868chr1252447 2229 1841 581 125 ------
NM_002869chr1142125 2075 1496 130 12228 141 --
NM_002871chr11249 11932 190 1684
NM_002874chr92934 798 22334 614 --11813
NM_002892chr1431204 386 100 2500 37 ----
NM_002893chrX1249 ------
NM_002901chr112407 368 131 ----
NM_002906chr11--11678 1233 --
NM_002911chr1951634 1432 1242 1078 119 --1496 1101
NM_002912chr61367 --1106 --
NM_002918chr19----185 --
NM_002922chr1--2444 230 ----
NM_002924chr1141 ------
NM_002931chr62219 207 ------
NM_002940chr43555 542 408 11660 ----
NM_002941chr31345 1455 1351 --
NM_002942chr32439 299 ------
NM_002953chr12314 224 1125 ----
NM_002955chr621532 701 11278 11499 --
NM_002956chr122251 154 ------
NM_002959chr174208 4168 1009 974 647 534 95 ------
NM_002971chr31195 ------
NM_002973chr12150 --1492 --
NM_002994chr431820 1733 450 1701 ----
NM_002997chr221814 336 --11290 --
NM_002998chr822114 797 11862 22168 1623 --
NM_002999chr2031921 1819 1496 ------
NM_003001chr122205 1854 --1419 --
NM_003010chr1772328 2287 2023 1914 1870 1852 1586 21712 807 1463 --
NM_003011chr931680 1358 415 ------
NM_003012chr831250 265 95 --1607 --
NM_003016chr17----11408 --
NM_003017chr62954 435 ------
NM_003022chrX2449 48 ------
NM_003026chr921317 254 --2419 59 --
NM_003027chr152446 277 ------
NM_003028chr973869 3828 3583 2384 716 132 83 12795 31421 1355 1287 --
NM_003029chr111037 ------
NM_003031chr161838 ------
NM_003032chr342550 2179 2051 2029 21682 314 22120 1843 --
NM_003034chr1257314 5988 2343 967 547 ------
NM_003035chr13379 293 106 ------
NM_003036chr11166 ------
NM_003038chr252670 2637 1647 983 614 1282 2425 84 --
NM_003042chr341693 865 427 369 1769 --11601
NM_003045chr1394963 4934 3600 3161 640 304 245 211 119 --13317 --
NM_003046chr885367 5354 4600 4203 4068 3783 812 366 15048 --14653
NM_003047chr141438 480 227 201 11428 ----
NM_003051chr121863 1458 --1774 --
NM_003054chr10179 ------
NM_003068chr821100 304 1347 ----
NM_003069chrX1612 2216 182 ----
NM_003070chr91609 ------
NM_003072chr191317 ------
NM_003074chr322073 923 --1671 --
NM_003081chr20--1381 ----
NM_003082chr1421300 308 186 ----
NM_003094chr12860 162 ------
NM_003099chr1566248 5894 4674 2190 1007 139 22577 1221 34927 54 39 --
NM_003100chr51294 ------
NM_003107chr632183 2018 1979 --12581 --
NM_003108chr2107082 6766 6187 5750 5658 5466 2798 2739 2145 602 --21516 1504 --
NM_003110chr1751006 944 431 127 87 --1373 --
NM_003111chr211217 ------
NM_003112chr722750 2048 ------
NM_003113chr22127 49 ------
NM_003114chr82681 655 1600 1575 --
NM_003128chr242733 950 917 857 1599 ----
NM_003131chr631865 1712 1584 --1515 --
NM_003133chr11702 2874 799 ----
NM_003136chr141332 ------
NM_003137chr64848 832 595 544 32137 2129 398 --1609
NM_003142chr21240 ------
NM_003144chr621504 166 ------
NM_003149chr341619 177 88 68 1197 ----
NM_003150chr1762282 1720 838 831 553 449 --12193 --
NM_003155chr831993 1919 667 --12027 --
NM_003156chr1131319 1010 134 ------
NM_003161chr1763512 2299 2225 887 386 327 1806 ----
NM_003164chr111480 3566 124 71 1139 --
NM_003165chr961675 1525 456 233 224 50 ------
NM_003173chrX41435 1189 1087 398 190 165 --
NM_003174chr103588 144 50 --1282 --
NM_003178chr3--22128 1497 --12023
NM_003182chr71409 ------
NM_003182chr71409 ------
NM_003184chr8--1399 ----
NM_003186chr11----1316 --
NM_003188chr62195 121 ------
NM_003189chr183327 2614 2530 2387 2229 1327 842 465 --1302 --
NM_003198chr11313 ------
NM_003199chr1885323 5083 4823 1377 1090 527 313 23 ------
NM_003200chr1992387 2012 1880 1811 1702 1628 794 700 583 ------
NM_003202chr561798 1389 463 392 73 52 --1122 1597
NM_003211chr1211394 ----1406
NM_003214chr631238 330 168 --11004 --
NM_003216chr2231129 362 30 --13287 --
NM_003220chr651678 1589 172 121 108 21660 185 21106 142 --
NM_003234chr331623 980 269 1815 ----
NM_003236chr233103 2902 992 22816 2464 22998 2597 177
NM_003239chr142416 53 --145 --
NM_003243chr111185 159 ----
NM_003244chr182376 43 ------
NM_003246chr1521829 1736 1748 1753 11767
NM_003247chr621602 282 11747 ----
NM_003248chr5125 ------
NM_003250chr171358 ------
NM_003255chr1742534 2474 860 822 ------
NM_003257chr152362 189 --1279 --
NM_003262chr344481 3632 2022 1050 24949 4855 ----
NM_003269chr62978 414 --1240 --
NM_003270chrX2988 391 ------
NM_003274chr2162886 2625 1986 993 422 278 12331 ----
NM_003284chr2--176 ----
NM_003286chr201309 ------
NM_003291chr132578 220 ------
NM_003292chr131783 1404 452 11795 ----
NM_003298chr321295 1146 25670 849 14649 --
NM_003305chr4--1422 ----
NM_003319chr21904 ------
NM_003320chr1164283 4115 3934 3676 3551 361 1938 33081 1265 1023 --
NM_003325chr22----1188 --
NM_003326chr16970 697 529 246 222 80 ------
NM_003334chrX----1150 --
