TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3605-5p
miRNA Sequence: UGAGGAUGGAUAGCAAGGAAGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1141131 768 682 676 12445 ----
NM_000067chr82684 37 ------
NM_000081chr131637 1324 694 1750 ----
NM_000084chrX96537 2547 1794 1496 1463 1249 906 530 353 --11769 35032 4826 1036
NM_000089chr73659 618 94 --1703 --
NM_000091chr242824 2718 467 37 1880 22344 1787 --
NM_000092chr273922 3710 3012 2838 1278 340 148 44207 4122 3107 281 13409 --
NM_000109chrX32245 2213 781 --1525 --
NM_000111chr71274 127 ----
NM_000112chr574815 4719 2008 1872 1414 1208 618 25252 3871 21633 337 --
NM_000114chr2051151 931 397 205 154 ------
NM_000125chr643636 3521 1437 898 --2512 173 --
NM_000141chr1031222 1092 181 11156 1966 --
NM_000151chr1781846 1832 1288 1186 602 389 263 113 11479 11208 --
NM_000158chr31229 1246 ----
NM_000165chr621050 425 ------
NM_000167chrX4691 606 336 281 1322 --1500
NM_000168chr793141 3062 2995 2731 2698 2560 2183 1091 441 1747 12574 --
NM_000176chr523254 2706 ------
NM_000189chr272305 2270 1847 838 651 468 418 ------
NM_000204chr4124 1175 ----
NM_000208chr1984397 4117 3784 3731 2922 1414 1368 144 21560 86 11360 --
NM_000214chr2011456 ------
NM_000217chr1271918 1663 1573 1497 970 676 431 24292 3601 35220 1774 655 15204
NM_000222chr431356 246 177 ------
NM_000227chr182303 85 ------
NM_000232chr432392 692 153 42609 735 476 202 1684 --
NM_000237chr811518 --1227 --
NM_000238chr71397 --1151 --
NM_000245chr732259 2052 1411 ------
NM_000248chr362330 2025 1953 1043 990 775 ------
NM_000252chrX1409 --11381 --
NM_000259chr15126369 6168 5438 5272 3958 3906 2472 2438 2246 1931 1658 1600 24640 329 25962 1991 24040 220
NM_000264chr933070 789 599 --11262 --
NM_000266chrX1111 --1878 --
NM_000267chr1773188 3004 2818 2798 2312 1120 396 --12932 --
NM_000276chrX102230 2002 1872 1805 791 645 588 359 352 164 1521 ----
NM_000280chr11--2700 219 ----
NM_000284chrX41711 1658 811 341 11785 11283 --
NM_000291chrX2241 194 --1899 1168
NM_000297chr421360 130 1241 ----
NM_000314chr1083298 2747 2546 1200 747 480 405 124 ------
NM_000321chr132495 453 1111 ----
NM_000332chr6106431 6287 2875 2867 2427 2358 2009 1156 497 99 16266 25799 2759 --
NM_000337chr5106465 6256 5806 5175 2644 1513 1443 721 408 204 1379 26231 4160 26245 5317
NM_000338chr1521138 914 1744 ----
NM_000340chr321397 93 ------
NM_000346chr172431 415 --21785 1587 --
NM_000353chr163827 198 176 11117 ----
NM_000367chr652099 1661 1565 675 475 12228 12117 --
NM_000369chr1431832 1810 1681 ------
NM_000378chr111110 ------
NM_000393chr22711 159 1189 --11907
NM_000399chr102817 187 ------
NM_000408chr243474 2694 999 799 11155 2525 290 12771
NM_000414chr51216 1240 ----
NM_000426chr61216 ------
NM_000430chr1763430 2895 2869 786 509 468 --23475 2335 23198 2704
NM_000436chr521558 479 11101 --11533
NM_000439chr53639 218 111 1322 ----
NM_000449chr151317 1266 1150 569 248 --3940 472 113 --
NM_000451chrX52001 1828 1767 270 68 1364 ----
NM_000461chr344352 4132 1482 1029 33162 1109 720 11427 --
NM_000462chr1531794 1389 229 ------
NM_000474chr72575 267 --1524 1253
NM_000478chr12568 170 ----1285
NM_000484chr2131110 770 291 ------
NM_000489chrX83216 3132 2253 857 776 382 205 122 ----13417
NM_000495chrX3953 842 789 ------
NM_000508chr44939 897 125 86 ------
NM_000523chr22444 342 2875 403 ----
NM_000530chr121078 356 2921 823 1711 --
NM_000533chrX4467 440 410 75 --1747 --
NM_000544chr6_cox_hap1103240 3132 3122 2744 2085 1108 1013 912 832 488 ------
NM_000555chrX75345 5018 4816 3044 2410 1233 948 12385 57544 5602 5263 2404 231 17844
NM_000574chr141153 1063 496 187 ------
NM_000598chr721382 196 ----11067
NM_000610chr1122886 927 22344 694 12604 1484
NM_000612chr1163621 3571 2915 2523 847 40 ----1210
NM_000615chr1153006 2881 2198 953 683 ----12959
NM_000618chr1276110 5649 5636 5397 2283 1905 48 15844 14220 12320
NM_000618chr1276110 5649 5636 5397 2283 1905 48 15844 14220 12320
NM_000621chr1331322 1151 1058 ------
NM_000633chr1874617 4473 3801 3643 1935 1572 869 --13376 11638
NM_000634chr21257 1345 11117 --
NM_000663chr1642138 1154 589 257 12596 1725 12823
NM_000726chr231356 951 71 ------
NM_000738chr11------2996 76
NM_000756chr81431 --1355 --
NM_000782chr2021293 79 --1171 1128
NM_000793chr1464932 4617 3392 1788 1451 281 23591 1219 ----
NM_000809chr4127653 7140 6305 6258 5608 3246 2585 1782 854 577 440 244 28424 3418 ----
NM_000813chr552052 1938 1165 527 132 --25050 368 --
NM_000814chr1553105 2648 978 521 454 14072 --11188
NM_000817chr211249 ------
NM_000824chr43821 358 273 ------
NM_000826chr441698 778 336 299 ------
NM_000829chr114909 642 128 103 --22071 732 --
NM_000831chr1126188 5860 5830 5545 5495 5257 4950 2048 1305 713 552 204 15119 2971 193 --
NM_000833chr1661385 1378 1281 1224 1121 170 ------
NM_000844chr3--1176 11067 --
NM_000860chr441572 1488 1168 473 165 ----
NM_000864chr131083 988 751 ----1982
NM_000868chrX42026 884 778 460 22279 2038 ----
NM_000875chr1575534 5374 5131 4571 1851 1560 1108 25941 116 ----
NM_000891chr1743248 3066 1131 989 11111 --11141
NM_000899chr1263504 2718 1438 793 413 120 ----13946
NM_000922chr1141033 995 258 144 ------
NM_000926chr11138499 8211 8139 7257 6443 3771 2396 1330 1125 981 904 835 724 68854 7800 7537 2596 1411 829 18227 19409
NM_000935chr321093 1019 11156 ----
NM_000944chr442341 2218 2043 695 11548 21770 1553 --
NM_000945chr24778 575 289 176 ----1448
NM_000956chr143978 849 772 1751 ----
NM_000964chr171502 ----2365 327
NM_000983chr15521 412 400 195 71 ------
NM_001001323chr1262944 2866 2797 2134 161 67 11994 ----
NM_001001389chr1122886 927 22344 694 12604 1484
NM_001001390chr1122886 927 22344 694 12604 1484
NM_001001391chr1122886 927 22344 694 12604 1484
NM_001001392chr1122932 973 22390 740 12650 1530
NM_001001395chr1262769 2263 1128 766 683 43 ------
NM_001001396chr193445 3424 3068 2970 2731 1434 1090 943 575 --21512 601 --
NM_001001433chr2053213 3015 1975 1127 480 12456 1873 --
NM_001001436chr162845 84 156 ----
NM_001001479chr221693 ----1841
NM_001001481chr852737 2347 2311 1084 153 1300 ----
NM_001001502chr51107 ------
NM_001001521chr21217 ------
NM_001001549chr742767 732 540 278 11841 ----
NM_001001550chr742767 732 540 278 11841 ----
NM_001001555chr742767 732 540 278 11841 ----
NM_001001556chr1551569 1459 555 186 82 --1494 --
NM_001001557chr831914 1595 478 ------
NM_001001664chr21360 1221 1998 --
NM_001001701chr472192 2168 1956 1485 887 864 633 ------
NM_001001870chr171801 ------
NM_001001890chr2163964 3239 2837 1464 1173 118 ------
NM_001001933chr12624 599 ------
NM_001001936chr10----2907 466 --
NM_001001971chr1021363 231 --31166 923 69 --
NM_001001973chr10------122
NM_001001974chr1032093 910 412 ----140
NM_001002009chr72555 64 194 ----
NM_001002010chr72555 64 194 ----
NM_001002033chr17------1791
NM_001002243chr2--1339 ----
NM_001002255chr6198 ----164
NM_001002265chr102745 661 ------
NM_001002266chr102745 661 ------
NM_001002269chr91160 ------
NM_001002838chrX61205 1161 691 438 237 169 1493 ----
NM_001002843chr152844 385 ------
NM_001002860chr1494684 4047 3990 3431 3317 1703 1495 751 550 14033 23543 3395 --
NM_001002901chr1----2187 95 1459
NM_001003652chr18157917 7497 6888 6840 6414 6217 5708 5254 3248 2376 1513 1445 935 645 607 37637 2208 760 28331 5720 --
NM_001003674chr1885289 5132 5023 4520 2644 1602 1369 684 15958 46048 4694 2024 976 --
NM_001003675chr1885289 5132 5023 4520 2644 1602 1369 684 15958 46048 4694 2024 976 --
NM_001003688chr42814 224 ------
NM_001003712chr1231114 537 181 21561 160 ----
NM_001003760chr683591 3159 2388 2378 2264 1191 1130 816 ------
NM_001003786chr172631 116 --125 1544
NM_001003787chr172631 116 --125 1544
NM_001003788chr172631 116 --125 1544
NM_001003800chr963214 3133 1402 1147 818 266 1217 1295 22855 2761
NM_001003894chrY------182
NM_001004065chr933926 3322 2952 21571 119 --12587
NM_001004196chr321092 849 --186 --
NM_001004303chr11685 1164 ----
NM_001004303chr11685 1164 ----
NM_001004306chr1741754 1663 1263 713 ------
NM_001004317chr664261 3844 1447 1347 926 812 14455 ----
NM_001004342chr145757 4563 4374 1599 23679 481 21430 689 22021 66
NM_001004356chr4----21543 1265 --
NM_001004358chr4----21543 1265 --
NM_001004360chr231431 1409 348 ------
NM_001004419chr1294485 4470 4433 4061 3451 1469 1228 543 506 14298 ----
NM_001004441chr52199 83 11276 124 --
NM_001004722chr2--1884 --1122
NM_001005209chr21704 ------
NM_001005266chr15--1463 ----
NM_001005267chr15--1463 ----
NM_001005268chr15--1463 ----
NM_001005269chr15--1463 ----
NM_001005353chr121237 108 1897 ----
NM_001005353chr121237 108 1897 ----
NM_001005366chr121284 1122 ----
NM_001005375chrY31674 1632 94 ------
NM_001005386chr22956 850 ------
NM_001005404chr1774286 1732 1072 749 273 145 57 24193 1556 31352 540 127 --
NM_001005463chr1062230 1869 857 795 713 651 199 --1592
NM_001005473chr5106347 6251 5855 4920 4536 2371 2012 1544 1357 82 25608 4168 12459 15202
NM_001005476chr2169 --1747 --
NM_001005502chr1284918 4547 2028 1136 998 860 382 117 15238 21219 1171 --
NM_001005527chr331356 971 318 21039 374 1229 --
NM_001005609chrX73040 2666 2608 2602 2591 2372 2321 --33462 3344 540 --
NM_001005612chrX2183 147 ------
NM_001005732chr211208 1164 ----
NM_001005733chr211208 2247 164 ----
NM_001005739chr21196 --1242 --
NM_001005746chr231356 951 71 ------
NM_001005747chr231356 951 71 ------
NM_001005753chr232302 866 545 --1129 --
NM_001005845chr831687 1477 350 31244 694 78 ----
NM_001005849chr172397 95 ----161
NM_001005861chr32698 282 1955 ----
NM_001006115chr341922 1761 1123 1040 --1545 --
NM_001006605chr12841 742 ------
NM_001006605chr12841 742 ------
NM_001006610chr162399 243 11020 ----
NM_001006623chr252276 1863 1741 842 300 31620 199 177 ----
NM_001006641chr9173 11664 ----
NM_001006642chr9173 11664 ----
NM_001006643chr9173 11664 ----
NM_001006657chr242646 2108 2069 2019 ------
NM_001006681chrX1117 ------
NM_001006682chrX1117 ------
NM_001006683chrX1117 ------
NM_001006932chr652983 2940 2733 2691 301 --32326 612 41 --
NM_001006946chr241458 605 430 265 --21644 1537 --
NM_001007023chr1464932 4617 3392 1788 1451 281 23591 1219 ----
NM_001007026chr12------1527
NM_001007067chr831045 399 198 ------
NM_001007068chr831045 399 198 ------
NM_001007069chr831045 399 198 ------
NM_001007070chr831045 399 198 ------
NM_001007097chr974986 4867 4127 3286 3154 3143 1581 --11678 14932
NM_001007102chr64666 356 212 32 ------
NM_001007156chr1551865 1692 1351 451 304 --2643 325 --
NM_001007214chr11138 ----1253
NM_001007237chr122654 1811 22023 306 1750 --
NM_001007245chr72183 85 ------
NM_001007246chr2131679 1587 119 ------
NM_001007250chr1--294 22 ----
NM_001007466chr694951 3712 3560 1961 1840 1324 1140 476 468 21027 538 11490 15017
NM_001007471chr92671 52 --1563 --
NM_001007538chr1321785 58 ------
NM_001007553chr121112 429 ------
NM_001007559chr183833 489 88 ------
NM_001007565chr31321 ------
NM_001007794chr14581 264 185 154 ------
NM_001008222chrX4535 499 378 343 ------
NM_001008239chr1843393 3076 2954 430 --152 --
NM_001008388chr43208 133 26 ------
NM_001008391chr114724 281 209 175 ------
NM_001008408chr7116195 5539 5307 5052 4466 4451 4150 1518 1136 1107 885 1417 1221 --
NM_001008495chr81357 11646 ----
NM_001008541chr1061734 943 763 713 671 533 12113 1319 --
NM_001008541chr1061734 943 763 713 671 533 12113 1319 --
NM_001008564chr1341446 437 168 47 2898 221 ----
NM_001008567chr91100 ------
NM_001008660chr1121264 1185 2454 60 ----
NM_001008701chr19--12910 11894 --
NM_001008707chr1421384 670 21526 353 1549 --
NM_001008738chr542421 2387 1907 1031 32315 2222 997 ----
NM_001008895chr131144 11280 ----
NM_001009183chr142155 29 ----1130
NM_001009552chr82576 415 ------
NM_001009554chr464734 4134 4030 2960 2907 1501 33165 1714 508 21372 886 --
NM_001009554chr464734 4134 4030 2960 2907 1501 33165 1714 508 21372 886 --
NM_001009555chr441671 1443 708 504 11723 ----
NM_001009880chr2284435 4006 3854 3369 3053 1456 1352 1214 14283 3885 827 502 13378
NM_001009899chr3146389 5947 5403 5078 4616 4404 2175 1433 1079 879 869 747 295 130 1552 36435 5392 4390 15505
NM_001009909chr1152484 1235 670 376 288 23586 172 --13056
NM_001009959chr252139 1961 1696 597 557 125 ----
NM_001010853chr642796 1163 613 236 12365 ----
NM_001010861chr152773 2701 2641 617 500 21037 402 ----
NM_001010870chr62471 59 1522 ----
NM_001010888chrX33738 1697 264 14121 1166 --
NM_001010895chr941958 802 626 518 ----1473
NM_001010924chr1031208 1081 49 --1902 --
NM_001010934chr721081 25 ------
NM_001010942chr123274 166 97 1836 ----
NM_001010986chrX52474 1960 819 414 125 ------
NM_001011513chr464016 3521 2902 1223 853 276 23980 3680 ----
NM_001011537chr312161 12399 ----
NM_001011546chr205654 554 318 116 47 ------
NM_001011553chr72928 722 2614 257 ----
NM_001011658chrX62103 2059 1391 687 356 160 1109 ----
NM_001011663chr102387 294 ------
NM_001011666chr7106122 4717 4294 4202 1734 1565 1433 429 301 53 14741 11416 --
NM_001011705chr131285 ------
NM_001011708chr232096 1173 940 12517 ----
NM_001011713chr141478 --11382 --
NM_001011885chr1531322 462 224 ------
NM_001012264chr142732 180 --1235 --
NM_001012270chr1731847 743 569 ----11612
NM_001012279chr62563 155 ------
NM_001012393chr1194931 4669 4513 3908 3370 2063 1157 954 548 --34654 596 320 24921 1058
NM_001012398chr1611099 1803 ----
NM_001012420chr1532063 1017 981 ------
NM_001012426chr643199 2646 2207 896 --13419 --
NM_001012427chr643199 2646 2207 896 --13419 --
NM_001012456chr7129 ------
NM_001012507chr6139 ------
NM_001012732chr441239 1159 145 71 ------
NM_001012751chr1021315 424 --11668 --
NM_001012755chrX105073 4885 4604 3195 3183 1637 1288 1084 369 43 23378 1712 24384 101 --
NM_001012968chrX31820 1076 316 --32686 813 383 1405
NM_001012989chrX1275 ----1122
NM_001013398chr721382 196 ----11067
NM_001013415chr421407 633 --11356 --
NM_001013438chr311013 ------
NM_001013439chr31859 ------
NM_001013620chr12148359 8276 7539 6937 5991 3208 2276 2096 1898 1693 1587 887 707 349 57995 6844 1231 983 114 ----
NM_001013659chr1944579 1185 436 293 24071 358 1142 --
NM_001013690chr1222395 933 --2394 385 --
NM_001013699chr121119 ------
NM_001014435chr16----140 --
NM_001014797chr10108035 7859 7453 6154 5637 3079 2291 1142 774 435 26512 6249 12940 17266
NM_001014812chr151397 ----1309
NM_001014839chr1----163 --
NM_001014841chr1----163 --
NM_001015877chrX32155 640 123 --12245 --
NM_001015881chrX11212 ----1381
NM_001015887chr311157 ------
NM_001017368chr1742511 2488 880 406 ----1806
NM_001017395chr352649 2623 2486 1432 1378 23639 3448 ----
NM_001017440chr7156832 6238 5908 5710 3106 3028 3022 2647 2462 1498 1168 1053 881 845 395 25206 2012 17957 22065 309
NM_001017920chr21125 ------
NM_001017992chr531102 1013 966 ------
NM_001017995chr554242 3733 1895 1629 509 14306 24229 84 --
NM_001018050chr2262762 2591 2098 693 576 361 ------
NM_001018052chr2262762 2591 2098 693 576 361 ------
NM_001018054chr1------11095
NM_001018056chr91190 ------
NM_001018064chr941877 1833 66 25 21997 1399 ----
NM_001018065chr9115684 5432 5342 2156 1520 1101 1068 893 602 571 119 11569 25904 4835 --
NM_001018066chr9115684 5432 5342 2156 1520 1101 1068 893 602 571 119 11569 25904 4835 --
NM_001018067chr134622 780 261 25043 3278 13506 11493
NM_001018068chr134622 780 261 25043 3278 13506 11493
NM_001018069chr134622 780 261 25043 3278 13506 11493
NM_001018074chr523254 2706 ------
NM_001018075chr523254 2706 ------
NM_001018076chr523254 2706 ------
NM_001018077chr523254 2706 ------
NM_001018091chr1572889 2872 2181 2091 1800 152 97 ------
NM_001018108chr1542301 1612 593 469 ------
NM_001020825chr51181 ------
NM_001023567chr1552388 2032 1786 989 439 --1210 --
NM_001023587chr34985 844 198 107 ------
NM_001024094chr523254 2706 ------
NM_001024218chr143327 123 56 ------
NM_001024372chr852252 1611 1549 784 655 12245 ----
NM_001024401chr1641920 959 464 422 --12842 21086 868
NM_001024455chrX41031 924 388 154 12466 12026 --
NM_001024460chr611031 1201 1393 --
NM_001024601chr1----135 --
NM_001024649chr532356 2060 282 ------
NM_001024666chrX2179 35 ------
NM_001024668chr121235 2733 351 ----
NM_001024808chr1241983 1874 1814 456 11108 ----
NM_001024809chr171502 ----2365 327
NM_001024847chr362514 2283 931 905 779 183 22174 974 1951 --
NM_001024855chr3----1154 11213
NM_001024934chr62472 82 ------
NM_001024935chr62472 82 ------
NM_001024936chr62472 82 ------
NM_001024948chr133467 3370 743 12741 --12342
NM_001024956chr1175265 5155 4913 3776 1398 1275 1077 14076 45602 3715 2274 613 13637
NM_001025068chr321773 131 ------
NM_001025069chr321773 131 ------
NM_001025076chr1045492 1542 1246 390 35962 3837 2413 12450 153
NM_001025077chr1086850 2900 2604 1748 1224 1049 345 245 27320 5195 --11411
NM_001025079chr373726 3686 3553 2942 1176 736 555 1601 32706 2541 1308 --
NM_001025105chr551388 1077 493 443 182 ------
NM_001025108chr2103878 3312 3286 3179 2964 2823 1382 1318 1078 1033 13614 12644 --
NM_001025233chr1242086 1895 1082 503 12199 ----
NM_001025252chr843102 2727 772 62 1167 ----
NM_001025253chr843102 2727 772 62 1167 ----
NM_001025266chr3114396 4240 4026 3043 1685 1490 989 423 211 180 68 --13818 --
NM_001025579chr1741126 842 824 465 --1971 --
NM_001025595chr431084 422 236 ------
NM_001025603chr151317 1266 1150 569 248 --3940 472 113 --
NM_001029860chr8184 ------
NM_001029863chr622929 801 23170 2591 ----
NM_001029875chr552825 2456 1920 1114 557 ----12185
NM_001029998chr441379 1326 1120 952 11409 21349 1337 --
NM_001030001chr142347 28 ------
NM_001030007chr1653155 1039 782 182 23 --13804 1465
NM_001030055chr1454100 3851 3479 571 437 24351 3996 ----
NM_001030272chr111434 ------
NM_001030273chr111434 ------
NM_001030287chr141169 249 206 168 31101 46 35 ----
NM_001031623chr621725 1323 ------
NM_001031689chr91121 ------
NM_001031690chr772826 2730 2450 1168 960 879 131 --22863 2115 --
NM_001031695chr2294711 4457 4378 3850 3377 1867 1808 1294 641 --25092 1219 --
NM_001031702chr32770 244 ------
NM_001031717chr3------1105
NM_001031732chr453608 3249 3207 3184 301 23526 3283 ----
NM_001031738chr2153 ------
NM_001031743chr61177 ------
NM_001031804chr161292 1767 13262 23759 878
NM_001031812chr51159 11978 2942 556 --
NM_001032221chr941797 1349 736 226 1488 31204 668 140 11182
NM_001032282chr841274 1181 486 469 ------
NM_001032283chr1231069 407 275 ------
NM_001032284chr1231069 407 275 ------
NM_001032288chr2031541 562 215 11244 11138 --
NM_001032293chr171117 ------
NM_001032296chr1342338 961 910 369 --22277 52 --
NM_001032363chr162089 1918 1599 1591 362 90 1737 ----
NM_001032363chr162089 1918 1599 1591 362 90 1737 ----
NM_001032380chr1061695 1416 1236 491 442 127 ------
NM_001032393chrX2775 585 ------
NM_001033045chr274032 3891 2884 2735 1003 861 719 22843 2719 2699 260 23951 2826
NM_001033047chr452583 2131 303 249 42 158 32173 297 63 --
NM_001033057chr332067 1749 832 --11831 --
NM_001033081chr11165 --11923 --
NM_001033082chr11165 --11923 --
NM_001033087chr2092664 2156 1322 1221 931 325 249 235 122 12233 22081 704 --
NM_001033117chr354898 4851 4828 3277 1923 11399 2892 330 --
NM_001033507chr131512 718 650 11962 --1276
NM_001033566chr172795 52 ------
NM_001033568chr172795 52 ------
NM_001033576chr1762654 2515 2146 1891 300 285 ----1924
NM_001033578chr812166 ------
NM_001033723chr851987 1862 1093 549 482 ------
NM_001034837chr52623 135 ------
NM_001034838chr52623 135 ------
