TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3607-3p
miRNA Sequence: ACUGUAAACGCUUUCUGAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr15691 629 450 144 135 --1529 --
NM_000052chrX133483 3436 3098 2808 2767 2666 2533 2115 1278 1142 579 538 257 --22576 1038 --
NM_000084chrX126954 5903 5457 5202 5158 4802 4564 4375 2635 2232 1345 193 31389 713 42 21740 664 --
NM_000091chr242812 2471 1823 1782 12544 --11020
NM_000092chr2104568 4516 4157 4105 3735 1617 1368 1244 1208 855 --1413 --
NM_000108chr741867 666 343 175 --21634 1581 1633
NM_000109chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_000112chr5155434 5336 4746 4703 4658 4583 3597 2128 2041 1590 1572 1130 611 369 88 23908 225 11123 --
NM_000115chr13112433 2291 2276 2162 2072 1974 1786 1004 753 103 36 --32401 243 180 --
NM_000125chr674221 3954 3814 3770 849 544 479 33980 3175 1165 12925 --
NM_000139chr1172438 1929 1824 547 403 220 112 --22539 2396 1606
NM_000163chr582338 2008 1777 1467 838 715 702 580 ------
NM_000167chrX61796 1505 702 661 112 42 11642 ----
NM_000176chr551538 1527 955 537 466 --23907 503 22478 154
NM_000217chr1285335 4449 4108 3648 2096 981 893 435 24951 3759 11566 --
NM_000232chr4113232 2939 2558 2132 1982 1214 722 543 507 192 31 --12175 176
NM_000245chr762092 1774 1507 891 772 113 --1843 --
NM_000248chr372151 1122 1018 704 529 463 189 --11984 --
NM_000259chr1575990 5454 5388 1877 1853 709 245 --32209 1451 205 11557
NM_000264chr992770 2700 2626 2485 2403 2358 2305 1257 457 ------
NM_000297chr451677 1303 702 151 80 ----21876 1369
NM_000304chr1791090 1075 892 807 754 289 206 194 181 ------
NM_000314chr1092652 2257 2065 1292 1226 577 416 300 113 --21219 441 --
NM_000328chrX6418 395 386 349 335 327 ------
NM_000329chr13786 598 130 1114 --1142
NM_000332chr6197067 6810 6382 4974 4846 4644 4632 2553 2363 2233 2201 2036 1810 1674 1549 1534 623 142 89 12338 26257 1012 --
NM_000368chr9104883 4591 4553 4457 4379 3891 3297 506 492 433 14517 ----
NM_000390chrX73008 2677 2584 2294 2259 630 572 21086 153 23281 1077 --
NM_000393chr241983 1921 859 804 ----1268
NM_000408chr2143379 3321 3266 3081 2893 2645 2619 2380 916 879 782 716 574 255 1454 --13151
NM_000441chr772299 2049 1862 1543 919 686 150 11968 ----
NM_000448chr1193240 2969 2549 2358 1153 561 474 466 32 --12210 12084
NM_000461chr384572 4444 4199 3976 3829 3500 2954 599 --44420 4000 837 506 23755 819
NM_000489chrX93429 3221 2844 2742 2164 955 632 387 372 ------
NM_000555chrX247862 7432 7181 7022 6662 6600 6522 6506 6014 5872 5856 5556 5194 5051 4790 3124 2978 1609 1413 1260 1006 955 681 361 --1931 --
NM_000615chr1163002 864 728 679 623 469 --3882 650 604 1204
NM_000618chr12136302 6193 5863 5564 5430 4935 4487 4428 4027 2279 512 423 183 16329 1459 25216 4210
NM_000618chr12136302 6193 5863 5564 5430 4935 4487 4428 4027 2279 512 423 183 16329 1459 25216 4210
NM_000633chr1895130 4842 4401 3739 3660 3425 762 585 235 --13862 --
NM_000686chrX41188 402 338 221 21439 634 2627 549 --
NM_000726chr281479 1417 1280 1230 1181 528 361 225 ------
NM_000782chr2031181 285 102 ----11048
NM_000809chr4239098 8924 8888 8734 8131 8117 7821 7634 7405 7209 6917 6751 6536 6224 5957 5683 3354 2874 2741 2625 2446 2307 1469 58620 6411 6238 2263 1619 --38152 7669 1652
NM_000813chr575566 5300 5237 4481 4452 4201 227 21670 1491 1925 --
NM_000814chr1553497 1013 963 202 74 --32715 1618 265 --
NM_000826chr452394 2337 1678 520 52 21926 355 12425 12120
NM_000866chr361603 1448 1176 393 314 136 1332 11526 11434
NM_000868chrX82381 2140 1727 456 195 147 132 120 --1352 --
NM_000875chr15186964 6867 6196 5898 5818 5705 5687 5635 5606 2641 2342 1616 1461 1217 1188 1160 1043 536 --11229 --
NM_000877chr2122994 2904 2875 2820 2767 2396 2129 2072 2057 1028 449 54 184 13005 22412 844
NM_000891chr1793671 3368 2472 1076 847 739 426 279 35 ----12443
NM_000899chr12134352 4199 4097 3921 3833 3589 3350 1325 870 847 335 285 149 1888 21081 569 --
NM_000901chr482538 2506 2211 2089 2038 1590 675 404 11619 42060 997 932 690 --
NM_000902chr392958 2796 2421 2001 792 752 726 456 21 --1466 --
NM_000944chr452382 2062 1507 773 149 21541 248 1419 --
NM_000945chr281623 1614 1580 766 629 471 333 294 11893 11394 --
NM_000950chrX123604 3569 3287 3239 3052 3013 2777 2721 1061 990 613 444 1163 --13186
NM_000959chr183964 3554 3356 3043 2595 1281 979 797 ------
NM_000963chr192288 2280 2193 858 700 351 225 71 30 12179 11519 --
NM_001001323chr1263069 3014 2824 2013 739 718 --32540 2204 2126 --
NM_001001419chr5115211 4237 3657 3537 3347 850 689 600 475 344 104 14259 24013 749 1973
NM_001001420chr5115211 4237 3657 3537 3347 850 689 600 475 344 104 14259 24013 749 1973
NM_001001484chr1062171 2156 2089 762 661 568 21909 44 ----
NM_001001664chr2124105 3888 3653 3640 3362 1561 1503 1300 759 743 665 372 11028 23794 394 --
NM_001001890chr2193345 3301 1330 1291 962 562 552 529 373 13197 ----
NM_001001974chr10112359 2163 2026 1956 1563 1459 815 563 493 406 133 --21821 1579 --
NM_001002257chr283153 3121 3111 3065 2282 892 136 82 1975 12617 --
NM_001002860chr1494614 4490 3007 1885 1620 389 331 297 277 43851 3324 483 73 ----
NM_001003652chr18218592 8451 7947 7760 7124 6712 6467 6222 6162 5651 3167 2255 2102 1509 1485 1247 1064 428 419 369 352 17981 12828 --
NM_001003674chr18145999 5638 5448 5151 4482 2372 2028 1657 1590 789 780 625 609 376 15528 --24551 347
NM_001003675chr18145999 5638 5448 5151 4482 2372 2028 1657 1590 789 780 625 609 376 15528 --24551 347
NM_001003679chr142158 2135 704 78 --11433 1511
NM_001003712chr12123942 3648 3483 3344 3287 2899 2675 2627 1250 1238 620 514 22826 452 33673 2939 2854 24008 856
NM_001003760chr683073 2474 1340 1240 1024 984 799 277 --1755 --
NM_001003800chr983575 3471 3406 3106 2570 992 482 271 12322 ----
NM_001004317chr6144449 4311 4217 3974 3542 3344 3077 3069 1738 1508 1249 457 320 279 1405 23391 3181 --
NM_001004419chr1273278 3014 2910 1820 447 308 82 13927 11513 14451
NM_001004441chr551263 1105 643 514 38 --11587 --
NM_001005404chr1774322 3632 3493 3244 3084 1043 795 --11090 13782
NM_001005473chr564597 2512 2488 2337 1905 1582 15160 14210 26431 4062
NM_001005527chr331151 537 340 11271 31240 1218 1015 2465 86
NM_001005746chr281479 1417 1280 1230 1181 528 361 225 ------
NM_001005747chr281479 1417 1280 1230 1181 528 361 225 ------
NM_001006600chr592378 1866 1660 1623 916 887 668 86 57 --12323 --
NM_001006623chr282502 2184 1696 1629 996 678 500 95 ------
NM_001006657chr29939 871 758 715 673 634 548 408 135 11094 21023 122 --
NM_001007097chr9104641 4037 4028 1975 1742 1682 1668 1154 955 274 1962 ----
NM_001007466chr6105090 4718 4708 3871 2066 2005 1921 1688 585 517 --34566 677 59 15220
NM_001008226chr1551783 1575 1425 311 108 --172 11339
NM_001008239chr1853691 3137 2694 688 630 ----11102
NM_001008495chr8122226 2101 1917 1568 1522 831 589 578 402 329 280 98 --1561 --
NM_001008529chr1731272 909 893 --1930 1980
NM_001008564chr13112192 2142 2133 2112 1974 1955 1676 726 507 322 102 --1821 --
NM_001008660chr1151531 1503 1301 568 198 --2520 174 --
NM_001008707chr1451897 1657 480 253 247 ----31581 1562 1543
NM_001008738chr5102792 2600 2522 2318 2075 1004 824 789 776 451 12607 ----
NM_001008801chr1951887 1877 1732 282 131 11786 --22145 1921
NM_001008925chr433335 2876 2866 --23516 3191 1722
NM_001009554chr494768 4702 4350 3687 3127 3111 3088 992 459 1966 31864 1846 424 --
NM_001009554chr494768 4702 4350 3687 3127 3111 3088 992 459 1966 31864 1846 424 --
NM_001009881chr11410 ----2475 201
NM_001009882chr11410 ----2475 201
NM_001009899chr3176552 6544 6395 6275 5519 5301 3975 2248 2145 2113 1659 1600 1043 911 816 769 238 --14140 16129
NM_001009909chr1173736 3146 2656 2550 2518 1153 125 11084 23706 1188 --
NM_001009993chr294317 3317 3269 1827 924 839 812 439 393 --21785 1320 --
NM_001010000chr1883340 2780 2493 1319 865 793 395 210 ----1570
NM_001010853chr6143121 3084 2952 2573 2536 2345 2322 1097 855 781 646 321 213 181 --23145 996 --
NM_001010861chr182559 2256 2162 1014 1001 976 119 97 --1995 11083
NM_001010888chrX144394 3839 3388 3172 1292 1213 1029 685 550 291 117 101 73 26 ----22929 175
NM_001010891chr5196749 6349 6301 6113 5880 5355 5219 5043 4497 4197 2773 2636 2378 1817 1781 1770 1400 1026 42 --12107 24451 1948
NM_001010895chr972082 2030 1966 1923 829 548 514 --1275 --
NM_001010922chr141483 1316 756 444 11368 --11420
NM_001010935chr181009 765 679 405 232 159 122 36 ----1746
NM_001011513chr4113909 3415 3397 3386 3154 2793 1356 842 745 240 87 ----23768 1603
NM_001011663chr103972 149 141 ----1797
NM_001011666chr7156520 5756 5459 4949 4830 4765 4666 4058 2033 1928 1910 1596 1024 263 159 15731 25740 133 14822
NM_001011708chr232858 2533 2076 1503 1377 1639
NM_001011885chr1571464 1268 1256 1212 701 365 198 21640 1547 ----
NM_001012398chr166945 930 841 816 772 346 ----1855
NM_001012755chrX135052 4659 4504 4175 4169 4101 3691 3631 3200 2033 1902 1458 1321 14795 24912 4897 14707
NM_001012756chr1992735 2608 2474 2089 1167 667 159 81 50 ----1880
NM_001012761chr552616 1989 543 281 236 --1217 11881
NM_001013406chr731379 578 483 1536 --11368
NM_001013438chr33252 199 188 --1178 --
NM_001013439chr3398 45 34 --124 --
NM_001013620chr12218446 7560 7410 7400 6976 6261 6231 6024 5854 5830 5492 5276 3221 3097 2962 2390 2211 1285 1117 623 468 1971 27938 7368 --
NM_001013629chr1092139 2122 1718 1710 1691 1663 1655 1474 272 ------
NM_001013699chr125567 529 515 455 88 ----1156
NM_001014797chr1095851 5082 3062 2989 2135 2122 1208 991 333 16401 ----
NM_001017923chr14131502 1372 1350 1138 1071 1042 595 394 294 273 214 194 156 ------
NM_001017926chr841577 1519 1342 586 --21744 443 --
NM_001018067chr1135256 5170 4325 4186 4101 3410 1877 1731 1725 715 616 446 59 --35189 4133 849 --
NM_001018068chr1135256 5170 4325 4186 4101 3410 1877 1731 1725 715 616 446 59 --35189 4133 849 --
NM_001018069chr1135256 5170 4325 4186 4101 3410 1877 1731 1725 715 616 446 59 --35189 4133 849 --
NM_001018074chr551538 1527 955 537 466 --23907 503 22478 154
NM_001018075chr551538 1527 955 537 466 --23907 503 22478 154
NM_001018076chr551538 1527 955 537 466 --23907 503 22478 154
NM_001018077chr551538 1527 955 537 466 --23907 503 22478 154
NM_001018089chr15103883 3638 3025 2944 2505 2479 1057 487 459 266 22655 535 ----
NM_001018090chr1592835 2287 2253 1873 1814 1779 469 226 106 11890 --12462
NM_001018091chr1592945 2397 2363 1983 1924 1889 579 336 216 12000 --12572
NM_001018102chr1592835 2287 2253 1873 1814 1779 469 226 106 11890 --12462
NM_001024094chr551538 1527 955 537 466 --23907 503 22478 154
NM_001024647chr1286820 6625 5521 5041 2389 2210 667 118 21910 790 26863 233 11095
NM_001024688chr861936 1928 1722 1600 1546 491 --11455 --
NM_001024847chr372461 2410 582 523 314 270 251 1829 11722 11674
NM_001024947chr551059 813 224 171 108 ----1162
NM_001025076chr1095037 4373 4172 2371 1845 1478 737 525 205 1304 14238 --
NM_001025077chr10116395 5731 5530 4828 2836 2095 1883 1563 1313 867 133 11662 25596 1107 --
NM_001025079chr373849 3744 3630 3296 3060 2726 820 --33817 3789 2549 --
NM_001025108chr244150 1629 1297 1249 1973 31641 1326 144 --
NM_001025266chr384951 4279 4247 4136 3985 3428 3264 1354 13084 ----
NM_001025356chr1253001 2959 2544 2372 434 2780 449 --2739 258
NM_001025580chrX84193 4174 3924 3721 3501 2956 1066 762 --1230 1751
NM_001025595chr451630 401 372 296 106 ----1471
NM_001025616chr41571 --11613 2405 133
NM_001029858chr693341 3166 3052 2871 2421 2217 663 452 103 --22463 1096 --
NM_001029863chr682212 1987 875 522 421 288 275 54 --11098 --
NM_001029875chr572528 2345 917 870 600 541 161 ------
NM_001030007chr1673960 3317 3074 2588 2485 1555 225 23871 1257 1276 13560
NM_001030055chr14134013 3855 3521 3200 2994 1823 1400 1153 1088 631 481 433 210 --11765 --
NM_001031679chr1262766 1236 1072 894 432 172 --43058 2274 292 199 --
NM_001031695chr22105425 5386 4896 4242 4187 4084 3722 685 633 156 13636 --13628
NM_001031700chr462411 1967 689 558 501 218 1796 11762 --
NM_001031712chr63405 270 112 ----1169
NM_001031732chr473508 1383 1300 1001 811 289 70 --11337 --
NM_001031804chr16114173 3794 3477 3247 1643 1494 1419 1161 1065 702 328 34228 1544 695 14377 --
NM_001031812chr552244 2009 1814 881 374 1708 21889 1547 --
NM_001032380chr1061830 1327 729 615 353 295 11569 1407 --
NM_001033045chr294325 3670 3578 3277 2980 1435 1083 679 174 --12993 --
NM_001033047chr44997 680 533 348 21767 1036 --2699 377
NM_001033057chr3112027 1984 1923 1858 1826 1646 1431 1404 1372 635 622 --1592 --
NM_001033059chr672059 1561 1489 714 594 444 286 1116 1633 11436
NM_001033576chr1752689 2592 889 806 333 12522 --12378
NM_001033910chr181719 1378 592 578 435 231 223 165 ------
NM_001033925chr1061947 1710 1684 766 696 581 --31955 1910 1621 --
NM_001034841chr16155486 5469 5305 5027 4672 4510 4290 4093 4083 2017 1459 1442 1239 682 488 23860 99 44412 3941 1720 1394 13837
NM_001034954chr1083201 2959 2912 2827 2551 2439 2343 2158 --33008 2663 2112 --
NM_001034955chr1083201 2959 2912 2827 2551 2439 2343 2158 --33008 2663 2112 --
NM_001034956chr1083201 2959 2912 2827 2551 2439 2343 2158 --33008 2663 2112 --
NM_001034957chr1083201 2959 2912 2827 2551 2439 2343 2158 --33008 2663 2112 --
NM_001037132chr771577 1518 733 685 661 378 138 ------
NM_001037133chr771577 1518 733 685 661 378 138 ------
NM_001037174chr2102229 2207 2121 2110 2053 1728 1678 1672 595 92 ------
NM_001037317chr182559 2256 2162 1014 1001 976 119 97 --1995 11083