NM_003337chr521577 1062 ------
NM_003338chr102606 80 ----1698
NM_003339chr521231 84 --21621 204 --
NM_003340chr431009 449 198 --1337 --
NM_003342chr1721006 64 13118 ----
NM_003345chr161173 --1138 --
NM_003347chr2272339 1940 1891 1884 784 498 457 --22209 236 --
NM_003348chr1231720 573 296 ----1180
NM_003349chr2011084 1488 21602 234 --
NM_003350chr8------1224
NM_003352chr21267 --1671 --
NM_003368chr11749 ------
NM_003371chr971904 1599 717 573 545 525 274 --1120 2800 173
NM_003373chr102787 75 21405 483 --1661
NM_003376chr621637 487 --198 --
NM_003376chr621637 487 --198 --
NM_003380chr101259 ------
NM_003383chr9--1482 ----
NM_003387chr2----1323 --
NM_003390chr113257 220 33 ------
NM_003392chr383880 3576 2917 1549 1478 1322 1273 971 ------
NM_003403chr141188 1726 ----
NM_003404chr2041914 1571 507 278 ------
NM_003405chr221174 ------
NM_003406chr841938 1637 339 313 ------
NM_003410chrX22729 2015 --12361 --
NM_003411chrY2722 683 1426 ----
NM_003412chr352896 2328 1128 1058 818 ------
NM_003413chrX21372 726 ------
NM_003427chr63620 567 143 ------
NM_003430chr191127 11384 ----
NM_003432chr5170 1176 ----
NM_003439chr743520 3459 2484 798 23253 2789 ----
NM_003442chr111112 ------
NM_003457chr17----1623 --
NM_003458chr343046 2979 203 46 33580 2595 1569 43235 1257 659 441 1757
NM_003459chr23739 709 67 ----129
NM_003462chr121758 565 21686 290 1316 11110
NM_003463chr643378 2663 2620 1164 ------
NM_003468chr253966 3482 3402 3127 218 33583 3318 3197 1507 13052
NM_003469chr22369 96 ------
NM_003470chr1691665 1634 1174 712 600 553 350 173 112 1260 ----
NM_003471chr361886 1761 919 493 239 161 ----1823
NM_003472chr631242 958 126 ------
NM_003473chr101401 ------
NM_003474chr1061823 1655 891 868 857 137 ----1804
NM_003477chr112631 532 ------
NM_003478chr1123309 563 1657 12947 --
NM_003482chr1242094 741 625 113 --1768 --
NM_003483chr1252259 452 375 237 64 2693 89 12894 --
NM_003485chr142410 88 21316 343 ----
NM_003486chr1682780 2488 2264 1908 468 434 104 21 12198 21995 1093 --
NM_003487chr171264 2238 53 ----
NM_003488chr17138 ------
NM_003489chr2143395 3214 2266 339 ------
NM_003498chr1662571 2418 697 205 199 79 1766 ----
NM_003513chr6----124 --
NM_003528chr131733 1506 450 ------
NM_003549chr31415 2259 42 122 --
NM_003557chr131383 1349 1118 11397 ----
NM_003558chr91547 ----1275
NM_003563chr1731385 217 52 160 ----
NM_003565chr1261659 1571 620 522 386 256 11430 1336 --
NM_003566chr1223337 3003 12675 ----
NM_003569chr62625 261 --2206 22 --
NM_003576chr1372751 2532 2439 1159 565 487 164 22640 2484 1886 12819
NM_003583chr1263501 2769 2379 1033 592 44 33623 2439 305 ----
NM_003586chr164537 477 455 94 ------
NM_003590chr233458 2739 2527 13269 --1766
NM_003591chr101419 ----140
NM_003592chr71166 ------
NM_003595chr222322 117 ----132
NM_003597chr212159 --182 --
NM_003607chr144173 3648 2667 741 --11693 12755
NM_003617chr153537 1836 1077 508 180 14067 21924 160 --
NM_003618chr22834 52 ------
NM_003622chr1252679 2313 1792 879 370 --12636 --
NM_003626chr11----11404 --
NM_003628chr2------1701
NM_003629chr183523 3397 3140 2807 2576 793 204 91 13134 ----
NM_003632chr172591 350 --1194 --
NM_003637chr1--1620 ----
NM_003642chr21227 ------
NM_003644chr17106441 6393 5621 4982 4370 1716 1080 940 554 517 15520 --1319
NM_003648chr252373 2231 1804 1740 722 --1341 --
NM_003654chr111521 ------
NM_003659chr21750 1292 ----
NM_003663chr332494 301 162 1392 ----
NM_003664chr5162 2524 224 ----
NM_003671chr973286 3105 2224 1359 1022 772 608 ------
NM_003672chr111220 ----11969
NM_003677chr1252293 507 466 300 277 2357 332 ----
NM_003692chr91408 ------
NM_003701chr13----11046 1850
NM_003709chr2----194 --
NM_003711chr5--157 ----
NM_003713chr14420 411 364 41 ------
NM_003714chr553081 2656 1193 919 641 --32446 703 662 --
NM_003716chr33898 873 698 2639 130 ----
NM_003718chr7------1470
NM_003719chr52292 44 ------
NM_003728chr42696 154 ------
NM_003732chr51295 --156 --
NM_003735chr52702 235 11441 11315 --
NM_003736chr52702 235 11441 11315 --
NM_003743chr232065 1845 1395 12257 ----
NM_003749chr1342318 1967 868 72 ------
NM_003750chr102721 629 ------
NM_003758chr1541120 651 525 503 1186 ----
NM_003758chr1541120 651 525 503 1186 ----
NM_003763chr2092940 2850 2465 2313 718 575 318 231 79 ----21110 1077
NM_003768chr121809 1630 --11481 11153
NM_003779chr1177 --1146 --
NM_003780chr12678 37 --1554 1268
NM_003783chr11800 ------
NM_003787chr1821472 93 ------
NM_003795chr61447 ------
NM_003796chr191171 1219 ----
NM_003797chr112188 167 ------
NM_003800chr622341 873 ------
NM_003812chr2135 ------
NM_003818chr201683 --1107 --
NM_003821chr82431 144 1608 ----
NM_003822chr133033 2892 98 --22757 2271 12424
NM_003825chr151179 --11550 1314