NM_001034841chr1675251 4742 4122 3924 3626 1760 1728 11452 14257 1189
NM_001034845chr4--11267 1461 --
NM_001034850chr51316 11211 ----
NM_001034852chr1451996 1976 1615 481 233 --11405 --
NM_001034915chr8------126
NM_001034954chr102784 771 1906 ----
NM_001034955chr102784 771 1906 ----
NM_001034956chr102784 771 1906 ----
NM_001034957chr102784 771 1906 ----
NM_001035chr141037 519 379 255 ------
NM_001035003chr421167 909 --1185 --
NM_001035004chr421167 909 --1185 --
NM_001035511chr131847 342 165 11785 1746 --
NM_001035512chr161954 449 272 113 69 54 11892 2853 27 --
NM_001035513chr161954 449 272 113 69 54 11892 2853 27 --
NM_001035521chr23792 665 22 1811 1735 --
NM_001037132chr75897 873 649 446 47 11772 ----
NM_001037133chr75897 873 649 446 47 11772 ----
NM_001037164chr71347 ------
NM_001037165chr7108364 7085 6681 6607 5541 5528 3590 2563 2451 321 22239 997 46749 5778 1519 1379 --
NM_001037317chr152773 2701 2641 617 500 21037 402 ----
NM_001037332chr562014 1945 1936 1790 1689 571 --1517 12565
NM_001037333chr562014 1945 1936 1790 1689 571 --1517 12565
NM_001037334chr1832431 897 409 --1425 --
NM_001037339chr151854 561 369 297 30 11266 ----
NM_001037340chr151854 561 369 297 30 11266 ----
NM_001037341chr151854 561 369 297 30 11266 ----
NM_001037341chr151854 561 369 297 30 11266 ----
NM_001037872chr21472 ------
NM_001037954chr1153395 2433 1397 1086 153 22651 2345 ----
NM_001038640chr15140 --2278 84 --
NM_001038702chr562687 2389 1878 852 682 207 ----1812
NM_001038707chr1102181 2170 1867 1821 1538 1438 817 613 43 29 21701 694 ----
NM_001038707chr1102181 2170 1867 1821 1538 1438 817 613 43 29 21701 694 ----
NM_001039111chr31183 ------
NM_001039348chr21311 --1912 --
NM_001039349chr21311 --1912 --
NM_001039350chr7----11225 --
NM_001039459chr73299 175 93 --21138 457 --
NM_001039479chr1482043 1937 1834 1632 969 902 893 233 --11587 --
NM_001039538chr272678 2558 2329 2290 1331 328 86 ------
NM_001039547chr3198005 7831 7460 7335 7191 6445 6436 6346 6165 3131 2718 1853 1748 1647 1497 1328 648 290 224 --11666 --
NM_001039550chr22720 298 ------
NM_001039570chr2243887 1437 1099 346 14694 --13334
NM_001039571chr2243887 1437 1099 346 14694 --13334
NM_001039577chr143957 3521 428 174 1929 --156
NM_001039580chr474932 3526 1538 1180 1140 954 840 ------
NM_001039585chr183956 3474 3462 1634 1609 853 596 81 ------
NM_001039590chrX43505 3322 1566 1017 23316 1286 ----
NM_001039591chrX43505 3322 1566 1017 23316 1286 ----
NM_001039616chr19------123
NM_001039618chr1165900 5773 2207 1585 1107 991 --11334 25480 84
NM_001039697chr971404 1264 1223 1138 634 459 280 --1332 --
NM_001039762chr1052051 1675 932 895 824 --21743 641 --
NM_001039802chr121393 401 --11038 --
NM_001039840chrX115882 5065 4950 4436 4075 3995 2300 1458 1180 937 167 44135 3665 1998 1159 --24605 1018
NM_001039916chr1221038 932 2355 340 1155 --
NM_001039917chr1221038 932 2355 340 1155 --
NM_001039918chr1221038 932 2355 340 1155 --
NM_001039919chr1221038 932 2355 340 1155 --
NM_001039920chr1221038 932 2355 340 1155 --
NM_001039937chr1384045 3332 3131 3035 2714 580 138 37 12971 11141 --
NM_001040002chr172939 113 ------
NM_001040020chr71103 ------
NM_001040057chr72553 337 1545 ----
NM_001040100chr31425 ------
NM_001040110chr721852 1530 ------
NM_001040114chr16------1133
NM_001040142chr222346 939 21619 574 ----
NM_001040143chr222346 939 21619 574 ----
NM_001040152chr7105077 3850 3164 1704 1319 1134 851 456 352 339 44774 3484 1767 1248 33426 1269 93 13175
NM_001040153chr131363 ----1201
NM_001040157chr452630 989 564 418 355 1604 12640 --
NM_001040159chr43458 300 75 1535 ----
NM_001040181chr31204 ------
NM_001040182chr31204 ------
NM_001040183chr31204 ------
NM_001040199chr31204 ------
NM_001040200chr31204 ------
NM_001040202chr442050 1021 536 358 1186 ----
NM_001040214chr652215 1485 813 434 248 ------
NM_001040273chr1042107 2095 1839 576 1378 ----
NM_001040284chr16125978 5658 5272 5142 5117 4149 4134 3981 3938 1309 1302 639 --15021 13734
NM_001040402chr442913 1266 801 756 ----1240
NM_001040441chr175496 4540 1265 539 268 247 165 ----14122
NM_001040446chr552054 952 811 577 355 12419 ----
NM_001040450chr1522304 334 ------
NM_001040453chr1522304 334 ------
NM_001040619chr151619 1182 1137 656 618 31551 496 485 1127 --
NM_001040624chr822078 703 ------
NM_001040625chr822078 703 ------
NM_001040626chr822078 703 ------
NM_001040627chr822078 703 ------
NM_001040628chr822078 703 ------
NM_001040629chr822078 703 ------
NM_001040630chr822078 703 ------
NM_001040665chr754854 4675 4467 4248 1223 11011 --14943
NM_001040666chr72556 169 ----1645
NM_001040709chr16947 828 816 750 185 108 ------
NM_001040712chr933313 2752 310 --1806 --
NM_001042355chr16125273 5254 4749 4637 4328 4236 3578 1870 1407 502 121 56 --21160 1030 12019
NM_001042403chr122958 287 ------
NM_001042404chr161932 1846 1612 1587 432 172 ------
NM_001042412chr16125273 5254 4749 4637 4328 4236 3578 1870 1407 502 121 56 --21160 1030 12019
NM_001042413chr963821 3441 2822 1414 1184 608 21517 425 ----
NM_001042424chr432526 762 580 1855 12833 22728 167
NM_001042437chr22877 81 ------
NM_001042453chrX11711 --21367 657 1362
NM_001042459chr32248 55 ------
NM_001042473chr1022009 320 ----11537
NM_001042476chr1632189 1970 81 11401 --11776
NM_001042481chr1462565 670 657 445 240 93 ------
NM_001042492chr1773188 3004 2818 2798 2312 1120 396 --12932 --
NM_001042494chr15103806 3490 3447 2611 1444 1279 1023 678 473 431 --43638 3330 1000 52 --
NM_001042495chr15103806 3490 3447 2611 1444 1279 1023 678 473 431 --43638 3330 1000 52 --
NM_001042496chr15103806 3490 3447 2611 1444 1279 1023 678 473 431 --43638 3330 1000 52 --
NM_001042497chr15103806 3490 3447 2611 1444 1279 1023 678 473 431 --43638 3330 1000 52 --
NM_001042510chr8----22109 224 11867
NM_001042511chr8----22109 224 11867
NM_001042537chrX32256 2219 147 ------
NM_001042555chr1254639 1816 1323 461 137 24540 846 11089 --
NM_001042599chr287708 7293 6919 6894 5926 5754 5624 5470 37078 1292 857 57610 6131 2195 1523 868 12027
NM_001042601chr353072 3039 3016 2441 2073 1698 --22183 2009
NM_001042603chr1231981 1541 1393 --1174 --
NM_001042604chr363928 1072 1020 789 682 342 34256 3436 1608 11869 --
NM_001042646chr331670 1550 645 11248 11378 1489
NM_001042681chr142458 2229 2193 103 1494 ----
NM_001042682chr142458 2229 2193 103 1494 ----
NM_001042682chr142458 2229 2193 103 1494 ----
NM_001042683chr621627 589 ------
NM_001042749chrX51981 1822 1814 482 346 11438 ----
NM_001042750chrX51981 1822 1814 482 346 11438 ----
NM_001042751chrX51981 1822 1814 482 346 11438 ----
NM_001042762chr73877 786 335 1909 ----
NM_001043318chr1493710 3391 2710 2636 2575 1660 1485 1184 694 13152 33945 3252 1595 --
NM_001043351chr132100 1499 1425 11874 ----
NM_001044305chr621647 1082 --11278 --
NM_001044385chr2104069 3667 3648 2954 2525 1574 1330 1251 1203 203 --13635 --
NM_001044722chr51159 11978 2942 556 --
NM_001044723chr51159 11978 2942 556 --
NM_001046chr562833 2818 1132 971 781 368 168 ----
NM_001071775chr1321540 205 ------
NM_001079874chr111968 1378 1123 --
NM_001083620chr441697 777 335 298 ------
NM_001083621chr1103944 3816 3385 1772 1625 1170 1025 742 538 105 11061 1211 1797
NM_001095chr124641 339 181 160 11476 11267 --
NM_001096chr17------1614
NM_001099678chr3105989 5559 5452 5303 5123 4494 4179 2208 1060 633 31250 915 95 ----
NM_001100108chr1108237 7891 6651 6369 5496 5174 5105 3042 2220 1612 36923 1384 1192 31570 1536 1150 --
NM_001106chr3118845 8085 7398 7044 6711 6608 3617 3447 3373 2540 951 29678 3661 21600 709 12555
NM_001113490chrX53593 3286 2337 1196 445 23206 1163 ----
NM_001117chr1852003 1585 702 650 542 ------
NM_001119chr431424 370 204 --1445 --
NM_001128chr1653155 1039 782 182 23 --13804 1465
NM_001148chr452121 1881 1657 1497 527 --2369 328 --
NM_001149chr1011234 11135 ----
NM_001152chrX168 ------
NM_001155chr51455 1139 ----
NM_001167chrX41957 1362 1205 1172 55994 2228 1666 1512 1353 --25935 1199
NM_001173chr1454100 3851 3479 571 437 24351 3996 ----
NM_001177chr1221932 1733 --11530 --
NM_001178chr111434 ------
NM_001186chr2123295 1129 12918 ----
NM_001198chr63826 474 360 --12240 --
NM_001200chr2021166 978 ------
NM_001204chr296950 6443 6302 4907 1322 1058 808 485 91 26128 5597 11043 27178 6285
NM_001206chr942501 2404 2195 1073 ------
NM_001219chr722095 1732 2379 309 ----
NM_001241chr21244 12297 ----
NM_001241chr21244 12297 ----
NM_001253chr61217 181 ----
NM_001256chr1741150 1039 1031 672 --12327 --
NM_001257chr1651502 438 411 260 212 --1185 --
NM_001259chr785106 4632 4616 2541 2513 2409 1116 722 25389 606 ----
NM_001260chr13------1113
NM_001273chr121448 --1113 --
NM_001274chr11179 --1142 --
NM_001290chr4----2849 279 --
NM_001304chr1753318 1459 1359 981 139 12956 12731 11267
NM_001310chr1252779 2766 2699 700 514 ------
NM_001316chr202332 118 ------
NM_001329chr1021634 395 ----11407
NM_001331chr1132303 2200 1868 2954 352 ----
NM_001332chr521086 981 ------
NM_001346chr352126 619 550 509 177 12401 22612 1911 --
NM_001351chr341605 1590 1461 632 ------
NM_001356chrX2630 119 22226 2147 ----
NM_001358chr42402 147 ------
NM_001363chrX3525 175 64 ------
NM_001364chr1174442 4171 3371 3230 3107 1848 445 --23337 1918 --
NM_001378chr22456 173 --1465 --
NM_001379chr191199 ------
NM_001381chr2--2413 362 ----
NM_001385chr82277 112 1423 ----
NM_001386chr86982 735 724 647 546 57 --21576 348 --
NM_001387chr542744 1035 735 314 ------
NM_001389chr21--1247 ----
NM_001391chr181200 ------
NM_001396chr2162710 2337 2226 1960 493 227 12647 --2566 206
NM_001399chrX73040 2666 2608 2602 2591 2372 2321 --33462 3344 540 --
NM_001401chr931329 615 204 --133 --
NM_001406chr1751342 489 240 140 24 --3665 450 298 --
NM_001412chrX33046 1409 29 23641 342 33194 2932 2595 --
NM_001415chrX41350 753 393 141 ------
NM_001416chr17198 ------
NM_001417chr1221868 411 1434 11935 --
NM_001419chr1964432 3570 3080 3067 1784 1315 11885 13612 --
NM_001421chrX21395 609 --1545 --
NM_001423chr1231539 443 161 ------
NM_001426chr2----1228 --
NM_001438chr132975 512 427 --4379 306 204 29 --
NM_001447chr5----1482 1379
NM_001448chrX31649 1343 70 11631 ----
NM_001449chrX31264 1221 895 11304 ----
NM_001453chr641274 1257 650 417 ------
NM_001455chr674836 4747 3653 626 466 335 236 21948 829 34715 3924 1115 --
NM_001460chr153006 2970 2680 2662 1188 1926 --22309 52
NM_001463chr21702 ------
NM_001478chr125944 817 348 341 241 1663 --1257
NM_001482chr152818 682 1634 168 1779
NM_001493chrX1190 1124 2168 67 --
NM_001494chr102650 205 ------
NM_001514chr11145 ------
NM_001521chr23792 665 22 1811 1735 --
NM_001530chr141904 1716 21162 982 --
NM_001540chr7186 ------
NM_001542chr122654 1811 22023 306 1750 --
NM_001546chr641302 222 208 183 21328 1054 ----
NM_001550chr72183 85 ------
NM_001552chr171941 --11036 --
NM_001560chrX12192 --22295 56 21659 210
NM_001584chr1121061 493 --2873 75 --
NM_001587chrX102230 2002 1872 1805 791 645 588 359 352 164 1521 ----
NM_001604chr11--2700 219 ----
NM_001614chr172608 573 ------
NM_001614chr172608 573 ------
NM_001616chr253236 1223 1179 1072 853 ------
NM_001617chr251170 1110 1062 1012 834 --11289 --
NM_001629chr132248 80 ------
NM_001635chr71375 21101 196 --1993
NM_001649chrX42466 2394 2142 1931 --21683 419 1638
NM_001650chr1864119 3676 3625 1618 1382 679 23409 48 ----
NM_001655chr1141527 863 184 130 ------
NM_001656chr531691 1340 240 --11456 --
NM_001659chr1242674 886 341 315 --11018 21013 900
NM_001660chr32218 199 1756 ----
NM_001663chr1412137 11893 ----
NM_001664chr31127 ----1648
NM_001674chr141169 249 206 168 31101 46 35 ----
NM_001678chr1751607 1262 1216 737 518 --31633 1356 134 --
NM_001682chr1242658 2580 2511 1848 ------
NM_001688chr11311 --1187 --
NM_001690chr352549 2506 2215 725 249 11739 ----
NM_001693chr841159 1091 1068 812 1205 ----
NM_001695chr893709 3374 3114 2980 1417 1386 1343 131 94 11699 24128 1537 23593 449
NM_001699chr1921451 1232 ------
NM_001701chr941470 1327 1244 1165 11066 11293 --
NM_001703chr1------1226
NM_001704chr63512 448 203 ------
NM_001707chr7150 --1167 --
NM_001709chr1162090 1873 854 790 424 336 ----12056
NM_001731chr122815 306 ------
NM_001742chr721862 76 --183 1490
NM_001745chr561174 1044 840 380 158 48 ------
NM_001746chr532356 2060 282 ------
NM_001748chr11937 ------
NM_001754chr2163964 3239 2837 1464 1173 118 ------
NM_001755chr1692206 2015 1625 922 908 766 659 493 79 11845 ----
NM_001759chr1285046 4632 3571 3459 1963 1220 701 604 --23832 3210 11723
NM_001768chr221184 42 --11292 1108
NM_001777chr373726 3686 3553 2942 1176 736 555 1601 32706 2541 1308 --
NM_001788chr72928 722 2614 257 ----
NM_001791chr121393 401 --11038 --
NM_001796chr16138 ------
NM_001797chr161576 ------
NM_001806chr1932844 1127 611 12641 ----
NM_001812chr41321 ------
NM_001826chr1161 ------
NM_001830chrX93879 3128 2693 1582 1214 1098 689 569 423 --11389 1763
NM_001839chr1----1561 --
NM_001842chr9----1115 --
NM_001845chr1351028 1021 517 357 84 ------
NM_001854chr1--1246 --1336
NM_001855chr93883 329 299 --1313 --
NM_001859chr922881 278 13347 ----
NM_001873chr42681 264 --1191 --
NM_001874chr1284918 4547 2028 1136 998 860 382 117 15238 21219 1171 --
NM_001892chr551388 1077 493 443 182 ------
NM_001893chr171353 ------
NM_001901chr61317 --1421 --
NM_001921chr441239 1159 145 71 ------
NM_001924chr1--1450 ----
NM_001931chr112432 47 ------
NM_001933chr1411410 --2539 460 --
NM_001935chr22982 158 ------
NM_001936chr7----11225 --
NM_001938chr121898 97 ----11740
NM_001939chrX62658 2594 1519 663 568 36 62462 1179 839 757 607 233 23586 738 13305
NM_001940chr12------1527
NM_001942chr1811556 --21875 312 --
NM_001946chr1211102 --1184 --
NM_001949chr622149 398 --11136 --
NM_001968chr42656 117 124 ----
NM_001977chr441694 433 373 293 11596 ----
NM_001980chr1251937 842 466 66 28 ------
NM_001981chr131895 858 409 ------
NM_001987chr1254093 3434 2952 1138 648 ----13255
NM_001993chr11159 ------
NM_001999chr51944 ------
NM_002006chr475541 5237 4186 660 651 464 196 --25431 4844 --
NM_002009chr151740 32056 773 548 ----
NM_002015chr1332391 2322 522 --12835 12056
NM_002017chr113985 243 27 1228 ----
NM_002019chr132911 251 1225 --1762
NM_002023chr111038 21657 1245 ----
NM_002024chrX31784 1683 879 21815 837 --1340
NM_002025chrX118761 7773 6812 6305 5690 3054 2542 2363 1770 1411 253 33254 764 490 36783 6084 6066 27336 6502
NM_002040chr2122871 88 23008 2674 ----
NM_002044chr1551569 1459 555 186 82 --1494 --
NM_002047chr7--1121 ----
NM_002048chr921191 547 ------
NM_002054chr2------127
NM_002056chr21769 2662 116 ----
NM_002063chrX--11071 ----
NM_002071chr182681 636 ------
NM_002074chr131539 1522 75 ------
NM_002076chr1253053 2571 2253 1315 279 --23175 1024 --
NM_002077chr93571 292 197 ------
NM_002078chr3--151 ----
NM_002086chr1752224 2094 2051 1593 373 11390 1274 --
NM_002092chr484117 4063 3791 3752 1795 1289 695 58 14256 --13380
NM_002107chr1------133
NM_002126chr1764025 3528 2965 2956 2661 1249 ------
NM_002129chr41141 ------
NM_002131chr631339 1004 467 --1135 11052
NM_002140chr9190 ------
NM_002146chr172447 397 ------
NM_002158chr263614 2574 2380 1386 550 304 12880 --12701
NM_002176chr9150 ------
NM_002193chr241422 579 256 108 21793 1785 --11729
NM_002196chr201712 ------
NM_002196chr201712 ------
NM_002199chr41665 --1917 --
NM_002202chr51380 11076 ----
NM_002203chr543569 790 630 280 11644 22591 1556 --
NM_002207chr34606 131 84 60 --145 --
NM_002211chr1021086 1065 ------
NM_002214chr7145728 5693 4631 4550 4468 3949 3847 3655 2200 1569 1467 1040 870 283 23885 151 1642 --
NM_002223chr1243457 2765 2633 1533 33659 3052 1370 12594 13548
NM_002226chr143766 339 207 ------
NM_002227chr12808 497 ------
NM_002228chr141256 1195 1178 148 11138 ----
NM_002232chr11307 --2197 138 --
NM_002240chr21--1141 164 --
NM_002247chr1022114 924 ------
NM_002252chr22295 32 198 ----
NM_002253chr42225 165 ----1320
NM_002254chr242175 2119 931 488 --1405 --
NM_002264chr3115048 4906 4890 4567 4461 1836 1590 1459 854 584 56 3984 543 77 11158 11136
NM_002265chr173831 244 54 ------
NM_002267chr1342021 1901 449 22 ------
NM_002268chr31517 ----1379
NM_002270chr5135448 5220 5006 4206 4095 3850 3839 3572 2001 1640 1572 881 762 ------
NM_002271chr1322118 119 --21934 834 --
NM_002283chr123200 190 102 --1597 --
NM_002285chr2103878 3312 3286 3179 2964 2823 1382 1318 1078 1033 13614 12644 --
NM_002293chr172260 1772 974 780 524 277 175 --21710 1109 --
NM_002296chr131496 1094 458 ------
NM_002310chr5116631 5743 5721 5629 5414 4610 4293 4225 1825 502 79 31093 253 200 35026 4143 1266 --
NM_002334chr1141987 253 241 103 ------
NM_002336chr1284836 4465 3363 3267 1593 1421 1044 599 14101 --14350
NM_002351chrX21639 1385 1320 ----
NM_002355chr1251345 1274 1092 995 945 --21108 144 --
NM_002356chr662178 1875 1068 897 324 206 11042 ----
NM_002372chr5------1700
NM_002374chr272678 2558 2329 2290 1331 328 86 ------
NM_002376chr14----1100 --
NM_002387chr595167 5025 4494 4176 4061 3647 3187 1529 370 1699 24477 398 --
NM_002395chr621075 977 ------
NM_002401chr1721849 1802 ----12114
NM_002408chr142779 726 ------
NM_002409chr2233144 870 527 --12189 12544
NM_002445chr8198 2641 306 21158 28 --
NM_002451chr972904 2560 1400 1197 1021 655 36 --1270 --
NM_002469chr122311 69 ------
NM_002474chr16------1133
NM_002479chr1----126 --
NM_002480chr1231396 116 91 ------
NM_002486chr952283 2242 1736 242 97 2696 522 --1686
NM_002487chr152636 309 ------
NM_002499chr15----31633 900 585 1932
NM_002505chr651267 1134 1027 538 95 ------
NM_002514chr841091 986 805 455 --2855 102 --
NM_002515chr1421509 658 11628 --1799
NM_002518chr21934 1948 ----
NM_002542chr31209 ------
NM_002545chr1194931 4669 4513 3908 3370 2063 1157 954 548 --34654 596 320 24921 1058
NM_002570chr151198 1318 --1434
NM_002572chr112389 72 ------
NM_002576chr112907 142 1308 ----
NM_002581chr985547 5450 5314 4779 2139 1228 861 457 31217 1211 112 ----
NM_002582chr16----1858 --
NM_002586chr631287 565 228 --11161 21449 1408
NM_002588chr521158 500 1494 1321 --
NM_002599chr1131077 449 297 1403 ----
NM_002600chr151854 561 369 297 30 11266 ----
NM_002605chr151354 11108 ----
NM_002613chr1675322 4970 3333 2164 1980 1858 733 ------
NM_002620chr4268 50 ------
NM_002628chr321058 494 ------
NM_002629chr102880 106 ------
NM_002636chr6----2425 221 --
NM_002645chr111766 12396 ----
NM_002655chr854404 2016 1516 1230 594 --1743 --
NM_002657chr2063739 3163 3001 2729 2501 2490 12531 43238 1510 976 850 --
NM_002670chr34645 422 295 140 --11249 --
NM_002674chr12123 ------
NM_002687chr1471323 430 404 275 262 155 30 --11150 --
NM_002699chr11253 --11460 --
NM_002707chr21304 ------
NM_002709chr243024 2883 2567 989 ----1254
NM_002710chr123971 281 217 ------
NM_002713chr13409 225 129 ------
NM_002715chr51834 ------
NM_002716chr11113624 3531 3459 3273 2875 2493 2440 2349 1460 645 375 --12626 1292
NM_002717chr82441 253 ------
NM_002718chr332577 2567 1878 --12198 1595
NM_002719chr1441990 1866 1557 221 21858 551 --22271 308
NM_002729chr101110 168 ----
NM_002731chr152888 2724 772 674 78 1918 ----
NM_002736chr721734 751 ------
NM_002737chr1786225 5827 4783 2339 1644 1384 918 701 22071 67 1506 --
NM_002745chr2274439 4215 3796 3481 3309 579 335 43895 2848 1661 1146 24178 1653 --
NM_002748chr1521223 813 --1273 --
NM_002752chr52436 399 ------
NM_002755chr152842 305 ------
NM_002758chr172547 91 ------
NM_002764chrX5802 695 678 626 205 --1886 --
NM_002776chr1921652 1397 1461 2193 79 --