NM_001037535chrX71529 1279 1240 472 265 153 128 --21548 231 --
NM_001037536chrX71529 1279 1240 472 265 153 128 --21548 231 --
NM_001037540chrX71529 1279 1240 472 265 153 128 --21548 231 --
NM_001037954chr11113541 3406 3162 3045 3036 2887 1408 1231 942 403 373 --13359 --
NM_001039538chr2103692 3658 3363 3207 2304 445 260 217 195 91 1772 --11123
NM_001039547chr3168090 7595 6684 6305 5821 5699 5021 4919 3104 2884 2272 1886 1672 1661 302 219 46732 3009 2567 1338 37034 3224 1277 11388
NM_001039580chr494906 4800 3860 3854 3822 1927 1144 1123 641 34296 3269 2011 2859 82 --
NM_001039585chr184221 3811 3613 3300 2852 1538 1236 1054 1238 ----
NM_001039590chrX84048 3976 3798 3722 3524 2457 403 51 12986 13849 23820 1424
NM_001039591chrX84048 3976 3798 3722 3524 2457 403 51 12986 13849 23820 1424
NM_001039618chr1155486 5111 3975 2346 1028 35458 606 262 --15884
NM_001039693chr283834 3016 2677 1601 1376 1229 1047 459 ----24018 99
NM_001039840chrX155208 3699 2189 1653 1633 1354 1235 1184 673 646 605 574 198 161 108 --12380 11792
NM_001039937chr1373545 2903 2562 1376 1343 1094 1046 --1155 --
NM_001040100chr361270 1121 438 182 51 39 --21042 405 1931
NM_001040108chr1492575 2303 2087 2005 1283 1185 844 766 222 ------
NM_001040110chr751655 1611 1587 343 52 ----162
NM_001040142chr262102 2054 1939 758 393 114 --143 --
NM_001040143chr262102 2054 1939 758 393 114 --143 --
NM_001040152chr754268 4162 4050 1498 1138 --13467 11529
NM_001040157chr4112380 2218 2160 1976 1911 1885 823 351 269 140 71 1254 ----
NM_001040159chr481514 1465 1431 603 547 195 140 46 1153 ----
NM_001040202chr452439 2394 807 177 126 --11864 12289
NM_001040214chr672383 2321 2055 2001 1630 960 817 --11831 --
NM_001040284chr16165880 5285 5205 4389 4087 3910 2040 1701 1638 1591 1227 1050 1022 566 476 327 25301 2095 1938 --
NM_001040402chr4103096 2835 2746 2390 2189 2173 1065 901 797 209 --1197 --
NM_001040429chr1363396 2804 2611 2209 1005 503 33217 2903 1037 22846 87 --
NM_001040441chr1205443 5228 4928 4897 4891 4879 4846 4674 4040 3693 3584 3494 3362 1970 1570 1492 1190 1137 997 42 ----15433
NM_001040446chr5112766 2714 2642 2597 2581 2430 2373 2223 2163 1808 913 22747 424 11707 --
NM_001040665chr7124379 3972 3821 1700 1512 1065 1018 829 333 297 269 242 23429 688 24277 3244 14286
NM_001040712chr973361 3002 2945 1399 915 771 713 ----23495 253
NM_001042355chr16145041 4885 4183 3932 3295 1905 1463 1451 1386 1378 1298 1259 824 194 ------
NM_001042403chr128895 811 319 242 143 121 112 36 ------
NM_001042404chr151986 1862 630 571 459 --11452 21511 610
NM_001042412chr16145041 4885 4183 3932 3295 1905 1463 1451 1386 1378 1298 1259 824 194 ------
NM_001042413chr9114138 4073 3354 2622 2503 1118 731 641 618 591 183 24023 1346 42961 2647 778 171 --
NM_001042453chrX111700 1654 1631 1575 1543 1537 1380 1265 652 170 111 --1607 --
NM_001042473chr10102087 2049 1819 1353 859 848 635 466 380 160 --22031 647 --
NM_001042481chr1462540 2236 982 756 122 72 22648 1887 12331 --
NM_001042533chr372525 2075 731 667 405 137 34 21138 544 13074 --
NM_001042550chr941838 257 129 80 21440 1389 ----
NM_001042555chr12184618 4454 4290 4223 4056 3953 3871 3783 3706 3679 3624 3599 3527 1433 1054 968 349 26 13423 --22964 99
NM_001042599chr2147667 5858 5396 4988 2906 2890 2677 1572 1429 1405 1084 872 730 681 17754 27220 5245 13154
NM_001042601chr383215 3126 2866 2368 2238 2129 854 224 ------
NM_001042603chr12104920 4731 4404 4209 3669 1859 1777 972 151 77 --24129 3877 --
NM_001042604chr3114690 4578 4334 4110 3675 1268 1232 1167 1080 388 53 23640 2982 23743 3383 --
NM_001042669chr41571 --11613 2405 133
NM_001042683chr651470 1401 515 361 215 --21431 531 11315
NM_001042749chrX92053 2027 1965 1957 1791 1759 1645 573 405 ----22009 817
NM_001042750chrX92053 2027 1965 1957 1791 1759 1645 573 405 ----22009 817
NM_001042751chrX92053 2027 1965 1957 1791 1759 1645 573 405 ----22009 817
NM_001043318chr1474055 3694 2886 2743 670 565 303 23338 2955 23753 3674 --
NM_001044385chr22283 70 11074 --24006 1533
NM_001044722chr552244 2009 1814 881 374 1708 21889 1547 --
NM_001044723chr552244 2009 1814 881 374 1708 21889 1547 --
NM_001046chr5112992 2825 2814 2530 2168 2160 1939 976 810 614 376 1386 ----
NM_001071775chr13101909 1658 1626 1377 1309 782 738 449 196 149 1173 1275 11809
NM_001083620chr452392 2335 1677 519 52 21924 354 12423 12118
NM_001099678chr3146425 6382 6101 6058 5927 5775 4955 4185 2255 997 891 686 602 261 1517 25446 242 12215
NM_001106chr3159514 9389 8688 7081 7065 6260 6116 6008 5990 3677 3549 3043 2433 2306 1595 --29570 8797 --
NM_001121chr1031486 179 144 ----11286
NM_001128chr1673960 3317 3074 2588 2485 1555 225 23871 1257 1276 13560
NM_001160chr1262728 2093 947 842 466 86 --12146 12643
NM_001167chrX146536 6231 5877 5742 5141 4997 4933 4784 2244 2127 1990 1652 1326 868 14683 36485 4735 816 16374
NM_001173chr14134013 3855 3521 3200 2994 1823 1400 1153 1088 631 481 433 210 --11765 --
NM_001174chrX52260 1862 1836 1631 1558 11952 --1207
NM_001177chr1272281 1821 1758 1751 891 522 339 --2591 581 --
NM_001198chr6112389 2377 2208 1940 1553 1524 1512 888 414 300 243 ------
NM_001200chr203362 259 172 ----1716
NM_001201chr4103877 3570 3218 3182 2943 2575 1586 637 625 88 --13102 --
NM_001204chr2186768 6260 5832 5708 5671 5591 5427 5395 5045 5021 2650 2505 1582 1402 1032 647 208 38 27444 972 21111 523 13027
NM_001206chr983014 2687 2588 2417 984 893 701 672 12898 12255 12924
NM_001219chr742303 2253 462 226 11573 146 22234 748
NM_001241chr2102429 1748 1676 958 912 560 513 494 350 262 --11968 12252
NM_001241chr2102429 1748 1676 958 912 560 513 494 350 262 --11968 12252
NM_001256chr1772963 2862 2417 2214 539 458 23 --12183 22300 1877
NM_001259chr7115898 5794 5775 4921 4684 4380 4090 3891 1633 665 195 --11881 11421
NM_001310chr1251917 716 599 341 306 33062 2081 749 12121 --
NM_001331chr1162196 2115 1972 957 253 128 ----12688
NM_001364chr1174794 4746 708 671 583 431 202 --32925 2890 109 24551 1226
NM_001396chr2172602 2470 2432 2382 2096 2023 373 1707 12205 2907 42
NM_001412chrX93595 3554 3297 2891 2864 2689 2280 878 514 1654 --1799
NM_001419chr19104782 4648 4603 4243 4191 1623 1477 1367 1174 141 --14082 24625 1494
NM_001427chr752041 2006 1966 1794 1781 --21985 157 --
NM_001432chr453855 3637 2577 273 224 --1881 12902
NM_001438chr163560 3406 3199 2647 1399 817 13255 12548 --
NM_001527chr6124809 4712 4680 4465 3363 3170 3036 813 785 515 448 93 34640 3488 1113 1494 --
NM_001546chr681456 1386 1120 1065 1025 434 241 192 --1952 --
NM_001584chr1161217 1040 924 751 381 88 --1485 1467
NM_001609chr10124364 3905 3571 3492 3473 3038 1446 1323 1289 662 565 532 1651 13678 23350 741
NM_001616chr263144 2314 1388 1020 876 74 --22408 2385 --
NM_001621chr763027 2484 1912 1132 593 500 22194 1200 ----
NM_001621chr763027 2484 1912 1132 593 500 22194 1200 ----
NM_001634chr672059 1561 1489 714 594 444 286 1116 1633 11436
NM_001650chr1893759 3680 3447 3429 3283 3072 858 563 159 11174 ----
NM_001663chr1482623 2536 2481 2329 2297 592 527 445 ------
NM_001668chr151727 1633 1621 1603 708 --11866 1182
NM_001682chr1252783 2728 2538 453 432 --32254 1918 1840 --
NM_001690chr33892 758 468 32308 1891 1627 31907 485 363 --
NM_001695chr8113691 3253 3147 1266 1057 1038 742 566 368 246 65 ------
NM_001718chr641138 1095 1088 1071 ----1439
NM_001730chr1361606 1456 1367 1083 1041 652 --1575 --
NM_001730chr1361606 1456 1367 1083 1041 652 --1575 --
NM_001754chr2193345 3301 1330 1291 962 562 552 529 373 13197 ----
NM_001755chr1671848 1794 799 653 572 209 83 11875 3638 582 537 --
NM_001777chr373849 3744 3630 3296 3060 2726 820 --33817 3789 2549 --
NM_001781chr126966 733 682 672 383 288 2696 34 1120 --
NM_001858chr6145033 4951 4851 3928 3901 3826 3698 3503 2011 576 519 502 252 222 21609 1334 13879 14064
NM_001918chr1239131 8790 8419 7474 7269 7217 7174 7039 6339 3550 2776 2575 1842 1516 1319 997 903 896 836 700 515 90 83 17486 1214 19076
NM_001938chr141467 670 353 309 1293 21500 1266 --
NM_001969chr1473836 3110 2689 995 972 269 119 --1218 --
NM_001980chr1272185 1947 861 818 744 638 499 --22019 1992 12138
NM_001981chr162311 2298 1785 596 546 64 1164 1402 22196 919
NM_001987chr1284344 4211 3689 3124 3011 2752 2632 432 2485 143 ----
NM_002006chr4134790 4625 4191 3672 2133 1618 1319 1292 1169 792 491 458 205 15639 ----
NM_002009chr1542585 970 903 765 ----12024
NM_002015chr1353049 2943 932 701 412 33224 2631 295 ----
NM_002024chrX42030 1738 557 184 --11422 1667
NM_002025chrX89107 7262 3445 3146 2474 1106 935 920 18919 58374 5614 2578 2072 1917 --
NM_002033chr11103969 3840 3479 3472 3308 2916 2793 781 675 195 1867 --1930
NM_002035chr18103870 3834 3354 3065 2963 2664 2457 1595 1314 1232 12746 1847 --
NM_002040chr21123162 3136 3039 2426 2338 1118 1016 563 555 516 423 131 --12451 --
NM_002048chr93989 843 415 ----31271 1174 483
NM_002092chr4114662 4423 4226 4202 3849 3829 3696 2033 1718 275 52 14289 14477 --
NM_002158chr2113846 3778 3400 3232 3220 2653 2637 1341 752 256 44 ----11071
NM_002196chr203939 793 210 2960 829 --11081
NM_002196chr203939 793 210 2960 829 --11081
NM_002203chr5144175 3882 3586 3455 3406 2839 2709 2582 1521 1114 567 288 276 227 33997 1282 978 ----
NM_002210chr2103564 2901 2429 1349 1238 1158 639 536 487 294 159 21052 855 --
NM_002211chr104876 763 745 387 --21127 404 --
NM_002214chr7165251 5192 5063 4473 4358 4351 4325 4030 3976 3891 3875 2035 1914 1435 1300 616 --34544 679 309 --
NM_002222chr361155 1118 351 268 128 36 1286 ----
NM_002223chr1274014 3092 2603 2526 905 554 159 --1578 --
NM_002242chr271979 1886 708 587 499 266 100 --12015 --
NM_002247chr1082156 2119 1999 1976 920 447 126 116 ------
NM_002264chr364007 3942 3451 3270 533 414 14264 --23633 237
NM_002270chr5165642 5276 4924 4568 4516 4305 3492 2192 2063 1988 1968 1935 1914 990 771 515 11942 32232 1091 98 --
NM_002285chr244150 1629 1297 1249 1973 31641 1326 144 --
NM_002293chr182774 2659 2473 1972 1820 1783 871 634 12288 11697 --
NM_002310chr5196463 6408 6021 5956 5913 5897 5355 5305 5122 5017 5006 4916 2603 1512 1209 1134 851 784 708 24484 4282 25043 396 --
NM_002336chr12154899 4770 4598 4153 4069 3882 3628 3284 1979 1673 1086 976 901 261 178 14512 --14395
NM_002349chr291504 1462 1447 1345 1113 1106 1033 654 27 ------
NM_002374chr2103692 3658 3363 3207 2304 445 260 217 195 91 1772 --11123
NM_002381chr28996 961 935 832 744 383 324 68 ------
NM_002395chr631440 286 78 --1569 11199
NM_002401chr1762528 2475 1586 1562 1534 724 11966 --11640
NM_002460chr693380 3314 2913 2758 2381 1286 468 400 183 ----11339
NM_002480chr1251471 1362 1268 1098 1008 1555 1287 11177
NM_002481chr1127978 5623 5463 5283 3068 2873 2543 2267 1809 939 704 387 22717 2369 16953 --
NM_002485chr861936 1928 1722 1600 1546 491 --11455 --
NM_002487chr154320 208 137 73 --3728 646 89 --
NM_002500chr281088 1001 934 903 524 477 67 50 ----1951
NM_002526chr671743 1625 1517 1504 1449 335 242 --2661 106 --
NM_002547chrX74284 3509 3033 1688 1138 705 187 --14270 22788 2585
NM_002577chr383427 3344 2909 2811 2760 729 288 183 23421 1186 13466 11309
NM_002581chr9105597 5468 5462 5005 4936 4282 3953 3926 2175 1317 14681 --1478
NM_002594chr2042444 2286 2163 982 1690 22368 975 --
NM_002595chr1271938 1663 783 535 377 241 164 --11862 --
NM_002610chr262776 2737 2177 2137 681 191 --12507 11016
NM_002612chr782117 1821 1580 844 706 613 439 248 --21767 26 --
NM_002613chr1695242 4870 4728 4540 3906 3741 2035 1608 129 24072 3485 --13822
NM_002645chr11112742 2565 2431 2362 2005 1128 1100 707 630 325 114 --22162 381 1527
NM_002655chr8114720 4599 4565 3890 3881 3863 3671 3563 2034 1481 289 25325 27 33800 3212 649 13658
NM_002657chr2073911 3791 3080 749 662 647 584 --11309 23883 1200
NM_002670chr351586 1517 1468 639 537 --2336 56 --
NM_002703chr471910 1396 674 311 226 123 56 ------
NM_002709chr2143630 3445 3344 3270 3229 3020 2952 2571 2382 2293 1371 1273 690 203 --1665 1484
NM_002734chr1771865 1751 1641 1435 632 125 83 12265 ----
NM_002736chr7101915 1654 1601 867 745 574 566 437 128 122 12141 ----
NM_002737chr17126635 6355 6117 6076 5325 4949 4463 1509 1338 1259 1251 1226 ----25443 2479
NM_002740chr362646 2472 1900 945 441 91 --22518 2459 --
NM_002745chr22104313 3963 3787 3223 3149 1801 1389 867 546 477 ------
NM_002822chr1291836 1823 1782 1640 1329 544 532 526 281 31701 578 162 11721 --
NM_002837chr12134120 3926 3753 3597 3181 2986 1624 1568 1441 878 666 241 145 ------
NM_002839chr973361 3002 2945 1399 915 771 713 ----23495 253
NM_002851chr75547 531 525 174 148 --1225 1293
NM_002869chr1151917 1616 589 206 199 11850 11594 1522
NM_002874chr972317 2262 1859 1526 774 705 344 --2399 246 --
NM_002884chr181009 765 679 405 232 159 122 36 ----1746
NM_002886chr3115038 4885 4490 4459 4417 3949 3432 2065 1882 660 103 1856 21959 228 15067
NM_002892chr1451669 1501 1373 1344 1218 1323 2670 617 --
NM_002906chr1152207 1923 1658 1499 1483 ----2836 69
NM_002942chr371417 1217 1177 900 894 879 435 ------
NM_002959chr173859 3827 3781 1777 704 264 195 11285 --11076
NM_002977chr2163358 3344 2980 2883 2523 2345 2335 2183 1358 1121 853 581 430 297 232 179 --128 13063
NM_003010chr171553 21765 1652 1547 1879
NM_003034chr12168161 7892 6724 6628 6494 5156 5042 4983 2493 2475 2321 1585 780 615 225 96 --27165 208 27146 5555
NM_003043chr364160 4074 3803 323 91 85 --14214 21410 77
NM_003099chr15146513 6450 6438 5867 5786 4652 2474 2453 2315 1919 1853 1798 1532 47 16415 36339 6254 5745 11788
NM_003108chr2117273 6902 6606 5866 5792 5380 5222 5080 4838 4556 809 ----15071