NM_003831chr1821352 1195 151 11792 --
NM_003860chr11----1334 --
NM_003866chr41735 1214 ----
NM_003870chr1532066 1432 700 --11662 --
NM_003872chr21221 2661 593 --12696
NM_003873chr1052112 1845 688 583 479 ------
NM_003877chr121976 ------
NM_003884chr31588 ------
NM_003885chr1731735 350 308 32455 1628 461 ----
NM_003887chr22410 200 --2901 124 --
NM_003899chr1352585 1916 1800 897 826 11685 22075 698 --
NM_003901chr1052571 2250 1984 883 558 22615 2266 11677 --
NM_003902chr13702 686 649 ------
NM_003908chr2041320 1184 1091 526 31303 1293 107 1180 --
NM_003913chr663561 3086 1213 968 667 200 1219 ----
NM_003914chr131195 ------
NM_003916chrX145 --21211 967 --
NM_003929chr131755 545 114 ------
NM_003932chr2231461 642 368 11816 ----
NM_003934chr91834 ------
NM_003936chr221061 831 --21180 995 --
NM_003941chr732266 619 496 ------
NM_003942chr112288 105 --2672 253 --
NM_003947chr321263 349 --11024 --
NM_003948chr421703 122 --12571 --
NM_003954chr1761448 1393 1083 1050 1002 66 --21202 31 --
NM_003956chr10138 ------
NM_003966chr5127586 6548 5482 5284 2441 2307 2273 1224 1162 651 488 65 37723 5772 145 27669 6517 --
NM_003971chr171190 ------
NM_003972chr101181 ------
NM_003980chr611223 11265 ----
NM_003988chr102658 52 --3823 612 62 --
NM_003994chr1243267 2923 512 22 33928 1536 1468 ----
NM_003998chr42562 52 ------
NM_004006chrX42653 2593 2553 2009 1641 1625 --
NM_004007chrX42653 2593 2553 2009 1641 1625 --
NM_004009chrX42653 2593 2553 2009 1641 1625 --
NM_004010chrX42653 2593 2553 2009 1641 1625 --
NM_004011chrX42653 2593 2553 2009 1641 1625 --
NM_004012chrX42653 2593 2553 2009 1641 1625 --
NM_004013chrX42653 2593 2553 2009 1641 1625 --
NM_004014chrX42653 2593 2553 2009 1641 1625 --
NM_004015chrX42653 2593 2553 2009 1641 1625 --
NM_004016chrX42567 2507 2467 1923 1555 1539 --
NM_004017chrX42653 2593 2553 2009 1641 1625 --
NM_004018chrX42567 2507 2467 1923 1555 1539 --
NM_004020chrX42653 2593 2553 2009 1641 1625 --
NM_004021chrX42567 2507 2467 1923 1555 1539 --
NM_004022chrX42567 2507 2467 1923 1555 1539 --
NM_004023chrX42567 2507 2467 1923 1555 1539 --
NM_004024chr121427 351 ------
NM_004028chr1874089 3589 2690 1478 1389 1112 44 --22604 538 --
NM_004035chr17105155 4946 4615 4379 4246 3833 3583 3494 1960 734 ------
NM_004036chr23695 655 290 ------
NM_004050chr1441765 1020 786 506 12426 ----
NM_004055chr1132128 1676 696 2347 246 --1255
NM_004067chr7--21483 990 ----
NM_004071chr2--1113 ----
NM_004074chr11269 27 ------
NM_004077chr1231301 1284 1073 11321 ----
NM_004080chr731414 1254 232 ------
NM_004081chrY21849 30 ------
NM_004085chrX2798 298 1644 ----
NM_004086chr143731 551 505 2813 619 2204 162 --
NM_004090chr1762677 2491 2189 1078 925 88 169 23015 477 --
NM_004093chr1373195 2993 2779 2640 772 497 246 --1766 --
NM_004097chr21332 ------
NM_004104chr172605 208 1714 1125 --
NM_004105chr21418 --11052 --
NM_004114chrX1406 1248 ----
NM_004116chr2----2305 117 --
NM_004117chr64887 881 372 169 12145 ----
NM_004124chr1432898 2167 92 22825 2679 --1841
NM_004133chr821959 246 12447 ----
NM_004161chr2170 ------
NM_004162chr32904 294 11247 ----
NM_004170chr9--11801 21848 67 --
NM_004171chr1198691 7796 6823 6604 6312 3053 2010 1001 755 --16136 --
NM_004183chr111303 --2625 554 --
NM_004187chrX31319 1256 1228 ------
NM_004197chr61155 1375 ----
NM_004200chr1133050 1193 758 ------
NM_004202chrY2125 46 ------
NM_004209chr166933 459 426 360 334 166 --1237 --
NM_004225chr831466 1324 416 ------
NM_004227chr731973 991 459 22643 926 ----
NM_004232chr1833269 1429 317 21248 97 --178
NM_004235chr92663 544 --168 132
NM_004236chr15186 1559 ----
NM_004255chr15140 ------
NM_004272chr51163 --2490 44 --
NM_004274chr1453135 3055 3042 2873 1992 --1122 --
NM_004277chr6------11408
NM_004282chr61618 ------
NM_004296chr1473540 2700 2518 727 677 607 106 13078 1551 1536
NM_004301chr32338 312 ------
NM_004311chr1052842 2111 1931 970 306 ------
NM_004316chr1221093 1031 ------
NM_004319chr143092 2950 2297 391 22849 27 21204 1124 12167
NM_004323chr962276 1980 1776 896 219 27 ------
NM_004326chr1--1300 ----
NM_004327chr222421 400 ------
NM_004329chr1031431 479 322 21304 562 ----
NM_004330chr15----1165 1915
NM_004336chr2136 ------
NM_004337chr8--11640 --2216 196
NM_004342chr741929 498 334 198 --12019 --
NM_004344chrX125 ------
NM_004360chr1631903 746 536 ------
NM_004370chr621946 1812 --12161 --
NM_004379chr251754 1200 1193 365 119 1460 ----
NM_004380chr162832 301 12170 12175 --
NM_004383chr151543 ----1600
NM_004384chr51925 11775 22289 584 --
NM_004385chr51567 1506 ----
NM_004386chr1932272 588 486 1861 ----
NM_004392chr1332680 2026 255 ------
NM_004393chr321796 1746 --192 12130