NM_002813chr1221502 180 --135 --
NM_002827chr2031696 1592 727 1529 2184 155 --
NM_002835chr73671 608 80 ------
NM_002837chr1263913 3539 2869 1739 820 357 33628 1328 1202 ----
NM_002839chr933313 2752 310 --1806 --
NM_002857chr182388 1093 953 928 810 595 533 525 21879 843 1729 --
NM_002868chr1221687 834 --22031 886 --
NM_002869chr111509 21697 1433 --1663
NM_002874chr921918 544 --22422 2001 --
NM_002894chr18195 ------
NM_002906chr112719 677 --1409 --
NM_002912chr63830 271 207 ------
NM_002924chr1----1503 --
NM_002930chr18169 ------
NM_002938chr441818 1509 1300 777 ----11353
NM_002942chr321098 270 ----11325
NM_002943chr151122 ------
NM_002945chr172586 567 ------
NM_002956chr1211211 21165 144 ----
NM_002958chr32698 282 1955 ----
NM_002959chr164065 3809 3657 3389 1457 253 13939 33956 3488 3128 --
NM_002968chr162821 141 ------
NM_002970chrX132 --1268 --
NM_002971chr3--1117 ----
NM_002977chr263273 985 655 313 108 91 --1956 --
NM_002994chr441512 1441 674 655 1458 ----
NM_002997chr241458 605 430 265 --21644 1537 --
NM_002998chr82699 109 21944 1924 ----
NM_003001chr161954 449 272 113 69 54 11892 2853 27 --
NM_003010chr1762430 2355 1831 1815 302 224 --21908 171 1789
NM_003011chr91658 --1624 --
NM_003014chr731292 1183 134 ------
NM_003016chr173712 422 354 1656 ----
NM_003026chr93912 551 183 1830 ----
NM_003027chr15----187 --
NM_003029chr131421 972 42 ------
NM_003030chr32559 150 ------
NM_003031chr162399 243 11020 ----
NM_003034chr1277202 6461 5164 3102 2436 1387 192 23140 3057 ----
NM_003035chr12649 95 ----1866
NM_003036chr131166 274 256 ------
NM_003042chr33710 670 639 12031 --21515 1390
NM_003043chr374274 4138 3867 3560 1302 494 381 33768 3148 59 --22966 2860
NM_003045chr1324313 4041 --21288 421 14184
NM_003051chr131750 1643 614 ------
NM_003068chr82309 202 ------
NM_003069chrX1761 ----1202
NM_003071chr321434 293 ------
NM_003072chr191130 ------
NM_003074chr321518 437 1186 --21478 237
NM_003076chr1251654 1638 1177 1156 165 ------
NM_003081chr20----1762 --
NM_003085chr51107 ------
NM_003091chr201182 ------
NM_003099chr15136211 5721 5618 5258 2638 2319 2136 1570 1502 1368 676 90 57 36185 1631 1480 11975 36075 6069 868
NM_003106chr3------11039
NM_003107chr652471 2326 2217 2195 2094 ------
NM_003108chr2127337 5473 5364 5025 4968 4619 4414 2847 1887 1368 1134 998 --24437 2151 16542
NM_003112chr752621 1014 783 274 111 ------
NM_003115chr11463 ------
NM_003128chr232715 945 387 12005 32630 1935 399 --
NM_003133chr12806 351 ------
NM_003137chr662084 1856 1782 1664 391 194 1651 5625 483 348 311 293 --
NM_003144chr612188 11976 1860 1577
NM_003149chr351375 1245 1038 589 399 ------
NM_003155chr84650 536 217 174 --1616 --
NM_003161chr1763558 3046 3006 2910 360 63 --1248 --
NM_003165chr941896 1448 1213 325 1587 31303 767 239 21281 34
NM_003178chr31295 1473 ----
NM_003185chr202462 225 11120 ----
NM_003188chr6----1551 --
NM_003189chr172976 2830 2567 2424 1355 1308 272 12289 1923 21297 487
NM_003198chr12273 109 ------
NM_003199chr1874639 4036 3823 3735 3480 2126 553 --11695 14993
NM_003203chr272173 1838 1685 898 687 562 480 ------
NM_003216chr2223333 2508 --2504 467 --
NM_003217chr1241941 1698 1599 1513 --1198 --
NM_003221chr673890 3841 3683 3561 1662 594 546 --23242 984 --
NM_003234chr331694 387 121 12125 --11502
NM_003242chr362514 2283 931 905 779 183 22174 974 1951 --
NM_003244chr18----1340 --
NM_003246chr1522021 783 --2426 219 --
NM_003253chr2131610 377 222 1254 ----
NM_003255chr1762642 2381 2073 962 438 247 2621 199 1209 --
NM_003257chr1531355 1213 1059 ------
NM_003262chr3115058 4513 4149 3603 3389 3237 1925 1767 1295 1181 96 33920 3815 2038 ----
NM_003275chr921509 456 ------
NM_003286chr2051119 1104 834 332 125 --1794 --
NM_003290chr19----194 --
NM_003291chr13--1592 1630 --
NM_003292chr132151 678 503 ------
NM_003298chr384680 4359 4066 2203 2145 458 176 38 1265 13833 --
NM_003304chr361517 1361 1245 1204 1081 121 ------
NM_003305chr42347 279 ------
NM_003314chr51100 ------
NM_003320chr1133335 1307 81 ------
NM_003326chr132532 1737 877 1206 22520 914 --
NM_003336chrX2823 393 --1127 --
NM_003337chr541124 1067 527 224 ------
NM_003338chr101395 21890 614 --1262
NM_003339chr521580 525 --1109 --
NM_003340chr42430 107 ------
NM_003342chr1743132 2992 2097 539 ------
NM_003345chr16----1131 --
NM_003347chr2232171 1873 528 1295 1552 --
NM_003348chr1231702 1578 275 11292 --1122
NM_003349chr2031541 562 215 11244 11138 --
NM_003350chr821001 371 1741 ----
NM_003363chr32535 60 ------
NM_003366chr161170 ------
NM_003369chr1122691 603 1318 1580 --
NM_003379chr64436 226 214 143 ------
NM_003383chr91190 ------
NM_003387chr222937 196 1675 ----
NM_003390chr112917 429 ------
NM_003392chr384267 4121 3415 3395 2775 2689 856 458 1593 1625 --
NM_003399chrX31021 743 734 --2953 131 --
NM_003400chr24757 737 197 165 ------
NM_003403chr141338 --142 --
NM_003406chr881756 1732 1698 1628 1516 1444 210 31 ------
NM_003409chr1811318 ------
NM_003410chrX42882 2073 740 648 ------
NM_003411chrY31231 664 611 ------
NM_003412chr342837 2709 2283 119 ------
NM_003413chrX32017 278 119 11681 ----
NM_003439chr783207 3032 1241 1191 809 426 184 130 33130 2810 668 12766 --
NM_003442chr11--1188 146 --
NM_003452chr91102 1917 ----
NM_003453chr13----1568 --
NM_003457chr171117 ------
NM_003471chr31198 21475 517 ----
NM_003473chr1021086 820 191 ----
NM_003474chr1032263 2158 319 22395 1962 ----
NM_003478chr11--23194 384 22542 2356 --
NM_003482chr1242699 2580 832 195 ------
NM_003483chr123878 620 498 ------
NM_003489chr2183052 2640 2629 2190 1062 1050 685 609 1886 ----
NM_003503chr151316 953 852 202 138 ------
NM_003507chr231866 1673 1456 ------
NM_003566chr1273175 2294 1358 1038 857 453 195 13439 --1932
NM_003567chr12441 54 ------
NM_003574chr1884862 4214 4141 3972 3733 3552 2320 918 15691 --1551
NM_003576chr1342338 961 910 369 --22277 52 --
NM_003580chr83570 374 181 ------
NM_003583chr1262521 1098 613 605 515 365 ----12977
NM_003589chr131144 11280 ----
NM_003590chr283087 2841 2721 1214 1149 951 619 217 44086 3147 1240 1068 1572 --
NM_003593chr171478 --1661 2673 558
NM_003603chr431901 1595 1421 ------
NM_003615chr353949 1328 1185 925 884 23447 780 ----
NM_003617chr1114414 4100 4044 3874 3353 3270 3098 1683 550 82 28 34390 997 239 34815 3807 3105 --
NM_003618chr211002 21264 894 ----
NM_003626chr1151019 923 510 475 281 ------
NM_003628chr2169 --1747 --
NM_003629chr162815 2586 2308 2231 848 75 ------
NM_003630chr61162 ------
NM_003633chr522086 910 11746 --12214
NM_003637chr151439 575 390 357 28 11266 ----
NM_003653chr17143 1224 ----
NM_003654chr11----1106 --
NM_003659chr231155 826 139 ------
NM_003660chr192670 41 ------
NM_003663chr393233 2832 2738 2146 2122 1161 1080 756 445 21383 490 ----
NM_003664chr52353 128 ------
NM_003672chr141922 1349 726 585 ------
NM_003679chr1102778 2727 2534 2420 2268 2255 1235 757 263 233 --11201 --
NM_003688chrX1262 ------
NM_003702chr82812 521 --190 --
NM_003705chr22320 304 ------
NM_003711chr5178 ------
NM_003713chr121366 449 --11182 11350
NM_003714chr532742 1058 249 --22194 843 --
NM_003716chr32975 230 ------
NM_003718chr7------1215
NM_003735chr521158 500 1494 1321 --
NM_003736chr521158 500 1494 1321 --
NM_003741chr3--1305 182 --
NM_003743chr221506 104 --12004 --
NM_003749chr1332022 833 548 1276 ----
NM_003759chr454088 4047 3517 2609 41 --13070 --
NM_003762chr131456 433 166 --1960 --
NM_003763chr2053213 3015 1975 1127 480 12456 1873 --
NM_003772chr1131051 879 397 188 ----
NM_003778chr3----1676 --
NM_003787chr1811630 ------
NM_003794chr3--1851 1865 1961
NM_003795chr61485 ------
NM_003796chr193207 104 31 ------
NM_003797chr111157 ------
NM_003798chr9171 ------
NM_003816chr821301 1091 1308 ----
NM_003831chr1821804 203 ------
NM_003838chr11318 --11603 --
NM_003846chr12706 592 ------
NM_003850chr131209 1441 ----
NM_003858chr141682 1165 1505 --
NM_003861chr1462741 2660 2353 2140 1985 590 --22331 1049 --
NM_003872chr22483 424 1974 1526 --
NM_003873chr1051915 1832 1000 743 720 22471 2091 ----
NM_003884chr331652 1619 1225 ------
NM_003888chr1541458 1331 1167 448 ------
NM_003895chr2132190 2179 1577 1114 ----
NM_003896chr22877 81 ------
NM_003899chr1342312 2102 1919 258 1752 ----
NM_003902chr1--1581 ----
NM_003913chr643992 3947 3517 3484 1902 14030 14159
NM_003927chr1821019 443 ------
NM_003930chr71678 11024 ----
NM_003931chr62472 82 ------
NM_003932chr2221732 1169 1249 1613 --
NM_003934chr911318 ------
NM_003938chr191984 --3767 207 182 --
NM_003941chr772314 2259 2250 2029 818 411 185 ------
NM_003943chr421052 308 11130 ----
NM_003945chr51497 ------
NM_003948chr442518 1945 1051 702 --154 --
NM_003953chr172888 2698 2428 1943 1035 715 181 32856 2443 24 12037 --
NM_003954chr1721348 276 ------
NM_003955chr1731481 585 276 1361 1601 --
NM_003958chr633648 1325 69 --11004 --
NM_003972chr101950 1167 ----
NM_003980chr641054 553 279 214 ------
NM_003983chr1664191 1613 1515 980 890 865 11564 11144 --
NM_003993chr1129 ------
NM_003994chr1263504 2718 1438 793 413 120 ----13946
NM_004006chrX32245 2213 781 --1525 --
NM_004007chrX32245 2213 781 --1525 --
NM_004009chrX32245 2213 781 --1525 --
NM_004010chrX32245 2213 781 --1525 --
NM_004011chrX32245 2213 781 --1525 --
NM_004012chrX32245 2213 781 --1525 --
NM_004013chrX32245 2213 781 --1525 --
NM_004014chrX32245 2213 781 --1525 --
NM_004015chrX32245 2213 781 --1525 --
NM_004016chrX32159 2127 695 --1439 --
NM_004017chrX32245 2213 781 --1525 --
NM_004018chrX32159 2127 695 --1439 --
NM_004020chrX32245 2213 781 --1525 --
NM_004021chrX32159 2127 695 --1439 --
NM_004022chrX32159 2127 695 --1439 --
NM_004023chrX32159 2127 695 --1439 --
NM_004024chr161528 1091 1046 608 565 527 31460 405 394 1127 --
NM_004028chr1864119 3676 3625 1618 1382 679 23409 48 ----
NM_004033chr51455 1139 ----
NM_004035chr17144866 4410 4220 4014 3962 3810 3614 3302 1793 1462 1317 1149 1125 796 13591 ----
NM_004036chr25629 607 487 469 264 ------
NM_004040chr221206 922 --11143 --
NM_004059chr94470 386 169 52 1421 ----
NM_004061chr52636 225 ------
NM_004063chr83788 239 63 --1651 --
NM_004067chr731004 580 272 ------
NM_004077chr1231229 1093 874 ------
NM_004081chrY31674 1632 94 ------
NM_004085chrX3803 122 101 ------
NM_004087chr32582 339 11448 ----
NM_004089chrX11212 ----1381
NM_004093chr1332175 2038 355 11268 ----
NM_004096chr1051637 1602 1501 823 700 --21442 693 --
NM_004100chr632567 1959 377 ------
NM_004103chr81826 ----1786
NM_004105chr21311 --1912 --
NM_004109chr1142209 1992 1554 157 --1873 --
NM_004113chr351777 1763 719 493 149 ------
NM_004114chrX--21057 780 ----
NM_004117chr622112 324 ------
NM_004124chr1473172 2777 2308 1107 1100 642 518 ----1169
NM_004134chr52700 661 --1637 --
NM_004136chr1542956 592 517 165 31125 547 72 --12065
NM_004156chr82576 415 ------
NM_004161chr241390 1315 1067 250 ------
NM_004162chr31396 1880 ----
NM_004170chr941908 1408 1358 1276 --11345 --
NM_004171chr11249280 8973 8502 8298 7308 6211 6070 5976 5964 3185 3058 2943 2775 2527 2463 2248 2046 1932 1644 1446 1110 977 555 47 69429 7744 6184 3378 1401 1005 16531 27381 6262
NM_004180chr24504 458 244 175 ------
NM_004185chr12502 63 --1624 1647
NM_004186chr32932 585 --1173 --
NM_004202chrY135 ------
NM_004205chr111516 ------
NM_004206chr33587 229 41 ------
NM_004219chr5150 ------
NM_004225chr831203 241 60 11157 ----
NM_004229chrX61635 1610 1486 597 579 175 1456 1667 1848
NM_004232chr1873520 3035 2898 979 881 275 22 11108 1674 --
NM_004235chr92216 138 ------
NM_004236chr153477 373 27 157 ----
NM_004261chr13886 684 26 --1212 --
NM_004279chr71742 ------
NM_004290chr541389 1031 384 48 --1372 --
NM_004293chr933703 3143 2687 22982 178 12448 --
NM_004296chr1463146 2777 1601 987 895 781 1359 --1581
NM_004301chr3183 ------
NM_004302chr1222304 2107 --12790 11031
NM_004319chr142792 2420 647 143 --12236 13126
NM_004329chr1021256 196 1961 --11107
NM_004330chr151775 --1305 --
NM_004331chr842612 1732 1668 553 ------
NM_004337chr861837 1541 801 429 256 160 --11558 --
NM_004338chr1885289 5132 5023 4520 2644 1602 1369 684 15958 46048 4694 2024 976 --
NM_004342chr742131 1731 1699 1478 ------
NM_004349chr82864 116 11316 --165
NM_004362chr43768 188 93 ------
NM_004365chr53125 102 44 ------
NM_004370chr631826 818 591 11410 ----
NM_004379chr221220 635 ----1484
NM_004380chr1642425 2374 2216 2208 --12408 --
NM_004384chr51159 11978 2942 556 --
NM_004389chr22675 580 ----1242
NM_004392chr1321703 424 ----12433
NM_004397chr1183898 3775 3324 3220 2806 491 367 93 --11669 --
NM_004405chr22985 847 149 ----
NM_004426chr124643 461 340 307 11900 1590 --
NM_004427chr111036 ------
NM_004428chr12649 556 --1547 --
NM_004429chrX----1959 --
NM_004432chr941803 921 245 132 12060 ----
NM_004434chr1421384 670 21526 353 1549 --
NM_004438chr252815 2544 2387 2248 351 --12957 --
NM_004441chr32999 403 ----1307
NM_004446chr1164 ------
NM_004454chr342262 2010 1724 489 ------
NM_004457chr211077 11402 --11144
NM_004458chrX2466 106 11682 ----
NM_004464chr463844 3762 3435 918 656 31 11356 ----
NM_004480chr14----1700 --
NM_004484chrX2264 105 ------
NM_004487chr331229 1094 48 ------
NM_004492chr15----133 --
NM_004496chr143888 331 280 ------
NM_004498chr151332 --1270 --
NM_004499chr51118 ------
NM_004500chr1432027 1530 83 199 41383 740 530 127 --
NM_004501chr1104079 3600 3432 3298 3151 2893 1548 1337 1081 898 21361 441 1487 --
NM_004504chr232124 705 486 1944 ----
NM_004505chr1741514 746 705 111 21359 773 ----
NM_004513chr1563890 3564 3137 2820 2765 659 21425 69 --12388
NM_004516chr1921236 951 ------
NM_004520chr52683 260 ------
NM_004525chr241191 1015 280 138 ------
NM_004527chr172939 113 ------
NM_004529chr931109 1064 1058 --11412 11454
NM_004532chr3------146
NM_004537chr1231522 1360 1351 21554 1186 ----
NM_004556chr62409 252 125 ----
NM_004569chr143774 530 130 ------
NM_004578chr12915 85 ------
NM_004580chr1551874 1681 539 448 51 ------
NM_004583chr171241 ------
NM_004586chrX55135 4724 4682 4016 3654 ----14921
NM_004598chr533068 2579 2351 32708 2538 2271 ----
NM_004612chr941776 1451 1270 327 1912 13933 1415
NM_004615chrX1668 1894 ----
NM_004631chr1------11095
NM_004637chr331307 1041 313 1980 ----
NM_004642chr122686 32 ------
NM_004654chrY31349 472 437 ------
NM_004655chr1711048 1364 ----
NM_004657chr22339 23 1971 ----
NM_004660chrY41566 626 555 118 12148 ----
NM_004661chr541110 1030 921 39 ------
NM_004663chr1521591 615 ------
NM_004673chr131461 1112 557 ------
NM_004685chr13--12738 ----
NM_004686chr831206 432 307 --21559 724 --
NM_004687chr1781454 1429 808 461 181 129 118 51 ------
NM_004690chr64652 607 536 153 ------
NM_004696chr11232 2831 788 ----
NM_004703chr1722322 50 22548 744 ----
NM_004709chrX1431 --11296 --
NM_004713chr14--1819 ----
NM_004719chr1242457 1108 251 184 ------
NM_004725chr1031228 1186 345 ------
NM_004726chrX75319 5110 4216 2222 1365 1198 823 24470 1058 13836 --
NM_004730chr5----12120 1474
NM_004733chr3122 ------
NM_004736chr131862 51 27 ------
NM_004741chr1021371 630 21014 287 1149 1562
NM_004742chr3----1126 --
NM_004744chr453528 2687 2407 327 187 11090 --12716
NM_004745chr856851 6737 6220 4641 2631 36953 957 921 56490 5998 5521 5171 108 14827
NM_004748chr151555 43272 1436 1153 589 --24083 1429
NM_004764chr121203 ------
NM_004768chr14789 443 424 319 ------
NM_004772chr521110 182 ------
NM_004774chr1742884 2823 2444 2395 22733 2470 ----
NM_004779chr53879 355 71 1412 ----
NM_004788chr1152041 1693 964 718 454 1473 ----
NM_004798chr2053130 816 741 427 201 --2862 846 --
NM_004805chr221001 317 --11205 --
NM_004808chr1042321 2179 799 245 12751 1190 --
NM_004815chr184425 4365 4335 4087 3863 3448 485 144 24888 1491 14548 --
NM_004820chr8151 1427 ----
NM_004827chr461969 1733 1645 1606 668 333 132 ----
NM_004831chr19134 ------
NM_004840chrX62009 828 766 516 394 43 11995 11933 --
NM_004841chr111129 ----2858 852
NM_004845chrX44145 3203 2936 1094 ----14173
NM_004849chr61504 ----135
NM_004850chr231330 419 332 21343 1193 ----
NM_004857chr1474007 3451 1718 1583 1310 1184 953 14116 ----
NM_004859chr1752658 2599 2355 2200 686 ------
NM_004866chr554651 4181 1243 538 234 55062 4791 3402 1989 1428 11477 --
NM_004869chr181405 ------
NM_004884chr1521454 120 ----149
NM_004896chr103607 401 369 ------
NM_004898chr482753 2621 2413 1956 1138 1066 685 535 11975 --11087
NM_004902chr20156 --1173 --
NM_004904chr7106122 4717 4294 4202 1734 1565 1433 429 301 53 14741 11416 --
NM_004921chr151803 1622 632 242 99 ------
NM_004922chr1041031 900 212 162 ------
NM_004929chr861346 1196 1148 957 393 141 ------
NM_004932chr531475 1324 687 1584 21586 1333 --
NM_004947chr352347 2218 2120 834 727 1928 ----
NM_004956chr744476 3565 1134 629 23228 826 ----
NM_004965chr212481 309 1770 ----
NM_004966chr102823 396 ------
NM_004969chr102511 71 1432 ----
NM_004972chr931189 893 407 --1866 --
NM_004976chr1145106 4249 1875 1397 24715 3472 34825 1746 634 --
NM_004985chr1243504 3387 1818 1428 1829 11783 11724
NM_004992chrX107087 6265 6180 5386 5186 2607 2046 1985 1377 952 23248 2029 67751 7686 6005 1281 1255 760 1748
NM_004992chrX107087 6265 6180 5386 5186 2607 2046 1985 1377 952 23248 2029 67751 7686 6005 1281 1255 760 1748
NM_004993chr1441243 1058 179 47 --11359 --
NM_004996chr1681713 1678 1628 1497 1308 1209 691 576 --1462 --
NM_004999chr694081 3579 3522 1592 1227 1011 920 405 233 13793 1274 --
NM_005006chr22953 65 3929 297 271 ----
NM_005010chr75897 873 649 446 47 11772 ----
NM_005011chr721852 1530 ------
NM_005020chr7150 --170 --
NM_005023chr511538 21031 376 ----
NM_005028chr1052324 2243 1861 775 97 11815 --1129
NM_005045chr72363 56 ------
NM_005063chr1073523 3274 3101 2947 442 234 208 23540 469 12505 1975
NM_005065chr1454831 4046 3757 366 320 ----14839
NM_005066chr11715 1616 ----
NM_005068chr621400 516 1347 ----
NM_005079chr843102 2727 772 62 1167 ----
NM_005087chr31859 ------
NM_005095chr1195 --12172 1229
NM_005096chrX41025 166 96 26 --11010 --
NM_005109chr361906 864 707 406 369 308 --11784 --
NM_005114chr41645 ------
NM_005116chr2064205 4096 3693 670 266 105 24255 3131 11569 23586 3081
NM_005119chr1----11065 11042
NM_005121chr1773510 3310 2992 2614 1165 818 80 32936 2847 1278 ----
NM_005135chr15103806 3490 3447 2611 1444 1279 1023 678 473 431 --43638 3330 1000 52 --
NM_005151chr1832431 897 409 --1425 --
NM_005157chr951954 1923 1842 1801 224 --11328 --
NM_005159chr1562140 1943 1826 1509 1446 84 12239 ----
NM_005164chr1242658 674 614 55 12017 --12355
NM_005168chr21140 ----1434
NM_005180chr101468 157 1362 --
NM_005182chr16----140 --
NM_005188chr11107927 7848 6842 5658 3125 3108 2615 2257 1768 874 27795 2563 36646 5691 638 18124
NM_005197chr1476093 5159 2236 2005 1714 650 616 25418 1639 15468 14483
NM_005203chr101101 ------
NM_005206chr1741104 998 509 246 ------
NM_005207chr2233302 678 412 ------
NM_005215chr183758 711 583 ------
NM_005220chr1721479 64 --1314 --
NM_005222chr71829 --1141 --
NM_005229chrX2928 129 ------
NM_005233chr33824 509 61 ------
NM_005235chr287708 7293 6919 6894 5926 5754 5624 5470 37078 1292 857 57610 6131 2195 1523 868 12027
NM_005241chr32388 185 --1295 --
NM_005244chr203623 509 479 ------
NM_005252chr14--1668 183 --
NM_005254chr1531434 1409 493 ------
NM_005259chr21297 ----1433
NM_005271chr1031023 999 30 1445 11061 1125
NM_005275chr6----123 --
NM_005277chr421414 478 ------
NM_005292chr13--1125 ----
NM_005296chrX2982 838 1803 ----
NM_005311chr742767 732 540 278 11841 ----