NM_003112chr7113208 3032 2858 2044 1284 880 864 607 397 264 44 188 22532 328 --
NM_003161chr1793482 3371 2800 2760 2705 2686 798 518 490 12779 21356 1085 --
NM_003185chr2051321 1254 114 98 29 ----2969 39
NM_003199chr18135297 5090 4960 4616 4581 4041 3485 2131 1954 1627 1517 1107 491 23778 617 11724 15578
NM_003211chr1271754 1532 1402 1266 1135 372 237 --1325 --
NM_003242chr372461 2410 582 523 314 270 251 1829 11722 11674
NM_003253chr2151863 1455 1434 1235 620 1632 31410 1276 747 --
NM_003262chr3114809 4682 4546 3955 2109 1890 1780 1168 1008 742 289 23754 1869 44226 1452 1156 228 21593 161
NM_003274chr2162665 2302 2051 984 859 821 --32292 1974 1140 --
NM_003292chr171875 1773 898 634 431 283 85 1738 ----
NM_003298chr3146240 6149 6120 6083 6000 5755 5589 5494 4062 2231 1930 1849 645 296 22401 388 11435 --
NM_003304chr341497 1370 637 618 --1136 21549 209
NM_003338chr1081663 1528 1351 602 457 413 372 331 1575 --21397 786
NM_003359chr481256 1161 1078 992 515 505 450 372 --11294 --
NM_003387chr2132808 2704 2676 2533 2517 2453 2337 2192 2160 696 651 561 467 1336 ----
NM_003392chr3104281 4075 3650 3446 2994 2760 1480 1371 1262 565 --11500 2646 51
NM_003406chr851799 1422 244 92 41 ----11824
NM_003409chr1851223 1108 555 535 330 ----1946
NM_003410chrX122844 2585 2267 973 916 908 829 818 644 357 286 271 --1461 --
NM_003411chrY111833 1691 1669 1573 1410 1246 1154 607 495 286 144 ------
NM_003412chr383110 2603 2317 2234 1197 913 603 461 ----11253
NM_003413chrX51497 1419 767 233 222 2334 29 11718 --
NM_003423chr1952268 604 475 90 53 1276 --1708
NM_003463chr6133363 3038 2329 2246 2067 1183 1159 1051 721 596 583 508 176 --12198 --
NM_003468chr254067 2649 1445 319 250 1753 31269 776 548 1657
NM_003471chr332236 907 560 ----11530
NM_003472chr661338 1107 931 381 271 54 --1240 --
NM_003478chr1152916 2748 2077 1152 877 1800 12926 13002
NM_003483chr1262962 2612 1989 1910 1822 1812 --22735 2648 --
NM_003489chr2153299 2676 2220 1204 277 12645 --1756
NM_003505chr721951 1836 ----21820 1582
NM_003566chr12102929 2773 2726 2323 1237 1034 1026 955 692 658 13044 ----
NM_003574chr18175805 5635 5401 5364 5066 4811 4084 3548 2265 2188 2118 1562 1198 1151 722 459 154 --14053 11454
NM_003583chr1283252 3213 3083 2941 1565 738 200 167 1726 13162 1317
NM_003590chr293676 3618 3493 3474 3083 1078 935 191 109 --22897 222 12991
NM_003597chr262326 1939 391 367 316 299 --1436 --
NM_003615chr3193907 3831 3772 3631 3503 3262 2604 2462 1425 1333 1238 1211 1181 734 696 662 357 349 253 ----12592
NM_003626chr1141025 444 438 238 21114 141 --1482
NM_003663chr372961 2570 2487 2445 1389 138 120 1858 1687 --
NM_003671chr933579 3515 424 22367 1121 13405 13310
NM_003722chr372594 2558 2433 2062 679 320 300 2929 214 ----
NM_003759chr464286 3717 3569 2831 1564 1011 43473 2940 1592 591 14214 --
NM_003762chr171293 1186 993 944 936 482 472 --1502 1448
NM_003799chr1884124 1289 1110 1000 911 812 365 178 1372 1348 --
NM_003800chr672064 1751 1662 1493 562 343 316 ----11880
NM_003816chr861340 1277 954 299 206 22 ----11398
NM_003825chr1571063 1009 576 543 506 500 140 ------
NM_003861chr1471989 1942 1924 1063 949 733 429 --12425 11101
NM_003884chr351814 1784 1263 511 72 21743 1658 --1502
NM_003887chr2112272 2207 2047 1996 1661 763 572 530 318 175 155 --11711 --
NM_003895chr2182126 2086 1628 1356 792 524 514 415 11825 --22143 1567
NM_003909chr8113036 2676 2662 2383 2312 2149 1095 961 555 230 220 12555 22291 371 --
NM_003913chr694091 3736 3407 3351 3031 806 383 259 238 14057 ----
NM_003930chr782479 2290 2240 1650 925 298 249 234 11929 12009 1514
NM_003955chr1761612 1582 1576 1566 1460 1432 --11240 --
NM_003958chr652715 1566 1546 1170 852 1695 33192 2878 2786 11519
NM_003994chr12134352 4199 4097 3921 3833 3589 3350 1325 870 847 335 285 149 1888 21081 569 --
NM_004006chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004007chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004009chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004010chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004011chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004012chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004013chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004014chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004015chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004016chrX152561 2477 2334 2123 1945 1707 485 434 351 334 293 260 179 78 37 ------
NM_004017chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004018chrX152561 2477 2334 2123 1945 1707 485 434 351 334 293 260 179 78 37 ------
NM_004020chrX162647 2563 2420 2209 2031 1793 571 520 437 420 379 346 265 164 123 96 ------
NM_004021chrX152561 2477 2334 2123 1945 1707 485 434 351 334 293 260 179 78 37 ------
NM_004022chrX152561 2477 2334 2123 1945 1707 485 434 351 334 293 260 179 78 37 ------
NM_004023chrX152561 2477 2334 2123 1945 1707 485 434 351 334 293 260 179 78 37 ------
NM_004028chr1893759 3680 3447 3429 3283 3072 858 563 159 11174 ----
NM_004087chr362046 2032 1742 821 767 331 1502 ----
NM_004094chr1472599 2490 2363 1021 943 893 756 ------
NM_004124chr1472224 1386 835 740 636 247 101 ----23082 301
NM_004133chr892660 2605 2585 2522 2434 2418 977 224 145 ------
NM_004171chr11199599 8194 7632 7553 7088 6994 6918 6283 6082 6062 3838 3742 3028 3017 2266 2212 1137 743 201 16520 49152 8950 2254 1569 37073 6945 1632
NM_004225chr891278 1090 966 490 465 340 215 131 65 ------
NM_004229chrX72248 2022 1876 1655 631 418 275 --12230 1897
NM_004232chr18113830 3715 3638 3512 2852 2524 2429 1056 999 475 64 13617 ----
NM_004261chr161004 909 680 305 199 56 1690 ----
NM_004293chr983879 3723 3244 2552 1452 589 573 134 --12831 11492
NM_004316chr1231153 372 256 ----2961 765
NM_004329chr1061272 1048 1035 1016 989 201 --11468 --
NM_004330chr1581178 798 323 280 264 237 230 178 1890 ----
NM_004331chr8102657 2492 2357 2347 2007 1961 869 829 253 117 --1634 --
NM_004337chr882187 2132 2040 1971 1475 603 174 168 --165 --
NM_004338chr18145999 5638 5448 5151 4482 2372 2028 1657 1590 789 780 625 609 376 15528 --24551 347
NM_004354chr44731 587 345 28 --135 --
NM_004362chr44609 598 525 519 1549 1678 --
NM_004384chr552244 2009 1814 881 374 1708 21889 1547 --
NM_004392chr1342548 1959 635 244 2413 32 146 --
NM_004430chr842699 2324 2102 1711 --22790 2528 22074 1808
NM_004432chr971511 667 487 436 317 70 27 --22259 788 --
NM_004434chr1451897 1657 480 253 247 ----31581 1562 1543
NM_004438chr273305 3256 2281 1326 1143 720 402 22264 179 ----
NM_004440chr641593 1453 1351 798 31677 294 33 1470 11343
NM_004458chrX92657 2141 1990 1935 1878 1628 1037 603 181 22593 238 1357 --
NM_004464chr493848 2849 2612 1492 1343 1193 851 635 562 23498 3458 23451 534 1322
NM_004500chr1452007 1541 1411 1309 553 --1733 11577
NM_004501chr183279 2969 1530 1376 1108 1043 933 179 ----11343
NM_004504chr262560 2537 917 901 739 522 32106 1156 256 2860 600 --
NM_004525chr281224 1061 464 334 214 177 58 43 ------
NM_004586chrX115464 5142 5037 3713 1832 1703 1297 1165 825 415 368 --44268 3583 1225 327 --
NM_004612chr954491 4009 1758 988 927 --43944 1682 1597 119 11478
NM_004619chr181719 1378 592 578 435 231 223 165 ------
NM_004642chr127682 495 270 189 102 54 38 --1173 --
NM_004654chrY3449 154 50 --1145 11385
NM_004660chrY51681 1540 1507 269 96 --12142 1533
NM_004719chr1252486 2200 2184 990 270 21124 433 --12615
NM_004726chrX104867 4367 4035 3973 3706 2102 1967 1424 1120 654 34901 2146 1186 ----
NM_004744chr493979 3941 3047 2989 2540 1267 1084 1078 50 2889 609 --158
NM_004745chr874886 4423 1576 1569 1089 878 355 27000 761 --15644
NM_004748chr15124183 3926 3909 3812 3701 3416 2944 1249 1134 559 267 261 --33649 2785 1353 --
NM_004760chr762270 2232 2106 1919 1632 1557 --1548 --
NM_004775chr1882124 1936 881 474 450 400 393 279 --12136 2435 138
NM_004797chr343736 3543 2572 1027 33662 2828 1170 --2445 325
NM_004808chr1053281 3125 2395 1355 932 42897 2355 1343 339 --12497
NM_004815chr1124282 4077 3212 3171 1955 1314 1077 804 759 629 566 401 11673 21419 477 14785
NM_004824chr641362 1271 929 227 ----11435
NM_004827chr461894 1834 1551 1364 724 480 ------
NM_004834chr253135 2232 1315 1004 563 1918 23358 2877 --
NM_004842chr681756 1546 1489 1401 1362 718 346 77 11159 1519 11110
NM_004850chr281728 1463 1432 1370 1319 1313 611 536 ------
NM_004857chr14133950 3325 3238 3024 1842 1830 1807 1751 1435 854 220 161 55 23063 1189 44634 3925 3503 430 --
NM_004859chr1772615 2547 1956 983 521 310 71 1552 22888 2341 --
NM_004866chr5144320 4043 4037 3829 3437 3274 3213 1972 1813 1596 1248 748 593 417 43788 1497 1364 204 ----
NM_004869chr1891567 1558 1502 424 376 333 320 295 145 1522 ----
NM_004897chr103784 97 85 ----1250
NM_004904chr7156520 5756 5459 4949 4830 4765 4666 4058 2033 1928 1910 1596 1024 263 159 15731 25740 133 14822
NM_004912chr731379 578 483 1536 --11368
NM_004921chr132408 2332 979 1958 1374 12360
NM_004949chr1852026 1603 1404 401 120 1540 1502 1360
NM_004956chr7134583 4548 4445 4256 3813 2946 2930 1514 1362 1165 962 590 529 23937 603 --14355
NM_004972chr951054 1048 422 338 54 ----141
NM_004985chr12164545 4195 4133 3850 3645 3639 3367 1766 1656 1645 1630 1315 964 791 773 748 --24452 3559 --
NM_004992chrX67245 5762 5480 1193 980 244 16764 --12062
NM_004992chrX67245 5762 5480 1193 980 244 16764 --12062
NM_005010chr771577 1518 733 685 661 378 138 ------
NM_005011chr751655 1611 1587 343 52 ----162
NM_005028chr1042206 1713 123 101 --1167 12072
NM_005054chr271683 1532 1336 1297 148 142 82 ----1618
NM_005056chr12105164 4975 4648 4453 3913 2103 2021 1216 395 321 --24373 4121 --
NM_005065chr14105044 4942 4214 2017 1580 1428 1144 1016 950 938 14405 ----
NM_005087chr3398 45 34 --124 --
NM_005121chr17123792 2602 1536 1141 969 807 798 772 586 521 498 405 1737 22566 719 23060 824
NM_005156chr995088 4934 4723 4648 3545 1693 1309 858 568 --24037 884 12009
NM_005160chr22106639 5580 5425 4935 2133 1765 1498 1299 1248 1064 --46764 5952 4517 702 --
NM_005171chr1291169 1135 1114 1095 1052 1010 906 357 69 --21040 836 --
NM_005180chr1061524 1502 590 537 68 45 11654 11195 --
NM_005188chr1178101 5121 3338 2082 1857 1559 785 18167 ----
NM_005197chr14136089 5876 5388 5356 5074 4881 4766 4760 4668 3772 1190 1165 248 ----25766 4024
NM_005233chr382597 2589 2397 2288 2211 706 461 397 ----12626
NM_005235chr2147667 5858 5396 4988 2906 2890 2677 1572 1429 1405 1084 872 730 681 17754 27220 5245 13154
NM_005238chr1183528 3316 2708 2411 1202 952 712 146 --12993 12296
NM_005259chr261393 1184 1174 1019 951 449 ----1369
NM_005324chr1792102 758 679 568 530 516 455 324 88 --11338 --
NM_005339chr484044 3795 3575 3154 1707 1637 1242 1200 --33869 3311 958 --
NM_005359chr18115854 5695 5328 2351 2217 1936 1359 1143 1005 563 67 26262 1232 ----
NM_005399chr143223 1286 525 150 1162 13890 11457
NM_005436chr1073768 3264 2749 1282 1274 366 105 12677 21162 573 --
NM_005455chr12329 121 --11499 11736
NM_005475chr1233191 2952 2779 12711 41998 915 904 705 1219
NM_005497chr17125687 5626 4968 4441 3972 1892 1491 1268 1087 512 382 230 25862 222 ----
NM_005502chr993230 3115 3088 2561 2416 2215 1169 179 57 --12102 12129
NM_005509chr561864 1825 1572 1540 718 113 11234 ----
NM_005542chr751931 1861 1282 1275 589 1510 11507 11798
NM_005546chr542354 2324 825 807 11462 --21700 627
NM_005570chr1861210 946 906 794 788 327 11151 21122 136 --
NM_005578chr394194 3559 1903 1204 1170 725 602 496 239 --24972 4465 --
NM_005587chr155902 816 765 124 96 1357 --1314
NM_005596chr9186098 5159 5049 4925 4728 1900 1836 1691 1459 1243 1237 895 887 575 481 439 251 63 11192 22096 1992 --
NM_005603chr1851871 1766 1338 426 130 11328 --11819
NM_005665chr1124956 4758 4472 4196 3391 3237 1716 1319 1088 1053 909 769 --1152 13054
NM_005668chr594320 4241 4206 1540 1426 1298 979 929 261 14498 --24451 3313
NM_005715chr672550 2406 2195 1747 1729 983 561 ------
NM_005725chr162255 2124 1723 537 242 131 --1725 --
NM_005739chr1582424 1922 1717 1631 671 650 638 85 --12060 --
NM_005746chr792655 2554 2431 2056 751 353 323 291 89 --12127 --
NM_005748chr12103284 2565 2168 1168 1156 1064 834 712 351 123 13025 --12259
NM_005795chr252951 2935 2242 1912 855 --22273 953 --
NM_005807chr12476 107 ----2701 188
NM_005813chr272662 2167 2042 881 782 317 217 ----11019
NM_005828chr17104962 4837 4762 3419 3175 1876 1378 568 553 115 44810 4119 3689 1264 14386 --
NM_005840chrX116846 5832 5816 4745 2827 2615 2372 2275 1974 938 214 12058 35869 3076 1038 21937 1202
NM_005863chr1091129 580 544 474 358 331 186 98 45 ------
NM_005880chr1671659 1534 1324 1318 1145 476 185 ----11076
NM_005901chr18218592 8451 7947 7760 7124 6712 6467 6222 6162 5651 3167 2255 2102 1509 1485 1247 1064 428 419 369 352 17981 12828 --
NM_005902chr1594519 4013 3474 2985 2799 1533 1244 1228 1001 14309 24493 1544 21446 1155
NM_005903chr5115211 4237 3657 3537 3347 850 689 600 475 344 104 14259 24013 749 1973
NM_005909chr553112 2896 2670 1540 1010 11033 11428 --
NM_005924chr74846 411 160 74 1889 --1151
NM_005935chr495148 3880 3768 1621 1484 1100 912 609 43 --11107 --
NM_005941chr872772 1195 1173 976 960 762 719 23894 1080 22574 33 --
NM_005955chr195341 4921 4896 4160 4067 2115 1981 1266 1064 21293 795 --13539
NM_005966chr262288 1923 1634 936 646 254 --11606 1328
NM_006007chr9124487 4437 4084 3918 3335 3290 2818 1569 1211 760 166 111 11016 34401 1647 323 --
NM_006037chr2104307 4294 3717 3699 3419 3178 3131 1589 1215 1058 14578 23474 1505 23785 1228