NM_004397chr1163458 1710 820 718 241 209 11244 11251 --
NM_004404chr241967 1642 1352 205 --11858 11900
NM_004405chr23716 438 53 --192 --
NM_004414chr2121486 259 ------
NM_004418chr2132 ------
NM_004420chr1152353 888 864 332 201 --52236 2126 2016 590 313 --
NM_004426chr1231863 659 295 --148 --
NM_004427chr11803 1949 ----
NM_004429chrX41287 1125 366 347 11195 11272 --
NM_004430chr842703 2214 760 460 ------
NM_004432chr94449 325 251 240 12078 1879 --
NM_004434chr1441321 543 357 70 ------
NM_004436chr11574 ------
NM_004438chr262672 2237 1324 1291 1276 189 22213 319 42801 1178 1087 290 --
NM_004440chr621816 1598 ------
NM_004442chr131502 629 85 ----11193
NM_004447chr122423 329 ------
NM_004454chr361641 1604 1542 1479 919 879 ------
NM_004456chr72166 39 ------
NM_004458chrX1768 ----11920
NM_004459chr1731827 1365 430 ------
NM_004464chr463504 3006 1303 1017 579 112 ------
NM_004469chrX2448 70 ------
NM_004472chr52587 132 1154 ----
NM_004475chr17----41185 1177 856 456 1213
NM_004480chr14------1303
NM_004481chr172577 2338 1803 1761 1720 794 193 --11036 --
NM_004482chr2169 ------
NM_004491chr1943439 1590 993 196 23886 174 43700 3354 1674 1353 --
NM_004492chr15146 ------
NM_004496chr142838 531 ----11065
NM_004499chr51101 ------
NM_004500chr1441913 295 158 114 ------
NM_004501chr163940 3909 3568 3102 2819 467 22612 2581 --21470 1457
NM_004504chr252974 2498 2403 441 70 1782 ----
NM_004524chr171261 ------
NM_004527chr1741233 1153 291 140 21383 314 ----
NM_004530chr163478 378 297 1309 2471 39 --
NM_004538chrX1533 1335 ----
NM_004543chr2297 76 ------
NM_004554chr143460 339 189 --21610 140 11784
NM_004567chr332024 494 391 11928 138 --
NM_004571chr2132490 2367 2107 1432 22798 2544 1316
NM_004575chr41534 --11316 --
NM_004576chr51277 ------
NM_004578chr11628 --1900 --
NM_004580chr1521209 723 1335 11620 11216
NM_004583chr171272 --2596 23 --
NM_004586chrX73402 2020 1725 1393 1236 494 425 25256 4905 34240 2150 102 --
NM_004593chr31259 ------
NM_004596chr191166 ------
NM_004598chr53502 475 145 ------
NM_004602chr2041267 265 245 63 11393 1555 --
NM_004607chr5------177
NM_004612chr943509 1621 1380 1373 13263 ----
NM_004622chr222020 105 --12244 21644 563
NM_004630chr1131162 1094 918 ------
NM_004631chr121444 275 ------
NM_004634chr3--1658 164 --
NM_004635chr341108 779 450 233 1241 11201 --
NM_004637chr331184 955 879 1121 ----
NM_004640chr6179 ------
NM_004642chr121211 ------
NM_004650chrX11762 --21309 516 --
NM_004654chrY31050 370 99 ------
NM_004655chr172263 55 1282 ----
NM_004660chrY22308 2260 ------
NM_004663chr1531430 450 282 ------
NM_004664chr121229 ------
NM_004670chr1041646 1545 1158 267 ------
NM_004671chr18143 ------
NM_004673chr11182 11057 11178 --
NM_004687chr1741924 1831 775 534 21793 1465 ----
NM_004694chr17128 ------
NM_004703chr17--12583 12004 --
NM_004705chr112753 297 ------
NM_004711chr22103388 3300 3027 2753 2316 1294 1132 633 171 80 1717 32266 1389 990 --
NM_004717chr7----1341 11250
NM_004719chr1262796 2748 2439 1012 541 170 ------
NM_004721chr31311 ------
NM_004725chr1031209 438 297 ------
NM_004726chrX115673 4865 4308 4263 3671 2134 1903 1779 1689 1221 774 --13814 15315
NM_004729chrX42091 1533 1443 400 1531 1110 12027
NM_004730chr561638 1616 1461 687 645 362 ------
NM_004734chr1382497 2436 2299 2151 1078 1066 983 521 22272 708 ----
NM_004736chr141711 818 331 165 ------
NM_004737chr2231096 296 140 ------
NM_004742chr341841 1793 1613 1184 ------
NM_004744chr443157 2562 722 108 21342 1186 ----
NM_004748chr1553768 3083 1465 1389 731 11501 1984 --
NM_004755chr145995 975 817 799 31 ------
NM_004758chr172773 330 --1268 --
NM_004760chr721605 541 12172 ----
NM_004766chr31189 ------
NM_004768chr111007 --1367 --
NM_004772chr561623 1501 1343 1261 353 216 1531 ----
NM_004774chr1742315 2285 1161 1112 12643 ----
NM_004775chr1812433 1519 ----
NM_004776chr2042612 2171 1011 265 --12684 12761
NM_004781chr131756 407 25 1297 ----
NM_004781chr131756 407 25 1297 ----
NM_004788chr1152606 2566 2511 1839 144 ------
NM_004789chr9--1303 ----
NM_004792chr2--1190 ----
NM_004796chr1432376 1636 96 1687 ----
NM_004800chr13175 ------
NM_004801chr221474 452 2961 440 ----
NM_004805chr251349 1086 1079 922 277 --2559 65 --
NM_004807chr252451 2147 940 496 454 2803 82 2988 742 --
NM_004808chr1063386 3147 2402 2148 954 691 31361 1238 69 13261 13213
NM_004814chr11111 ------
NM_004817chr94821 631 577 243 ------
NM_004824chr61275 ------
NM_004826chr21320 --132 --
NM_004830chr62884 87 ------
NM_004834chr211108 --1846 --
NM_004835chr31827 ----1573
NM_004835chr31827 ----1573
NM_004839chr152569 87 ------
NM_004840chrX72342 1620 803 627 574 408 345 --1379 --
NM_004841chr13870 338 251 ------
NM_004842chr63432 157 124 1340 11551 --