NM_005312chr951948 1844 983 524 411 12494 22657 2578 --
NM_005324chr1742118 812 800 122 1696 ----
NM_005328chr82554 152 ------
NM_005336chr221909 370 21946 804 --11524
NM_005337chr122422 297 ------
NM_005339chr463840 3423 1209 1017 425 103 ------
NM_005342chrX62720 2702 2158 1927 604 593 ------
NM_005347chr951445 1181 636 535 212 1103 ----
NM_005358chr1331447 501 245 ------
NM_005359chr1895612 5233 4898 3962 2184 1748 1680 351 238 --11949 --
NM_005378chr21855 ------
NM_005387chr112260 182 --1599 --
NM_005392chr92713 22 21334 506 ----
NM_005398chr1051444 1233 1145 528 519 11083 11006 --
NM_005399chr194241 2950 2808 2788 2776 1281 1105 574 367 --22764 961 13383
NM_005400chr292828 2169 2139 2122 2106 971 955 881 655 ------
NM_005402chr721586 636 ------
NM_005407chr1431282 237 212 --21382 1141 --
NM_005413chr21429 ------
NM_005414chr31113 ------
NM_005417chr2041483 1428 482 98 ----1766
NM_005433chr1822808 89 22710 475 ----
NM_005434chr231164 720 138 --21276 522 --
NM_005436chr1074032 3749 3243 2622 2553 1204 702 2715 228 1322 --
NM_005437chr1021453 270 --1914 --
NM_005439chr121494 ------
NM_005440chr1792951 2711 2131 1193 1022 750 735 373 344 33191 774 418 --12154
NM_005455chr13419 125 75 1561 ----
NM_005465chr162039 1752 1629 1427 791 336 21654 131 --135
NM_005475chr1263179 3126 2873 2147 996 866 --1741 --
NM_005479chr1021472 509 ------
NM_005493chr62268 197 ------
NM_005494chr71660 ------
NM_005497chr1764935 4800 2460 2024 1859 278 1102 ----
NM_005499chr191665 ------
NM_005501chr174981 745 410 171 ------
NM_005502chr922565 628 42530 2110 1087 338 --32377 765 417
NM_005503chr1511003 ------
NM_005509chr52760 624 11457 176 1483
NM_005512chr1121686 1477 1263 11284 --
NM_005522chr731004 352 345 ------
NM_005524chr31324 ------
NM_005527chr63261 165 24 ----162
NM_005544chr22117 53 1175 --1275
NM_005546chr552184 884 820 306 157 52164 2033 1663 1608 60 1917 --
NM_005552chr141525 ------
NM_005574chr113705 477 21 --163 --
NM_005575chr52712 163 ------
NM_005578chr3104964 4837 4338 3775 1145 990 893 509 455 413 11137 11586 11842
NM_005587chr152885 340 ------
NM_005593chr121447 ------
NM_005596chr945883 4232 2280 39 26052 4477 25565 1799 14552
NM_005602chr351180 494 266 173 128 1970 ----
NM_005604chr62819 186 12530 ----
NM_005607chr82946 349 21005 88 ----
NM_005610chr11795 ------
NM_005613chr122206 1604 ------
NM_005625chr831045 399 198 ------
NM_005627chr62939 93 --1175 --
NM_005637chr183833 489 88 ------
NM_005638chrX5679 607 600 542 407 ------
NM_005639chr121503 ------
NM_005644chr1----175 --
NM_005647chrX63250 2224 1277 587 543 75 22479 165 ----
NM_005651chr41299 ------
NM_005652chr1621088 913 --1190 --
NM_005655chr841274 1181 486 469 ------
NM_005665chr143878 3048 1471 318 24459 1427 ----
NM_005667chr22332 274 ------
NM_005668chr544549 2835 1061 577 --2762 398 24099 1746
NM_005684chr11282 ------
NM_005711chr511062 2921 896 ----
NM_005715chr622032 247 173 22298 1002 --
NM_005717chr11997 --1222 --
NM_005721chr21777 ------
NM_005722chr22956 850 ------
NM_005730chr1243364 979 790 503 23216 898 11132 --
NM_005734chr112321 202 ------
NM_005737chr252878 2817 2807 2250 1064 --22893 786 --
NM_005738chr71347 ------
NM_005739chr1531878 1523 863 ------
NM_005741chr162234 106 1891 ----
NM_005746chr752334 2261 2072 1101 629 11763 ----
NM_005748chr1252318 1235 1080 471 316 33301 3144 3021 ----
NM_005749chr171470 ------
NM_005756chrX2532 103 ----11328
NM_005759chr224402 3245 14128 1559 --
NM_005765chrX2785 256 ------
NM_005779chr533671 3556 1011 ------
NM_005795chr252630 2150 2088 725 470 ------
NM_005813chr251750 1641 983 830 267 ------
NM_005814chr121445 451 --148 --
NM_005819chr172996 2934 2602 2291 778 357 100 22830 912 ----
NM_005826chr1293 59 ------
NM_005828chr1795023 4728 4223 1600 1111 1066 920 749 558 ------
NM_005832chr321224 58 ------
NM_005836chr8166 ------
NM_005839chr13739 662 190 ------
NM_005840chrX117621 5466 5206 4715 2494 2321 2096 1574 616 155 69 25693 5226 --25699 541
NM_005842chr131676 ------
NM_005843chr221830 1507 ------
NM_005862chr31966 2865 844 ----
NM_005870chr131223 ------
NM_005871chr102977 278 158 ----
NM_005880chr161599 ----1191
NM_005885chr541220 449 272 177 ------
NM_005898chr1163028 2717 2394 1293 862 223 12830 --13156
NM_005900chr42814 224 ------
NM_005901chr18157917 7497 6888 6840 6414 6217 5708 5254 3248 2376 1513 1445 935 645 607 37637 2208 760 28331 5720 --
NM_005902chr1564579 4265 3469 3405 2849 1423 13945 11272 --
NM_005904chr1811021 --1150 11174
NM_005906chr621614 1499 ------
NM_005907chr631646 489 185 ------
NM_005909chr554169 3220 1695 678 540 21718 1450 ----
NM_005910chr1754049 3785 3346 2877 206 --13683 --
NM_005917chr21186 ------
NM_005920chr143826 3585 1035 194 --23602 3223 --
NM_005923chr6258 21 ------
NM_005924chr711166 11062 --128
NM_005930chr141660 1121 ----
NM_005933chr1142517 2232 1861 513 11970 --1365
NM_005935chr475265 4021 3599 3389 3215 2087 1544 ----13351
NM_005937chr1744017 3597 3273 1036 24039 1314 ----
NM_005941chr873589 3008 2803 2698 1449 1142 858 21265 743 ----
NM_005944chr321092 849 --186 --
NM_005955chr165167 4937 4928 3980 2082 1163 34379 4372 118 15030 13843
NM_005962chr1061734 943 763 713 671 533 12113 1319 --
NM_005962chr1061734 943 763 713 671 533 12113 1319 --
NM_005964chr1741296 1289 1086 151 --1997 --
NM_005966chr222023 1975 ------
NM_005968chr191214 ------
NM_005977chr131319 ------
NM_005990chr562417 2190 2061 1858 332 239 --160 --
NM_006007chr943507 3313 871 593 --13732 12904
NM_006011chr15104341 4076 3923 3884 3803 3665 3170 1589 1148 275 --23363 1025 --
NM_006016chr61626 1481 ----
NM_006036chr22976 176 1922 1382 --
NM_006040chr1651064 885 507 264 257 11030 ----
NM_006047chr2022227 2175 2464 34 ----
NM_006054chr1131304 1141 485 --31379 1366 147 11374
NM_006055chr262722 2641 2561 2059 1169 1159 12862 ----
NM_006058chr5135 ------
NM_006060chr794123 3748 3305 3239 3123 2985 1113 891 700 14195 ----
NM_006070chr31321 ------
NM_006073chr642259 1571 1530 883 ------
NM_006080chr732786 2082 2027 11919 --12142
NM_006089chrX21361 483 21865 35 ----
NM_006090chr14581 264 185 154 ------
NM_006095chr464500 3842 3094 3052 1602 452 11279 12847 --
NM_006099chr12823 773 ------
NM_006106chr1163272 3196 2894 2503 981 139 1867 ----
NM_006113chr111968 1378 1123 --
NM_006133chr1152272 1550 1525 442 304 2782 416 32358 1738 604 --
NM_006134chr2121545 290 11237 ----
NM_006135chr131440 390 295 --1489 --
NM_006136chr721169 403 --11008 --
NM_006147chr12446 125 ------
NM_006148chr1752824 2206 2062 74 54 --1328 --
NM_006154chr1532850 2590 760 12278 ----
NM_006158chr831823 1322 36 --11817 --
NM_006166chr1262514 2489 1750 1722 1638 842 1825 ----
NM_006178chr1751468 1375 1222 525 451 21303 68 ----
NM_006180chr941877 1833 66 25 21997 1399 ----
NM_006183chr12--1186 ----
NM_006186chr22431 235 1288 ----
NM_006191chr121726 1620 ----
NM_006194chr141531 --1140 --
NM_006195chr931150 969 513 ------
NM_006197chr812278 11635 ----
NM_006201chrX----2426 78 --
NM_006203chr565348 5327 4082 2228 1769 1665 15363 14197 24400 210
NM_006206chr432219 1925 404 1745 ----
NM_006212chr195311 4538 3783 2003 1423 1266 1006 328 204 34660 362 253 ----
NM_006216chr2171 ------
NM_006224chr1762521 1861 938 906 443 114 ------
NM_006237chr1352060 1854 725 396 105 --21673 154 --
NM_006239chr4177 1220 ----
NM_006243chr13969 660 408 21043 771 ----
NM_006245chr61972 ----1353
NM_006246chr1431144 1070 499 --3851 517 467 --
NM_006251chr533018 598 452 --13193 --
NM_006252chr187181 7166 5988 5848 3007 2573 1766 169 1895 ----
NM_006255chr143752 715 54 ------
NM_006256chr152586 2466 2280 1737 154 ------
NM_006265chr82466 170 ------
NM_006281chr821130 223 ------
NM_006281chr821130 223 ------
NM_006290chr631821 1774 69 1461 ----
NM_006298chr6102738 2675 2574 1280 1182 1101 966 887 686 238 ------
NM_006304chr7152 ------
NM_006306chrX64435 3685 2020 1525 1433 1255 14709 34397 1721 1463 --
NM_006310chr1711100 1871 ----
NM_006313chr1231571 495 128 ------
NM_006317chr54790 645 601 595 --1638 --
NM_006327chr10278 52 ------
NM_006334chr91291 ------
NM_006345chr421385 324 1425 ----
NM_006350chr51329 ------
NM_006357chr21126 --144 --
NM_006359chrX32256 2219 147 ------
NM_006363chr202504 241 2638 451 ----
NM_006366chr611189 ------
NM_006367chr13777 249 195 ------
NM_006371chr364956 4582 3401 1575 1149 1038 34911 540 179 ----
NM_006380chr1743862 3545 1122 358 12909 12741 14290
NM_006386chr2252454 2241 1695 1635 706 ------
NM_006393chr1093228 2960 2830 1650 1231 1160 961 385 113 --14271 --
NM_006411chr62389 120 1136 140 --
NM_006420chr2053124 2669 2623 894 104 12965 11335 --
NM_006425chr541107 1003 86 46 --1362 --
NM_006430chr24499 491 212 200 ------
NM_006434chr102784 771 1906 ----
NM_006439chr41191 ------
NM_006451chr51307 --1381 --
NM_006457chr464016 3521 2902 1223 853 276 23980 3680 ----
NM_006465chr1552267 2192 1993 889 830 1578 2798 721 --
NM_006469chr121253 1131 1549 ----
NM_006475chr131245 ------
NM_006476chr113725 567 505 --1697 --
NM_006482chr1262521 1098 613 605 515 365 ----12977
NM_006489chr1421509 658 11628 --1799
NM_006496chr141606 619 476 296 ------
NM_006504chr1052917 2529 2355 1991 92 21136 1065 1820 --
NM_006517chrX41859 1548 929 180 12327 ----
NM_006519chr6----291 49 --
NM_006520chrX31729 343 55 21543 1169 ----
NM_006534chr2032386 926 94 13263 ----
NM_006536chr13960 953 880 ------
NM_006538chr223005 231 21669 413 --13863
NM_006540chr8--11359 ----
NM_006541chr10--176 --1204
NM_006544chr14106044 3683 2253 2191 2065 1223 381 288 260 236 ------
NM_006546chr1746513 5421 2052 417 24937 4526 26526 6196 1724
NM_006547chr721742 1587 ------
NM_006561chr1045492 1542 1246 390 35962 3837 2413 12450 153
NM_006565chr162883 60 1981 ----
NM_006572chr17113396 2981 2593 2398 2220 1368 1099 790 505 405 322 33022 2843 921 ----
NM_006575chr142438 243 2472 406 ----
NM_006593chr22581 268 ------
NM_006595chr1152019 1350 363 333 73 ------
NM_006599chr16157985 7545 7455 7179 6981 5881 3186 2540 2510 1700 1612 1518 936 771 543 36492 5503 3053 13222 1198
NM_006602chr203229 201 21 --1332 --
NM_006603chrX51981 1822 1814 482 346 11438 ----
NM_006609chr222309 170 1444 1964 --
NM_006614chr353418 2673 1305 1275 129 1818 ----
NM_006618chr121491 1428 31246 1140 413 ----
NM_006620chr62781 689 14832 23202 3147 21920 843
NM_006621chr142015 1262 673 121 11420 ----
NM_006624chr1032081 1387 738 ------
NM_006626chr91136 1592 11680 --
NM_006628chr1574155 2858 1856 1815 1418 573 329 11244 13955 --
NM_006629chr1841873 1861 891 323 11813 ----
NM_006633chr52775 264 ------
NM_006654chr1254639 1816 1323 461 137 24540 846 11089 --
NM_006670chr61444 1410 188 --
NM_006698chr201303 1148 21124 556 --
NM_006699chr152579 2358 2079 1683 849 ----126
NM_006703chr62335 58 ------
NM_006704chr13170 ------
NM_006706chr5----1256 --
NM_006710chr21759 --1839 131
NM_006717chr923238 2293 13387 12635 --
NM_006722chr362330 2025 1953 1043 990 775 ------
NM_006727chr51389 ------
NM_006729chrX75157 4194 4050 3830 3523 1864 465 24463 3655 --23592 1606
NM_006731chr952265 2079 2032 1985 152 55742 4305 3826 996 843 --22330 1666
NM_006735chr71358 1291 ----
NM_006736chr241730 1308 673 80 --1541 --
NM_006742chr1621982 466 2474 163 11712 --
NM_006749chr841052 1004 979 90 ------
NM_006750chr16107889 6514 6200 5622 2065 1743 1721 1133 939 814 37470 506 236 37457 7081 5237 --
NM_006751chr21250 ------
NM_006754chr721200 997 2316 189 ----
NM_006759chr21217 ------
NM_006763chr121865 174 21575 1469 ----
NM_006766chr862483 2401 2342 2263 1644 161 --11794 11914
NM_006769chr11262 ------
NM_006774chr72477 184 --4666 494 148 122 --
NM_006775chr642538 2077 288 175 ------
NM_006777chrX62870 2177 2085 909 775 343 1387 ----
NM_006788chr1831697 96 53 ------
NM_006790chr52166 148 ------
NM_006791chr15--1641 1459 --
NM_006807chr17--1328 ----
NM_006811chr202865 375 ------
NM_006814chr2072636 1734 906 684 667 504 308 --21779 41 --
NM_006823chr821217 250 21258 1040 ----
NM_006825chr121611 ------
NM_006826chr2----122 --
NM_006827chr1463020 2787 2589 825 377 79 12365 --12473
NM_006851chr1242441 872 790 176 --12305 --
NM_006854chr771912 1851 1649 1613 1598 1493 183 --21956 1787 --
NM_006856chr1221008 68 126 ----
NM_006870chr205654 554 318 116 47 ------
NM_006873chr243378 3240 2474 552 22612 2441 ----
NM_006874chr421126 314 ------
NM_006884chr32559 150 ------
NM_006885chr1653506 2813 1325 1117 189 33167 1228 503 23518 2934 --
NM_006888chr1493115 2900 2644 2308 1308 1071 711 547 107 ------
NM_006908chr741513 921 292 223 ------
NM_006913chr61352 1307 ----
NM_006914chr91246 11443 ----
NM_006918chr1175265 5155 4913 3776 1398 1275 1077 14076 45602 3715 2274 613 13637
NM_006920chr21413 11495 ----
NM_006922chr262597 2392 1044 933 791 331 12527 22334 864 --
NM_006924chr1753903 3260 1441 869 125 ------
NM_006930chr531655 1403 1279 ------
NM_006937chr172397 95 ----161
NM_006939chr14--2221 186 1434 --
NM_006940chr1221583 707 1356 11400 161
NM_006943chr2033342 2205 643 12851 1284 --
NM_006947chr441393 430 260 243 --1149 --
NM_006955chr1053415 3097 1195 1050 87 22967 2470 12707 --
NM_006965chr182915 435 1140 ----
NM_006981chr952678 2426 1915 829 789 ------
NM_006982chr12148 ------
NM_006997chr101450 ------
NM_006999chr521375 1320 ----1167
NM_007005chr91554 1205 160 --
NM_007007chr1284245 4145 4011 3954 3344 3173 1556 1418 ------
NM_007008chr23317 192 33 ------
NM_007010chr1731386 741 260 --11295 --
NM_007011chr1576692 6502 5296 4742 2644 821 780 1723 ----
NM_007013chr8189 11003 1164 1220
NM_007015chr131285 ------
NM_007023chr231078 420 122 11102 1262 --
NM_007035chr122646 305 ------
NM_007036chr5----2843 821 --
NM_007038chr2196034 5486 4920 4745 4621 4299 4287 1825 639 15203 1399 14514
NM_007040chr192689 420 ------
NM_007042chr352585 1750 1652 734 313 --11803 --
NM_007052chrX1228 149 ----
NM_007054chr563601 3264 3188 2745 502 471 23278 44 ----
NM_007067chr1741160 518 316 107 --11152 --
NM_007076chr121106 ------
NM_007078chr1032195 1898 376 --11133 --
NM_007106chr1332115 2041 145 11877 ----
NM_007111chr13----1873 --
NM_007114chr332667 2344 2201 1281 ----
NM_007118chr5----127 --
NM_007124chr632014 1833 1263 ----11619
NM_007139chr721116 149 1188 ----
NM_007146chr1722395 614 22711 2213 ----
NM_007153chr1934295 2844 797 5455 293 202 117 33 11591 --
NM_007158chr121112 429 ------
NM_007166chr1121264 1185 2454 60 ----
NM_007172chr2273000 2993 2401 1155 626 506 94 21307 1219 22554 1324 12598
NM_007174chr1221553 31 --1593 22196 610
NM_007184chr34556 392 118 89 ------
NM_007187chr132714 333 ------
NM_007192chr144413 320 270 30 --11000 --
NM_007195chr1873090 2755 1405 1270 1039 892 817 13244 ----
NM_007202chr17----1680 --
NM_007203chr933926 3322 2952 21571 119 --12587
NM_007212chr121896 619 31452 511 466 ----
NM_007214chr621350 252 --1549 --
NM_007216chr113898 386 117 1808 ----
NM_007217chr31143 ------
NM_007218chr84787 709 671 71 ------
NM_007236chr1562464 2049 1714 1579 260 58 1811 3679 408 252 --
NM_007238chr2054310 3655 3611 1341 335 31170 1019 823 24775 3927 --
NM_007246chr4--11016 ----
NM_007249chr13229450 9173 8601 8578 8286 7457 6996 6020 5878 5780 5733 3267 3001 2792 2502 2118 1838 1591 1479 727 606 266 29203 8899 58684 7878 7727 2604 1883 --
NM_007269chr11617 ------
NM_007276chr72355 94 ------
NM_007282chr31781 1276 ----
NM_007285chr161501 1387 ----
NM_007286chr542122 1301 777 720 ------
NM_007292chr17144866 4410 4220 4014 3962 3810 3614 3302 1793 1462 1317 1149 1125 796 13591 ----
NM_007313chr951954 1923 1842 1801 224 --11328 --
NM_007345chr1821448 586 ------
NM_007349chr71164 ------
NM_007350chr1253939 3461 3438 1615 1424 ------
NM_007358chr111513 11784 --11500
NM_007363chrX2814 334 ------
NM_007373chr1041762 1426 1215 562 21114 402 ----
NM_007375chr142791 2149 2038 369 --12320 --
NM_012069chrX52644 1926 813 688 127 ------
NM_012081chr553437 3296 2515 1149 190 --12382 12869
NM_012092chr24785 690 199 69 --1115 11831
NM_012095chr1043368 2247 1318 1210 --13479 2878 593
NM_012098chr931552 1010 97 ------
NM_012102chr142458 2229 2193 103 1494 ----
NM_012104chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_012104chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_012134chr131810 1464 1330 --21346 1227 --
NM_012137chr152218 1929 1005 719 434 ------
NM_012141chr1384045 3332 3131 3035 2714 580 138 37 12971 11141 --
NM_012154chr82824 132 ------
NM_012156chr2072997 2633 2579 1043 1007 80 72 12078 42912 2833 2548 201 --
NM_012158chr132711 348 1116 ----
NM_012161chr411064 ------
NM_012164chr9107471 6705 5728 2311 2038 1544 1306 1218 593 280 36932 6472 4614 46464 6259 5522 2967 16987
NM_012175chr112920 383 ------
NM_012177chr62488 117 1205 ----
NM_012183chr11532 ------
NM_012193chr1134836 4031 3449 25203 4779 24897 522 23700 1116
NM_012199chr163359 1559 1540 1517 1303 232 --22877 1436 --
NM_012214chr265909 4661 3950 2356 1343 298 24506 190 ----
NM_012234chr352994 2543 1170 416 91 --21428 404 13120
NM_012238chr1011704 1237 ----
NM_012249chr233435 2521 1331 1130 --12344
NM_012250chr1121073 73 1977 148 --
NM_012252chr734722 3387 860 1628 22118 395 --
NM_012255chr20237 27 ------
NM_012259chr64939 342 163 40 ------
NM_012261chr204700 511 212 77 ------
NM_012262chr174410 3981 1925 1548 1531 1421 1291 13652 ----
NM_012281chr711887 1809 ----
NM_012286chrX1480 --1447 --
NM_012287chr374489 4013 3279 1339 1192 1070 353 23559 2973 ----
NM_012288chr695136 5082 4174 3667 3488 2251 1742 589 28 3963 490 249 --25184 197
NM_012290chr221466 457 ------
NM_012294chr752674 1539 901 441 239 ----11505
NM_012297chr472511 2473 2348 1684 320 129 57 12438 1545 --
NM_012300chr531951 1810 402 --1477 --
NM_012301chr741869 1856 1570 742 --21410 587 --
NM_012307chr1831018 924 173 ------
NM_012308chr1142490 853 561 38 ----1888
NM_012309chr11--54815 4139 3637 3379 262 21499 393 11078
NM_012316chr1135405 4182 4069 3730 3721 1939 1896 1655 1639 1474 744 409 398 ----35225 4922 3935
NM_012322chr71168 1348 ----
NM_012327chr183622 557 40 --1239 --
NM_012328chr721385 1219 --11229 --
NM_012329chr1721154 451 1543 11055 --
NM_012330chr1021114 242 11597 ----
NM_012333chr141294 465 373 261 ------
NM_012334chr594320 3827 3462 3078 2880 1581 1021 571 153 11108 1403 23697 3523
NM_012382chr544165 4039 2901 560 23012 724 13662 11561
NM_012395chr763102 2804 2353 2225 827 48 13110 13163 --
NM_012399chr221732 21628 329 11657 --
NM_012402chr1121213 205 --185 --
NM_012416chr93396 182 157 ------
NM_012417chr173395 229 68 ------
NM_012419chr62507 237 ------
NM_012421chr11430 ------
NM_012433chr21250 ------
NM_012434chr641441 1239 1105 87 21344 352 11485 --
NM_012448chr1772498 2157 2083 1981 684 673 667 12254 --237 22
NM_012471chrX51645 1318 465 227 136 --1152 1376
NM_012479chr722693 827 11942 --2677 520
NM_013230chrY11619 --142 --
NM_013231chr14----44326 3860 3300 3235 33460 1642 754
NM_013233chr231403 926 208 ------
NM_013238chr1361718 1331 1314 1303 717 123 ------
NM_013245chr162718 279 ------
NM_013255chr7108654 8496 6127 3268 3030 2882 2611 802 506 188 27494 3391 12117 --
NM_013257chr812166 ------
NM_013261chr482969 2623 2517 1407 1392 915 740 60 --22772 1063 1876
NM_013262chr631449 426 367 ------
NM_013263chr16147 ------
NM_013269chr1294412 4397 4360 3988 3378 1396 1155 470 433 14225 ----
NM_013281chr201384 1622 ----
NM_013282chr19--11327 1429 --
NM_013283chr51887 1260 1324 --
NM_013293chr71221 ------