NM_006047chr2063522 2908 2324 439 312 195 --122 1156
NM_006080chr742407 2365 2303 111 12352 22649 2092 12189
NM_006089chrX91875 1624 1548 1504 1379 719 684 360 305 1129 11894 --
NM_006095chr4124348 4167 3876 3709 3134 3069 2967 1762 1490 1303 941 655 1157 24399 1221 --
NM_006106chr1193292 2816 2790 2774 2387 1064 956 925 82 --11321 --
NM_006108chr1172260 2022 2008 1795 1571 907 693 --22071 112 --
NM_006154chr1562770 1000 916 717 196 45 --1950 1969
NM_006166chr1252650 2406 1746 974 648 1849 1864 --
NM_006197chr861938 1875 1438 1431 738 363 22118 581 ----
NM_006203chr5235407 5387 5226 5143 4987 4643 4614 4557 4508 4174 4059 3590 3543 2107 1896 1859 1287 1252 890 853 804 758 358 11689 11242 11453
NM_006206chr482943 2782 2715 2269 1930 784 658 327 ----11093
NM_006246chr1471343 1270 1052 998 510 220 124 --2415 95 --
NM_006251chr5123062 3008 2699 2617 2521 894 871 764 312 276 242 128 --3403 152 29 --
NM_006252chr1187511 7301 6677 6600 6467 6438 6391 6290 5699 5609 5311 5196 4828 4741 2337 1791 822 747 47489 2919 2503 1846 15660 11626
NM_006256chr172069 1703 1076 642 607 574 388 11756 22303 323 12154
NM_006267chr261444 635 533 134 127 112 ----11600
NM_006282chr2084280 3640 3306 1675 1494 714 298 222 --1553 14135
NM_006283chr894899 4875 4500 4261 4231 1994 1918 1203 466 ----31927 536 97
NM_006287chr252669 1691 870 770 44 --2478 361 12280
NM_006298chr643395 3200 3059 1127 ----1508
NM_006300chr1962391 2322 1896 1624 898 178 --11610 --
NM_006315chr443839 2738 255 122 14382 --2779 181
NM_006353chr661444 1365 1279 313 77 32 ----11336
NM_006364chr1461097 1059 885 844 249 221 1319 ----
NM_006375chrX61628 1408 1251 568 395 70 --11752 1679
NM_006379chr761939 1504 704 421 244 134 --11447 --
NM_006380chr1784175 4082 3933 3578 3220 3081 461 96 1154 11659 1294
NM_006393chr1094489 4328 4186 3692 2993 2984 957 642 101 --11382 --
NM_006407chr371131 1093 562 333 302 45 28 --21059 311 --
NM_006434chr1083201 2959 2912 2827 2551 2439 2343 2158 --33008 2663 2112 --
NM_006449chr231622 653 158 1676 2360 90 2692 273
NM_006457chr4113909 3415 3397 3386 3154 2793 1356 842 745 240 87 ----23768 1603
NM_006467chr562233 2002 888 763 460 156 11917 22276 2044 12133
NM_006482chr1283252 3213 3083 2941 1565 738 200 167 1726 13162 1317
NM_006496chr131632 1411 416 11741 --21405 1260
NM_006504chr1072836 2801 2781 2258 1080 552 526 --12570 --
NM_006534chr2063313 2767 2472 2437 2380 418 12975 --33092 1049 644
NM_006538chr294192 4097 4071 3355 1074 1008 679 669 295 22992 493 ----
NM_006544chr14145652 5326 4938 4837 4694 4547 4284 3936 3751 2427 2363 2075 2046 1014 --55789 5739 5058 2445 2290 142
NM_006546chr1764940 4504 1745 897 542 478 --21728 460 --
NM_006561chr1095037 4373 4172 2371 1845 1478 737 525 205 1304 14238 --
NM_006572chr1763406 3254 2967 2337 621 83 --22178 1350 22723 518
NM_006587chr491603 1420 1221 1114 664 624 478 220 138 ------
NM_006599chr16208170 7267 7194 6843 6604 5245 5051 5008 3288 3137 3074 2971 2533 2458 2040 1929 1660 850 207 170 27782 5223 21251 1201 --
NM_006603chrX92053 2027 1965 1957 1791 1759 1645 573 405 ----22009 817
NM_006609chr262593 2022 1837 236 182 82 --22187 836 12667
NM_006614chr3113582 3336 3230 3093 3081 2487 1227 917 858 754 332 ----12949
NM_006620chr674269 4059 3808 3784 3744 3644 2955 34849 3061 896 24129 349 13173
NM_006624chr105727 659 620 139 103 21473 820 --1285
NM_006625chr151154 1023 775 325 240 1800 21208 1168 --
NM_006625chr151154 1023 775 325 240 1800 21208 1168 --
NM_006625chr151154 1023 775 325 240 1800 21208 1168 --
NM_006626chr972711 2619 2454 2389 1811 1036 574 ----1304
NM_006628chr15103707 3572 1587 1465 1254 1062 869 843 738 337 33834 1826 885 1115 --
NM_006654chr12184618 4454 4290 4223 4056 3953 3871 3783 3706 3679 3624 3599 3527 1433 1054 968 349 26 13423 --22964 99
NM_006699chr182571 2526 1838 1030 433 354 181 43 12428 12517 --
NM_006716chr74855 210 140 59 2986 182 11376 1107
NM_006717chr993359 3278 2642 2151 1285 1019 845 749 236 ------
NM_006722chr372151 1122 1018 704 529 463 189 --11984 --
NM_006729chrX105551 5439 5426 4219 4116 3844 1840 1557 780 767 14624 33464 2232 993 --
NM_006731chr974904 3659 1660 1010 904 889 203 14319 15549 --
NM_006746chrX71529 1279 1240 472 265 153 128 --21548 231 --
NM_006750chr16158101 7781 7551 6332 6079 6043 5955 5723 5551 5148 2854 2220 2085 1757 446 --12477 22934 2406
NM_006754chr761272 1185 1078 482 291 142 ----1851
NM_006766chr862494 2078 1666 824 309 57 --2384 224 1676
NM_006775chr6103122 3003 2801 2776 2237 2208 995 728 579 568 --32907 2757 2423 --
NM_006805chr561578 1475 603 498 287 234 ----11196
NM_006811chr208935 779 406 369 363 279 132 108 --1851 --
NM_006851chr1272728 2553 1956 794 687 349 121 --22882 201 11917
NM_006873chr293372 3235 2957 2795 2405 2176 1122 916 802 --11143 --
NM_006885chr1693952 3691 3619 3279 2852 1179 545 420 185 ------
NM_006888chr1483503 2906 2895 2829 2615 827 821 222 ------
NM_006914chr921159 335 --11334 1293
NM_006920chr271722 1692 1413 1316 562 359 113 11937 21286 42 --
NM_006922chr292466 2138 2127 1896 1863 1722 1021 449 364 --140 --
NM_006939chr146763 458 378 260 254 97 ------
NM_006948chr2182404 2112 1994 1747 894 843 544 141 --22489 464 1963
NM_006981chr982727 2508 2255 1965 924 367 250 213 1187 --11054
NM_006996chr131536 681 28 --21916 335 11790
NM_007006chr1673497 3193 2953 2404 574 552 294 21098 514 23420 2827 --
NM_007007chr1294397 4042 3362 3222 2993 469 361 250 242 11126 14367 13184
NM_007038chr21155753 5445 5364 5258 4986 4052 4035 3705 2257 1808 1610 1562 1420 889 419 --14980 15581
NM_007042chr372637 2135 1735 541 473 336 317 --12438 --
NM_007043chr1291916 1695 1376 1332 1321 1310 651 183 147 ----1575
NM_007049chr651015 986 969 950 937 ------
NM_007073chr6114212 4178 4111 3727 3671 3356 3144 3091 2866 1046 839 --24124 4049 13742
NM_007114chr393059 2649 2622 2330 957 758 747 369 143 1928 21195 163 32750 2285 88
NM_007124chr671915 1573 772 485 402 394 189 --11538 --
NM_007137chrX64058 1708 909 654 624 201 --34675 1451 318 24390 1111
NM_007139chr75805 764 258 216 133 1847 21123 976 --
NM_007147chr1941175 1057 949 922 21064 189 1337 --
NM_007157chrX103004 2611 2317 2117 1975 1891 569 230 105 45 --1637 --
NM_007166chr1151531 1503 1301 568 198 --2520 174 --
NM_007173chr1192163 1910 915 705 620 552 353 309 236 ------
NM_007175chr872996 2890 2726 2691 2548 592 210 --13526 12801
NM_007195chr18113455 3365 2440 2361 1437 1063 1054 976 514 303 225 1655 --1998
NM_007212chr131606 865 135 --42152 1529 439 39 --
NM_007222chr841577 1519 1342 586 --21744 443 --
NM_007231chrX72392 2138 2001 1891 947 622 580 ------
NM_007236chr1561793 1747 1644 881 414 240 42386 1972 1613 185 ----
NM_007249chr13138993 8779 8693 7071 5737 3727 3640 3553 2453 1748 1542 820 562 11859 67204 5883 3122 3034 1712 1129 1426
NM_007287chr392958 2796 2421 2001 792 752 726 456 21 --1466 --
NM_007288chr392958 2796 2421 2001 792 752 726 456 21 --1466 --
NM_007289chr392958 2796 2421 2001 792 752 726 456 21 --1466 --
NM_007332chr841435 1350 1128 1000 ----1208
NM_007347chr15142501 2398 2364 2203 2197 2065 2056 1180 1084 972 719 259 125 45 1596 1317 --
NM_007358chr161745 1598 1529 1467 712 704 11407 ----
NM_007373chr1071838 1817 1655 1527 578 405 106 --1483 --
NM_012081chr5103772 3471 3079 3045 2631 2391 2316 1404 1060 486 13707 13145 --
NM_012089chr151568 1495 1412 1044 544 154 21588 1056 1446
NM_012095chr1053278 3217 2368 887 619 --32923 2705 658 1469
NM_012096chr3123189 2813 1433 1390 1374 1086 1041 508 468 446 170 108 --1534 --
NM_012097chr2102229 2207 2121 2110 2053 1728 1678 1672 595 92 ------
NM_012120chr661168 1132 1058 576 356 160 --22850 901 --
NM_012129chr741717 1644 1601 124 11594 12244 --
NM_012141chr1373545 2903 2562 1376 1343 1094 1046 --1155 --
NM_012158chr1351828 1797 1590 1201 1175 1592 1275 --
NM_012164chr9167214 7010 6810 5901 5763 5732 5259 5103 4799 4639 2973 2943 2479 2376 508 437 21899 964 26439 1829 35851 2908 2149
NM_012180chr44713 618 605 222 ----1190
NM_012193chr1174705 4247 1663 1327 1215 995 274 14611 1495 1767
NM_012199chr1104665 4510 3909 1728 1623 1568 1324 1265 1000 918 ----14238
NM_012214chr2105645 5249 4996 4767 4655 2236 1617 1226 949 654 31629 626 377 15258 25221 391
NM_012234chr3103781 3610 2595 1339 1084 874 770 271 240 216 1581 --12658
NM_012262chr1185282 5193 5042 4968 4219 4023 3793 3440 3396 3291 1885 1866 1716 1236 1172 1024 940 914 23418 1413 24012 2027 --
NM_012287chr3134270 4225 4025 3898 3524 3027 2901 1709 1506 1165 894 871 147 21777 1671 14450 13640
NM_012294chr783983 3614 2985 2905 2759 777 648 618 --32918 1544 680 --
NM_012300chr562142 2053 1717 728 372 362 ----1320
NM_012301chr761941 1737 1664 1564 825 356 --21432 776 12181
NM_012316chr195578 5425 5154 4831 3421 1728 1171 575 326 22001 1022 ----
NM_012327chr1851594 1188 1142 1027 1000 --2512 191 --
NM_012329chr1741050 276 261 113 --1565 1291
NM_012334chr5114601 4546 3874 3736 3049 1731 1255 1168 892 819 733 22913 1035 ----
NM_012347chr662979 2967 2419 807 453 32 22485 2170 --12556
NM_012382chr564113 3530 1192 847 711 195 --24215 1082 1778
NM_012388chr1573169 3099 1201 920 901 251 189 --13020 --
NM_012431chr7103616 2881 2238 1443 1143 727 625 177 85 38 --1995 2958 888
NM_012464chr492935 2777 2405 1900 1795 678 581 384 94 ------
NM_012479chr732548 608 585 12773 1592 --
NM_013229chr1262728 2093 947 842 466 86 --12146 12643
NM_013230chrY101788 1750 1623 1474 1320 1299 1175 1109 542 443 ------
NM_013255chr7178730 8388 7959 7436 7183 6681 6619 6609 6294 3427 3047 2904 2733 2461 990 622 63 12312 21974 716 --
NM_013261chr453330 1485 1148 184 109 --12595 11086
NM_013269chr1263205 2941 2837 1747 374 235 13854 11440 14378
NM_013302chr16114717 4527 4511 4423 4272 3212 1869 1121 562 459 130 14676 11338 14330
NM_013309chr1572603 1720 1628 1018 589 366 336 ----2455 228
NM_013341chr232858 2533 2076 1503 1377 1639
NM_013374chr3113001 2811 2663 2649 2506 2499 2196 1040 430 240 199 12537 32643 2600 627 --
NM_013386chr181798 1472 1436 1136 479 394 374 354 1437 11179 1415
NM_013438chr971819 1634 1451 620 448 427 372 --21283 259 --
NM_013448chr142587 578 ----2711 238
NM_013995chrX52379 2365 2351 1887 94 --2475 216 12316
NM_014011chr232269 1798 552 11046 --22309 996
NM_014021chr163515 3237 2470 2242 1050 287 12537 12801 1604
NM_014023chr1032709 589 529 --32861 978 741 1637
NM_014043chr381601 1589 1436 1417 456 258 93 75 ------
NM_014048chr16105295 5208 5169 5122 4205 2130 1951 1598 1235 627 --11149 24487 4294
NM_014089chr13112192 2142 2133 2112 1974 1955 1676 726 507 322 102 --1821 --
NM_014106chr1582445 2011 1960 1175 840 707 557 433 12372 12662 11948
NM_014109chr861220 1151 816 793 781 29 ------
NM_014112chr8155241 4468 3708 3605 2201 2023 2010 1991 1671 1629 1623 1350 442 363 321 ----14369
NM_014141chr784923 4597 4105 3960 1960 929 849 485 1467 45008 2095 918 197 --
NM_014155chr11107466 7085 6759 6235 5346 5084 2069 1654 1385 1156 --37115 6564 880 25259 2642
NM_014181chr282927 1058 887 813 753 540 487 418 ------
NM_014243chr451780 1353 650 373 341 1706 1466 --
NM_014294chr841160 492 351 300 11285 21190 547 --
NM_014296chr361120 1035 522 208 126 30 11043 --1428
NM_014309chr22105415 5376 4886 4232 4177 4074 3712 675 623 146 13626 --13618
NM_014331chr4317856 7786 7742 7715 7298 6953 6946 6771 6396 6347 5635 5603 5207 5091 2843 2755 2727 2713 2668 2489 2132 2085 1805 1730 1564 1163 1055 1046 1008 482 385 1193 66531 5557 5297 5289 5268 3029 17062
NM_014363chr1351208 1102 976 821 271 21160 113 --11073
NM_014372chr192047 1949 1875 1749 1472 1395 599 492 451 11552 1630 --
NM_014381chr1492575 2303 2087 2005 1283 1185 844 766 222 ------
NM_014393chr862142 1820 1585 679 439 381 22159 1524 32048 551 422 --
NM_014415chr3111540 1461 1455 1070 624 364 334 293 231 98 67 ------
NM_014421chr441934 1616 501 60 32051 2036 30 22078 2005 --
NM_014423chr5105211 4790 3780 3524 1812 1476 1462 1168 1099 421 1837 33850 2139 576 25146 1866
NM_014431chr1021436 1138 1285 1169 21466 1383
NM_014445chr382079 1861 1800 982 648 594 463 413 --22003 1980 12228
NM_014447chr451629 401 372 296 106 ----1471
NM_014494chr1651699 1559 665 396 208 ----1755
NM_014574chr1451420 1193 994 603 591 --11084 --
NM_014577chr2210926 917 747 726 639 613 595 361 320 98 ------
NM_014584chr1481596 1570 1507 1448 1418 1337 521 105 ------
NM_014629chr82462 34 11058 --21233 363
NM_014630chr1563547 3531 3523 1332 1304 1292 --12655 12515
NM_014636chr993853 3797 3240 3229 1445 1300 919 606 404 12645 13056 12966
NM_014674chr3103959 3866 3784 3761 2881 2794 2743 840 492 308 13825 22501 721 12718
NM_014682chr872067 1862 566 375 306 117 110 ------
NM_014701chr15153410 3377 3265 2842 2422 2384 2347 2180 1302 1052 980 765 627 81 46 ----23229 2828
NM_014702chr693418 3371 3365 2824 2349 2243 1189 730 455 129 2498 74 12859
NM_014705chr751626 1566 1368 288 44 11420 11739 --
NM_014707chr792205 2024 1812 1563 1451 858 604 389 54 ------
NM_014711chr1672073 2007 1928 490 439 247 73 1415 11680 1311
NM_014721chr677467 6856 6545 6334 2314 1310 334 --11894 12503
NM_014733chr542244 756 738 214 --2712 263 --
NM_014735chrX7686 342 194 185 173 141 101 --11946 --
NM_014739chr674149 3568 2644 1660 1437 1112 112 --22764 1414 23349 409
NM_014743chr472927 2743 1257 1248 760 359 294 33008 2541 825 13029 --
NM_014746chr293750 3590 3385 3250 3017 2920 1389 1325 581 --11181 --
NM_014752chr1171830 1659 1544 1446 1431 595 306 11764 ----