NM_004844chr341021 979 799 114 ------
NM_004850chr231750 1374 499 ------
NM_004857chr1443993 1553 876 535 11881 ----
NM_004859chr1733076 2536 275 22651 473 23026 1950 --
NM_004860chr173563 409 44 ------
NM_004862chr1611078 --1291 --
NM_004863chr1494900 4024 3895 1758 1325 939 576 375 176 13804 1114 24979 1999
NM_004866chr574905 4342 3376 3352 1555 646 22 13937 ----
NM_004867chrX2191 156 ------
NM_004871chr1793349 2741 1701 1129 605 527 508 383 86 2513 399 12716 --
NM_004872chr11293 1323 ----
NM_004874chr81425 ------
NM_004884chr152581 127 175 --21193 395
NM_004886chr19126 ------
NM_004887chr531112 1070 398 --11044 1777
NM_004891chr21192 ------
NM_004893chr51219 ------
NM_004898chr442722 2645 2289 158 1276 1921 1396
NM_004899chr21115 ------
NM_004902chr201195 1105 ----
NM_004904chr7106580 6227 6062 2587 1610 1404 1367 1290 764 691 15540 ----
NM_004906chr6155 1446 ----
NM_004921chr151861 1607 524 332 112 ------
NM_004922chr101267 --1787 --
NM_004925chr9158 --2195 32 --
NM_004926chr1421141 396 11191 ----
NM_004929chr841300 567 418 37 ----11515
NM_004938chr92502 202 ----1829
NM_004939chr2172 ------
NM_004945chr193851 797 182 1567 ----
NM_004947chr342605 1015 347 147 ----1641
NM_004948chr181444 11429 ----
NM_004949chr181710 12018 ----
NM_004955chr62535 24 ------
NM_004956chr711059 13838 ----
NM_004958chr11683 1789 ----
NM_004961chrX51387 1011 396 371 162 --1962 11246
NM_004962chr104482 262 169 43 ------
NM_004966chr101877 ------
NM_004967chr42431 383 ------
NM_004968chr7----2628 514 --
NM_004973chr661662 699 268 229 216 195 11463 ----
NM_004976chr11105084 4757 3992 3666 3330 1987 1716 758 549 51 13980 24741 3970 --
NM_004978chr121161 228 21677 1072 21177 187 --
NM_004979chrX----11134 --
NM_004981chr221324 --127 --
NM_004985chr1273585 3531 3118 1363 1182 865 531 --14165 1562
NM_004991chr3145 --1336 --
NM_004992chrX78015 7767 7415 6949 6369 3187 2280 43029 2190 2180 1386 26825 1895 18126
NM_004992chrX78015 7767 7415 6949 6369 3187 2280 43029 2190 2180 1386 26825 1895 18126
NM_004998chr151824 --1914 --
NM_004999chr654071 3701 3685 1510 1235 14423 11367 13546
NM_005011chr721865 571 --1224 --
NM_005012chr11138 ------
NM_005017chr31262 ------
NM_005020chr7--3425 411 33 ----
NM_005023chr521441 1347 --1413 --
NM_005026chr13390 351 123 ----11537
NM_005028chr1031785 1673 817 ----11840
NM_005030chr161263 ------
NM_005032chrX2289 271 ------
NM_005045chr71161 1784 ----
NM_005057chr141918 1911 662 59 11820 11538 --
NM_005063chr1073370 2557 2416 1504 1100 628 275 --11207 13712
NM_005065chr1445088 4228 1507 1199 --34372 1849 1169 11001
NM_005067chr31763 1379 ----
NM_005069chr2131695 1338 1211 --1514 --
NM_005076chr163497 2730 1142 929 268 91 33758 3636 74 11417 1766
NM_005094chr93596 446 126 1145 1159 --
NM_005095chr1----1619 1549
NM_005096chrX41149 809 411 113 11134 11001 --
NM_005097chr10--3329 123 23 ----
NM_005099chr13846 238 79 ------
NM_005105chr142001 1799 1664 337 12116 1381 --
NM_005109chr332554 2185 625 185 ----
NM_005116chr2054156 3897 1821 779 231 ----11743
NM_005117chr111226 --2277 30 --
NM_005121chr1763736 3199 2778 765 525 57 12510 ----
NM_005134chr182346 126 ------
NM_005135chr1573556 3176 3057 2802 2454 2441 401 --23032 529 --
NM_005137chr2292185 1619 1589 1007 928 878 827 745 665 1423 2236 111 12201
NM_005151chr1862331 1711 860 358 321 201 ------
NM_005153chr163574 560 309 1637 ----
NM_005156chr944790 4668 1184 609 23830 3736 ----
NM_005168chr231702 1186 452 ------
NM_005171chr1211272 21215 1026 ----
NM_005180chr101486 ------
NM_005183chrX123 ------
NM_005187chr1631662 157 108 --21286 149 --
NM_005188chr11137208 6989 6577 6252 6075 5629 3254 2863 2680 2182 2053 1298 831 12512 16632 --
NM_005194chr20--1395 ----
NM_005197chr14115372 5344 4633 4611 4426 4210 2351 1677 1146 912 300 36114 5934 5652 ----
NM_005201chr32896 458 1308 ----
NM_005202chr12732 23 --21491 632 --
NM_005206chr1721426 278 1192 1474 --
NM_005207chr2283570 3450 3044 604 371 300 164 96 42821 2560 1381 408 33214 2715 102 --
NM_005208chr17192 ------
NM_005214chr2----21063 900 --
NM_005215chr182292 244 ------
NM_005216chr11500 ------
NM_005219chr551266 471 271 174 48 11509 ----
NM_005222chr71671 ------
NM_005225chr202823 319 --1960 --
NM_005229chrX11216 ----1815
NM_005230chr121564 ------
NM_005233chr31500 ------
NM_005235chr267766 7156 6648 5677 1596 288 16298 15504 --
NM_005241chr3179 ------
NM_005245chr4--1176 ----
NM_005249chr142645 254 --1605 --
NM_005254chr1521439 285 ------
NM_005256chr111859 ------
NM_005257chr182878 538 ------
NM_005259chr2--11255 ----
NM_005266chr131776 1531 725 11261 1102 194
NM_005269chr121174 ------
NM_005271chr101386 1788 --1969