NM_013341chr232096 1173 940 12517 ----
NM_013348chr192866 530 ------
NM_013354chr831365 898 384 11077 ----
NM_013357chr83286 278 69 1151 ----
NM_013372chr1532769 2616 2213 --1463 --
NM_013374chr312215 22417 514 22055 938 --
NM_013377chr123688 603 467 ------
NM_013381chr1222137 186 21877 516 ----
NM_013396chr2121583 335 11566 ----
NM_013410chr121237 108 1897 ----
NM_013433chr1941407 761 755 213 --11661 --
NM_013434chr231738 403 59 --1694 --
NM_013434chr231738 403 59 --1694 --
NM_013437chr83401 327 261 ------
NM_013438chr931435 1417 626 ------
NM_013444chrX2834 766 ------
NM_013448chr141171 1128 ----
NM_013449chr121365 --32715 708 153 12269
NM_013450chr231221 842 460 ------
NM_013958chr82354 315 --1333 --
NM_013959chr82354 315 --1333 --
NM_013961chr82354 315 --1333 --
NM_013962chr82354 315 --1333 --
NM_013989chr1464932 4617 3392 1788 1451 281 23591 1219 ----
NM_013999chr172976 150 ------
NM_014005chr542230 2099 1923 634 42798 2705 2664 2267 11964 --
NM_014011chr241900 1641 1016 619 ------
NM_014016chr32445 123 ------
NM_014021chr153441 3038 2400 2327 643 12865 ----
NM_014028chr643097 2580 655 318 ----11044
NM_014034chr631337 454 117 ------
NM_014043chr341353 1269 632 566 ------
NM_014089chr1341446 437 168 47 2898 221 ----
NM_014109chr861215 905 429 417 354 96 ----11173
NM_014110chr13409 225 129 ------
NM_014112chr884907 3511 3359 1995 1898 1681 771 256 25466 1167 ----
NM_014117chr1622528 1084 2306 52 192 12608
NM_014141chr785378 4713 4247 3927 3483 1891 1639 1503 11654 23234 427 198
NM_014155chr1185902 5628 2181 1831 1543 1489 1237 1220 14774 21352 867 --
NM_014157chr1683813 3796 3701 2856 2668 1563 1456 1043 23886 3108 1623 1412
NM_014176chr1122 ------
NM_014182chr122288 80 1538 169 --
NM_014189chr431424 370 204 --1445 --
NM_014191chr122425 159 1367 ----
NM_014212chr1231000 655 370 ------
NM_014240chr363363 2918 2591 1370 574 298 24042 677 1657 --
NM_014243chr431953 1497 599 --1168 --
NM_014245chr32809 187 1178 ----
NM_014252chr131142 ------
NM_014253chrX------1362
NM_014258chr20142 ------
NM_014263chr1021237 92 1167 ----
NM_014267chr112868 675 1813 ----
NM_014268chr1821121 342 ------
NM_014278chr42383 58 ------
NM_014284chr1----163 --
NM_014285chr941005 419 305 284 ------
NM_014289chrX21189 418 ------
NM_014299chr1932164 1449 282 11501 --12239
NM_014302chr7129 ------
NM_014309chr2294701 4447 4368 3840 3367 1857 1798 1284 631 --25082 1209 --
NM_014316chr1632189 1970 81 11401 --11776
NM_014317chr101211 ------
NM_014319chr1221768 1693 11574 ----
NM_014323chr222700 421 --2407 160 --
NM_014331chr4107643 7210 6343 6086 6060 5609 5309 3004 772 664 67226 7203 2939 2687 2315 804 21854 298 14859
NM_014333chr1122258 575 ------
NM_014344chr111342 --1224 --
NM_014345chr62931 123 ------
NM_014351chr2231471 1452 478 ------
NM_014352chr1131158 962 342 1539 ----
NM_014376chr562014 1945 1936 1790 1689 571 --1517 12565
NM_014382chr331655 1337 431 ------
NM_014388chr194708 4661 2225 2019 1570 1025 444 205 142 24682 1531 --45878 4501 795 691
NM_014390chr72488 200 --1469 1446
NM_014393chr841518 487 443 77 11684 --11990
NM_014405chr171701 178 21589 1487 --
NM_014408chr11616 --2582 134 --
NM_014415chr3--1408 11630 --
NM_014423chr595040 4565 4459 4383 2168 1791 1702 1151 639 ------
NM_014432chr61610 21460 146 ----
NM_014445chr31101 1975 130 --
NM_014447chr431083 422 236 ------
NM_014452chr62432 21 1753 ----
NM_014454chr61670 ------
NM_014456chr1021914 512 21882 1351 ----
NM_014458chr12470 250 11075 ----
NM_014470chr121541 ------
NM_014491chr711042 ------
NM_014494chr1621867 108 --11908 --
NM_014515chr121841 ------
NM_014522chrX1692 1477 --1592
NM_014554chr1262246 2198 1605 1426 635 277 --11784 --
NM_014563chrX62103 2059 1391 687 356 160 1109 ----
NM_014574chr1441585 998 453 151 ------
NM_014575chr31515 ------
NM_014585chr251207 1196 1181 420 23 1485 ----
NM_014592chr52623 135 ------
NM_014603chr1721686 341 ------
NM_014607chr232063 1764 565 1856 ----
NM_014613chr531219 729 359 ----1157
NM_014614chr221296 1258 ------
NM_014615chr1633653 2979 2938 12556 22735 2341 --
NM_014618chr9--1136 ----
NM_014623chr6----193 --
NM_014630chr1583819 3498 2504 2468 2444 1556 1214 897 12482 12925 12817
NM_014634chr2243413 2723 2598 162 --140 --
NM_014636chr974362 3580 3299 2780 1350 674 214 --21699 471 11257
NM_014637chr841370 1116 558 435 11065 11239 --
NM_014646chr1822458 898 22400 690 2644 136 --
NM_014647chr1642161 1555 379 123 1252 181 --
NM_014660chr7--2984 934 127 --
NM_014667chr332435 893 746 --12383 1245
NM_014670chr241389 1213 603 251 --183 1639
NM_014677chr831108 1006 912 ------
NM_014682chr82486 438 1429 ----
NM_014686chr1942210 1026 850 818 ------
NM_014689chr21411 ------
NM_014690chr772826 2730 2450 1168 960 879 131 --22863 2115 --
NM_014701chr1531182 1072 618 12128 13236 --
NM_014702chr652918 2393 336 160 62 1777 13290 1205
NM_014705chr731373 405 31 ------
NM_014707chr741921 1624 1487 919 ------
NM_014709chr21472 ----1184
NM_014711chr1652129 1934 1731 1469 706 ------
NM_014713chr21517 ------
NM_014720chr1051345 694 250 219 50 11746 162 --
NM_014721chr696651 5956 5720 5566 4558 4510 2047 660 40 45285 2969 1510 1181 --15151
NM_014726chr173553 499 408 --2152 37 --
NM_014727chr19156 ------
NM_014730chr1294892 4752 4677 3836 1993 454 381 273 203 33802 688 291 25056 209 14602
NM_014730chr1294892 4752 4677 3836 1993 454 381 273 203 33802 688 291 25056 209 14602
NM_014735chrX2729 485 ----11554
NM_014742chr2031657 633 190 --21469 35 1485
NM_014743chr441143 442 298 175 ------
NM_014746chr263217 1443 1419 544 481 90 13682 ----
NM_014747chr195745 5671 5566 5240 5140 4012 2103 900 62 --24537 3731 --
NM_014751chr8--1491 ----
NM_014755chr233871 3154 2775 --11330 --
NM_014757chr552203 1794 1571 814 38 153 ----
NM_014764chr121353 11087 ----
NM_014765chr152545 2114 805 472 210 21951 1049 12531 --
NM_014771chr163780 328 190 ------
NM_014774chr142267 2134 92 84 --22287 2199 12242
NM_014779chr33979 140 47 ------
NM_014781chr84430 188 90 25 ------
NM_014784chr121157 22 ----2964 761
NM_014795chr211282 ------
NM_014800chr73299 175 93 --21138 457 --
NM_014802chr122380 72 ------
NM_014810chr151092 1070 884 771 502 --33438 3154 2624 13271
NM_014812chr161932 1846 1612 1587 432 172 ------
NM_014819chr532132 1950 905 1639 ----
NM_014820chr341964 1917 623 586 11986 11424 --
NM_014824chr1131527 814 703 21692 398 ----
NM_014827chr11223 ----11443
NM_014830chr1243093 2432 1144 246 --12872 --
NM_014832chr1321911 403 11397 --12066
NM_014836chr1061695 1416 1236 491 442 127 ------
NM_014840chr1262737 2362 2241 1090 668 629 --12513 11170
NM_014841chr6----1973 --
NM_014844chr1444155 1201 1018 283 13728 12981 11037
NM_014846chr8145 ------
NM_014850chr354898 4851 4828 3277 1923 11399 2892 330 --
NM_014857chr1--137 ----
NM_014860chr2--11641 1667 --
NM_014870chr1103944 3816 3385 1772 1625 1170 1025 742 538 105 11061 1211 1797
NM_014873chr153692 1896 1306 865 287 13258 24153 560 --
NM_014876chr2231724 384 44 21658 676 ----
NM_014877chr17127164 6597 6317 6008 5402 2947 2577 1918 1438 1206 632 553 37534 5882 1616 22362 499 --
NM_014885chr4146 ------
NM_014887chr133812 611 203 --1637 --
NM_014888chr71103 ------
NM_014890chr32248 55 ------
NM_014893chrY52384 2304 1987 915 142 11502 ----
NM_014897chr1742885 2567 2213 922 ----12969
NM_014899chr532857 1054 806 13029 ----
NM_014900chr21756 --1313 --
NM_014904chr1043911 1631 1336 114 2306 227 1637 --
NM_014906chr1774061 3951 3747 3462 3385 1336 1000 22713 582 1266 --
NM_014912chr1011383 ----1311
NM_014916chr7--1530 ----
NM_014918chr1531132 1108 1073 11426 1187 --
NM_014921chr19--12910 11894 --
NM_014923chr1322383 2192 12319 ----
NM_014926chr32914 823 ----1107
NM_014932chr321690 1449 11314 ----
NM_014934chr1353637 1319 1280 1227 951 23806 473 ----
NM_014935chr193838 3753 3208 2708 2513 2416 1067 491 59 1773 171 1286
NM_014936chr631801 336 226 ------
NM_014937chr102190 21 11244 ----
NM_014939chr1831334 271 181 ------
NM_014946chr223112 998 160 ----
NM_014949chr121011 277 1173 ----
NM_014950chr1431665 1251 99 2322 43 ----
NM_014951chr1052458 2077 1644 874 783 22055 1679 ----
NM_014953chr1343860 3853 1543 469 2911 22 13676 --
NM_014961chr441884 1816 867 369 1569 1747 1645
NM_014962chr2042625 2581 2087 1157 ------
NM_014970chr11215 ------
NM_014974chr1031475 1239 359 --1490 --
NM_014977chr14----1152 --
NM_014978chr1021573 164 --1232 --
NM_014982chr1474662 4179 3748 3402 2107 1437 1360 --13614 1274
NM_014988chr431028 814 310 --22163 1142 --
NM_014989chr631305 789 732 ------
NM_014991chr422587 53 1291 12144 22011 343
NM_014992chr142875 608 ------
NM_015000chr1232216 2128 301 --23087 459 --
NM_015002chr124526 322 280 43 11519 ----
NM_015008chr352649 2623 2486 1432 1378 23639 3448 ----
NM_015020chr1651084 931 785 689 69 12859 1210 --
NM_015024chr811401 --11122 --
NM_015025chr212704 ------
NM_015027chr162611 423 ----11798
NM_015032chr1332764 2371 425 22689 564 1805 --
NM_015033chr952905 2295 1061 798 337 32183 529 240 1891 --
NM_015035chr2096275 4740 2571 2520 2386 2046 1797 1623 138 11381 21765 720 --
NM_015039chr154007 3343 2860 180 41 --2358 319 1944
NM_015042chr1543679 1079 239 110 ----13705
NM_015045chr101439 148 ----
NM_015046chr931748 745 335 11118 12141 2160 135
NM_015051chr923040 435 --11262 --
NM_015057chr131203 ------
NM_015064chr1283261 2836 713 531 361 328 295 140 --12717 --
NM_015068chr753929 2702 1192 556 171 33626 619 100 1121 11096
NM_015073chr19----11722 21830 1692
NM_015075chrX21897 1663 --196 1656
NM_015076chr644222 3421 2841 725 13923 ----
NM_015082chr552503 2112 1871 674 562 12154 2480 462 --
NM_015086chr1241379 1310 1054 63 --3614 126 42 --
NM_015090chr135462 476 460 15694 31556 1151 383 11488
NM_015091chr141825 1758 ----
NM_015092chr1684606 4467 3722 3474 1597 1270 707 468 ----14042
NM_015097chr332304 1517 667 1168 189 --
NM_015100chr121327 792 ----1812
NM_015101chr152672 2283 1118 963 825 --141 --
NM_015107chrX32441 447 196 ------
NM_015110chr942459 2004 1620 804 12312 ----
NM_015115chr442913 1266 801 756 ----1240
NM_015130chr43968 923 539 ------
NM_015132chr741259 737 496 61 11719 1299 1160
NM_015135chr71129 ----1162
NM_015138chr1532200 487 470 --1818 --
NM_015143chr421491 1272 1148 11222 --
NM_015144chr1653804 3786 3514 2761 852 21309 1238 --1929
NM_015153chr62676 96 ------
NM_015155chr1033013 280 154 1124 32571 2231 583 1884
NM_015156chr1463227 2854 1367 885 768 557 ------
NM_015161chr1631149 504 348 ------
NM_015163chr1451898 1752 1423 384 132 ----11252
NM_015170chr831896 1649 614 ------
NM_015172chr131654 1047 107 1313 1637 1243
NM_015173chr431757 1440 475 ------
NM_015176chr12445 151 --11588 --
NM_015184chr31247 ------
NM_015192chr2042362 1994 668 649 1472 31892 502 91 --
NM_015199chr342441 2276 2231 1972 12767 ----
NM_015206chr1551549 947 604 541 162 32943 1344 592 22997 2976 22461 723
NM_015215chr142408 774 255 241 1493 ----
NM_015225chr933102 2609 119 --22866 2336 --
NM_015226chr1633246 3198 95 1748 ----
NM_015230chr421591 586 ------
NM_015231chr112835 131 1674 ----
NM_015234chr621155 1143 ------
NM_015235chr1041874 1505 836 825 --1655 --
NM_015239chr91526 ------
NM_015247chr16125273 5254 4749 4637 4328 4236 3578 1870 1407 502 121 56 --21160 1030 12019
NM_015250chr921516 1435 ------
NM_015252chr21731 ------
NM_015264chr2284435 4006 3854 3369 3053 1456 1352 1214 14283 3885 827 502 13378
NM_015265chr21320 --12063 --
NM_015267chr1272100 1860 884 849 759 675 353 ------
NM_015268chr3------1493
NM_015270chr121254 ----11939
NM_015271chr474112 4036 2705 1289 931 637 446 13249 ----
NM_015272chr1631928 673 513 11665 ----
NM_015275chr122556 160 12045 ----
NM_015277chr1821398 1144 11229 1304 --
NM_015282chr252540 1006 997 844 828 ----12117
NM_015284chr121533 693 12129 1539 1573
NM_015289chr1561922 1827 1331 1253 469 281 --1762 11835
NM_015296chr1321224 838 --11038 154
NM_015299chr1433981 3242 1318 --23399 2526 1789
NM_015310chr8107340 6531 6222 5359 3319 3187 2818 2462 1148 877 1324 ----
NM_015313chr1144636 3112 1568 68 1747 24074 1261 --
NM_015314chr722496 431 --1720 --
NM_015315chr572674 1238 1218 1181 1148 1065 229 11318 32332 752 581 12514
NM_015317chr222516 1941 194 12379 --
NM_015321chr1943650 3391 3040 1409 11854 54914 4876 4177 4033 3544 --
NM_015326chr142551 1055 395 63 --12808 --
NM_015328chr753013 2708 2546 2348 2065 1298 ----
NM_015335chr121399 11725 193 --
NM_015336chr1212213 32422 926 886 22091 88 --
NM_015338chr2031844 1245 412 --2766 342 --
NM_015347chr1252304 1873 902 569 229 22492 680 --12665
NM_015349chr662304 2264 2112 559 221 204 12211 ----
NM_015355chr173619 520 216 --160 --
NM_015361chr22675 52 --1749 --
NM_015367chr2231521 606 553 --1296 11262
NM_015375chr164844 4433 3784 3664 3539 3043 14946 --1382
NM_015378chr131157 465 410 1141 ----
NM_015382chr14--1297 ----
NM_015384chr5----1118 --
NM_015385chr102784 771 1906 ----
NM_015387chr231423 1382 414 2735 301 ----
NM_015393chr443506 2815 1379 192 ----11259
NM_015396chr31159 ------
NM_015397chr911560 21830 1650 21655 291 145
NM_015416chr121235 2733 351 ----
NM_015419chrX21144 457 ------
NM_015429chr321045 1023 1449 ----
NM_015435chr811023 ------
NM_015439chr6----186 --
NM_015455chr563865 2787 1526 837 384 322 --11001 --
NM_015457chr111433 ------
NM_015464chr71241 1418 ----
NM_015472chr31397 ------
NM_015472chr31397 ------
NM_015483chr72973 845 ----1810
NM_015484chr14781 660 250 162 ------
NM_015496chr8121 1295 ----
NM_015497chr152171 107 ------
NM_015507chrX1191 ------
NM_015509chr1231537 1363 334 ------
NM_015514chr143495 419 70 ------
NM_015520chr332765 2447 1940 161 12529 --
NM_015530chr24904 888 159 111 --1289 --
NM_015535chr274128 3245 2966 2878 2584 1307 709 32920 2762 1679 43759 1486 982 121 --
NM_015541chr311097 ------
NM_015542chr1041103 502 248 61 11223 ----
NM_015549chr141465 --161 --
NM_015550chr743508 2271 2194 1166 --12982 --
NM_015554chr1521173 1029 1137 12672 --
NM_015555chr621725 1323 ------
NM_015560chr321943 206 11784 ----
NM_015564chr523319 2865 42459 2433 1060 481 1547 --
NM_015565chr2131644 1512 807 ------
NM_015569chr174110 4069 1940 1723 1005 966 408 23025 1877 --1149
NM_015570chr721742 1483 11804 ----
NM_015571chr642515 2502 1991 486 ------
NM_015575chr252728 2515 2378 2356 1095 22310 983 ----
NM_015576chr352278 2239 461 332 291 11960 ----
NM_015578chr1921939 197 ------
NM_015589chr14----1161 170
NM_015622chr71224 ------
NM_015640chr134622 780 261 25043 3278 13506 11493
NM_015646chr123274 166 97 1836 ----
NM_015670chr171473 1348 ----
NM_015678chr1341608 1114 1093 446 11077 ----
NM_015686chrX12220 1436 12082 12006
NM_015832chr181160 ------
NM_015853chr112168 46 ----177
NM_015865chr1821063 174 ------
NM_015872chr131621 1242 1168 ------
NM_015879chr18138455 7968 7630 7272 6764 6136 5534 5262 2792 2317 1539 777 727 35639 707 354 37765 6256 456 21957 1345
NM_015886chr895422 4934 3930 2084 1552 1317 1287 1176 170 45551 1836 1160 471 ----
NM_015906chr174610 4024 3719 3207 278 181 101 24094 1168 ----
NM_015912chr852422 1737 1705 776 526 1470 22489 2094 --
NM_015933chr3180 ------
NM_015948chr62398 322 ------
NM_015955chr2------138
NM_015975chrX11412 11394 11126 --
NM_015981chr51100 --12807 --
NM_015995chr1575376 5009 4157 3547 1743 1136 1049 12194 ----
NM_015999chr11471 --1185 --
NM_016009chr174569 4244 4222 1359 1215 221 83 ------
NM_016018chr852789 2069 2048 1809 1762 --12178 12102
NM_016021chr672049 590 533 505 182 126 51 32627 2397 2198 1272 --
NM_016025chr1631744 1406 109 21273 1227 --11393
NM_016032chrX4535 499 378 343 ------
NM_016037chr13454 319 27 --1884 --
NM_016040chr172763 2575 2053 1951 1846 1809 1105 ------
NM_016041chr172248 68 ------
NM_016057chr1251241 1167 807 185 131 1119 130 --
NM_016061chr241540 550 248 23 ------
NM_016071chr72238 182 --194 --
NM_016072chr1232165 774 632 11709 --1310
NM_016073chr152997 295 ----1856
NM_016075chr1363174 2640 2632 2336 1960 22 1283 ----
NM_016076chr163037 2617 1243 1196 863 719 33160 3076 344 179 12343
NM_016078chr17--1770 ----
NM_016079chr232302 866 545 --1129 --
NM_016083chr653740 3508 3388 771 237 13522 1186 --
NM_016096chr8----22109 224 11867
NM_016097chr1821089 974 ------
NM_016107chr551230 1165 1047 546 444 1327 ----
NM_016120chrX1469 ------
NM_016121chr1--2993 362 ----
NM_016125chr172571 440 ------
NM_016129chr4133 ------
NM_016131chr221579 112 --12325 --
NM_016132chr1533471 2680 753 22428 943 ----
NM_016133chr231547 1257 1027 --11131 --
NM_016147chr1111038 ------
NM_016162chr122857 839 --2669 315 --
NM_016169chr1023292 1188 11206 41157 1124 878 614 --
NM_016185chr17------1791
NM_016205chr441223 1037 497 141 --1933 2123 87
NM_016206chr398580 8160 8133 7700 6512 6484 1777 872 359 27895 6359 12971 17218
NM_016217chr653023 2509 1102 391 76 1913 12928 --
NM_016224chr662106 2076 1510 1463 486 372 21680 693 ----
NM_016252chr23905 765 381 ------
NM_016255chr653313 2556 1145 1106 413 12353 ----
NM_016257chr1113515 3253 3111 2753 2567 2542 2162 566 328 197 125 12697 43088 2399 1367 677 12595
NM_016260chr2107332 6525 5958 5534 4712 4667 2982 2864 2551 2478 --11110 --
NM_016269chr421126 354 ------
NM_016270chr191493 ------
NM_016271chr1881968 1921 1873 1825 1619 168 45 24 ------
NM_016272chr2252552 2487 491 294 107 --22440 1868 --
NM_016275chr331751 891 435 ----11859
NM_016277chr62599 373 --21570 1145 --
NM_016279chr5----172 --
NM_016281chr121958 ------
NM_016284chr163729 616 78 ------
NM_016287chr132061 1424 820 --11851 --
NM_016301chr122415 57 ------
NM_016302chr32304 251 ------
NM_016312chr122383 131 ------
NM_016316chr21472 ------
NM_016320chr111326 1429 2143 90 1225
NM_016322chr9102638 2505 1120 1046 938 690 627 577 251 91 12995 --1390
NM_016352chr741292 1200 1123 351 ------
NM_016353chr821879 798 --1268 --
NM_016357chr1221212 183 1999 1826 --
NM_016374chr131628 1365 567 ------
NM_016374chr131628 1365 567 ------
NM_016376chr17144251 3063 2903 2735 2670 1568 1542 1522 1077 946 726 499 285 31 22951 742 1709 14270
NM_016395chr1551435 1349 685 216 125 1111 21869 573 --
NM_016396chr1562784 2525 2258 2122 1952 649 2819 420 --12158
NM_016403chr112618 50 --1193 --
NM_016424chr1741231 538 396 306 ------
NM_016441chr212228 ------
NM_016442chr51722 ----1921
NM_016454chr15----153 --
NM_016470chr20--1156 ----
NM_016485chr622264 484 31483 538 66 ----
NM_016486chr11507 1340 ----
NM_016489chr72555 64 194 ----
NM_016499chr111469 --1177 --
NM_016507chr1752506 2312 2218 719 609 12067 23064 46 1646
NM_016516chr21196 --1242 --
NM_016522chr1161573 1454 1336 1282 1140 366 ------
NM_016530chr1543935 3264 1605 555 ------
NM_016531chr484058 3300 3229 2887 2810 527 407 180 13716 ----
NM_016536chr193235 99 73 138 ----
NM_016542chrX11711 --21367 657 1362
NM_016577chr374276 3557 3474 3006 2881 1012 960 24546 1732 --13337
NM_016586chr14--1155 ----
NM_016587chr72355 94 ------
NM_016588chr62148 100 ------
NM_016598chr31323 11298 1194 --
NM_016603chr52302 219 1392 31437 568 276 --
NM_016604chr52845 240 --1297 --
NM_016605chr532164 2051 139 ----22083 1933
NM_016607chrX41662 1333 678 83 ------
NM_016612chr81450 --138 --
NM_016620chr11972 ------
NM_016621chr1164102 3391 3346 2957 2845 175 24369 398 13848 14082
NM_016623chr8----1209 --
NM_016626chr181222 ------
NM_016649chr20135 ------
NM_016652chr2051809 1748 1552 1330 280 ----11157
NM_016653chr21273 --11045 --
NM_016654chr1531434 1409 493 ------
NM_016819chr31516 1104 ----
NM_016823chr175974 868 507 379 116 ------