NM_014755chr2114280 3765 2934 2771 1161 1143 712 611 552 514 120 34166 3955 3576 --1696
NM_014757chr562207 2129 2121 1525 468 431 ----12184
NM_014774chr133237 2231 354 ----23074 394
NM_014795chr271107 1039 994 943 923 353 270 ------
NM_014810chr1113708 3570 3403 3260 3252 3060 2668 1275 1120 428 169 13213 ----
NM_014812chr151986 1862 630 571 459 --11452 21511 610
NM_014820chr391873 1859 1572 1544 1388 766 656 435 192 --2386 184 11416
NM_014829chr5112204 1793 1582 1546 784 707 646 616 606 570 70 ------
NM_014836chr1061830 1327 729 615 353 295 11569 1407 --
NM_014839chr162220 2041 987 818 808 468 2914 159 1349 31626 425 263
NM_014860chr292588 2434 2360 1982 1657 1630 908 574 173 --1187 --
NM_014864chr1123468 3144 2990 2709 1708 1456 1346 1314 743 402 361 35 ------
NM_014873chr1154608 4473 4329 3862 3836 2979 1900 1474 903 719 648 617 532 509 71 23135 3096 34581 4498 486 11023
NM_014877chr17237788 7223 6920 6890 6878 6818 6422 6175 5502 5325 4979 4868 4803 2943 2610 2256 2250 1851 1352 992 375 265 184 --37484 638 566 27011 5168
NM_014897chr1783232 2733 2600 2350 693 324 287 254 1504 22784 969 --
NM_014900chr271006 957 836 433 358 265 169 --1177 --
NM_014903chr1282429 2237 2194 904 722 658 339 216 --11558 --
NM_014904chr1094059 4035 3886 3542 2775 1269 1149 456 449 22601 661 13950 --
NM_014906chr1734009 2985 885 --43215 2922 1485 603 23341 620
NM_014912chr10103482 3209 2357 2189 1343 1194 904 269 225 79 23027 202 1158 --
NM_014920chr683678 3431 3370 3339 2972 2937 918 290 1707 42787 2346 1170 117 --
NM_014923chr1361863 1813 1669 1522 404 76 22053 273 ----
NM_014934chr1393993 3828 3398 1365 1007 999 766 418 343 11187 --14026
NM_014936chr692703 2627 2562 2327 2055 1949 898 471 388 ----12664
NM_014946chr232938 1056 502 1326 42983 2922 967 99 --
NM_014947chr143168 2375 340 260 11186 12424 11239
NM_014950chr145643 438 396 307 284 --11172 --
NM_014962chr2052783 2353 1905 980 525 11846 ----
NM_014964chr1732092 680 603 --2873 148 1643
NM_014982chr14165058 3870 3817 3730 3576 2070 1913 1864 1701 1688 1336 1296 1208 612 460 241 --21180 570 --
NM_014988chr4112840 2620 2273 2262 2089 2014 1930 1923 715 210 204 --22824 1786 22002 391
NM_014991chr473101 2792 1212 1165 940 405 95 33113 2048 873 --21314 329
NM_014999chr1271565 1463 1281 631 567 505 136 21171 108 ----
NM_015020chr1673886 3817 3772 3213 2551 380 243 22699 1567 12583 --
NM_015024chr831151 1021 366 ----1414
NM_015025chr282117 2069 1958 1933 1714 1676 1066 646 11799 1247 --
NM_015026chr12154702 4517 4084 3941 3680 3615 2949 1629 1580 1470 1330 934 896 389 161 ----14045
NM_015032chr1372242 2135 2126 2086 1844 1036 665 --22439 1074 --
NM_015040chr243346 2619 480 175 13131 12913 12750
NM_015049chr272972 2240 2091 1041 942 709 27 1421 --11169
NM_015051chr963152 2068 1293 1162 881 265 22470 2417 --13250
NM_015055chr1162929 2480 1870 1859 313 59 --12757 12253
NM_015071chr5126157 5830 5459 4943 4258 3977 1729 771 549 516 444 33 25856 5482 25892 2394 --
NM_015076chr694525 4324 4202 3479 3354 3009 1649 1323 413 14334 1639 1689
NM_015092chr16104645 4086 3731 3501 1734 1352 1315 1186 1091 955 ----14050
NM_015097chr362284 2151 2143 1823 790 768 1612 11574 --
NM_015110chr992539 2171 2070 1786 1709 882 826 800 52 1352 ----
NM_015115chr4103096 2835 2746 2390 2189 2173 1065 901 797 209 --1197 --
NM_015130chr421061 944 --11330 11174
NM_015137chr852069 1897 910 776 733 12401 1756 11820
NM_015141chr352716 2370 2218 1779 1725 --1130 12743
NM_015144chr1663839 3097 2993 1399 941 264 --11413 11297
NM_015172chr161405 1254 539 256 192 151 21636 1060 ----
NM_015185chrX61975 935 880 854 812 93 ----21111 56
NM_015192chr20102667 2584 2307 2265 2069 2003 759 529 511 276 22153 2083 12331 --
NM_015199chr34907 703 660 172 --22297 264 1677
NM_015200chr472470 1677 860 735 679 625 391 --32248 2106 1745 --
NM_015208chr18154025 3317 2919 2558 1495 1323 1292 1282 1121 1088 526 217 152 121 97 12704 --12634
NM_015215chr173173 2348 2312 2287 2278 383 201 ----1655
NM_015225chr993022 2946 2743 2643 2263 2229 1275 1068 102 --1950 --
NM_015247chr16145041 4885 4183 3932 3295 1905 1463 1451 1386 1378 1298 1259 824 194 ------
NM_015269chr11410 ----2475 201
NM_015271chr483938 3567 3551 1727 1057 360 289 236 --24041 463 --
NM_015275chr1271519 1495 871 630 619 337 124 11398 ----
NM_015291chr143385 2419 2205 1128 13520 33086 3035 1090 23243 2820
NM_015310chr8168279 8103 8096 7815 7623 7375 6029 5795 5447 2381 2037 1773 1324 1157 438 200 36913 5526 5376 78306 6877 5369 5252 2982 1301 297 11687
NM_015314chr792433 2402 2209 937 724 596 501 196 83 --11880 1692
NM_015317chr241046 803 476 441 2852 844 22571 625 1422
NM_015326chr182428 2231 2020 1146 483 466 447 120 1416 1926 --
NM_015335chr1272654 2477 2069 1690 943 884 333 --12462 --
NM_015347chr1282999 2820 2773 1907 1174 771 318 254 --1213 --
NM_015349chr692973 2933 1003 930 923 755 641 278 194 32803 2138 1946 ----
NM_015355chr1781976 1850 1744 1347 683 593 573 330 21510 693 1504 --
NM_015361chr25971 912 744 281 124 192 4838 818 377 266 --
NM_015365chrX84193 4174 3924 3721 3501 2956 1066 762 --1230 1751
NM_015375chr164890 4753 3954 3859 911 596 13141 1603 14984
NM_015385chr1083201 2959 2912 2827 2551 2439 2343 2158 --33008 2663 2112 --
NM_015387chr261803 1636 1416 797 231 93 1818 2497 257 --
NM_015419chrX5740 721 423 287 227 ----1942
NM_015436chr433154 2695 2685 --23335 3010 1541
NM_015446chr181678 1633 1057 422 321 213 192 92 --1409 --
NM_015455chr5124037 4011 3697 1658 1486 1179 1120 1008 685 620 224 196 13317 ----
NM_015458chr8114818 4327 4220 4124 3901 3761 1015 914 646 250 83 24806 1151 ----
NM_015520chr392725 2682 2621 2556 2524 2344 2129 2102 2070 ------
NM_015532chr1592835 2287 2253 1873 1814 1779 469 226 106 11890 --12462
NM_015535chr2104178 3926 3530 3032 2691 2617 1440 1149 1046 1014 12660 1224 --
NM_015541chr331459 1070 468 ----31368 398 254
NM_015553chr674291 4188 3323 3259 3240 980 836 1496 24587 1603 11035
NM_015554chr1562929 2836 2407 1981 1824 391 --22804 2755 12862
NM_015565chr2161934 1867 1846 1605 421 210 1305 ----
NM_015569chr1101893 1658 1626 1504 1194 1123 929 580 215 71 --11117 --
NM_015571chr691781 1755 970 872 773 587 490 419 207 12147 21071 308 --
NM_015602chr1101832 1764 1659 1343 1287 1190 680 597 434 285 ----11618
NM_015640chr1135256 5170 4325 4186 4101 3410 1877 1731 1725 715 616 446 59 --35189 4133 849 --
NM_015713chr8133591 3322 2860 2853 2829 2724 2525 2442 2209 1174 1103 153 147 12413 12463 --
NM_015879chr1887554 6733 5225 2755 2302 2047 444 140 12925 --17723
NM_015886chr875542 5416 4646 4328 957 378 80 44925 4208 1675 1636 24259 1713 --
NM_015888chr172700 2577 2413 2185 941 625 419 21289 181 11324 --
NM_015891chr671311 737 261 196 183 163 55 11633 --196
NM_015892chr1052092 1657 965 863 60 12032 11778 11894
NM_015906chr1164648 4548 4057 3938 3924 3475 3443 3361 3163 1464 1369 1256 720 515 213 144 --13740 --
NM_015938chr36897 780 385 374 266 236 ------
NM_015994chr142684 261 1224 --2238 157
NM_016009chr164614 4071 3906 3895 1786 46 1173 11624 14749
NM_016040chr162745 1886 566 496 280 63 11825 11905 22176 215
NM_016072chr1262092 1914 1804 1751 660 46 --1112 12223
NM_016075chr1363154 2923 2426 2235 544 300 ----1324
NM_016076chr193239 3139 3059 1126 995 933 442 300 253 --1279 --
NM_016078chr1771142 1117 796 399 338 317 132 ----1693
NM_016081chr492246 2147 2136 1806 1745 1563 877 737 725 ------
NM_016083chr673852 3493 2924 2762 1121 405 397 --22441 199 --
NM_016087chr771471 1449 1156 423 370 224 104 21165 629 ----
NM_016138chr1671308 1301 1129 571 291 272 224 ----2481 62
NM_016195chr104695 189 176 125 1634 135 --
NM_016206chr3258474 7963 7657 7079 6716 6662 6598 6567 6203 5998 5756 5691 3499 3447 3402 3113 2710 2515 2055 2013 1865 1773 1571 661 30 16936 12703 28498 3612
NM_016217chr642965 2840 1392 799 23032 1251 165 --
NM_016224chr692229 1611 1383 748 540 470 355 321 304 ------
NM_016248chr1373948 3767 3351 2953 2846 2540 394 --11610 --
NM_016255chr683254 2987 2176 983 945 617 423 235 12322 13244 --
NM_016260chr2116774 6746 6180 6013 5954 5921 5786 4914 2783 595 578 46404 4925 2830 1227 47240 5523 5278 1570 26515 728
NM_016271chr1862303 2212 1883 1835 532 78 1436 --12160
NM_016275chr392673 2424 2280 715 521 512 469 399 32 --32541 945 419 --
NM_016277chr651267 1154 1119 627 218 1334 11434 --
NM_016322chr992721 2283 2185 1982 1109 1036 1030 942 615 ------
NM_016356chr662489 2298 1996 1974 1860 255 --22851 1160 22946 742
NM_016374chr161419 1369 622 105 61 27 11516 1594 --
NM_016374chr161419 1369 622 105 61 27 11516 1594 --
NM_016376chr1774264 3829 1639 1562 1499 1453 528 13444 1639 1805
NM_016377chr681756 1546 1489 1401 1362 718 346 77 11159 1519 11110
NM_016396chr15102934 2869 2008 1879 1007 695 485 474 272 93 1154 --12468
NM_016422chr1173070 3048 2490 2035 1161 826 680 12372 1326 12181
NM_016467chr251228 1117 503 218 110 11256 131 --
NM_016472chr1481225 1099 1084 1073 524 339 319 288 ----11260
NM_016513chr683678 3431 3370 3339 2972 2937 918 290 1707 42787 2346 1170 117 --
NM_016530chr1564114 3795 3294 835 346 294 33817 1273 266 43838 3183 2575 411 23148 2836
NM_016531chr4104119 3514 3340 3304 3290 2987 1104 1032 133 87 43832 3569 2779 265 13455 --
NM_016542chrX111700 1654 1631 1575 1543 1537 1380 1265 652 170 111 --1607 --
NM_016545chr1------2773 694
NM_016599chr471458 1394 1254 1035 543 326 313 11084 11144 --
NM_016613chr462411 1967 689 558 501 218 1796 11762 12577
NM_016620chr171260 1039 964 581 181 127 88 1301 1332 --
NM_016622chr2112136 2066 1940 1886 1342 773 692 566 557 507 61 ------
NM_016824chr1031486 179 144 ----11286
NM_016936chr1651628 1558 870 730 224 --1306 21654 648
NM_016950chr481514 1465 1431 603 547 195 140 46 1153 ----
NM_016952chr11113989 3545 3467 3094 1027 947 811 783 700 239 169 --11475 --
NM_017415chr5134500 4275 4056 3932 3812 3730 3092 3024 2973 2794 1626 1569 976 --24152 3647 --
NM_017420chr1493864 3858 3143 3051 2412 1358 675 189 107 --13069 1973
NM_017423chr492092 1796 1724 1640 447 228 192 161 48 ------
NM_017426chr43623 547 208 ----1574
NM_017437chr1492451 2263 2129 1796 1741 1584 922 349 162 ----21605 262
NM_017444chr841246 1239 1181 283 --41678 547 433 329 --
NM_017447chr21124418 4358 4236 3500 3068 3045 2879 1240 494 458 417 269 ------
NM_017594chr953242 3213 1241 1014 489 --12438 13199
NM_017610chr15102078 1638 1622 1570 1557 355 302 270 243 187 21788 830 ----
NM_017617chr991605 1507 1217 584 339 311 198 173 113 ----11528
NM_017628chr4135167 5126 4614 3934 3850 3415 3393 3292 2070 1172 653 481 458 12044 24493 1083 --
NM_017633chr663769 2669 2602 1373 1071 1058 13689 23913 3121 12390
NM_017637chr9149464 9365 9070 8370 8158 5810 3365 3148 2581 2516 1937 1691 1001 460 22693 1810 67708 2710 2342 763 603 217 --
NM_017643chr1793129 2866 2792 2153 653 559 193 56 41 --12429 --
NM_017644chr3125228 4995 4415 4342 4329 4121 3923 3610 3343 1482 1364 830 11940 24771 1974 --
NM_017650chr7135835 5599 5389 5221 5016 4297 4227 4164 2394 2279 2218 2155 641 --11812 11163
NM_017658chr14144559 4196 4155 4106 4032 3289 3237 3021 2887 2869 1848 1017 944 862 --11739 13615
NM_017719chr392252 2089 2015 1943 1839 1808 1651 681 221 ------
NM_017740chr1671851 1678 1169 486 445 142 126 --1151 --
NM_017752chrX72155 2015 1950 1799 1671 379 273 --22023 1653 --
NM_017753chr93806 780 327 --1800 1823
NM_017754chr674118 3621 3583 1714 1420 1409 995 --11740 --
NM_017762chr1551847 1618 216 124 98 1678 11645 --
NM_017769chr14133275 3262 3200 2913 2617 2557 2365 2307 2149 2065 1305 557 150 ------
NM_017813chr8165665 5125 4388 4177 4080 4060 4044 3997 3798 2322 2078 1827 1735 672 625 406 ------
NM_017824chr1072517 2353 1681 1072 847 808 646 1994 21867 822 --
NM_017831chr18134633 4285 4271 3530 3238 3027 1373 1026 922 759 295 188 141 --34352 1147 963 --
NM_017848chrX123934 3818 3566 3138 3078 2910 1660 1597 998 961 627 375 13427 --14028
NM_017919chr975337 5300 4424 4399 2329 2157 1691 ----13779
NM_017926chr142842 220 --1311 2586 293
NM_017938chrX51981 1859 1725 1510 111 --21616 398 --
NM_017944chr1153063 2911 2122 1252 776 32171 2134 1160 --1588
NM_017972chr142842 220 --1311 2586 293
NM_017994chr742416 2115 536 163 12392 12129 13011
NM_018003chr1562165 1753 659 549 478 212 --2874 602 --
NM_018018chr1281858 1632 1529 1235 1195 732 380 280 11899 ----
NM_018046chr581957 1717 1437 1381 720 619 395 268 11252 1143 11737
NM_018078chr45987 967 864 310 96 ----1253
NM_018084chr252912 1142 955 613 436 12663 1664 --
NM_018085chr1137591 7522 7165 6320 5923 5658 5331 2664 1812 1391 902 865 380 45417 3092 2205 1631 156 28009 5263
NM_018105chr841215 1113 1008 191 ----1292
NM_018120chr841515 316 304 84 ----2559 531
NM_018155chr383261 2968 1070 832 383 334 147 49 22838 1016 ----
NM_018157chr1242930 2232 2066 214 ----23232 1299
NM_018181chr1861902 1557 1262 623 401 225 11581 31837 1212 73 --
NM_018211chr151941 879 812 763 623 --1109 1430
NM_018227chr462752 2631 2297 1091 538 247 11081 13167 --
NM_018247chr683020 2723 2118 1977 1021 761 728 694 ------
NM_018254chr1112336 2270 2158 2138 2050 1755 966 770 536 333 188 --21865 955 --
NM_018290chr481274 1044 1035 1026 970 435 303 118 ----1516
NM_018293chr3102893 2886 2619 2184 2145 2118 1152 1139 1119 389 22828 332 32271 807 238 --
NM_018313chr3112690 2606 2346 1691 1647 849 471 371 220 140 24 1554 --2780 426
NM_018323chr451711 1678 1645 1577 268 --21856 152 11156
NM_018325chr961520 1340 1287 333 234 117 ----1368
NM_018339chr951811 1788 1702 1502 1140 11233 1674 --