NM_005277chr411757 ------
NM_005278chrX1347 ------
NM_005281chr11773 ------
NM_005284chr61340 1378 ----
NM_005295chr7--176 ----
NM_005296chrX--2430 208 ----
NM_005308chr102429 353 195 ----
NM_005311chr751885 1870 1108 796 648 --1964 --
NM_005313chr154425 377 327 171 ------
NM_005316chr1161001 978 810 779 327 309 ------
NM_005324chr1741750 1556 394 180 ------
NM_005328chr8----1107 --
NM_005329chr1662354 2051 1802 756 641 238 ------
NM_005339chr423824 3659 24038 800 13580 --
NM_005342chrX62500 1894 1790 1739 732 511 1600 12608 --
NM_005346chr6------1249
NM_005347chr931395 1319 151 1128 11511 --
NM_005358chr1321819 26 11748 11773 --
NM_005359chr1894646 4395 4067 4034 2153 2079 1715 900 136 1962 12366 --
NM_005369chrX2512 70 ------
NM_005370chr192352 170 ------
NM_005375chr611155 --11091 --
NM_005376chr131092 962 233 ------
NM_005378chr2----1587 130
NM_005384chr91108 ------
NM_005389chr61161 ------
NM_005391chrX165 ------
NM_005399chr174067 2736 1521 1167 457 450 305 --21153 434 1393
NM_005400chr232618 2214 332 --2255 127 --
NM_005402chr741183 742 393 220 --1671 163
NM_005406chr1841527 571 542 276 ------
NM_005407chr141354 ------
NM_005415chr21152 ------
NM_005429chr42329 67 ------
NM_005430chr121905 --1269 --
NM_005436chr1063959 3879 3676 2992 2803 2700 13565 ----
NM_005440chr1743359 2100 2039 1188 ------
NM_005442chr31594 ------
NM_005450chr171179 ------
NM_005455chr121620 228 ------
NM_005458chr962430 2104 1918 1681 735 417 22390 510 178 --
NM_005460chr5148 ------
NM_005461chr2051684 1466 1370 596 394 11386 ----
NM_005465chr12711 247 --11952 129
NM_005474chr1721586 460 --1137 --
NM_005475chr1283050 2405 1172 735 640 123 115 32 --2774 624 1357
NM_005476chr911238 ------
NM_005493chr61130 ------
NM_005497chr17126064 5709 5575 5399 5368 4982 4463 1685 1578 1545 700 365 ------
NM_005502chr962760 2289 934 915 825 472 --21991 1137 --
NM_005503chr1531049 462 256 ------
NM_005506chr422768 2052 ----22493 1110
NM_005509chr511652 1696 1192 11554
NM_005527chr61400 ------
NM_005529chr11282 --1291 --
NM_005537chr1321054 59 2994 435 ----
NM_005539chr1081323 1283 1274 1263 1060 999 547 369 1332 1186 --
NM_005540chr131437 646 340 135 --1417
NM_005544chr22919 237 ------
NM_005559chr18133 ------
NM_005561chr13----1973 --
NM_005562chr131439 478 457 ------
NM_005563chr12892 632 ------
NM_005566chr11----130 --
NM_005569chr221210 --147 --
NM_005576chr151266 ------
NM_005578chr343764 3149 944 879 11330 11931 --
NM_005587chr15137 ------
NM_005593chr122482 179 ------
NM_005596chr946389 5896 4909 3987 36372 6300 1983 14342 15068
NM_005598chr131275 1151 336 --159 --
NM_005599chr11623 ------
NM_005602chr311336 ------
NM_005603chr182691 448 ------
NM_005604chr632021 1827 529 ------
NM_005610chr1--1739 ----
NM_005611chr162285 194 21295 226 ----
NM_005613chr151973 1765 1655 1618 124 1696 ----
NM_005614chr7158 --1833 --
NM_005617chr5138 ------
NM_005618chr61108 --1203 --
NM_005626chr1----193 --
NM_005627chr62661 144 ------
NM_005629chrX11341 ------
NM_005637chr1852037 1692 656 597 62 ------
NM_005638chrX2693 212 ------
NM_005639chr1271759 1686 1559 1468 1461 1447 271 11545 21565 194 --
NM_005650chr2211034 ------
NM_005652chr1631220 470 159 ------
NM_005655chr831146 807 77 ------
NM_005664chr15284 55 ------
NM_005665chr194650 4110 3333 3000 1255 1119 783 569 365 ----23874 206
NM_005668chr564561 4462 4112 3483 731 324 --12858 1317
NM_005669chr552328 2077 850 465 165 12270 ----
NM_005678chr151637 1666 ----
NM_005688chr33930 876 379 --21235 851 143
NM_005708chr132457 187 ------
NM_005715chr652598 2305 2201 2134 583 --11015 --
NM_005717chr14868 530 456 400 11036 180 --
NM_005720chr71257 ------
NM_005722chr23485 302 200 22277 56 --1945
NM_005730chr1253503 3357 3094 3022 53 --23237 1441 1407
NM_005734chr111278 ------
NM_005736chr1031155 432 87 --21586 1000 --
NM_005737chr262868 2404 2347 761 644 414 ------
NM_005746chr75765 742 674 601 121 --1490 --
NM_005751chr71315 ------
NM_005752chr1621230 1046 ------
NM_005754chr51109 ------
NM_005756chrX21215 1070 --1975 11226
NM_005761chr12----1123 --
NM_005765chrX1191 ------
NM_005768chr12--1140 1532 --
NM_005776chr141321 ------
NM_005779chr51842 33132 1419 624 31196 520 375 --
NM_005785chr1221796 1723 --1747 --
NM_005786chr1821261 33 21147 901 ----
NM_005789chr1722131 1910 11973 21567 54 --
NM_005795chr252332 2012 395 328 26 22135 1974 ----
NM_005802chr9169 2554 229 ----
NM_005807chr11237 ------
NM_005808chr373324 2238 1133 1056 1043 604 312 1843 11412 21084 1010
NM_005819chr183413 3377 3341 2354 1190 473 277 113 --22588 79 --
NM_005822chr652229 1814 1602 927 79 ------
NM_005828chr17134892 4801 4063 3868 3771 3507 3485 3479 3197 1880 363 123 109 13786 34173 801 648 --