NM_016827chr3131 1734 123 --
NM_016834chr1754049 3785 3346 2877 206 --13683 --
NM_016835chr1754049 3785 3346 2877 206 --13683 --
NM_016841chr1754049 3785 3346 2877 206 --13683 --
NM_016929chr643988 3441 2848 122 13264 33726 1362 429 2603 424
NM_016941chr192401 60 --1102 --
NM_016950chr43458 300 75 1535 ----
NM_017415chr584421 3582 3503 2953 1419 634 615 404 13615 24569 4215 --
NM_017420chr1413309 --1926 --
NM_017423chr432045 451 232 ----11623
NM_017426chr4----141 --
NM_017483chr251170 1110 1062 1012 834 --11289 --
NM_017488chr251505 1445 1397 1347 1169 1141 11624 --
NM_017519chr6----1213 --
NM_017522chr1------11095
NM_017545chr202533 217 ------
NM_017551chr102596 288 12421 --12390
NM_017553chr15299 92 --11284 --
NM_017563chr3116210 6152 5582 5549 4797 4523 4274 2524 1704 1695 1337 --34393 3896 2436 --
NM_017569chr131309 ------
NM_017575chr1711535 --1123 1435
NM_017577chr311221 --1191 --
NM_017580chr1032036 1723 436 ----1334
NM_017582chr131499 477 256 ------
NM_017589chr11--199 ----
NM_017593chr41196 --199 --
NM_017594chr9113276 3152 3139 3002 2909 2869 2657 1218 1120 415 130 1652 ----
NM_017596chr194546 4238 3265 3225 3199 2916 508 186 35 23510 1042 1443 --
NM_017602chrX2821 596 ------
NM_017610chr1551978 1834 1581 638 448 --144 1547
NM_017612chr121564 1189 1531 --
NM_017628chr4134984 4726 4030 3884 3605 3442 3280 3265 1979 1120 1059 1006 517 1385 12120 21191 1091
NM_017632chr41131 ------
NM_017633chr641557 238 216 198 ------
NM_017634chr82768 338 --11237 --
NM_017637chr9179025 8323 7437 6848 6706 6667 6490 6297 3775 3767 3488 3412 2808 2596 1653 1344 1328 2874 499 47990 7212 6452 1143 --
NM_017641chr122213 173 ------
NM_017643chr1752701 1921 987 691 597 11980 12421 --
NM_017649chr103947 807 117 ------
NM_017650chr785002 4075 1599 1517 945 727 603 278 44628 1777 1153 515 ----
NM_017657chr2--1339 ----
NM_017658chr1434207 1162 839 22992 870 ----
NM_017660chr1923109 2834 23219 3089 12179 --
NM_017661chr152844 385 ------
NM_017686chr13385 308 185 11085 1768 --
NM_017697chr8------126
NM_017709chr143461 1652 655 251 1419 --13618
NM_017714chr202966 312 ------
NM_017730chr31463 ----1173
NM_017736chr1633086 2378 341 22279 1033 ----
NM_017737chr152176 2079 586 447 397 11450 --1751
NM_017740chr1641741 1520 1212 367 --1567 --
NM_017744chr122143 471 12230 11674 1881
NM_017745chrX2558 45 ------
NM_017753chr9----141 --
NM_017754chr6104974 4820 4471 4276 4180 3271 1897 1643 295 274 13383 ----
NM_017758chr1731023 387 299 --1999 2989 40
NM_017769chr1442565 1164 1121 894 11047 ----
NM_017786chr82715 272 1173 ----
NM_017789chr2----1214 --
NM_017798chr2031087 464 113 21080 266 ----
NM_017799chr1431969 1732 1238 --11540 --
NM_017811chr942905 2396 2113 223 ------
NM_017812chr71726 ------
NM_017813chr8135836 5504 5197 4912 4796 4221 4127 4094 2045 1437 1112 1011 718 2954 332 1761 --
NM_017822chr121265 1755 ----
NM_017824chr1021908 579 ----138
NM_017831chr1844682 3399 3141 1524 --1193 --
NM_017848chrX83944 3779 3763 3746 3350 3265 1631 141 11720 12996 --
NM_017851chr1511124 ----1900
NM_017880chr23406 322 291 1132 ----
NM_017890chr831686 1220 115 ----1273
NM_017915chr1231106 804 234 ----1782
NM_017919chr9125516 5390 5084 5019 4928 3664 2097 1180 808 596 533 41 --11083 --
NM_017922chr14--1655 ----
NM_017933chr221615 1086 ------
NM_017935chr41238 1163 ----
NM_017938chrX42210 1791 1582 314 --1216 1652
NM_017943chr1451077 1031 1016 955 791 1354 --1285
NM_017944chr1143148 2559 1004 821 1873 ----
NM_017974chr231243 917 386 ------
NM_017975chr1531068 963 135 ----2883 395
NM_017987chr105848 789 710 686 125 11683 11882 --
NM_017988chr122627 65 ------
NM_017994chr72663 49 11034 ----
NM_017999chr14178 ------
NM_018008chr32353 332 ------
NM_018027chr1051136 834 754 276 143 1344 ----
NM_018028chr191543 ----11250
NM_018043chr1131434 367 38 ------
NM_018060chr12397 351 ------
NM_018061chr161715 1169 1163 661 569 512 ------
NM_018078chr43407 260 122 ------
NM_018084chr212044 11233 ----
NM_018085chr1126873 6833 5568 3229 2694 2489 2436 2404 1018 691 520 106 21567 440 --27684 6004
NM_018086chr241659 1511 320 137 ------
NM_018087chr1172 1171 ----
NM_018099chr121240 169 ----
NM_018103chr11106 ------
NM_018107chr142720 102 --1727 --
NM_018116chr1--1633 --2538 532
NM_018119chr16------1283
NM_018121chr1013161 --11031 --
NM_018128chr1721469 1087 --1518 --
NM_018131chr102777 689 ------
NM_018133chr311480 12163 ----
NM_018137chr111153 --1158 21181 950
NM_018156chr131157 465 410 1141 ----
NM_018157chr1273242 3129 2412 2141 753 506 44 --1791 12588
NM_018159chrX21687 134 ------
NM_018178chr161604 1336 775 632 555 535 --1652 --
NM_018181chr1831528 157 119 ------
NM_018182chr17102179 2144 1452 792 678 620 522 295 165 109 --22205 173 --
NM_018184chr36713 653 553 323 294 164 ------
NM_018195chr1131905 1824 481 ------
NM_018200chr1522045 1891 21019 302 ----
NM_018202chr12763 253 --1846 --
NM_018211chr131612 217 91 ------
NM_018227chr433133 1190 439 12353 ----
NM_018241chr42816 261 --1402 --
NM_018243chr4103802 3648 3524 3414 3365 3164 1384 1340 781 723 11580 22973 716 --
NM_018246chr842803 617 588 116 1394 ----
NM_018247chr63868 513 240 --21055 816 --
NM_018263chr272625 2379 1923 1725 929 561 71 ------
NM_018287chr102853 228 ------
NM_018299chr852737 2347 2311 1084 153 1300 ----
NM_018307chr172795 52 ------
NM_018310chr83581 478 28 ------
NM_018313chr31475 11737 11813 12197
NM_018314chr111244 1158 135 1119
NM_018315chr421407 633 --11356 --
NM_018348chr162154 61 11164 ----
NM_018351chr1264373 3787 3595 3407 1064 1030 23643 1672 --24007 3798
NM_018362chr1183780 3496 3273 2963 978 807 325 120 ------
NM_018364chr194008 3738 3596 2840 2627 1633 1416 1060 289 ----1794
NM_018365chr15------1252
NM_018373chr1475616 5521 3982 2595 2023 1776 396 15943 ----
NM_018374chr794986 4870 4756 3976 3615 3380 2072 2052 659 42079 1570 1061 702 --21805 1651
NM_018375chr1411915 1279 ----
NM_018381chr195709 606 582 372 257 1941 ----
NM_018383chr22694 565 ------
NM_018387chr92126 77 ------
NM_018394chr311610 --21510 307 --
NM_018403chr374086 3539 3461 3454 900 745 202 33919 757 317 --1158
NM_018406chr3------146
NM_018409chr452659 721 293 270 107 23291 211 1622 --
NM_018416chr1292577 1938 1023 1013 989 949 555 187 111 21052 592 ----
NM_018424chr931649 1449 687 --11235 21522 198
NM_018425chr1022235 891 12456 12030 --
NM_018429chr532496 2352 188 12511 12301 --
NM_018433chr21516 --193 1204
NM_018444chr81100 128 ----
NM_018445chr152514 202 ------
NM_018448chr1221217 843 ------
NM_018449chr92731 39 1526 ----
NM_018452chr6_random33349 2810 1507 ------
NM_018464chr101388 1334 ----
NM_018471chr21144 --1158 --
NM_018482chr81157 32615 2482 384 2232 34 --
NM_018489chr132356 1515 441 ----1340
NM_018490chr11--168 1541 1438
NM_018509chr1741482 1448 1417 1237 --11192 --
NM_018534chr21244 --1161 --
NM_018557chr211115 11227 ----
NM_018566chr164527 3651 3358 1369 1251 251 23829 920 2690 115 --
NM_018584chr131037 894 420 ------
NM_018602chr1541329 502 394 124 ------
NM_018638chr1284529 3817 2217 1488 1475 585 420 21 24213 1527 ----
NM_018639chr1231121 416 45 ------
NM_018640chr1262769 2263 1128 766 683 43 ------
NM_018644chr1122009 1948 --21369 54 --
NM_018650chr12914 372 ------
NM_018652chr15140 --2278 84 --
NM_018667chr1641858 1744 976 233 12675 1958 11113
NM_018704chr161770 830 578 513 470 194 --11983 11659
NM_018710chr851123 537 99 84 69 ------
NM_018712chr1151571 572 448 365 231 ------
NM_018715chr122049 1897 --1864 --
NM_018717chr412687 22600 370 180 --
NM_018841chr173941 3786 3695 3067 2678 2452 631 12688 ----
NM_018847chr961828 1821 1410 316 166 67 ------
NM_018890chr741513 921 292 223 ------
NM_018898chr51830 --12057 --
NM_018899chr51830 --12057 --
NM_018900chr51830 --12057 --
NM_018901chr51830 --12057 --
NM_018902chr51830 --12057 --
NM_018903chr51830 --12057 --
NM_018904chr51830 --12057 --
NM_018905chr51830 --12057 --
NM_018906chr51830 --12057 --
NM_018907chr51830 --12057 --
NM_018908chr51830 --12057 --
NM_018909chr51830 --12057 --
NM_018910chr51830 --12057 --
NM_018911chr51830 --12057 --
NM_018912chr521158 500 1494 1321 --
NM_018913chr521158 500 1494 1321 --
NM_018914chr521158 500 1494 1321 --
NM_018915chr521158 500 1494 1321 --
NM_018916chr521158 500 1494 1321 --
NM_018917chr521158 500 1494 1321 --
NM_018918chr521158 500 1494 1321 --
NM_018919chr521158 500 1494 1321 --
NM_018920chr521158 500 1494 1321 --
NM_018921chr521158 500 1494 1321 --
NM_018922chr521158 500 1494 1321 --
NM_018923chr521158 500 1494 1321 --
NM_018924chr521158 500 1494 1321 --
NM_018925chr521158 500 1494 1321 --
NM_018926chr521158 500 1494 1321 --
NM_018927chr521158 500 1494 1321 --
NM_018928chr521158 500 1494 1321 --
NM_018929chr521158 500 1494 1321 --
NM_018944chr212523 24 ------
NM_018945chr633579 2859 979 11013 3987 662 133 --
NM_018947chr793739 3247 1866 1745 1686 1516 1506 610 299 14690 23773 68 --
NM_018948chr121095 566 --11179 --
NM_018951chr721161 882 ------
NM_018963chr2131149 105 68 ------
NM_018970chr762001 1112 848 841 357 129 ----12539
NM_018979chr1222271 2105 --12328 --
NM_018992chr1621327 134 --21479 1295 --
NM_018999chr1084424 3544 3481 1847 1400 892 698 667 13056 ----
NM_019000chr51316 11211 ----
NM_019001chr363928 1072 1020 789 682 342 34256 3436 1608 11869 --
NM_019003chrX1117 ------
NM_019004chr792105 2014 1758 1734 1672 936 659 413 303 1455 ----
NM_019005chr71125 1338 ----
NM_019010chr171257 ------
NM_019016chr17188 --1153 --
NM_019026chr1130 --1269 --
NM_019027chr442586 1914 1804 246 12032 1725 --
NM_019035chr411942 32005 1797 1683 1787 --
NM_019041chr6102610 2304 2245 2044 1891 1698 1648 1010 614 199 --21784 506 --
NM_019042chr7------1325
NM_019053chr1031006 979 698 1866 ----
NM_019063chr231784 1482 685 ----1797
NM_019067chrX84241 4048 3702 1810 1758 1553 1340 1147 --34845 1441 778 --
NM_019071chr72575 305 1767 ----
NM_019072chr563913 3543 3418 1597 1430 1038 22831 782 ----
NM_019083chr141086 349 213 197 ----11204
NM_019084chr1042096 1663 946 145 ------
NM_019087chr551648 1463 568 242 221 --11752 --
NM_019091chr21228 ------
NM_019102chr71130 ------
NM_019102chr71130 ------
NM_019106chr222426 124 --22800 2373 --
NM_019114chr9--1677 1952 --
NM_019116chr1653763 3198 2774 1453 403 --1553 --
NM_019555chr3138 ------
NM_019556chrX21133 545 21286 1183 ----
NM_019557chr12750 99 ------
NM_019593chr2043113 2612 2109 481 13186 ----
NM_019597chrX2775 585 ------
NM_019600chr153195 115 103 ------
NM_019606chr71476 --1221 --
NM_019610chr151926 1900 1836 384 341 ------
NM_019854chr12----1691 --
NM_019862chr1681713 1678 1628 1497 1308 1209 691 576 --1462 --
NM_019891chr131003 347 304 ------
NM_019895chr31204 ------
NM_019898chr1681713 1678 1628 1497 1308 1209 691 576 --1462 --
NM_019899chr1681713 1678 1628 1497 1308 1209 691 576 --1462 --
NM_019900chr1681713 1678 1628 1497 1308 1209 691 576 --1462 --
NM_020039chr124641 339 181 160 11476 11267 --
NM_020062chr20--1979 ----
NM_020066chr13663 386 90 1297 1899 --
NM_020116chr441580 1392 1228 97 --31771 1191 1169 --
NM_020122chr232216 648 29 14540 25487 1430 1917
NM_020123chr1041061 618 394 257 --1556 --
NM_020133chr6105609 5234 4373 4149 4124 2153 1223 835 507 60 14301 25655 352 14556
NM_020141chr122410 313 1728 ----
NM_020143chr22842 287 ----1126
NM_020144chr721793 1421 --1123 --
NM_020150chr1052244 2166 1610 1603 224 ------
NM_020177chr53837 526 264 12519 ----
NM_020178chr172882 118 ------
NM_020182chr2033612 2928 2475 43177 2638 2469 1267 23357 2294 12305
NM_020200chr101760 ----196
NM_020205chr152961 2892 2588 2201 642 1562 ----
NM_020225chr43395 76 23 ------
NM_020228chr1172476 2386 2361 1669 1010 784 169 1653 ----
NM_020239chr1102181 2170 1867 1821 1538 1438 817 613 43 29 21701 694 ----
NM_020240chr562687 2389 1878 852 682 207 ----1812
NM_020245chr694857 3618 3466 1867 1746 1230 1046 382 374 2933 444 11396 14923
NM_020310chr1732324 1974 655 12226 --11796
NM_020317chr11338 ------
NM_020336chr2053817 3547 2805 2645 1241 23522 1248 13766 --
NM_020337chr422837 2437 32746 1184 826 1762 --
NM_020338chr1032653 2642 41 --32831 735 384 --
NM_020341chr2041265 655 301 98 --1160 --
NM_020346chr1141752 1608 325 212 21165 564 ----
NM_020357chr311227 1653 --11109
NM_020360chr171612 ------
NM_020390chr374514 4258 3516 1738 1672 1537 1023 33531 3397 482 ----
NM_020403chr1321750 1402 11121 11214 --
NM_020416chr452620 2405 2253 876 387 21705 704 --12134
NM_020420chrY31674 1632 94 ------
NM_020432chr732339 1640 794 ------
NM_020444chr5--21525 532 ----
NM_020453chr4--21660 1314 1279 --
NM_020456chr1342134 1735 887 815 ------
NM_020457chr161588 ----1151
NM_020474chr1821642 73 ------
NM_020532chr23317 192 33 ------
NM_020546chr552886 1969 958 326 291 22298 567 1746 --
NM_020640chr362204 277 266 248 170 148 1104 1326 --
NM_020651chr231457 1355 1191 1300 ----
NM_020654chr311512 21011 608 ----
NM_020661chr122755 277 --1379 --
NM_020673chr2097239 6068 5574 5299 2459 2186 1721 1560 621 ----25504 1274
NM_020686chr1642138 1154 589 257 12596 1725 12823
NM_020699chr1115222 4861 4694 4628 4207 3421 2136 944 924 380 38 --23435 30 --
NM_020704chr752302 2241 801 727 615 ------
NM_020711chr252139 1961 1696 597 557 125 ----
NM_020714chr19104340 4071 3760 3380 3142 3038 1852 1803 470 344 13685 11324 24580 1593
NM_020717chrX124934 4767 4143 3960 3914 3632 3287 2001 1564 714 304 61 --11876 --
NM_020718chr1656635 5859 4790 1417 1024 14603 15573 --
NM_020726chr52462 418 --1119 --
NM_020727chr2121422 513 11604 11185 --
NM_020728chr752976 2716 2542 1208 469 --22265 24 --
NM_020732chr6----1213 --
NM_020734chr1242962 2592 2546 847 12678 ----
NM_020739chr151555 43272 1436 1153 589 --24083 1429
NM_020742chrX32458 2055 979 32620 2503 885 ----
NM_020748chr172739 191 ------
NM_020750chr631428 996 245 --121 --
NM_020752chr1052532 2339 2319 1974 1885 ------
NM_020755chr61257 --11227 --
NM_020765chr11287 ------
NM_020766chrX83417 3145 2833 1435 1364 1302 935 149 ------
NM_020769chrX2950 646 ------
NM_020771chr631225 1217 1051 ------
NM_020772chr1788533 7853 7273 6556 5599 5581 2491 1288 58072 3437 3283 2866 88 12054 --
NM_020774chr18105777 5275 5210 4753 4199 1995 1557 1428 361 278 --12050 15666
NM_020776chr1872910 1138 645 462 453 152 124 13020 ----
NM_020778chr1594827 4162 3383 3149 1370 1200 544 504 323 21163 452 34750 1817 560 --
NM_020779chr242646 2108 2069 2019 ------
NM_020783chr1831688 1569 459 1406 ----
NM_020791chr1741289 1103 964 395 11253 ----
NM_020794chr121298 1048 ----1150
NM_020796chr542412 2162 755 135 --1220 --
NM_020801chr531735 642 176 ------
NM_020803chr431480 933 703 ------
NM_020805chr1841500 1357 86 36 1691 ----
NM_020806chr143327 123 56 ------
NM_020809chr1142312 1758 791 146 --1288 --
NM_020810chr1463373 3215 3072 735 728 430 12473 1712 --
NM_020818chr14----1109 --
NM_020826chr1173022 2631 2515 1449 878 386 81 --32508 2319 47 --
NM_020834chr1431590 1285 428 1546 1761 --
NM_020839chr321127 1014 ----11335
NM_020841chr1231114 537 181 21561 160 ----
NM_020845chr1242112 1738 831 425 --22059 171 --
NM_020850chr1643274 1184 982 910 23198 1079 13164 12845
NM_020854chr1821430 122 11294 ----
NM_020856chr1931316 1203 379 --1264 --
NM_020858chr1562202 1481 900 647 538 35 ------
NM_020860chr41418 --1389 --
NM_020861chr651327 1198 1104 936 49 --31376 518 490 --
NM_020868chr231431 1409 348 ------
NM_020871chrX51999 1007 990 852 228 ------
NM_020872chr321780 160 ------
NM_020886chr113917 319 26 ------
NM_020888chr161861 1782 1770 1309 256 184 1174 1426 --
NM_020896chr111280 ------
NM_020899chr1731023 608 453 12020 21606 532 --
NM_020917chr1942612 1415 728 447 31458 591 164 23557 2696 --
NM_020918chr102889 166 ----22287 2240
NM_020921chr1463589 3580 3139 2701 2608 2492 ------
NM_020922chrX61205 1161 691 438 237 169 1493 ----
NM_020925chr111276 --1939 1573
NM_020935chr284592 3791 3478 3084 1803 1714 855 211 ------
NM_020940chr1032414 1900 158 --1375 --
NM_020948chr142996 2950 2733 649 --13456 --
NM_020951chr1932318 246 130 --12306 --
NM_020952chr92671 52 --1563 --
NM_020962chr1552416 2331 1000 796 322 --3917 829 455 --
NM_020964chr18104494 4137 3906 3757 3082 2921 1703 1582 1186 926 1642 24302 1124 14098
NM_020977chr452121 1881 1657 1497 527 --2369 328 --
NM_020981chr21583 ----1217
NM_020983chr121254 ----11939
NM_020987chr1011234 11135 ----
NM_020993chr1241983 1874 1814 456 11108 ----
NM_021003chr14------186
NM_021007chr222346 939 21619 574 ----
NM_021013chr171112 165 1332 --
NM_021019chr121148 ------
NM_021032chr351777 1763 719 493 149 ------
NM_021033chr1332736 849 624 1205 ----
NM_021035chr2021106 401 --196 --
NM_021061chr8114052 3780 3757 3727 3467 1541 1171 878 553 450 207 ----129
NM_021064chr62604 156 --21259 632 --
NM_021069chr431901 1595 1421 ------
NM_021079chr1752559 1308 963 782 689 --12498 1237
NM_021083chrX43371 2336 1093 790 11180 ----
NM_021097chr252559 2499 2053 745 218 1268 12570 12580
NM_021101chr341991 1734 1013 192 22341 348 ----
NM_021102chr192385 172 ------
NM_021105chr33733 624 140 ------
NM_021116chr7108004 7231 6640 6217 5842 3502 3164 2267 906 832 12082 57625 6135 2067 778 264 28535 2435
NM_021120chrX32757 2233 1944 --42807 753 678 22 --
NM_021133chr151331 485 300 225 69 11161 11232 --
NM_021135chr652983 2940 2733 2691 301 --32326 612 41 --
NM_021140chrX1264 11113 ----
NM_021145chr72762 444 21062 453 ----
NM_021155chr1962846 2618 2585 2444 674 117 --52190 2101 504 178 46 11886
NM_021156chr2021114 901 181 21104 409 --
NM_021174chr82229 25 ------
NM_021183chrX42523 894 471 236 ------
NM_021190chr111326 11102 --1864
NM_021215chr2052325 540 279 165 146 --12147 --
NM_021222chr121008 327 ----11319
NM_021238chr1221423 182 --11828 --
NM_021240chr92469 80 ------
NM_021245chr10--199 1170 --
NM_021252chr1051466 1410 1387 811 49 1512 ----
NM_021253chr62377 114 11292 ----
NM_021255chr1463694 3614 3516 3449 1300 744 14110 13775 --
NM_021260chr1441426 932 563 107 11203 ----
NM_021572chr621055 976 ------
NM_021622chr1032093 910 412 ----140
NM_021627chr3--1848 ----
NM_021629chr364863 4744 4252 1332 888 841 14113 ----
NM_021633chr151181 1033 507 166 71 ------
NM_021637chrX21378 226 1880 1439 --
NM_021638chr444747 1295 653 288 157 24407 3985 14531
NM_021647chr464734 4134 4030 2960 2907 1501 33165 1714 508 21372 886 --
NM_021648chr622254 182 1138 --1953
NM_021705chr651267 1134 1027 538 95 ------
NM_021728chr143385 267 240 ------
NM_021809chr2031688 1678 1580 12100 ----
NM_021813chr6125681 4049 4030 3579 3566 1612 1530 1490 1309 1034 513 154 24232 3736 --14855
NM_021905chr631532 1465 470 1282 22064 1599 --
NM_021907chr21108 ------
NM_021911chr552052 1938 1165 527 132 --25050 368 --
NM_021912chr1553105 2648 978 521 454 14072 --11188
NM_021913chr1921451 1232 ------
NM_021914chr1472192 2179 2006 1876 619 581 533 ------
NM_021923chr4----21543 1265 --
NM_021935chr3140 11060 ----
NM_021940chr621647 1082 --11278 --
NM_021943chr61140 1450 --11799
NM_021946chrX11377 --11080 --
NM_021947chr172906 852 ------
NM_021951chr93870 790 709 ------
NM_021954chr1373343 2970 2957 1287 1184 929 343 22923 266 12443 --
NM_021960chr152656 2636 2532 2142 1812 1656 ----
NM_021961chr1196836 5896 5825 4982 2829 2692 2117 1807 1141 57036 6858 6038 746 668 32423 2140 1333 11121
NM_021963chrX2695 238 ------
NM_021964chr346631 1557 326 177 11327 11774 --
NM_021970chr4--2570 34 ----
NM_021977chr653075 1299 931 451 48 33766 3267 337 ----