NM_018351chr1294748 4704 4214 3962 3661 3062 1888 1493 637 ----1701
NM_018361chr8143935 3901 3464 3293 3279 2952 2478 1173 712 640 600 594 424 303 13058 1339 --
NM_018362chr11103801 3681 3586 3567 2878 2796 1287 633 321 134 23034 280 32607 443 239 --
NM_018364chr183875 3388 1338 1284 456 157 64 57 ------
NM_018373chr14156494 6127 6048 5973 5960 5887 5724 5554 4988 2114 2002 1888 1606 1503 533 24576 2121 11640 --
NM_018374chr7205049 4651 4576 4103 4043 3987 3810 3738 3284 2004 1796 1241 1124 976 877 755 675 610 447 112 --44367 3514 1167 514 1383
NM_018403chr374104 4096 4042 3959 3121 2968 549 1346 24024 3626 --
NM_018409chr463225 1127 1096 904 167 86 --2120 63 13051
NM_018429chr592932 2865 1005 568 514 338 263 208 152 ------
NM_018433chr23578 439 29 ----2191 157
NM_018439chr1822197 1682 32316 2066 660 22239 513 1990
NM_018452chr6_random63767 3452 2710 346 318 231 137 1544 --
NM_018482chr861898 1588 833 645 604 313 2527 96 22074 495 --
NM_018490chr1171702 1670 1534 1523 1356 580 313 --11637 152
NM_018557chr271718 1544 1472 1294 609 318 227 ----11188
NM_018566chr184569 4432 4082 3982 3955 3530 1056 604 --34681 3495 673 1182
NM_018638chr12145662 5411 4838 4587 4227 4200 3979 3943 3556 3526 1801 1722 1395 119 --1796 --
NM_018695chr592378 1866 1660 1623 916 887 668 86 57 --12323 --
NM_018710chr86862 480 386 380 351 233 1244 21128 959 --
NM_018841chr173717 3093 3002 2795 1555 765 406 ----22764 1065
NM_018844chr761959 1789 1751 740 491 236 11487 ----
NM_018945chr673418 3107 2499 773 729 532 418 11281 --1954
NM_018970chr782878 2021 1161 1064 728 721 451 141 --22504 2179 13095
NM_018981chr251196 1003 958 194 117 --21083 213 --
NM_018993chr2051463 507 476 455 290 --21260 498 --
NM_018999chr10174505 4473 3986 3916 3599 3039 1955 1707 1650 1408 1396 888 798 663 343 232 55 24276 3799 --13228
NM_019001chr3114690 4578 4334 4110 3675 1268 1232 1167 1080 388 53 23640 2982 23743 3383 --
NM_019004chr792339 2302 2258 2206 1997 1918 768 177 33 --2928 596 --
NM_019022chr18123061 2499 2483 2223 2035 2016 1268 808 585 519 420 264 ----22539 90
NM_019027chr472540 2417 2153 2132 1016 866 142 --12578 --
NM_019035chr421999 540 --11858 1635
NM_019050chr452124 1767 1619 875 777 ----12151
NM_019067chrX94410 3610 3604 3324 1806 1721 1586 552 412 --24638 3348 --
NM_019072chr584183 3978 3892 3656 3425 1630 1463 1294 ------
NM_019084chr1092154 2087 1690 929 903 795 778 605 425 12105 ----
NM_019091chr261163 914 726 186 173 71 --1870 1109
NM_019094chr1293432 2949 2864 2818 2378 1505 1373 1109 132 12663 1473 22521 815
NM_019555chr34593 565 322 56 --21524 1183 11352
NM_019556chrX41005 921 346 243 1595 11016 31231 1150 186
NM_019593chr20113155 2788 2564 2494 2044 1245 635 501 444 338 331 --1206 --
NM_019903chr1031486 179 144 ----11286
NM_020116chr45729 455 93 72 38 --11549 --
NM_020119chr783157 2684 2570 1598 791 658 527 89 43445 2804 1120 880 --154
NM_020122chr2116002 4915 4143 3857 3710 2198 1895 1677 1344 930 594 --24572 386 15262
NM_020130chr851276 1079 1023 885 496 1219 ----
NM_020141chr121886 802 12240 52367 2270 2121 2016 905 --
NM_020143chr291130 868 736 385 371 353 345 339 331 --2858 57 --
NM_020159chr481482 1391 1280 386 241 108 98 65 ------
NM_020177chr5123395 3115 2788 2296 2210 2089 2067 1261 692 349 325 150 12807 33043 2235 504 --
NM_020193chr1171339 1204 950 499 473 437 302 --2997 238 --
NM_020198chr1741462 1444 1103 242 --1354 1165
NM_020205chr182813 2704 2468 2245 2132 1263 957 693 --12931 --
NM_020245chr6104996 4624 4614 3777 1972 1911 1827 1594 491 423 --24472 583 15126
NM_020337chr493165 2845 2589 2547 2492 2277 2101 1969 1170 --1612 13032
NM_020390chr3124785 4331 4289 3671 3195 3103 3075 1583 1371 1193 832 146 1407 ----
NM_020432chr7102049 1825 1776 768 753 685 510 194 176 121 --12317 --
NM_020440chr153319 2727 2615 1043 517 --1321 22972 296
NM_020443chr156754 6642 6079 6007 740 15873 25036 1644 24341 1470
NM_020466chr643080 1558 518 97 1680 13316 23350 1706
NM_020525chr124416 376 370 183 1511 --1446
NM_020640chr362114 2041 1599 713 405 223 ------
NM_020647chr892272 2121 2056 2037 2011 1775 1554 1523 1471 21673 1488 ----
NM_020651chr261803 1430 529 135 104 38 1428 1360 --
NM_020654chr361645 1361 1219 235 111 101 --2520 441 --
NM_020662chr651839 1650 537 300 44 ----21772 249
NM_020673chr20157798 7652 7360 7321 6710 6411 6237 6101 5809 5751 3030 2672 2334 1881 1498 15310 47508 5910 2865 506 27725 7569
NM_020717chrX95040 4902 4615 4514 4457 4317 1925 723 396 --1502 --
NM_020718chr16136525 6517 6233 6127 6076 5997 5526 5373 4597 4468 2194 1324 857 ----35072 4676 4168
NM_020727chr2183849 3321 2878 2830 967 729 622 460 --22935 448 --
NM_020728chr782830 1282 666 373 364 319 131 91 ----12970
NM_020739chr15124183 3926 3909 3812 3701 3416 2944 1249 1134 559 267 261 --33649 2785 1353 --
NM_020748chr1742164 1693 1452 798 --1504 1731
NM_020751chr1341268 1258 318 99 ----11231
NM_020752chr10142950 2907 2624 2575 2559 2421 2060 1128 854 831 757 572 482 358 1646 ----
NM_020760chr231678 691 586 11897 11641 21730 580
NM_020766chrX74499 4061 3742 3688 1781 801 297 1857 41808 1517 893 135 --
NM_020771chr671523 1481 973 600 425 407 126 --11337 11465
NM_020772chr17108522 7436 7124 6831 6618 6436 5727 1786 1485 590 36592 2882 802 27983 2217 11938
NM_020774chr18115707 4932 4802 2432 2077 1569 1377 1046 790 609 382 35228 2105 1829 35717 5547 1076 31683 1490 935
NM_020779chr29939 871 758 715 673 634 548 408 135 11094 21023 122 --
NM_020782chr1274562 4181 3757 1822 1587 1531 530 11055 1648 --
NM_020794chr161441 1407 1292 621 385 62 ------
NM_020810chr14102935 2883 2412 2229 973 702 649 343 212 123 --13520 --
NM_020819chr651123 965 131 115 105 ------
NM_020825chr1653435 3340 873 804 688 12380 1946 13639
NM_020830chr253041 2497 2106 2064 974 ----12271
NM_020841chr12123942 3648 3483 3344 3287 2899 2675 2627 1250 1238 620 514 22826 452 33673 2939 2854 24008 856
NM_020844chr8157366 7341 7197 6966 6867 6674 6478 5043 2276 1822 1406 566 379 107 79 15440 ----
NM_020853chr1262481 2372 2278 1107 836 638 22793 24 22019 589 --
NM_020858chr1561960 1886 1831 1624 1598 670 21976 1812 --12323
NM_020870chr441929 1474 1429 297 --1808 12119
NM_020871chrX91869 985 760 627 574 531 509 439 337 ----12437
NM_020872chr371824 1485 1429 582 335 214 123 ----11323
NM_020909chr2104117 4033 3271 2855 2815 1621 1259 633 528 236 13776 24050 3943 11638
NM_020921chr1483640 3558 2955 2482 2412 2399 2380 1467 21099 616 22520 1005 11264
NM_020937chr142731 118 1148 --1141
NM_020940chr1092947 2775 2103 1046 963 863 850 533 439 --12658 --
NM_020948chr1103212 3106 2691 2299 1470 1435 1114 1012 1001 547 33685 3504 1353 1692 23462 162
NM_020951chr1981940 1900 1771 1598 1495 438 263 177 --1430 --
NM_020964chr1894782 3849 3643 1844 843 705 591 231 45 --43028 1501 1458 1305 --
NM_021007chr262102 2054 1939 758 393 114 --143 --
NM_021033chr1372721 2494 1360 1320 1068 778 519 21132 85 --1919
NM_021072chr562312 2178 2137 2041 1067 829 ----1500
NM_021083chrX63390 3101 2645 2622 2439 1314 ----23091 138
NM_021097chr272862 2684 2544 2336 2192 922 28 12415 1223 --
NM_021111chr961404 1193 1053 549 259 181 ----1424
NM_021116chr779064 8541 8283 6463 2180 910 366 11924 46825 2748 1721 1083 --
NM_021163chr783818 3662 2565 2338 703 279 240 222 --53692 3145 2511 1216 393 --
NM_021183chrX82125 2028 1877 1613 529 129 83 57 197 2758 258 --
NM_021191chr1252401 2236 1793 974 367 11832 --1195
NM_021239chr1451144 1057 1017 238 205 ----1333
NM_021252chr10121730 1460 1422 1391 1336 541 260 235 134 113 98 92 --1192 12017
NM_021255chr1464030 3522 2658 1428 1032 816 43056 3005 2619 1383 14097 1346
NM_021622chr10112359 2163 2026 1956 1563 1459 815 563 493 406 133 --21821 1579 --
NM_021629chr3114727 4595 4512 4279 1935 1682 1339 1097 1018 326 305 13781 24421 92 --
NM_021639chr12758 596 ----2680 194
NM_021645chr1342392 2301 2000 676 --22213 346 11705
NM_021647chr494768 4702 4350 3687 3127 3111 3088 992 459 1966 31864 1846 424 --
NM_021813chr645535 4181 1223 1072 24763 826 44645 4464 1790 413 --
NM_021814chr651606 1560 1525 1442 248 ----11596
NM_021911chr575566 5300 5237 4481 4452 4201 227 21670 1491 1925 --
NM_021912chr1553497 1013 963 202 74 --32715 1618 265 --
NM_021914chr1472295 2285 1829 887 413 269 202 1856 1396 --
NM_021954chr13133617 3487 3423 3417 3072 2931 2802 2775 2721 2360 1409 1113 197 23494 3245 1524 --
NM_021960chr162268 2201 813 782 750 546 --12473 21928 710
NM_021961chr11117402 7250 7223 6313 6019 5441 4720 1376 910 838 388 --42444 2058 884 380 17063
NM_021964chr3186140 5913 5835 5696 5504 5428 5278 4854 4648 4592 4527 4470 4385 2427 1518 1214 898 558 --14495 36257 424 210
NM_022048chr1576155 4022 2289 2269 1819 1338 1059 --24783 285 25335 4476
NM_022058chr281660 1601 1371 1344 1321 672 622 118 11565 21858 498 --
NM_022080chr2082566 1114 836 788 782 688 451 372 --12517 12382
NM_022114chr194771 4619 4378 3398 1687 631 581 554 418 14206 ----
NM_022133chr8101860 1837 1831 1706 1255 1213 505 497 410 132 --11176 --
NM_022166chr1636133 5476 1593 15872 22451 1634 56247 6159 5443 2292 354
NM_022351chr893859 3430 3341 3147 2620 2530 1549 819 518 1599 13164 23620 3461
NM_022456chr1286820 6625 5521 5041 2389 2210 667 118 21910 790 26863 233 11095
NM_022459chr13146307 6142 5110 5034 4942 4755 4570 3923 2137 1881 1391 1358 1294 634 ------
NM_022469chr162525 2388 2093 1069 898 813 32448 2230 855 22929 2428 --
NM_022476chr166945 930 841 816 772 346 ----1855
NM_022491chr1223182 669 13522 33150 2972 861 12757
NM_022716chr142484 1018 973 965 ----1469
NM_022763chr3113136 2831 2402 2097 1956 916 429 359 345 316 100 ----1116
NM_022781chr9102883 2454 2241 2163 2144 1301 949 333 302 129 1971 ----
NM_022782chr126322 255 145 114 91 39 ----1347
NM_022824chr571946 1889 1549 1331 1275 370 141 ------
NM_022828chr541333 1144 310 44 1188 1178 --
NM_022841chr15102803 2494 2453 2186 1928 1834 1110 656 547 227 ------
NM_022843chr1361513 1412 1353 1246 1019 108 --3376 260 140 --
NM_022845chr1671802 1748 753 607 526 163 37 11829 3592 536 491 --
NM_022893chr262783 2292 924 525 332 296 12481 12747 --
NM_022912chr263022 2584 2442 2222 2184 465 22569 343 ----
NM_022977chrX92657 2141 1990 1935 1878 1628 1037 603 181 22593 238 1357 --
NM_023000chr1451669 1501 1373 1344 1218 1323 2670 617 --
NM_023001chr1451669 1501 1373 1344 1218 1323 2670 617 --
NM_023074chr1951381 960 841 133 104 --2911 423 --
NM_023076chr1672954 2899 2848 1171 639 609 473 ----12982
NM_023929chr8102815 2677 2448 2093 1969 974 615 174 168 147 --1266 --
NM_024052chr1742456 2125 1004 910 12530 1987 13109
NM_024094chr85843 569 283 167 41 --1666 --
NM_024519chr16------2296 286
NM_024524chr3103098 3073 2959 2685 2628 2282 2037 621 404 289 22785 588 12618 --
NM_024557chr1111336 41592 1114 374 291 --11618
NM_024590chr4111767 1731 1695 1587 1293 771 556 451 415 373 319 --11905 21229 749
NM_024611chr15103883 3638 3025 2944 2505 2479 1057 487 459 266 22655 535 ----
NM_024636chr7112936 2882 2812 2749 2070 1947 1798 906 619 601 354 11068 12473 --
NM_024646chr1123969 3894 3807 3552 3228 2450 1457 1377 693 456 408 298 --33609 3074 353 --
NM_024665chr3114672 4660 4341 4074 1800 1612 1534 1435 1149 538 451 ----13210
NM_024692chr2101806 1763 1623 1505 1405 1336 1232 500 319 153 ------
NM_024721chr892554 2487 2211 2172 1801 686 659 548 105 ------
NM_024740chr11124147 3935 3689 3479 3200 3064 2707 2647 1583 1082 675 330 --41525 1064 937 220 11167
NM_024744chr2102660 2222 1908 1804 1774 1729 1026 537 498 26 12385 22029 1008 1836
NM_024745chr1681159 1110 1005 446 418 178 100 41 --1148 --
NM_024749chr131522 502 271 --11468 1790
NM_024751chr4102135 1880 1591 1453 1359 489 432 371 358 186 --21714 218 --
NM_024761chr985190 5153 5022 4219 3420 1949 1102 768 --14485 23630 3338
NM_024770chr2116017 4825 4462 4293 2134 1695 1244 1144 863 332 267 1418 --15233
NM_024817chr1555196 4088 3760 952 174 21569 940 35089 4810 1689 --
NM_024828chr981251 1160 1106 1006 980 611 391 176 ------
NM_024834chr1071446 1417 1394 361 213 152 72 11630 188 --
NM_024913chr771648 1414 1388 1366 1354 653 178 11464 1625 --
NM_024947chr3239624 9579 9570 9244 9111 8354 8324 7573 7438 7136 7052 6628 5819 3844 3815 3533 2962 2843 2824 1968 1769 1312 353 23705 246 21481 214 19074
NM_024953chr1242817 2626 2434 226 --1711 12411
NM_024989chr2227984 7776 7704 7408 7216 6811 6752 6654 6604 6567 6392 6250 6188 5941 5401 5270 2627 2449 1466 1166 802 120 32937 1967 1273 32976 465 345 27726 5305
NM_024991chr1083201 2959 2912 2827 2551 2439 2343 2158 --33008 2663 2112 --
NM_025040chr1982468 2405 2334 2247 2238 2010 1823 492 21808 1577 ----
NM_025054chr893451 3398 3381 2983 1681 1663 1602 1294 820 23663 762 22864 1539 --
NM_025057chr1431291 1139 1012 152 --11059
NM_025073chr1114335 4132 3467 1756 1744 1150 948 853 342 322 260 --54695 4583 3698 870 544 --
NM_025074chr482918 2782 2724 2614 2443 196 72 43 ------
NM_025134chr1682444 2362 2314 2127 2032 1636 615 155 --42385 1818 365 310 1391
NM_025160chr184247 4003 3742 3673 3667 3070 2700 158 11129 31090 697 507 --
NM_025179chr154922 3497 713 489 313 11203 24799 1172 13325
NM_025184chrX5766 712 676 603 105 ----1162
NM_025191chr143299 2797 2629 2618 11006 33328 3090 2980 12472
NM_025222chr363044 2971 1040 915 585 119 ----1524
NM_025235chr10132117 1933 1841 1835 1800 1763 1692 1509 551 484 440 374 283 11374 11545 --
NM_025238chr1561261 1065 1053 1009 498 162 21437 1344 --1592