NM_005832chr321160 518 ------
NM_005833chr91174 ------
NM_005839chr13888 610 158 ------
NM_005840chrX75564 1798 1642 1607 1582 1482 473 --16856 12644
NM_005842chr13196 ------
NM_005845chr131346 11427 ----
NM_005853chr161595 --1602 --
NM_005857chr121433 1345 --11134 11500
NM_005859chr511574 --11105 --
NM_005862chr31324 ------
NM_005869chr51275 ------
NM_005870chr132505 402 21411 83 ----
NM_005871chr10--1168 ----
NM_005876chr21764 --1677 --
NM_005877chr2272212 1951 1815 998 581 542 482 --12155 --
NM_005884chr191608 --1733 --
NM_005885chr53612 554 189 ------
NM_005895chr1253337 2933 2731 910 622 --132 --
NM_005897chr121194 250 ------
NM_005898chr1143192 3074 2497 579 ------
NM_005899chr17127 ------
NM_005901chr18128558 8341 8033 7356 6461 5818 3365 3138 2308 1483 815 394 1689 27483 7131 --
NM_005903chr555047 1537 1134 963 288 --1540 --
NM_005906chr631441 662 31 11480 1192 1497
NM_005909chr534018 3968 1194 12783 ----
NM_005911chr241392 931 266 251 ------
NM_005927chr5--1144 ----
NM_005930chr14163 ------
NM_005933chr1162672 2494 2329 2298 793 389 --1753 22862 2309
NM_005934chr1942267 1619 518 138 12337 51739 570 355 330 100 --
NM_005935chr4125102 4630 4599 4322 4232 4081 3878 1979 860 668 550 179 34266 4095 1291 1657 1793
NM_005937chr1743365 3249 1268 741 --21174 214 --
NM_005941chr821358 562 --22734 881 11401
NM_005955chr184654 4239 3915 3815 1640 697 353 250 11766 34780 1333 748 --
NM_005962chr1022238 719 1701 11712 --
NM_005962chr1022238 719 1701 11712 --
NM_005964chr172460 236 ------
NM_005966chr221770 1541 ----11559
NM_005969chr1121003 896 ------
NM_005994chr172676 46 ------
NM_005996chr122381 46 11026 ----
NM_005998chr1178 ------
NM_006003chr192203 193 ------
NM_006007chr943932 3701 3087 715 ------
NM_006012chr191164 ------
NM_006015chr12879 460 ----1849
NM_006016chr622236 1512 --11975 --
NM_006022chr1331052 106 99 1787 ----
NM_006030chr341655 1161 337 318 --11423 --
NM_006037chr244611 4286 4038 337 ------
NM_006038chr2042033 1593 372 354 1746 ----
NM_006040chr163932 250 137 11386 ----
NM_006047chr2023489 183 23381 2423 --23478 1411
NM_006048chr121079 80 --1453 --
NM_006060chr7134277 4265 4104 3615 3481 3221 3140 3023 1413 777 759 656 60 1232 11614 --
NM_006062chr221252 490 --2195 100 --
NM_006076chr751099 964 893 746 154 11121 22344 1215 13136
NM_006079chr62720 339 1173 ----
NM_006080chr742969 2918 1963 270 1327 ----
NM_006089chrX11331 ------
NM_006094chr852330 2229 1907 1652 804 ------
NM_006095chr474390 4297 3147 3138 2881 1075 169 1333 ----
NM_006096chr821364 90 21347 296 ----
NM_006100chr33118 108 53 ------
NM_006106chr1143112 2710 2128 164 22432 654 ----
NM_006133chr114697 343 287 134 --2808 356 --
NM_006134chr2131303 567 174 ----179
NM_006135chr11504 1206 ----
NM_006136chr741352 117 82 55 175 ----
NM_006139chr21987 12014 31844 509 60 --
NM_006141chr1642824 2583 787 701 --12635 --
NM_006147chr11431 ------
NM_006153chr3124 ------
NM_006154chr1522595 549 22467 35 ----
NM_006155chr241967 1642 1352 205 --11858 11900
NM_006156chr14----187 --
NM_006157chr11--1122 ----
NM_006159chr121575 ------
NM_006160chr1721621 432 --11033 --
NM_006161chr53663 500 68 ------
NM_006163chr12125 ------
NM_006166chr1242274 1963 956 652 1296 ----
NM_006167chr862089 1887 1602 1573 718 39 11824 1790 --
NM_006180chr9175 ------
NM_006185chr11171 ------
NM_006186chr22453 110 21140 51 11199 --
NM_006190chr221109 929 152 ----
NM_006192chr2031150 906 394 1366 ----
NM_006194chr1421095 270 ------
NM_006197chr832261 1460 199 --1112 --
NM_006206chr451992 1983 1937 946 331 12676 12705 11895
NM_006209chr81150 ------
NM_006212chr174812 4236 4224 2019 1657 1101 480 --25274 1129 --
NM_006218chr3145 ------
NM_006224chr1731679 829 354 1890 ----
NM_006226chr211256 ------
NM_006228chr8138 ----1370
NM_006237chr1311935 12049 ----
NM_006241chr321648 21 2882 126 ----
NM_006243chr1----2861 388 --
NM_006245chr61743 --153 --
NM_006246chr141133 1439 ----
NM_006251chr532946 1078 567 --13032 --
NM_006252chr186896 6132 5134 5103 2812 1082 556 88 35633 2111 1762 ----
NM_006253chr12192 11255 ----
NM_006256chr142613 2525 2197 612 ------
NM_006257chr102345 309 --2418 67 1774
NM_006258chr101462 2640 61 ----
NM_006265chr82343 53 ------
NM_006266chr94664 645 343 139 --1198 --
NM_006270chr19148 --1236 1278
NM_006275chr2032218 964 498 12087 ----
NM_006282chr2054763 4004 3108 791 768 23166 1012 14646 --
NM_006283chr8105003 4758 4741 3609 3358 3056 1808 580 134 87 54831 4486 4400 1901 156 24979 1419 --
NM_006285chr92268 214 ------
NM_006301chr121638 ------
NM_006305chr15--1208 ----
NM_006306chrX55892 4687 1958 519 314 14742 24929 4460 1131
NM_006310chr1741273 1080 1012 41 ------
