TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3605-3p
miRNA Sequence: CCUCCGUGUUACCUGUCCUCUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000216chrX23787 155 13728 --1224
NM_000618chr1245619 5481 1222 1191 15774 --14000
NM_000618chr1245619 5481 1222 1191 15774 --14000
NM_001009993chr244249 2795 653 26 --12890 14228
NM_001010867chr155818 5615 5081 4982 2003 --1777 26379 1565
NM_001012755chrX63884 3685 3508 1203 1128 632 ------
NM_001040152chr754964 4841 3541 1571 759 14455 1397 --
NM_001042494chr1563065 2693 1531 834 709 58 ------
NM_001042495chr1563065 2693 1531 834 709 58 ------
NM_001042496chr1563065 2693 1531 834 709 58 ------
NM_001042497chr1563065 2693 1531 834 709 58 ------
NM_001204chr247321 7216 5035 21 ----27269 698
NM_001420chr1933146 831 113 --1781 21056 823
NM_001759chr1253987 1975 1274 836 801 2812 536 ----
NM_002006chr424372 323 ----14476
NM_002264chr354770 4724 4685 3657 237 --182 --
NM_002737chr1786480 5611 5149 4699 2525 2293 518 114 14179 12581 --
NM_004748chr1521571 115 13015 --11076
NM_005135chr1563065 2693 1531 834 709 58 ------
NM_005197chr1431255 1159 1044 ----1704
NM_005410chr53803 335 197 ----1119
NM_005595chr14723 310 261 87 ----1389
NM_005596chr945591 5008 1655 487 14252 ----
NM_005725chr12612 482 ----11572
NM_005933chr111422 ----22366 938
NM_006885chr1624128 3736 --12918 14106
NM_007249chr1377316 7038 6552 5969 2877 2826 747 26522 517 --16095
NM_012252chr754226 3944 2024 1877 223 25297 3586 11301 --
NM_012329chr171416 ----1633
NM_014112chr825178 4358 ----11391
NM_018227chr422600 2541 ----12307
NM_018327chr2021489 1435 ----11193
NM_018330chr101678 1661 --11594
NM_018373chr1466346 6306 5438 2586 1579 1496 26056 556 15604 --
NM_018388chrX137 21055 185 --11071
NM_020443chr185921 4794 4524 2628 2528 2157 1810 1223 12181 16110 14767
NM_020739chr1521571 115 13015 --11076
NM_020935chr254547 4056 3353 329 319 --1864 --
NM_021964chr346429 5731 4069 78 12574 12616 12150
NM_032281chr1933146 831 113 --1781 21056 823
NM_053016chr926099 1003 17413 25794 2777 27363 3085
NM_130438chr2163081 1090 787 374 226 145 ------
NM_133647chr1563065 2693 1531 834 709 58 ------
NM_152253chr2273799 3498 1695 613 586 137 45 --1781 23141 737
NM_152265chr1128 ----179
NM_152487chr12524 366 ----1901
NM_173468chr421171 1112 ----25784 917
NM_194071chr714714 23566 1894 --23622 103
NM_198484chr335082 2074 1577 35496 4541 723 11849 25245 4870
NM_212467chr1541789 1748 1015 561 32086 880 208 2713 380 11677