NM_021988chr2031541 562 215 11244 11138 --
NM_021992chrX2265 115 1326 ----
NM_021998chrX1119 ------
NM_021999chr131529 ------
NM_022003chr1131308 1204 813 11277 11063 --
NM_022037chr22683 243 ------
NM_022048chr15106331 6000 4690 1570 1439 1366 1217 1041 954 325 25473 23 11006 1898
NM_022054chr141132 2841 216 ----
NM_022058chr212097 21792 104 ----
NM_022068chr183566 260 143 166 ----
NM_022073chr1441674 1525 243 55 21433 184 1124 --
NM_022093chr12889 21 2690 262 ----
NM_022114chr174630 4152 4016 3851 1490 1094 1050 --53844 3496 1024 968 115 --
NM_022116chr73877 786 335 1909 ----
NM_022123chr141532 ------
NM_022129chr1011376 1111 ----
NM_022130chr521037 371 --124 1246
NM_022137chr1451996 1976 1615 481 233 --11405 --
NM_022166chr1685530 4720 4512 3962 2177 1701 896 715 1252 55163 2327 1951 1829 1765 22230 1775
NM_022170chr751417 1261 1152 175 77 ----11609
NM_022173chr22683 243 ------
NM_022336chr252258 1830 661 526 24 12233 ----
NM_022366chr1----2303 83 --
NM_022373chr71787 ------
NM_022442chr2031541 562 215 11244 11138 --
NM_022454chr82581 352 2799 76 ----
NM_022458chr732437 663 252 22277 935 22649 420 11977
NM_022459chr13115857 5732 5609 5337 5210 4267 4156 1728 1491 1264 32 14188 ----
NM_022461chr341167 507 492 56 ------
NM_022465chr1282384 1873 1055 653 375 226 166 154 32045 874 444 --12480
NM_022469chr133082 2629 489 12750 --1675
NM_022475chr45667 601 150 80 52 1524 1107 --
NM_022476chr1611099 1803 ----
NM_022477chr2031199 248 222 --3489 149 39 1427
NM_022484chr721156 917 11226 ----
NM_022488chr3124 ------
NM_022494chr102174 24 ------
NM_022495chr143186 156 53 ------
NM_022496chr122407 393 ------
NM_022574chr721671 711 ------
NM_022648chr294562 3782 3695 3302 2852 1760 1555 1268 1208 24147 324 14452 1602
NM_022652chr1211102 --1184 --
NM_022716chr172399 2195 1934 770 555 449 59 32998 2908 412 ----
NM_022719chr2242454 725 464 283 12867 --12470
NM_022726chr651718 1079 331 267 229 ------
NM_022730chr2----1961 --
NM_022737chr1921294 1269 --163 --
NM_022748chr722105 136 32743 2046 1935 --11137
NM_022753chr181747 1738 1717 1027 715 599 495 390 ------
NM_022758chr631069 635 332 12600 22480 2367 --
NM_022763chr362960 2838 2418 2349 1193 294 12787 ----
NM_022766chr222956 456 1515 12636 --
NM_022771chr121387 ------
NM_022776chr33549 229 57 11596 ----
NM_022780chr211735 11151 ----
NM_022781chr942753 2694 2131 793 --12660 --
NM_022802chr1021634 395 ----11407
NM_022817chr252027 1801 1688 1420 424 172 ----
NM_022824chr541583 1271 725 580 ------
NM_022826chr2----1162 --
NM_022828chr51549 ----1143
NM_022841chr1522167 1819 --1860 --
NM_022843chr13--153 ----
NM_022845chr1692160 1969 1579 876 862 720 613 447 33 11799 ----
NM_022875chr51513 ------
NM_022877chr51513 ------
NM_022893chr232679 2561 493 ------
NM_022894chr231616 1283 697 --1183 --
NM_022898chr1474714 3629 1704 1617 1230 889 858 11851 53802 3557 3550 3162 3097 --
NM_022900chr711199 ------
NM_022912chr233075 2838 2820 22262 1195 22883 42 --
NM_022918chr1141426 854 555 41 ------
NM_022970chr1031222 1092 181 11156 1966 --
NM_022977chrX2466 106 11682 ----
NM_023009chr11167 --1705 --
NM_023010chrX1660 ------
NM_023039chr5------1321
NM_023068chr2061581 1563 527 519 382 353 --21036 309 21169 362
NM_023074chr1941332 1026 948 884 ------
NM_023079chr1731736 1189 111 --11264 --
NM_023112chr1422299 50 --12984 --
NM_023929chr812097 --11084 --
NM_023943chr31147 ------
NM_024007chr552809 2794 2176 1001 976 --1781 --
NM_024019chr431082 911 181 ------
NM_024052chr1732622 2259 969 22853 2632 --22508 2416
NM_024054chr71336 ------
NM_024085chr21705 ------
NM_024090chr451950 1466 1357 425 179 ----2632 587
NM_024094chr81128 ------
NM_024122chrX2175 23 ----1243
NM_024293chr2--1301 1639 --
NM_024294chr631069 635 332 12600 22480 2367 --
NM_024295chr832061 1995 1497 22022 186 ----
NM_024315chr72312 163 ------
NM_024325chr2021284 1066 2980 809 ----
NM_024345chr964907 3924 3827 2011 1058 208 26099 740 11316 25917 491
NM_024408chr1113182 2631 2610 2397 2324 1085 897 548 452 386 314 --12866 --
NM_024415chr52230 94 1146 ----
NM_024424chr111110 ------
NM_024425chr111110 ------
NM_024426chr111110 ------
NM_024430chr1851761 1677 1403 1297 218 ------
NM_024494chr12502 63 --1624 1647
NM_024501chr2--1484 ----
NM_024520chr2--184 ----
NM_024524chr353094 2534 1958 824 176 1219 ----
NM_024529chr12898 862 --1341 --
NM_024539chrX31243 1192 800 ------
NM_024545chr22690 673 ------
NM_024551chr1232409 1590 1012 12575 --11649
NM_024551chr1232409 1590 1012 12575 --11649
NM_024554chr14582 543 268 204 2700 177 --11435
NM_024567chr8----1651 --
NM_024569chr172965 2775 2505 2020 1112 792 258 32933 2520 101 12114 --
NM_024581chr61168 ------
NM_024586chr1299 68 ------
NM_024596chr854756 3836 3657 2002 1819 23516 3405 21914 872 --
NM_024612chr1711082 ------
NM_024624chr231579 410 99 11487 ----
NM_024639chr612067 ----1183
NM_024641chr622637 350 22188 2015 12391 12514
NM_024645chr81420 2601 377 11224 --
NM_024646chr164011 1020 683 500 242 39 ------
NM_024657chrX2668 36 ------
NM_024665chr394624 4348 4268 4185 3659 3172 1079 917 589 ------
NM_024674chr173054 2515 2192 953 588 457 409 1466 ----
NM_024686chr11585 1447 ----
NM_024692chr221282 114 --11354 --
NM_024699chr81694 1194 1322 --
NM_024704chr2021035 743 --1715 --
NM_024713chr151663 ----11264
NM_024721chr82767 576 1418 ----
NM_024740chr1164118 3865 3031 1659 976 34 21114 486 ----
NM_024744chr242184 2087 1673 309 ------
NM_024749chr132237 1950 1855 ----167
NM_024769chr112871 213 ----1728
NM_024770chr295709 5592 5478 5463 1791 1396 1197 1071 1004 35194 4392 1209 34287 4221 1520 16011
NM_024779chr1231327 1315 144 --21558 1494 11161
NM_024812chr852146 1505 1443 678 549 12139 ----
NM_024817chr1585417 4159 3730 2354 2273 2225 1879 1853 ----1506
NM_024828chr91626 11018 ----
NM_024857chr17--176 ----
NM_024893chr202215 156 ------
NM_024896chr92911 723 ------
NM_024909chr641531 1239 634 305 --1507 --
NM_024920chr41303 --11121 --
NM_024930chr562765 2612 2382 1898 1773 666 ------
NM_024939chr1631216 260 37 --1155 --
NM_024946chr1651692 1541 1228 411 106 ------
NM_024947chr3189134 8682 8155 7917 6878 6601 6533 6044 5832 3065 2721 2596 2359 2265 1533 1113 805 329 28753 3458 37991 7801 3259 13594
NM_024948chr102505 190 ------
NM_024949chr443769 1853 1734 1213 24176 1269 ----
NM_024953chr122650 295 11926 155 --
NM_024969chr23821 731 121 ------
NM_024971chr92671 52 --1563 --
NM_024989chr2137169 6860 6839 6417 5441 5093 2053 1418 1395 1312 695 363 95 27100 2516 ----
NM_024991chr102784 771 1906 ----
NM_025004chr113634 616 310 ------
NM_025054chr894023 3890 3687 3492 3369 1449 1162 1115 316 32958 1613 1048 ----
NM_025083chr1531941 1566 758 --11496 11869
NM_025126chr121147 --1555 --
NM_025133chr2--1340 ----
NM_025134chr1642102 2092 1809 664 --12167 --
NM_025146chr332583 579 532 11790 ----
NM_025160chr164027 3498 3315 3151 1264 332 ------
NM_025164chr1162052 1673 1631 885 824 245 11532 1524 1894
NM_025179chr174562 4414 3501 3031 1477 465 124 24537 791 54519 4186 3219 1985 1244 1215
NM_025182chr9255 45 ------
NM_025184chrX3267 211 24 ------
NM_025187chr1641109 945 193 51 --11299 --
NM_025191chr153267 2662 846 456 69 12222 ----
NM_025194chr1911178 ------
NM_025195chr851465 439 427 294 267 ------
NM_025202chr241011 993 393 262 1362 --173
NM_025221chr421167 909 --1185 --
NM_025222chr31798 --1114 1308
NM_025235chr103523 147 95 ----12210
NM_025238chr1531119 259 21 ------
NM_030621chr1431275 931 229 ------
NM_030623chr211436 --1564 186
NM_030625chr1042090 799 740 719 22231 93 32535 914 474 --
NM_030627chr593499 3334 1610 1602 1147 945 488 236 59 --11492 --
NM_030634chr132465 947 616 1796 41789 526 470 333 --
NM_030637chr141672 ------
NM_030640chr121913 --1276 --
NM_030647chr776316 6048 4501 1942 1690 1311 24 34745 4596 1868 15521 14046
NM_030648chr4125338 5228 4795 3658 2188 2154 1964 736 574 452 445 208 --24778 111 --
NM_030660chr1441243 1058 179 47 --11359 --
NM_030661chr7--11059 11608 --
NM_030674chr12105336 5281 5244 4665 4551 4307 4289 3888 1806 1155 13762 25108 659 --
NM_030755chr1472774 2294 2021 1149 997 851 626 11049 11017 --
NM_030759chr10--1316 ----
NM_030780chr821763 1453 11244 1598 --
NM_030786chr151751 1669 1451 454 127 ------
NM_030799chr51478 31977 1920 760 ----
NM_030803chr231243 917 386 ------
NM_030806chr1168631 8068 7156 7057 7034 3451 3435 3420 3406 2856 2308 1820 1389 1012 946 775 --39169 6308 3265 12335
NM_030808chr1741040 756 738 379 --1885 --
NM_030809chr1211663 11732 2714 34 --
NM_030816chr183398 2427 2411 1472 1307 998 732 434 ----23218 2340
NM_030820chr6----11002 --
NM_030821chr42761 209 ------
NM_030881chr2252454 2241 1695 1635 706 ------
NM_030885chr362365 1728 1553 1470 919 657 ----1340
NM_030916chr13946 882 66 ------
NM_030918chr194744 4442 4423 4252 2068 1928 1682 1525 37 34296 384 225 34987 4573 856 14547
NM_030920chr141863 756 59 22 11787 ----
NM_030927chr1031562 1505 117 1575 ----
NM_030934chr131894 1825 328 ------
NM_030962chr1131181 346 77 --11058 --
NM_030978chr91392 --184 --
NM_031203chr191214 ------
NM_031208chr162184 76 ------
NM_031217chr111105 ------
NM_031262chr9133 ------
NM_031263chr9190 ------
NM_031266chr51118 ------
NM_031267chr7------1215
NM_031268chr1675322 4970 3333 2164 1980 1858 733 ------
NM_031314chr1432027 1530 83 199 41383 740 530 127 --
NM_031362chr232750 2644 393 1806 12270 --
NM_031365chr242886 2780 529 99 1942 22406 1849 --
NM_031366chr242886 2780 529 99 1942 22406 1849 --
NM_031371chr131628 1365 567 ------
NM_031371chr131628 1365 567 ------
NM_031372chr4148 --1469 --
NM_031407chrX----2179 147 --
NM_031411chr51830 --12057 --
NM_031417chr194777 589 512 359 32813 2427 2257 12169 --
NM_031418chr1142760 2046 1775 467 42776 2496 2119 244 ----
NM_031427chr1495830 4586 3898 3766 2021 1381 1175 680 201 --11974 1133
NM_031431chr1321421 539 1726 1569 1689
NM_031435chr12103413 3392 3294 3202 3182 3016 2424 360 39 32 1962 13062 12122
NM_031442chrX53083 2927 1098 426 63 --22247 2098 --
NM_031445chr222526 995 11147 12946 1663
NM_031450chr11156 ----1138
NM_031461chr872275 2253 2226 1992 1938 761 572 ------
NM_031468chr7156832 6238 5908 5710 3106 3028 3022 2647 2462 1498 1168 1053 881 845 395 25206 2012 17957 22065 309
NM_031483chr2063250 3135 1254 1189 342 75 ------
NM_031844chr1104079 3600 3432 3298 3151 2893 1548 1337 1081 898 21361 441 1487 --
NM_031845chr272678 2558 2329 2290 1331 328 86 ------
NM_031847chr272678 2558 2329 2290 1331 328 86 ------
NM_031849chr51830 --12057 --
NM_031857chr51830 --12057 --
NM_031860chr51830 --12057 --
NM_031866chr1021065 831 ------
NM_031889chr481940 1600 1269 568 472 377 49 22 2590 117 --11511
NM_031890chr2242247 980 684 229 12879 1736 --
NM_031892chrX3895 179 35 ------
NM_031911chr441945 962 393 214 2855 330 22298 823 --
NM_031922chr61508 ------
NM_031953chr41364 ------
NM_031992chr751417 1261 1152 175 77 ----11609
NM_032012chr943730 3306 1373 498 24709 3325 ----
NM_032013chr2031199 248 222 --3489 149 39 1427
NM_032025chr32370 193 42050 2019 571 409 151 --
NM_032041chr822078 703 ------
NM_032042chr562507 1088 950 695 486 406 11858 ----
NM_032047chr342322 1679 975 622 ------
NM_032050chr222700 421 --2407 160 --
NM_032052chr2231085 910 335 --1545 --
NM_032088chr521158 500 1494 1321 --
NM_032092chr521158 500 1494 1321 --
NM_032102chr1143055 2548 1946 174 11149 ----
NM_032121chrX102610 2585 1906 745 546 486 457 442 210 175 ------
NM_032139chr192788 329 1254 ----
NM_032144chr22446 358 11553 --1515
NM_032147chr122958 287 ------
NM_032153chr321887 849 --12145 1121
NM_032154chr102387 294 ------
NM_032160chr18113920 3715 3598 3417 3277 1638 1347 1122 796 754 438 --14118 --
NM_032182chr101465 ------
NM_032186chr11972 ------
NM_032189chr1354403 3673 1827 397 181 --21075 774 11015
NM_032192chr171530 172 ----
NM_032195chr211101 145 ----
NM_032199chr1031409 1359 752 13213 ----
NM_032221chr20--31974 1618 224 11726 --
NM_032228chr1143538 3498 519 106 13477 ----
NM_032233chr142349 192 --1719 --
NM_032236chr131033 893 415 --1748 --
NM_032239chr42497 347 ------
NM_032246chr153899 505 296 ------
NM_032250chr91291 ------
NM_032288chr312161 12399 ----
NM_032291chr111198 1546 ----
NM_032293chr92283 26 ------
NM_032307chr91724 1934 --1121
NM_032325chr111774 1651 11903 2797 89
NM_032328chr1171 ------
NM_032352chr14--2197 96 11252 --
NM_032364chr1231003 653 212 ------
NM_032373chr10105763 5564 5135 4857 4360 3799 776 606 531 192 --15233 --
NM_032403chr521158 500 1494 1321 --
NM_032408chr72462 441 --1996 --
NM_032433chr1931545 1140 71 ------
NM_032438chr64666 356 212 32 ------
NM_032440chr1031869 447 156 ------
NM_032445chr1532021 1936 842 ------
NM_032457chr41508 1718 1198 --
NM_032458chrX42485 970 453 322 --12575 --
NM_032468chr821736 1098 ------
NM_032471chr61360 --1931 --
NM_032486chr1631918 1734 491 22034 150 11637 --
NM_032499chr152358 301 ------
NM_032505chr352554 1848 1781 854 40 1460 1163 --
NM_032509chr842261 2243 1711 518 ------
NM_032511chr62330 97 ------
NM_032521chr2052746 2455 591 404 278 --1977 --
NM_032523chr23187 131 36 ------
NM_032532chr62502 142 1572 ----
NM_032547chr41396 --11147 --
NM_032550chr10----2907 466 --
NM_032557chr43731 411 355 1317 ----
NM_032559chr171115 ------
NM_032560chr141454 ------
NM_032569chr1631784 1270 86 ------
NM_032578chr1031253 1117 567 ------
NM_032582chr1731537 728 111 11378 ----
NM_032590chr121456 1294 ----
NM_032603chr21627 ----1726
NM_032632chr1441628 1504 1448 1432 11331 ----
NM_032664chr841502 1065 395 235 ------
NM_032682chr353473 3250 2288 1082 902 12904 1784 12655
NM_032689chr1921131 326 11019 1350 --
NM_032701chr192560 543 ------
NM_032741chr62389 120 1136 140 --
NM_032765chr53802 719 673 --1182 --
NM_032784chr62315 248 ------
NM_032804chr1082527 2100 1822 1026 728 317 301 278 1808 --1584
NM_032813chr1321119 753 ------
NM_032819chr201200 183 --1465
NM_032828chr1974930 4913 4103 1594 435 238 125 14504 14509 14492
NM_032833chr162506 2127 2026 1699 700 221 ------
NM_032836chr193844 649 346 ------
NM_032837chr1722087 275 1377 ----
NM_032838chr192433 376 ------
NM_032842chr751214 1137 1053 485 184 11060 ----
NM_032846chr1461203 533 405 351 216 169 --11369 --
NM_032859chr1333550 3261 1573 31382 948 236 ----
NM_032866chr1553025 2666 2525 621 546 12058 23149 634 12036
NM_032870chr6----1498 --
NM_032876chr1441867 554 377 114 1293 ----
NM_032883chr202786 267 1579 --1649
NM_032895chr171801 ------
NM_032900chr1043843 3557 3306 2898 1828 13085 --
NM_032905chr102457 185 2285 40 ----
NM_032918chr1221323 86 ----1293
NM_032947chr551173 796 233 89 59 2175 82 ----
NM_032961chr41529 ------
NM_032968chrX43402 3071 2624 1391 ------
NM_032969chrX43402 3071 2624 1391 ------
NM_032973chrY53595 3398 3066 2623 1391 ------
NM_032978chr181200 ------
NM_032979chr181200 ------
NM_032981chr181200 ------
NM_033018chrX----2426 78 --
NM_033020chr174610 4024 3719 3207 278 181 101 24094 1168 ----
NM_033025chr192983 245 ------
NM_033027chr31146 --1772 --
NM_033030chr221569 53 11454 ----
NM_033055chr111043 --1262 --
NM_033056chr102697 596 ------
NM_033058chr84788 352 277 79 ------
NM_033081chr202503 162 ------
NM_033083chr363413 3302 2275 1260 1060 205 23023 324 12227 12560
NM_033089chr201382 11274 ----
NM_033105chr81107 ------
NM_033117chr91285 ------
NM_033132chr1331425 704 58 21458 901 11607 --
NM_033133chr1752537 1190 942 611 69 ----13188
NM_033138chr742131 1731 1699 1478 ------
NM_033139chr742131 1731 1699 1478 ------
NM_033140chr742131 1731 1699 1478 ------
NM_033143chr464175 4093 3766 1249 987 362 11687 ----
NM_033147chr21108 ------
NM_033148chr21108 ------
NM_033157chr742131 1731 1699 1478 ------
NM_033181chr653740 3508 3388 771 237 13522 1186 --
NM_033211chr52291 196 1374 ----
NM_033221chr941854 390 259 116 32738 520 361 1366 --
NM_033224chr7108004 6698 6397 2763 2570 1751 1402 1380 504 329 37217 2993 1199 --11114
NM_033225chr832712 2476 1977 22043 116 12013 1973
NM_033226chr163629 461 81 ------
NM_033261chr101488 1166 ----
NM_033285chr853767 3177 2884 941 338 43271 3262 1645 396 ----
NM_033300chr1------11095
NM_033326chr111646 ----1375
NM_033364chr31660 21895 1826 1196 --
NM_033380chrX3953 842 789 ------
NM_033381chrX3953 842 789 ------
NM_033389chr1784760 4392 3997 3687 3621 3214 837 798 34368 3741 1654 --14312
NM_033397chr1062119 1991 1633 819 521 26 ------
NM_033401chr162191 122 ----1476
NM_033425chr1153395 2433 1397 1086 153 22651 2345 ----
NM_033426chr1442102 1036 922 430 12283 ----
NM_033429chr15--1581 1461 --
NM_033430chr443518 3205 1640 432 ----11498
NM_033437chr443518 3205 1640 432 ----11498
NM_033450chr62305 298 --187 --
NM_033484chr51574 ------
NM_033495chrX4412 316 199 58 1909 ----
NM_033502chr6------150
NM_033505chr276778 6245 4573 2649 2273 2259 1989 ------
NM_033535chr411064 ------
NM_033540chr3----1356 --
NM_033542chr2031831 660 22 ------
NM_033551chr572674 1238 1218 1181 1148 1065 229 11318 32332 752 581 12514
NM_033624chr124526 322 280 43 11519 ----
NM_033631chr183862 3274 2509 1284 1261 273 231 59 12612 1874 --
NM_033632chr421407 633 --11356 --
NM_033642chrX--21057 780 ----
NM_033644chr531951 1810 402 --1477 --
NM_033645chr531951 1810 402 --1477 --
NM_033656chr2175856 4885 4828 3864 2037 1088 291 14101 11039 15869
NM_033666chr104957 731 640 132 1986 ----
NM_052840chr1511183 ------
NM_052851chr1352209 2128 1754 963 372 ------
NM_052867chr1371105 1015 984 920 544 409 140 ------
NM_052875chr1162103 1952 1893 1845 415 235 11630 2603 325 --
NM_052879chr1253767 3695 2883 1620 767 --24058 358 13202
NM_052885chr1254814 3897 3871 1526 303 --11730 --
NM_052886chr852009 1808 1706 1575 1335 ------
NM_052901chr9173 11664 ----
NM_052904chr61274 ------
NM_052905chr241182 1165 573 553 ------
NM_052910chr1321795 1773 --147 --
NM_052911chr182926 733 ------
NM_052917chr273378 3171 2712 1157 497 422 105 22158 371 ----
NM_052918chr1023568 1226 22592 2346 173 --
NM_052927chr542194 1580 726 548 22143 1983 ----
NM_052928chr1731681 453 181 ------
NM_052932chr1121919 87 1203 ----
NM_052937chr822029 282 ------
NM_052965chr12139 71 ------
NM_052978chr1451872 1687 1597 603 76 --1298 --
NM_053016chr9117643 7592 5300 2471 2420 2373 2340 1829 1188 918 832 --47170 5585 2823 197 16534
NM_053023chr1142718 2343 2231 2155 31051 459 272 ----
NM_053024chr311380 ------
NM_053025chr331438 1432 323 ------
NM_053026chr331438 1432 323 ------
NM_053027chr331438 1432 323 ------
NM_053028chr331438 1432 323 ------
NM_053031chr331438 1432 323 ------
NM_053032chr331438 1432 323 ------
NM_053035chr72238 182 --194 --
NM_053042chr432883 2540 520 ------
NM_053043chr7116195 5539 5307 5052 4466 4451 4150 1518 1136 1107 885 1417 1221 --
NM_053056chr1122887 2807 --2404 121 11220
NM_053064chr1431115 185 116 32622 618 295 --11223
NM_054016chr131507 1354 1276 1247 ----
NM_054016chr131507 1354 1276 1247 ----
NM_054016chr131507 1354 1276 1247 ----
NM_054025chr1122009 1948 --21369 54 --
NM_057159chr931329 615 204 --133 --
NM_057175chr452361 1853 901 252 147 ------
NM_057178chr1742511 2488 880 406 ----1806
NM_057749chr81134 1420 ----
NM_058170chr131092 512 186 ----11617
NM_058172chr451762 1620 1204 590 529 ------
NM_058241chr21144 12197 ----
NM_058241chr21144 12197 ----
NM_078487chr942715 2364 650 623 ------
NM_078625chr611094 1264 1456 --
NM_080546chr911817 --1765 --
NM_080552chr201587 ------
NM_080599chr1041103 502 248 61 11223 ----
NM_080626chr121335 ------
NM_080629chr1--1246 --1336