NM_006312chr123843 746 80 --1357 --
NM_006313chr1251345 1270 484 432 373 1641 ----
NM_006317chr53767 343 171 ------
NM_006320chr421008 66 2893 178 ----
NM_006322chr131226 ----149
NM_006325chr121254 1302 ----
NM_006328chr111467 ------
NM_006329chr141235 --128 --
NM_006330chr8--1290 ----
NM_006333chr21496 ------
NM_006350chr51136 ------
NM_006352chr121372 310 --1608 --
NM_006357chr2151 ------
NM_006359chrX32155 626 465 ------
NM_006364chr1421319 1110 ------
NM_006367chr13889 261 106 --1814 1939
NM_006369chr1167 --1380 --
NM_006371chr375322 4351 4213 4190 1648 610 285 11583 24972 1374 34871 3989 3922
NM_006372chr61164 1436 ----
NM_006378chr921092 212 --21183 1057 --
NM_006380chr1733931 3514 1682 23264 579 ----
NM_006386chr2242488 1751 778 490 --157 1179
NM_006390chr123513 406 36 ------
NM_006391chr111285 ------
NM_006400chr121272 ------
NM_006401chr9151 1461 ----
NM_006403chr6162 11562 ----
NM_006408chr71985 ------
NM_006416chr6--1170 ----
NM_006420chr2032972 2561 278 2426 265 31352 956 815 --
NM_006421chr81894 ------
NM_006430chr22528 425 ------
NM_006434chr1063199 2079 631 492 462 341 13128 1523 --
NM_006451chr52988 364 ------
NM_006454chr452329 2087 312 178 138 22442 653 52893 2418 986 148 101 --
NM_006459chr1021960 273 2777 237 1788 --
NM_006469chr11525 ------
NM_006472chr131157 997 923 21165 1068 11209 --
NM_006476chr11--175 ----
NM_006482chr1263501 2769 2379 1033 592 44 33623 2439 305 ----
NM_006489chr1431288 803 533 11254 22018 422 --
NM_006491chr14--1308 ----
NM_006496chr121235 750 1807 ----
NM_006497chr173318 89 31 --1159 --
NM_006516chr141445 1418 1392 625 ------
NM_006517chrX--2650 351 --1423
NM_006526chr2031547 1390 332 1546 ----
NM_006532chr1921681 756 1358 31309 455 235 --
NM_006534chr2063407 3176 2557 921 50 36 23052 620 ----
NM_006538chr274145 3575 3353 2989 2759 545 468 14125 --11038
NM_006544chr1434383 1356 279 24362 1633 ----
NM_006545chr3129 ------
NM_006546chr17116541 6383 4129 4109 2488 2378 2221 1918 1564 1095 531 21009 569 34144 864 208 16132
NM_006548chr311714 11436 ----
NM_006549chr1212345 32482 2236 1038 ----
NM_006555chr741949 1554 1535 479 11613 21420 1404 --
NM_006557chr911696 --11763 11439
NM_006559chr121061 357 ------
NM_006561chr1085598 4687 4325 4206 4020 2430 487 256 22112 1484 25697 5252 14768
NM_006565chr1611269 11041 ----
NM_006574chr31237 ------
NM_006575chr142923 191 ------
NM_006577chr231309 949 103 1901 ----
NM_006585chr211146 ------
NM_006589chr11480 ------
NM_006595chr1151508 1474 1382 152 126 11673 ----
NM_006597chr112187 171 ------
NM_006599chr1668047 7189 6499 5185 2853 995 --27282 6764 --
NM_006601chr12------1722
NM_006602chr20--1596 ----
NM_006603chrX41670 1654 1631 772 1663 ----
NM_006609chr2--12233 12572 --
NM_006614chr332647 2494 835 23312 2574 ----
NM_006621chr111907 ------
NM_006622chr5144 ------
NM_006624chr10--11509 ----
NM_006628chr1564491 3850 3508 1722 1378 610 --14388 14212
NM_006633chr52603 223 --195 --
NM_006634chr21224 ------
NM_006640chr173656 609 580 1134 ----
NM_006646chr1322626 352 ----12690
NM_006650chr522505 860 23171 778 1334 32722 743 320
NM_006654chr1264567 4272 4086 1889 1249 373 ----13904
NM_006666chr19154 ------
NM_006667chrX2971 730 ------
NM_006668chr143458 426 62 ------
NM_006670chr61454 ------
NM_006675chr1243171 2768 2704 37 11099 23350 2382 --
NM_006690chr2031576 755 705 1215 2951 482 --
NM_006695chr171328 ------
NM_006698chr201314 21423 1201 ----
NM_006699chr142717 2564 1769 1739 1719 ----
NM_006703chr61467 ------
NM_006704chr132423 315 ------
NM_006713chr5--1585 ----
NM_006717chr942975 2407 2235 370 12594 1581 --
NM_006718chr61701 --1350 --
NM_006720chr1095075 5021 4284 3929 1904 1844 824 430 336 ----15107
NM_006722chr353004 2918 533 487 35 12351 22374 2341 --
NM_006726chr41800 ------
NM_006729chrX85486 5121 1770 1582 1012 665 534 498 24841 1217 ----
NM_006732chr1952140 1846 1697 669 148 ----1158
NM_006736chr251754 1724 1689 97 56 --1582 --
NM_006738chr1584409 4331 3919 3632 1718 1266 220 29 23962 3050 1102 1999
NM_006742chr1642005 1573 1505 51 12024 21274 314 --
NM_006745chr42702 68 ------
NM_006748chr841588 685 332 56 ------
NM_006750chr16115977 5630 5164 5018 4958 3061 2034 1854 1108 502 131 55357 1277 1184 281 34 47733 7091 724 631 1917
NM_006751chr2----1342 --
NM_006754chr7121 ------
NM_006763chr151845 1737 1643 576 43 ------
NM_006766chr842290 1927 1891 378 11898 ----
NM_006769chr12146 124 ------
NM_006772chr651214 219 153 138 102 --11689 --
NM_006775chr632725 1924 584 12895 12169 --
NM_006777chrX1377 11991 --1634
NM_006788chr1882120 2011 1310 717 694 639 501 395 ------
NM_006790chr51350 ------
NM_006791chr151260 1208 ----
NM_006796chr18136 ------