NM_030621chr14133810 3710 3572 3487 3170 2853 2815 1648 1451 1382 1050 806 726 --14180 13947
NM_030627chr5114105 4091 3931 3723 3690 3253 3117 1301 1217 1055 928 23459 3094 23433 2885 23008 2860
NM_030647chr7106142 5401 5313 4736 2145 1519 1419 872 633 613 --35132 980 762 15288
NM_030648chr4105438 4819 3852 2184 1696 1333 885 798 622 594 1725 24462 1736 --
NM_030650chr2104227 3635 3280 1241 767 706 700 661 490 459 --137 --
NM_030664chr1062171 2156 2089 762 661 568 21909 44 ----
NM_030674chr12135103 4940 4900 4710 4697 4522 4460 2105 1074 1034 938 534 83 --24567 2147 2460 93
NM_030751chr1071605 1554 1390 1369 736 566 428 11840 --11273
NM_030751chr1071605 1554 1390 1369 736 566 428 11840 --11273
NM_030755chr14102729 2577 1979 1119 993 955 844 560 303 101 11960 22689 1079 --
NM_030777chr2092487 2471 2401 2333 2317 1598 1550 718 268 ------
NM_030780chr851585 1488 1192 667 299 11109 --11134
NM_030799chr572200 1430 813 613 224 171 108 ----1162
NM_030806chr189397 8441 7968 7688 5857 845 147 71 13027 12830 1320
NM_030816chr193260 3200 2953 2249 1166 1024 611 454 308 13222 12658 --
NM_030885chr352251 2033 668 542 277 11915 --2834 91
NM_030918chr1105194 4407 4183 4064 3326 2101 1425 1300 1170 437 13508 22138 1384 --
NM_030945chr572521 2366 1716 763 395 316 91 --12181 --
NM_031268chr1695242 4870 4728 4540 3906 3741 2035 1608 129 24072 3485 --13822
NM_031296chr472435 2363 2045 1966 1915 1054 921 --12272 12173
NM_031305chr41571 --11613 2405 133
NM_031314chr1452007 1541 1411 1309 553 --1733 11577
NM_031362chr232738 2397 1749 12470 --1946
NM_031365chr242874 2533 1885 1844 12606 --11082
NM_031366chr242874 2533 1885 1844 12606 --11082
NM_031371chr161419 1369 622 105 61 27 11516 1594 --
NM_031371chr161419 1369 622 105 61 27 11516 1594 --
NM_031418chr11112450 2436 2388 2320 2243 2144 1936 934 724 578 223 --42481 1953 841 506 --
NM_031427chr1495877 5310 5080 2240 2033 1743 1438 644 64 23640 1254 1789 13937
NM_031431chr1331826 167 64 ----21614 355
NM_031435chr1263311 3047 2669 2566 2238 1301 1210 --1468
NM_031438chr54780 569 182 172 11706 --11236
NM_031442chrX62287 2026 1238 1186 772 169 11970 33148 2522 2309 1815
NM_031469chr672964 2726 1466 1438 837 342 265 ----23542 2692
NM_031483chr2083577 3519 3500 3246 1259 961 685 43 --32745 2347 990 --
NM_031844chr183279 2969 1530 1376 1108 1043 933 179 ----11343
NM_031845chr2103692 3658 3363 3207 2304 445 260 217 195 91 1772 --11123
NM_031847chr2103692 3658 3363 3207 2304 445 260 217 195 91 1772 --11123
NM_032012chr9155277 4773 4386 4274 3570 1096 1085 1075 1028 1015 1008 659 590 331 266 34954 4807 3296 65017 4885 4658 4572 3509 3269 --
NM_032042chr562245 2155 2092 2014 721 150 --12006 --
NM_032047chr392345 2318 1727 1622 948 872 681 618 224 --11938 11579
NM_032102chr1192951 2625 2553 2492 1989 968 914 636 153 1771 ----
NM_032105chr1128111 5756 5596 5416 3201 3006 2676 2400 1942 1072 837 520 22850 2502 17086 --
NM_032128chr42953 751 2946 223 --11005
NM_032144chr251773 1472 1215 56 49 11706 11451 1371
NM_032147chr128895 811 319 242 143 121 112 36 ------
NM_032154chr103972 149 141 ----1797
NM_032160chr18104165 4152 4075 3881 3748 3233 1476 1281 133 26 ----11045
NM_032186chr171260 1039 964 581 181 127 88 1301 1332 --
NM_032189chr1375089 4616 4303 2012 1917 1891 706 --11768 24594 3802
NM_032199chr1073720 3564 3185 2733 1162 790 584 177 1675 --
NM_032208chr263334 2960 2918 2612 2585 2519 --2574 222 --
NM_032217chr451315 1274 1246 1001 398 ----1129
NM_032228chr1183282 3080 2787 2727 2651 2421 1120 898 23328 1214 23059 985 --
NM_032291chr151490 1465 1420 708 602 1372 11598 --
NM_032303chr961759 1480 1400 468 429 226 ------
NM_032321chr283048 2810 2676 2427 2336 735 593 376 --21036 930 1653
NM_032373chr10114908 4826 4478 4110 3811 2169 1951 1899 1463 1168 368 --21322 1215 15738
NM_032435chr162385 2205 2008 1675 463 325 1908 22418 1561 --
NM_032439chr1051212 1143 588 500 423 11344 --11446
NM_032440chr1052189 945 597 219 121 --21053 585 2916 114
NM_032446chr5113856 3360 3171 3133 3035 2933 2916 1088 602 372 313 2677 288 13046 13876
NM_032456chr46665 636 574 219 146 95 ----1437
NM_032457chr473861 3134 3107 2688 2675 642 32 --1970 --
NM_032499chr1541739 1613 1336 1223 --1610 21277 264
NM_032505chr3132774 2520 2444 2321 2027 1895 1861 1055 939 475 253 136 105 --11854 --
NM_032510chr1882497 1730 1694 1647 707 427 302 247 ----1168
NM_032521chr2083226 3115 3095 3074 2574 2526 2420 1135 --12948 --
NM_032558chr941359 1313 1156 204 --21496 1233 11150
NM_032582chr17----21621 1188 11696
NM_032682chr373574 3155 2941 2849 1317 1238 444 23217 2878 32914 2860 1054 --
NM_032778chr372525 2075 731 667 405 137 34 21138 544 13074 --
NM_032826chr743656 3496 3398 965 ----23487 1942
NM_032828chr19124834 4437 4269 3952 3944 3425 3386 3253 3120 1911 1195 405 ------
NM_032859chr13193936 3923 3865 3714 3659 3602 3140 3100 2943 2933 2826 2437 1317 1163 938 917 491 159 137 ------
NM_032873chr11154402 4336 4123 4073 3837 3697 3213 3026 1790 1716 1603 1447 1439 1014 978 14518 1941 --
NM_032961chr481115 976 539 444 398 312 151 39 --21299 260 --
NM_032968chrX84016 3610 3568 3553 3135 1428 1242 226 --13633 --
NM_032969chrX84016 3610 3568 3553 3135 1428 1242 226 --13633 --
NM_032973chrY84008 3602 3564 3549 3130 1428 1242 226 --13625 --
NM_033020chr1164648 4548 4057 3938 3924 3475 3443 3361 3163 1464 1369 1256 720 515 213 144 --13740 --
NM_033081chr2041407 1064 580 166 --21162 377 11084
NM_033121chr1271807 1720 1627 625 387 272 208 1370 1505 --
NM_033132chr1382150 2126 1980 1939 1801 837 681 253 ----11833
NM_033143chr494179 3180 2943 1823 1674 1524 1182 966 893 23829 3789 23782 865 1653
NM_033181chr673852 3493 2924 2762 1121 405 397 --22441 199 --
NM_033224chr7178040 7536 7106 6989 6867 6361 5751 5294 2816 2517 2448 2323 1395 1016 814 665 523 26196 2956 18055 12274
NM_033225chr873008 2702 889 718 707 655 603 --11119 11021
NM_033285chr8184468 4452 4318 3845 3772 3471 3330 3039 2902 2800 1794 1512 918 677 464 251 159 91 --24113 2753 24307 2932
NM_033331chr933579 3515 424 22367 1121 13405 13310
NM_033360chr12164666 4316 4254 3971 3766 3760 3488 2852 1777 1766 1751 1436 1085 912 894 869 --24573 3680 --
NM_033389chr1753881 3659 3329 587 95 44874 4808 1763 1701 ----
NM_033394chr261308 1238 1138 1038 465 438 --31511 641 432 11367
NM_033425chr11113541 3406 3162 3045 3036 2887 1408 1231 942 403 373 --13359 --
NM_033429chr1562669 2282 1187 721 573 554 2915 774 --12543
NM_033430chr473926 3819 3813 3529 3161 2672 132 22813 912 1454 134
NM_033437chr473926 3819 3813 3529 3161 2672 132 22813 912 1454 134
NM_033480chr662979 2967 2419 807 453 32 22485 2170 --12556
NM_033481chr662979 2967 2419 807 453 32 22485 2170 --12556
NM_033505chr286557 5791 5232 1901 1485 1408 276 194 16452 ----
NM_033644chr562142 2053 1717 728 372 362 ----1320
NM_033645chr562142 2053 1717 728 372 362 ----1320
NM_033656chr21145918 4993 4544 3834 3700 3654 1977 1935 1344 1316 1175 663 163 107 25523 4070 --1427
NM_052832chr883020 2981 2950 2349 806 501 372 70 --32611 2009 1943 --
NM_052879chr1273909 3532 3486 2828 2529 2490 1394 --23843 1206 33435 3060 287
NM_052885chr12104912 4497 4223 4133 3867 3759 1192 696 387 324 --23807 3774 21858 209
NM_052905chr251915 1851 1472 1370 250 --1659 11559
NM_052907chr1283479 3016 2816 1535 954 579 489 479 33949 1671 1304 --13833
NM_052911chr184958 802 384 258 ----1210
NM_052917chr252262 2184 1237 887 398 ----1567
NM_052937chr882126 725 712 389 380 332 181 109 1299 42668 2366 2292 582 12414
NM_053016chr9207501 6576 6075 5978 5762 5657 5633 5363 5256 5238 5068 4907 2652 2121 1836 855 721 565 442 119 25858 1634 57627 6042 5170 1495 935 15422
NM_053023chr1163012 2517 2488 2479 2174 805 11213 32449 2256 1154 12510
NM_053024chr371221 1088 1014 532 515 300 236 --11207 11557
NM_053056chr11112757 2066 1214 1120 873 674 591 408 324 299 244 12123 12448 --
NM_053064chr1472864 2613 2329 2300 2194 2046 1926 --12947 --
NM_054016chr151934 1768 1419 706 300 21910 1535 21856 1734 --
NM_054016chr151934 1768 1419 706 300 21910 1535 21856 1734 --
NM_054016chr151934 1768 1419 706 300 21910 1535 21856 1734 --
NM_057168chr771471 1449 1156 423 370 224 104 21165 629 ----
NM_057175chr462554 468 313 291 183 136 ----21660 517
NM_058241chr2102329 1648 1576 858 812 460 413 394 250 162 --11868 12152
NM_058241chr2102329 1648 1576 858 812 460 413 394 250 162 --11868 12152
NM_078476chr651823 1794 1777 1758 1745 ------
NM_080759chr1342548 1959 635 244 2413 32 146 --
NM_080760chr1342548 1959 635 244 2413 32 146 --
NM_080867chr1494690 4132 3833 3410 1970 1823 1561 297 272 ----23514 920
NM_080872chr883129 3099 2944 1279 706 632 151 112 23826 2726 13091 12694
NM_080874chr441800 1535 206 196 21626 627 --21570 1290
NM_080927chr3132727 2720 2550 2347 2274 2215 2188 1231 1073 1027 861 702 517 12514 12302 --
NM_130391chr973361 3002 2945 1399 915 771 713 ----23495 253
NM_130392chr973361 3002 2945 1399 915 771 713 ----23495 253
NM_130393chr973361 3002 2945 1399 915 771 713 ----23495 253
NM_130435chr1072836 2801 2781 2258 1080 552 526 --12570 --
NM_130436chr2172602 2470 2432 2382 2096 2023 373 1707 12205 2907 42
NM_130438chr2173179 3047 3009 2959 2673 2600 950 11284 12782 1619
NM_130798chr1571063 1009 576 543 506 500 140 ------
NM_130809chr552529 1015 665 384 279 --2254 196 --
NM_133334chr4116284 5330 4543 4415 4145 2344 1484 1468 1235 774 309 --25507 594 15370
NM_133370chr473508 1383 1300 1001 811 289 70 --11337 --
NM_133372chr5102792 2600 2522 2318 2075 1004 824 789 776 451 12607 ----
NM_133433chr54741 668 246 226 --2679 29 --
NM_133473chr1961818 1704 655 412 328 258 11293 --11244
NM_133496chr1144203 4129 3884 3770 3605 3583 3427 3039 1719 1460 1345 1221 946 845 ----23659 3524
NM_133638chr541008 211 184 50 ----21219 539
NM_133646chr2135596 5285 5245 5182 5098 4834 4490 4220 4006 3432 967 449 131 2244 176 15475 --
NM_138270chrX93429 3221 2844 2742 2164 955 632 387 372 ------
NM_138348chr5136637 6110 5282 5067 4896 4870 4406 4271 2526 1960 1819 1444 655 --1914 --
NM_138423chr1592220 2095 1972 1948 1671 893 547 395 245 --22194 1817 --
NM_138444chr1364771 3360 3216 1999 1154 493 2717 64 24434 3889 --
NM_138468chr2104668 3939 2405 2030 1577 1308 967 837 382 47 15961 35728 4654 194 --
NM_138554chr972216 1963 1846 1013 657 634 357 1511 ----
NM_138621chr294192 4097 4071 3355 1074 1008 679 669 295 22992 493 ----
NM_138633chr681756 1546 1489 1401 1362 718 346 77 11159 1519 11110
NM_138638chr1472295 2285 1829 887 413 269 202 1856 1396 --
NM_138694chr653561 782 635 618 544 43664 1434 434 171 1200 23044 381
NM_138713chr16208170 7267 7194 6843 6604 5245 5051 5008 3288 3137 3074 2971 2533 2458 2040 1929 1660 850 207 170 27782 5223 21251 1201 --
NM_138714chr16208170 7267 7194 6843 6604 5245 5051 5008 3288 3137 3074 2971 2533 2458 2040 1929 1660 850 207 170 27782 5223 21251 1201 --
NM_138731chr14113589 3525 3319 3278 3233 3094 2809 1062 1005 265 243 1312 23500 1258 14099
NM_138773chr51917 ----2810 316
NM_138782chr5152392 2116 1918 1882 1769 1738 1599 1530 1511 894 883 865 740 592 314 --1688 --
NM_138811chr741074 401 320 127 1788 1242 --
NM_138959chr1146809 6793 6571 6311 6016 4986 4584 2567 2523 2321 2251 2186 1791 261 26199 5927 56027 2721 2357 2339 575 12558
NM_139207chr1242126 1611 748 71 1427 1809 22111 1432
NM_139279chr253543 3428 2894 864 320 --23275 3037 --
NM_144571chr4177038 6678 6219 6067 4641 4470 4348 2454 1418 905 690 599 488 458 370 248 206 ----24621 745
NM_144599chr1595200 4867 4812 4267 4200 2113 1530 1024 453 ----25436 5209
NM_144632chr262351 2050 2040 1999 1938 1678 --22069 1967 --
NM_144664chr1172445 2235 2218 1906 474 369 99 --21848 709 --
NM_144721chr462665 1781 834 510 132 53 12749 --1216
NM_144726chr561119 1029 988 914 220 193 ----1244
NM_144775chr17104947 4698 4602 4570 4465 3593 3306 1940 1353 1002 --14295 --
NM_144778chr1382681 2412 2325 2251 1098 783 758 706 1913 --12340
NM_144949chr232269 1798 552 11046 --22309 996
NM_144963chr8112713 2414 2222 2207 716 680 602 370 332 296 248 --2270 64 --
NM_145055chr1853691 3137 2694 688 630 ----11102
NM_145207chr4125114 5108 4437 4365 4056 3343 2074 1993 1407 969 866 353 25183 147 --15135
NM_145251chr144581 399 381 244 1501 21407 472 --
NM_145259chr276902 6209 5764 2821 2119 651 302 12156 16826 25773 860
NM_145263chr462384 1912 1895 1544 855 572 ----2400 204
NM_145284chrX52302 2071 1711 863 673 --12233 1105
NM_145307chr10114438 4083 3762 3575 3565 3468 3240 1103 715 148 106 34466 440 68 1529 34391 1429 187
NM_145686chr253135 2232 1315 1004 563 1918 23358 2877 --
NM_145687chr253135 2232 1315 1004 563 1918 23358 2877 --
NM_145690chr851799 1422 244 92 41 ----11824
NM_145698chr10102087 2049 1819 1353 859 848 635 466 380 160 --22031 647 --
NM_145735chr1372853 2812 2593 2517 2249 740 346 --21012 262 --
NM_145753chr351402 1198 1154 1092 258 1326 31485 1355 653 --
NM_145759chr181719 1378 592 578 435 231 223 165 ------
NM_145808chr7102904 2895 2565 2459 2289 1980 1253 1150 766 686 12031 12537 --
NM_147128chr731175 1093 1041 11216 21084 22 --
NM_147147chr6114212 4178 4111 3727 3671 3356 3144 3091 2866 1046 839 --24124 4049 13742
NM_148571chr1731688 1311 184 2521 390 1497 11287
NM_148894chr461247 1224 1155 1142 939 160 ----1433
NM_148921chr1732092 680 603 --2873 148 1643
NM_148955chr15146513 6450 6438 5867 5786 4652 2474 2453 2315 1919 1853 1798 1532 47 16415 36339 6254 5745 11788
NM_148957chr1392637 2623 2256 2218 1909 1878 874 792 378 1859 12583 --
NM_152265chr171590 1559 1422 1345 397 174 167 ----171