NM_080630chr1--1246 --1336
NM_080632chrX1660 ------
NM_080645chr631826 818 591 11410 ----
NM_080651chr8--1229 ----
NM_080654chr1131125 81 53 1191 1263 --
NM_080664chr1431857 1489 400 197 ----
NM_080672chr201415 ------
NM_080676chr2092664 2156 1322 1221 931 325 249 235 122 12233 22081 704 --
NM_080678chr2--1626 --2156 88
NM_080723chr61466 ----21276 1225
NM_080737chrX1341 11244 11208 --
NM_080738chr131634 309 248 1528 ----
NM_080743chr642502 2329 2010 624 --1555 --
NM_080749chr202122 34 ------
NM_080759chr1321703 424 ----12433
NM_080760chr1321703 424 ----12433
NM_080798chr101101 ------
NM_080799chr101101 ------
NM_080800chr101101 ------
NM_080801chr101101 ------
NM_080802chr101101 ------
NM_080803chr101101 ------
NM_080804chr101101 ------
NM_080805chr101101 ------
NM_080806chr101101 ------
NM_080807chr101101 ------
NM_080808chr101101 ------
NM_080809chr101101 ------
NM_080810chr101101 ------
NM_080811chr101101 ------
NM_080812chr101101 ------
NM_080813chr101101 ------
NM_080814chr101101 ------
NM_080815chr101101 ------
NM_080832chrX31826 1196 706 21450 220 ----
NM_080867chr1483667 1928 1854 1319 1313 1272 680 282 25031 1124 --1772
NM_080872chr883769 3536 3140 3117 1365 1357 1339 1147 33839 2981 1073 22529 1432 13471
NM_080927chr373214 2977 2441 2166 692 538 161 --1651 --
NM_130391chr933313 2752 310 --1806 --
NM_130392chr933313 2752 310 --1806 --
NM_130393chr933313 2752 310 --1806 --
NM_130435chr1052917 2529 2355 1991 92 21136 1065 1820 --
NM_130436chr2162710 2337 2226 1960 493 227 12647 --2566 206
NM_130438chr2193287 2914 2803 2537 2102 1070 804 191 34 13224 1291 21143 783
NM_130439chr1061734 943 763 713 671 533 12113 1319 --
NM_130439chr1061734 943 763 713 671 533 12113 1319 --
NM_130442chr73299 175 93 --21138 457 --
NM_130768chr7297 36 ------
NM_130797chr7----11225 --
NM_130806chr132455 88 ------
NM_130809chr542640 2418 842 189 ------
NM_130811chr20----1762 --
NM_130830chr3113623 3091 1528 1472 1432 1304 1060 304 291 158 61 33822 2874 2651 ----
NM_130831chr321943 206 11784 ----
NM_130832chr321943 206 11784 ----
NM_130833chr321943 206 11784 ----
NM_130834chr321943 206 11784 ----
NM_130835chr321943 206 11784 ----
NM_130836chr321943 206 11784 ----
NM_130837chr321943 206 11784 ----
NM_130838chr1531794 1389 229 ------
NM_130839chr1531794 1389 229 ------
NM_133171chr20167 ------
NM_133264chr1743504 2519 1301 141 --1231 --
NM_133265chrX53593 3286 2337 1196 445 23206 1163 ----
NM_133329chr25730 445 341 128 108 11561 ----
NM_133330chr432526 762 580 1855 12833 22728 167
NM_133331chr432526 762 580 1855 12833 22728 167
NM_133334chr496114 5623 4452 4410 2009 1821 1094 1045 527 34709 1326 433 12106 12261
NM_133335chr432526 762 580 1855 12833 22728 167
NM_133367chr653304 2731 2668 2394 407 33145 719 386 12959 1280
NM_133370chr453608 3249 3207 3184 301 23526 3283 ----
NM_133372chr542421 2387 1907 1031 32315 2222 997 ----
NM_133433chr52837 72 1198 ----
NM_133443chr161197 11789 ----
NM_133445chr962521 2444 1456 1151 618 472 13764 --23781 1096
NM_133452chr191803 ------
NM_133476chr1221038 932 2355 340 1155 --
NM_133486chrX2384 98 ------
NM_133493chr684245 3934 3541 3148 2904 1795 945 309 14676 --1748
NM_133496chr1104165 4026 3744 3292 3006 2795 1667 1415 1025 780 11130 23141 352 --
NM_133647chr15103806 3490 3447 2611 1444 1279 1023 678 473 431 --43638 3330 1000 52 --
NM_134260chr151122 ------
NM_134261chr151122 ------
NM_134262chr151122 ------
NM_134268chr17----11155 51134 1128 1122 1116 1110
NM_134325chr141113 653 554 369 11417 11799 --
NM_134442chr221220 635 ----1484
NM_134447chr193207 104 31 ------
NM_138270chrX83216 3132 2253 857 776 382 205 122 ----13417
NM_138292chr1141131 768 682 676 12445 ----
NM_138297chr3------146
NM_138316chr1031303 1043 143 21347 854 ----
NM_138319chr151198 1318 --1434
NM_138326chr22169 127 ------
NM_138328chr1763364 3131 3085 2765 2493 1247 12824 ----
NM_138333chr972343 2250 2222 1886 1810 1661 241 11789 22475 1697 --
NM_138338chr2262762 2591 2098 693 576 361 ------
NM_138357chr1021661 1263 1438 21351 318 --
NM_138423chr1541650 1522 674 53 ------
NM_138426chr742340 1817 1768 659 ------
NM_138440chr161513 ------
NM_138444chr1383974 3414 1809 1697 1484 671 421 185 11388 1110 --
NM_138457chr643199 2646 2207 896 --13419 --
NM_138459chr632652 1312 475 32936 567 112 13644 --
NM_138468chr264832 4484 4009 1442 732 175 1955 1707 --
NM_138473chr1285063 4976 3364 3230 1495 1300 837 490 23468 1601 24779 733 --
NM_138479chr13796 553 113 12018 ----
NM_138558chr13409 225 129 ------
NM_138563chr192576 33 ------
NM_138576chr1474714 3629 1704 1617 1230 889 858 11851 53802 3557 3550 3162 3097 --
NM_138621chr223005 231 21669 413 --13863
NM_138638chr1472192 2179 2006 1876 619 581 533 ------
NM_138693chr71297 1335 177 --
NM_138694chr652333 2288 2277 755 452 21440 655 1341 12449
NM_138701chr7145 ------
NM_138713chr16157985 7545 7455 7179 6981 5881 3186 2540 2510 1700 1612 1518 936 771 543 36492 5503 3053 13222 1198
NM_138714chr16157985 7545 7455 7179 6981 5881 3186 2540 2510 1700 1612 1518 936 771 543 36492 5503 3053 13222 1198
NM_138727chr122143 471 12230 11674 1881
NM_138728chr122143 471 12230 11674 1881
NM_138731chr1463869 3392 3175 1531 1294 1219 1345 13212 --
NM_138771chr751264 1015 566 400 48 ------
NM_138782chr541672 848 187 49 3614 557 242 ----
NM_138811chr711032 1802 --1262
NM_138819chrX127 ----1308
NM_138927chr21--1413 ----
NM_138959chr1156747 5964 4917 4339 4319 2578 2027 1680 1507 1352 1239 713 509 390 136 12056 14520 --
NM_138971chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_138971chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_138972chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_138972chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_138973chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_138973chr1193767 3438 2396 1434 1421 1389 1031 930 319 11096 ----
NM_138994chr162191 122 ----1476
NM_139035chrX1761 ----1202
NM_139048chr32204 106 ----1178
NM_139062chr171435 ------
NM_139068chr52567 530 ------
NM_139069chr52567 530 ------
NM_139070chr52436 399 ------
NM_139071chr1251654 1638 1177 1156 165 ------
NM_139072chr21567 ------
NM_139131chr112260 182 --1599 --
NM_139132chr111326 1429 2143 90 1225
NM_139136chr123941 813 174 ------
NM_139168chr531325 151 59 1537 1217 --
NM_139182chr421591 586 ------
NM_139207chr1242196 2034 2025 697 22228 1860 ----
NM_139244chr63959 735 66 ------
NM_139312chr1021237 92 1167 ----
NM_139316chr71375 21101 196 --1993
NM_139321chr2063892 3836 3621 3438 3430 867 13561 --11221
NM_144571chr486236 6072 5917 5848 5545 4609 4549 2515 14267 26635 1626 192
NM_144574chr141636 --1232 --
NM_144578chr1485559 4361 3434 3418 1235 804 584 492 ------
NM_144582chr252325 2158 825 811 260 --21841 515 --
NM_144586chr22895 171 --1468 --
NM_144590chr1051865 889 829 450 202 2881 58 ----
NM_144595chr131363 ----1201
NM_144599chr1572056 1545 1299 830 523 283 86 --11633 --
NM_144600chr1621457 324 --11155 --
NM_144601chr1621053 218 ------
NM_144604chr161481 --1426 --
NM_144632chr21385 31959 1517 825 ----
NM_144633chr321475 598 ------
NM_144635chr311218 ------
NM_144664chr1122481 2009 11774 ----
NM_144709chr21270 --1315 --
NM_144723chr52358 309 ------
NM_144732chr192689 420 ------
NM_144778chr1321846 74 ------
NM_144949chr241900 1641 1016 619 ------
NM_144963chr842310 1999 177 87 ------
NM_144973chr1294931 4462 4384 3553 1444 758 473 459 235 32134 1318 130 11323 --
NM_144977chr15718 504 279 249 102 ------
NM_144982chr123504 177 143 2235 150 ----
NM_145000chr52586 472 ------
NM_145005chr92295 44 ------
NM_145011chr1031738 1427 37 ------
NM_145021chr102745 661 ------
NM_145025chr631035 393 171 --1293 --
NM_145036chr171304 1116 ----
NM_145044chr331704 1513 1139 1589 ----
NM_145049chr521030 755 ------
NM_145052chrX2978 749 ------
NM_145055chr1843393 3076 2954 430 --152 --
NM_145115chr73712 628 36 22344 719 3588 444 352 1553
NM_145117chr1162888 1164 1121 968 378 139 --33158 2370 2357 11044
NM_145159chr143766 339 207 ------
NM_145175chr221296 578 11043 ----
NM_145203chr131704 ------
NM_145234chrX1951 ------
NM_145235chr101145 ------
NM_145246chr103984 435 325 --11140 --
NM_145254chr162460 48 ------
NM_145259chr2126039 5919 5783 5701 5473 5067 2853 1413 1384 1263 671 239 11794 14892 15829
NM_145263chr41189 ------
NM_145266chr5121 ------
NM_145284chrX52347 1583 416 389 118 --11663 --
NM_145301chr171591 ------
NM_145305chrX11025 11088 1892 --
NM_145307chr1074093 4043 2967 1852 583 470 240 2480 378 --13486
NM_145309chr1141365 1313 432 262 ------
NM_145313chr102316 265 --11154 --
NM_145320chr743508 2271 2194 1166 --12982 --
NM_145321chr743508 2271 2194 1166 --12982 --
NM_145322chr743508 2271 2194 1166 --12982 --
NM_145331chr6----1551 --
NM_145332chr61153 --1699 --
NM_145333chr61153 --1699 --
NM_145341chr1021914 512 21882 1351 ----
NM_145350chr1711550 ------
NM_145638chr111280 ------
NM_145648chr122809 268 ------
NM_145658chr151152 ------
NM_145690chr881756 1732 1698 1628 1516 1444 210 31 ------
NM_145698chr1022009 320 ----11537
NM_145735chr1322413 1926 1286 --1717
NM_145739chr23187 131 36 ------
NM_145800chrX1839 --1970 1809
NM_145802chrX1788 --1919 1758
NM_145808chr753079 2118 1194 975 948 ------
NM_145859chr31143 ------
NM_145860chr31143 ------
NM_145861chr131634 309 248 1528 ----
NM_145888chr1921652 1397 1461 2193 79 --
NM_145899chr631339 1004 467 --1135 11052
NM_145901chr631339 1004 467 --1135 11052
NM_145902chr631339 1004 467 --1135 11052
NM_145903chr631339 1004 467 --1135 11052
NM_145904chr631339 1004 467 --1135 11052
NM_145905chr631339 1004 467 --1135 11052
NM_145913chr121409 2153 26 ----
NM_147150chr933926 3322 2952 21571 119 --12587
NM_147156chr1021337 1309 ------
NM_147164chr9----1115 --
NM_147166chr71566 ------
NM_147175chrX21601 89 ------
NM_147181chr421167 909 --1185 --
NM_147182chr421167 909 --1185 --
NM_147183chr421167 909 --1185 --
NM_147223chr231689 1522 287 --12187 --
NM_147233chr221506 104 --12004 --
NM_148898chr711042 ------
NM_148899chr711042 ------
NM_148904chr1299 68 ------
NM_148905chr1299 68 ------
NM_148906chr1299 68 ------
NM_148907chr1299 68 ------
NM_148908chr1299 68 ------
NM_148909chr1299 68 ------
NM_148955chr15136211 5721 5618 5258 2638 2319 2136 1570 1502 1368 676 90 57 36185 1631 1480 11975 36075 6069 868
NM_148977chr1031303 1043 143 21347 854 ----
NM_148978chr1031303 1043 143 21347 854 ----
NM_152253chr2264085 3834 3010 1474 1034 145 --21365 529 --
NM_152261chr1262486 2402 1572 617 556 103 1327 ----
NM_152263chr195664 5241 5226 4917 4093 3732 1873 566 476 11505 1497 1603
NM_152265chr121073 361 ------
NM_152272chr83845 414 222 ------
NM_152275chr232294 263 81 11739 ----
NM_152277chr532034 772 622 ------
NM_152278chrX1153 --1405 --
NM_152280chr163112 2824 2575 2300 829 330 ------
NM_152283chr52132 111 1266 ----
NM_152300chr1731386 741 260 --11295 --
NM_152330chr1462565 670 657 445 240 93 ------
NM_152344chr172404 347 ------
NM_152348chr172889 808 ------
NM_152375chr142517 2421 2221 708 --12536 1826
NM_152380chr141363 600 218 66 ------
NM_152388chr2104069 3667 3648 2954 2525 1574 1330 1251 1203 203 --13635 --
NM_152409chr51777 --1818 --
NM_152417chr81129 ------
NM_152418chr831622 1242 557 --1655 --
NM_152420chr91612 ------
NM_152422chr91292 ------
NM_152424chrX43286 2946 1342 596 --23964 450 --
NM_152437chr121509 22435 533 ----
NM_152440chr1231069 756 130 ------
NM_152441chr12----1169 --
NM_152442chr1241222 992 302 142 ------
NM_152446chr142722 697 ------
NM_152447chr141290 ------
NM_152448chr153495 458 395 1214 ----
NM_152450chr153525 513 269 ------
NM_152455chr1541142 530 337 241 --1324 --
NM_152470chr1883293 3196 2883 1487 812 567 470 344 ----12748
NM_152493chr131535 1475 124 ------
NM_152512chr221450 --1599 --
NM_152519chr282090 1916 1875 1867 1673 1492 828 603 ------
NM_152520chr23942 899 400 --1325 --
NM_152522chr21257 ----1140
NM_152525chr21149 ------
NM_152529chr274032 3891 2884 2735 1003 861 719 22843 2719 2699 260 23951 2826
NM_152538chr311157 ------
NM_152564chr831686 1220 115 ----1273
NM_152588chr1231882 622 271 --124 --
NM_152594chr1531744 1582 731 21937 749 --1686
NM_152608chr142364 1848 1829 294 11893 1584 --
NM_152609chr121043 453 ------
NM_152622chr552849 2522 960 882 633 ------
NM_152624chr5117049 6291 5719 5624 5348 5240 4900 2293 1606 1315 526 15548 16271 15578
NM_152626chr721116 149 1188 ----
NM_152628chr83759 322 28 ------
NM_152629chr963821 3441 2822 1414 1184 608 21517 425 ----
NM_152636chr1162886 2703 2155 1021 730 487 11112 ----
NM_152638chr122809 417 ------
NM_152641chr1222332 674 11835 ----
NM_152660chr131013 400 124 1982 ----
NM_152663chr12311 85 ------
NM_152666chr15795 740 661 223 126 ------
NM_152678chr332208 1855 406 ------
NM_152682chr42309 33 ------
NM_152699chr383372 3306 3267 3100 3065 2787 1392 1246 --11174 --
NM_152739chr721028 148 ------
NM_152740chr72667 633 ----1270
NM_152749chr741131 1000 458 325 --1371 --
NM_152756chr553627 2908 1450 460 110 ------
NM_152758chr873042 2779 1882 1128 670 272 111 --12787 1988
NM_152765chr82562 120 21944 726 12185 --
NM_152780chrX2926 346 ------
NM_152787chrX53315 3292 1498 1445 844 ------
NM_152789chr72553 337 1545 ----
NM_152793chr774252 3462 3385 2080 1434 935 284 34841 4822 367 11213 --
NM_152826chr15136211 5721 5618 5258 2638 2319 2136 1570 1502 1368 676 90 57 36185 1631 1480 11975 36075 6069 868
NM_152835chr11560 ------
NM_152838chr2022227 2175 2464 34 ----
NM_152857chr61126 ------
NM_152858chr61126 ------
NM_152860chr1231425 1105 141 --2434 104 --
NM_152890chr11471 ------
NM_152896chr92143 121 ------
NM_152903chr1342194 1144 299 85 ----12765
NM_152924chr1576692 6502 5296 4742 2644 821 780 1723 ----
NM_152989chr1221583 707 1356 11400 161
NM_152991chr112687 478 ----194
NM_152994chr2--1571 1442 --
NM_152996chr162133 1858 701 609 538 430 --11711 --
NM_152999chr754854 4675 4467 4248 1223 11011 --14943
NM_153013chr531760 763 628 1857 --11989
NM_153020chr611715 ------
NM_153029chr1663930 3099 2879 1201 1085 916 22716 989 --13469
NM_153184chr32170 65 ------
NM_153188chr5135448 5220 5006 4206 4095 3850 3839 3572 2001 1640 1572 881 762 ------
NM_153207chr121166 2913 801 11333 --
NM_153261chr1631464 1145 474 11202 ----
NM_153262chr152807 2301 2090 1190 246 33199 2378 1026 ----
NM_153267chr92887 238 ------
NM_153273chr341922 1761 1123 1040 --1545 --
NM_153341chr12113 49 ------
NM_153342chr2153 ------
NM_153343chr422298 545 --11684 1432
NM_153347chr1132526 2009 541 11851 11065 --
NM_153350chr16----21671 521 --
NM_153354chr5--2893 153 ----
NM_153362chr62957 843 1338 ----
NM_153371chr1322070 1476 --32415 571 33 --
NM_153374chr152451 110 ------
NM_153464chr192829 544 ------
NM_153605chr341315 1160 376 356 196 ----
NM_153607chr532786 2051 70 ------
NM_153616chr1562202 1481 900 647 538 35 ------
NM_153617chr1562202 1481 900 647 538 35 ------
NM_153618chr1562202 1481 900 647 538 35 ------
NM_153619chr1553440 2719 1273 1158 219 ------
NM_153631chr7--11059 11608 --
NM_153632chr7--11059 11608 --
NM_153634chr122455 154 11210 ----
NM_153645chr2273000 2993 2401 1155 626 506 94 21307 1219 22554 1324 12598
NM_153649chr132100 1499 1425 11874 ----
NM_153685chr1231191 880 379 --1850 --
NM_153686chr411915 32311 2193 1901 --12387
NM_153687chr12188 ------
NM_153715chr721161 882 ------
NM_153748chr123941 813 174 ------
NM_153757chr41471 ------
NM_153810chr1064678 3142 1946 1906 1728 1635 24625 4503 ----
NM_153828chr23317 192 33 ------
NM_153831chr82946 349 21005 88 ----
NM_170587chr82812 521 --190 --
NM_170607chr1721534 1333 21398 157 11203 --
NM_170665chr1233512 3037 2884 13747 1290 --
NM_170692chr111129 ----2858 852
NM_170695chr18----1340 --
NM_170696chr1541458 1331 1167 448 ------
NM_170697chr1541458 1331 1167 448 ------
NM_170706chr154007 3343 2860 180 41 --2358 319 1944
NM_170709chr812166 ------
NM_170720chr192866 530 ------
NM_170723chrY------182
NM_170724chr62990 872 ------
NM_170731chr1162090 1873 854 790 424 336 ----12056
NM_170732chr1162090 1873 854 790 424 336 ----12056
NM_170733chr1162090 1873 854 790 424 336 ----12056
NM_170734chr1162090 1873 854 790 424 336 ----12056
NM_170735chr1162090 1873 854 790 424 336 ----12056
NM_171825chr51100 --12807 --
NM_171827chr221184 42 --11292 1108
NM_172016chr62377 114 11292 ----
NM_172037chr82973 372 --1403 1271
NM_172057chr71397 --1151 --
NM_172070chr24618 429 412 295 ----1600
NM_172071chr1127239 6430 6012 5978 5797 5647 5452 4864 2426 2401 2299 27 3724 445 435 36142 6056 753 --
NM_172103chr632567 1959 377 ------
NM_172105chr632567 1959 377 ------
NM_172110chr203623 509 479 ------
NM_172111chr203623 509 479 ------
NM_172112chr203623 509 479 ------
NM_172113chr203623 509 479 ------
NM_172127chr452028 1647 834 784 190 11542 2112 72 11286
NM_172128chr451984 1603 790 740 146 11498 268 28 --
NM_172159chr31198 21475 517 ----
NM_172160chr31198 21475 517 ----
NM_172217chr1563890 3564 3137 2820 2765 659 21425 69 --12388
NM_172337chr143385 267 240 ------
NM_172344chr25730 445 341 128 108 11561 ----
NM_172373chr1331396 1339 236 ------
NM_173054chr72363 56 ------
NM_173083chr111298 ------
NM_173156chr122016 461 ----12084
NM_173167chr1762654 2515 2146 1891 300 285 ----1924
NM_173171chr22431 235 1288 ----
NM_173173chr22431 235 1288 ----
NM_173174chr81826 ----1786
NM_173175chr81826 ----1786
NM_173176chr81826 ----1786
NM_173198chr952678 2426 1915 829 789 ------
NM_173200chr952678 2426 1915 829 789 ------
NM_173207chr18----1340 --
NM_173208chr18----1340 --
NM_173209chr18----1340 --
NM_173210chr18----1340 --
NM_173211chr18----1340 --
NM_173214chr16157985 7545 7455 7179 6981 5881 3186 2540 2510 1700 1612 1518 936 771 543 36492 5503 3053 13222 1198
NM_173355chr24930 873 825 135 ------
NM_173359chr321463 256 --11183 --
NM_173454chr151354 11108 ----
NM_173468chr421519 1244 --1194 1797
NM_173470chrX42732 2051 362 252 1953 12794 11056
NM_173473chr1072633 2489 1000 729 698 631 413 ------
NM_173485chr20179 ----1186
NM_173491chr53492 284 64 ------
NM_173494chrX2911 86 ------
NM_173495chrX42189 2178 1675 1629 11793 ----
NM_173500chr152101 38 11044 ----
NM_173503chr171114 ------
NM_173508chr111141 11217 ----
NM_173510chr2262567 2330 923 791 391 342 --22368 780 --
NM_173511chr263861 1317 975 405 354 243 ------
NM_173531chr1953417 3127 2523 2491 446 33147 115 31 ----
NM_173546chr3----1243 1579
NM_173554chr10----1318 --
NM_173564chr71706 ------
NM_173570chr372201 2121 1469 694 515 496 241 ------
NM_173576chr1031940 466 62 --12089 11701
NM_173582chr11114909 4669 4514 4433 2487 2427 2228 1783 1191 1145 797 1908 26198 88 --
NM_173595chr12105236 4814 2127 2112 2018 1670 1619 880 784 166 --25214 1530 --
NM_173602chr1283236 2857 2637 1076 664 401 128 32 ----13400
NM_173609chr15--1463 ----
NM_173614chr162317 156 1326 --1169
NM_173631chr1931347 1284 547 11133 ----
NM_173642chr1118956 7469 7172 6621 3242 2990 2790 1465 1166 899 500 18985 26157 1673 --
NM_173644chr2041458 1318 371 292 11707 ----
NM_173653chr33898 226 149 --11224 --
NM_173662chr42201 44 ------
NM_173681chr731456 288 229 11668 1567 22069 1556
NM_173694chrX52540 2026 885 480 191 ------
NM_173698chrX4786 580 554 310 ------
NM_173808chr174042 3821 3795 2975 1227 967 35 --11333 --
NM_173822chr241758 1653 1549 22 1131 1191 --
NM_173824chr3192 ------
NM_173825chr363013 2735 1159 1082 104 58 12922 ----
NM_173829chr546157 5211 2406 2119 ------