NM_152275chr262272 2147 2004 679 363 85 11997 --1719
NM_152330chr1462540 2236 982 756 122 72 22648 1887 12331 --
NM_152352chr1842654 2648 2642 308 --22548 1990 13047
NM_152384chr241977 515 105 90 1653 197 --
NM_152388chr22283 70 11074 --24006 1533
NM_152409chr583504 3430 3306 3065 1116 828 736 513 --12384 1717
NM_152424chrX73491 3484 3475 1570 1396 1275 832 1942 13556 --
NM_152519chr242222 1760 1706 382 12179 11781 22192 678
NM_152529chr294325 3670 3578 3277 2980 1435 1083 679 174 --12993 --
NM_152556chr782261 2144 2104 2078 1995 855 782 100 1492 --22033 125
NM_152594chr15112347 2238 2066 1905 1703 1697 1589 844 709 509 201 1876 --1220
NM_152608chr1102277 2247 2087 1657 997 829 751 650 337 48 --133 --
NM_152622chr5113192 2820 2735 2589 2302 1396 1354 1023 946 615 67 1901 1460 --
NM_152624chr5186860 6837 6538 6380 6250 6122 5473 4555 2715 2650 2046 1976 879 461 357 193 166 138 --47199 5353 1737 1323 --
NM_152626chr75805 764 258 216 133 1847 21123 976 --
NM_152629chr9114138 4073 3354 2622 2503 1118 731 641 618 591 183 24023 1346 42961 2647 778 171 --
NM_152636chr1182821 2748 1960 1032 963 867 702 54 11116 12965 --
NM_152641chr1252552 2492 1093 419 413 --22902 2624 12501
NM_152678chr382505 2349 2252 2150 1764 995 547 127 1323 12687 --
NM_152682chr461607 1308 589 513 256 99 21560 1292 ----
NM_152699chr343789 3734 2956 2370 --53398 3316 3105 2549 990 189
NM_152716chr1171629 1342 1245 1211 1124 270 233 --21638 139 --
NM_152734chr685499 4019 3985 3950 3746 3581 3325 123 11331 11770 1935
NM_152754chr783769 3335 3074 2998 2823 2460 1082 74 --33638 3485 246 13175
NM_152756chr5134177 4140 3681 3535 3237 3123 3103 1082 1063 937 790 681 561 --23919 1217 23795 775
NM_152758chr892918 2839 2728 2514 1981 1937 1110 811 29 --1972 --
NM_152774chr782468 1076 1044 771 603 595 92 86 11881 22254 1729 --
NM_152787chrX53602 3214 2762 1117 832 --33340 1009 952 --
NM_152793chr784477 3603 3583 2045 1908 1296 759 83 13657 23449 1724 14334
NM_152826chr15146513 6450 6438 5867 5786 4652 2474 2453 2315 1919 1853 1798 1532 47 16415 36339 6254 5745 11788
NM_152836chr8101860 1837 1831 1706 1255 1213 505 497 410 132 --11176 --
NM_152837chr8101860 1837 1831 1706 1255 1213 505 497 410 132 --11176 --
NM_152838chr2063522 2908 2324 439 312 195 --122 1156
NM_152991chr116683 674 483 249 202 76 --183 --
NM_152999chr7124379 3972 3821 1700 1512 1065 1018 829 333 297 269 242 23429 688 24277 3244 14286
NM_153013chr572513 1925 1793 1599 749 232 133 1601 1418 1980
NM_153020chr681700 1540 1522 1457 1076 440 348 150 --1321 --
NM_153182chr372525 2075 731 667 405 137 34 21138 544 13074 --
NM_153184chr351621 1332 1233 463 313 1681 11249 --
NM_153188chr5165642 5276 4924 4568 4516 4305 3492 2192 2063 1988 1968 1935 1914 990 771 515 11942 32232 1091 98 --
NM_153207chr12123850 3596 3433 3413 2579 1535 1121 903 675 615 365 301 24025 1015 23239 3182 1558
NM_153223chr571348 627 479 250 208 202 112 ----124
NM_153262chr193167 2824 2783 1266 1243 1044 888 864 397 ------
NM_153321chr1791090 1075 892 807 754 289 206 194 181 ------
NM_153322chr1791090 1075 892 807 754 289 206 194 181 ------
NM_153332chr8123216 2981 2370 2266 2179 1187 1180 952 585 480 255 124 ------
NM_153346chrX91873 1700 1527 1382 1321 643 540 519 108 ------
NM_153365chr472549 2451 2247 2240 1964 848 766 12204 --11898
NM_153369chr641394 1306 644 123 --11625 11368
NM_153371chr1351753 1588 810 738 225 ----12166
NM_153605chr351405 1142 558 531 444 ----11263
NM_153607chr592840 2680 2627 2545 2386 2341 964 107 78 ------
NM_153616chr1561960 1886 1831 1624 1598 670 21976 1812 --12323
NM_153617chr1561960 1886 1831 1624 1598 670 21976 1812 --12323
NM_153618chr1561960 1886 1831 1624 1598 670 21976 1812 --12323
NM_153619chr1563198 3124 3069 2862 2836 54 23214 3050 --13561
NM_153634chr1271402 1305 1150 1140 1125 416 383 ------
NM_153686chr472479 706 325 174 165 152 111 ------
NM_153836chr242081 1971 1682 31 31830 839 534 11861 1189
NM_170606chr741900 1884 1415 1342 11644 --177
NM_170672chr24616 389 318 291 ----11570
NM_170751chr641362 1271 929 227 ----11435
NM_170752chr641362 1271 929 227 ----11435
NM_172070chr282195 2058 2045 1746 1662 1530 868 390 ------
NM_172071chr1167484 7273 6684 6051 5662 5099 5022 4822 4681 2932 2668 2055 1758 1644 1424 748 17379 ----
NM_172159chr332236 907 560 ----11530
NM_172160chr332236 907 560 ----11530
NM_172193chr1481293 1194 1181 975 351 183 75 61 ----1848
NM_173082chr661207 1138 524 490 252 98 --21168 268 11052
NM_173083chr171255 1132 885 867 817 238 62 ------
NM_173167chr1752689 2592 889 806 333 12522 --12378
NM_173198chr982727 2508 2255 1965 924 367 250 213 1187 --11054
NM_173200chr982727 2508 2255 1965 924 367 250 213 1187 --11054
NM_173214chr16208170 7267 7194 6843 6604 5245 5051 5008 3288 3137 3074 2971 2533 2458 2040 1929 1660 850 207 170 27782 5223 21251 1201 --
NM_173468chr4126074 5731 5321 4912 4524 4423 4376 3872 3740 1808 1225 614 --25069 1289 --
NM_173469chr1551065 370 170 162 90 11517 1390 1984
NM_173473chr1052693 2637 2278 1977 1033 22662 553 1857 1437
NM_173496chr1062920 2840 2326 2273 899 59 11949 1152 --
NM_173511chr263749 3655 3324 3029 1539 429 --33481 2640 2582 --
NM_173531chr19143800 3591 3448 2912 2891 2686 2566 2534 1342 1303 1151 1077 671 384 12360 32828 962 835 22632 774
NM_173536chr4125004 4732 4271 3733 3215 1624 1350 1096 877 764 668 183 ----11790
NM_173552chr392468 2323 2229 2134 1968 1864 1784 1550 350 12078 1420 --
NM_173576chr1062050 1742 1695 1428 841 248 11983 22076 1620 --
NM_173582chr11176257 5828 5724 4914 4905 4346 4337 3878 2238 2172 1975 1455 1218 562 503 314 252 35600 1673 947 --1779
NM_173607chr1472112 1794 1740 1390 555 435 99 1673 ----
NM_173642chr1107555 7508 7040 6727 3201 2667 2002 261 176 93 --26068 1414 1677
NM_173644chr2051987 1857 1825 691 683 ------
NM_173654chr392382 2215 2041 1607 876 716 583 417 213 11685 21718 230 11778
NM_173694chrX62499 2356 1770 903 657 62 12572 ----
NM_173698chrX82058 1742 1595 1550 1330 1322 762 465 --21782 650 --
NM_173808chr1114394 4069 3177 3099 2971 1632 1136 429 354 338 325 --31684 1573 1510 --
NM_173826chr381503 1458 1426 487 374 262 171 93 --1644 --
NM_173827chr472304 1253 947 812 556 547 32 12726 12839 --
NM_173829chr5136177 5414 5382 5060 4994 4930 3801 1609 1178 938 813 786 91 14348 14746 15674
NM_173830chr67923 912 865 699 673 621 132 1588 --1257
NM_173851chr853825 2786 1451 644 223 23767 2741 --13576
NM_175056chr382157 2090 2023 1573 1475 775 393 266 --12081 11901
NM_175607chr351174 1151 464 252 31 ----1300
NM_175612chr351174 1151 464 252 31 ----1300
NM_175623chr1286820 6625 5521 5041 2389 2210 667 118 21910 790 26863 233 11095
NM_175624chr1286915 6720 5616 5136 2484 2305 762 213 22005 885 26958 328 11190
NM_175625chr1286915 6720 5616 5136 2484 2305 762 213 22005 885 26958 328 11190
NM_175736chr1257601 6840 6727 5912 5643 15195 25159 377 27555 5110
NM_175854chr1392318 2219 2166 2143 1938 1853 957 769 367 32807 465 422 21082 1042 --
NM_175861chr12135987 5800 5731 5193 5004 4760 4337 4253 4127 4099 1155 612 243 11749 35617 3733 1526 1254
NM_175876chr132214 64 58 1820 11995 11833
NM_175921chr5114180 4048 3885 3834 3591 3030 2928 2694 1726 603 283 23457 3010 23900 3757 --
NM_176787chr1851594 1188 1142 1027 1000 --2512 191 --
NM_176816chr581535 1493 538 525 504 427 292 39 11678 ----
NM_177438chr14133810 3710 3572 3487 3170 2853 2815 1648 1451 1382 1050 806 726 --14180 13947
NM_177538chr2208660 8634 7970 7705 7688 7655 7566 7246 6911 6729 6374 5927 5696 5671 2190 2069 1735 1019 146 81 48570 8147 8122 3535 28273 1133 1333
NM_177966chr371561 1388 1310 639 599 464 164 11401 --11376
NM_177974chr1592220 2095 1972 1948 1671 893 547 395 245 --22194 1817 --
NM_177985chr2102229 2207 2121 2110 2053 1728 1678 1672 595 92 ------
NM_178011chr1072952 2190 2109 2092 1293 728 394 --13077 --
NM_178140chr522029 1861 ----21014 742
NM_178151chrX247862 7432 7181 7022 6662 6600 6522 6506 6014 5872 5856 5556 5194 5051 4790 3124 2978 1609 1413 1260 1006 955 681 361 --1931 --
NM_178152chrX247862 7432 7181 7022 6662 6600 6522 6506 6014 5872 5856 5556 5194 5051 4790 3124 2978 1609 1413 1260 1006 955 681 361 --1931 --
NM_178153chrX247862 7432 7181 7022 6662 6600 6522 6506 6014 5872 5856 5556 5194 5051 4790 3124 2978 1609 1413 1260 1006 955 681 361 --1931 --
NM_178313chr24687 615 288 131 --1241 1383
NM_178426chr151827 1733 1721 1703 808 --11966 1282
NM_178427chr151727 1633 1621 1603 708 --11866 1182
NM_178505chr10123616 3610 3206 2914 2459 2234 1466 1435 1139 289 225 55 22997 623 23452 759 11449
NM_178509chr17114131 4024 3716 3498 3095 3060 1258 533 419 347 258 --11190 --
NM_178585chr473101 2792 1212 1165 940 405 95 33113 2048 873 --21314 329
NM_178812chr871576 1039 569 474 294 96 33 ------
NM_178815chr1072599 2530 2057 906 863 614 97 --12639 --
NM_180991chr5122867 2508 2476 2439 2352 2338 2300 1001 370 125 108 27 --11928 12491
NM_181351chr1163002 864 728 679 623 469 --3882 650 604 1204
NM_181358chr184200 4005 3790 1553 1252 1088 620 486 1564 11664 --
NM_181443chr2052783 2353 1905 980 525 11846 ----
NM_181481chr18145999 5638 5448 5151 4482 2372 2028 1657 1590 789 780 625 609 376 15528 --24551 347
NM_181482chr18145999 5638 5448 5151 4482 2372 2028 1657 1590 789 780 625 609 376 15528 --24551 347
NM_181483chr18145999 5638 5448 5151 4482 2372 2028 1657 1590 789 780 625 609 376 15528 --24551 347
NM_181504chr564000 3945 2991 2686 2572 2534 14135 11017 11352
NM_181521chr1696237 5994 5752 5384 2918 2195 1801 1311 1015 1749 11386 --
NM_181523chr564000 3945 2991 2686 2572 2534 14135 11017 11352
NM_181524chr564000 3945 2991 2686 2572 2534 14135 11017 11352
NM_181659chr2063313 2767 2472 2437 2380 418 12975 --33092 1049 644
NM_181659chr2063313 2767 2472 2437 2380 418 12975 --33092 1049 644
NM_181672chrX71828 1818 1486 1406 1263 543 368 21733 108 1535 --
NM_181673chrX71828 1818 1486 1406 1263 543 368 21733 108 1535 --
NM_181705chr5135626 5220 4828 4483 4034 3661 2060 1655 1350 1168 1022 615 338 1121 25593 5351 --
NM_181706chr1182217 1974 1515 896 199 193 186 109 --1353 --
NM_181723chr851968 1800 1473 570 465 ----12189
NM_181782chr672153 2096 1822 1779 818 632 622 1152 --2930 279
NM_181783chr1271967 1538 1356 1309 470 245 226 1259 ----
NM_181836chr592314 2188 1711 1697 796 663 579 332 263 31991 1847 708 12551 11651
NM_181861chr1262728 2093 947 842 466 86 --12146 12643
NM_181868chr1262728 2093 947 842 466 86 --12146 12643
NM_181869chr1272813 2178 1032 927 551 171 63 --12231 22728 74
NM_182314chrX61628 1408 1251 568 395 70 --11752 1679
NM_182485chr463708 3493 2802 1349 1167 263 1675 --23025 2618
NM_182487chr994419 4089 3989 2999 2853 2814 1189 988 52 1186 --23313 3047
NM_182503chr694739 4170 1266 1232 1028 915 610 547 93 --21509 435 --
NM_182515chr19155639 5499 5470 5364 5353 5300 4764 4384 2665 2236 1852 1246 1013 233 62 11579 21531 1097 11345
NM_182522chr331151 537 340 11271 31240 1218 1015 2465 86
NM_182551chr283153 3121 3111 3065 2282 892 136 82 1975 12617 --
NM_182646chr463708 3493 2802 1349 1167 263 1675 --23025 2618
NM_182648chr142587 578 ----2711 238
NM_182715chr761272 1185 1078 482 291 142 ----1851
NM_182734chr20102914 2831 2554 2512 2316 2250 1006 776 758 523 22400 2330 12578 --
NM_182757chr6113412 3140 3093 2851 2553 1376 1232 1097 960 756 674 12305 ----
NM_182758chr1573929 3537 3398 2785 2728 898 729 13443 13913 1922
NM_182762chr7156209 5767 5489 5262 5063 4567 4485 4472 3905 3832 3797 2291 2198 1136 726 --15604 --
NM_182763chr162257 2190 802 771 739 535 --12462 21917 699
NM_182765chr1072298 2143 900 660 620 251 30 --22050 484 --
NM_182830chr1492305 2298 1686 1678 1410 899 798 667 267 --11805 --
NM_182848chr1321062 250 --21227 222 11446
NM_182896chr371856 1687 434 295 269 151 110 ----1356
NM_182898chr7156520 5756 5459 4949 4830 4765 4666 4058 2033 1928 1910 1596 1024 263 159 15731 25740 133 14822
NM_182899chr7156520 5756 5459 4949 4830 4765 4666 4058 2033 1928 1910 1596 1024 263 159 15731 25740 133 14822
NM_182907chr6112389 2377 2208 1940 1553 1524 1512 888 414 300 243 ------
NM_182972chr142598 2041 1895 933 --12812 12529
NM_183004chr1473836 3110 2689 995 972 269 119 --1218 --
NM_183050chr692227 1649 949 818 717 509 478 343 192 11747 1179 12171
NM_183078chr652621 1472 1452 1076 758 1601 33098 2784 2692 11425
NM_183227chr651267 1154 1119 627 218 1334 11434 --
NM_183416chr16737 626 582 323 127 103 --11595 --
NM_194071chr775070 4982 4852 4342 4195 3872 46 --24395 1247 14708
NM_194278chr1474055 3694 2886 2743 670 565 303 23338 2955 23753 3674 --
NM_194282chr4103031 2396 2372 2286 2259 2162 1947 1214 321 304 ----21247 934
NM_194283chr5104206 4198 4049 3910 3783 3629 3233 1281 762 687 11478 ----
NM_194285chr1193413 3392 3306 2925 2291 835 781 521 96 --1138 --
NM_194291chr852928 2536 959 488 260 --12832 --
NM_194292chr141527 1188 697 156 --11661 1241
NM_194314chr1155528 5400 4532 4118 4066 3879 3787 3514 2212 2039 1420 1188 1069 505 266 --45372 4153 3435 1593 15575
NM_194328chr9102883 2454 2241 2163 2144 1301 949 333 302 129 1971 ----
NM_194329chr9102883 2454 2241 2163 2144 1301 949 333 302 129 1971 ----
NM_194330chr9102883 2454 2241 2163 2144 1301 949 333 302 129 1971 ----
NM_194332chr9102883 2454 2241 2163 2144 1301 949 333 302 129 1971 ----
NM_194356chr1262308 2070 941 867 761 622 --22142 2115 12261
NM_194434chr18175805 5635 5401 5364 5066 4811 4084 3548 2265 2188 2118 1562 1198 1151 722 459 154 --14053 11454
NM_194454chr731379 578 483 1536 --11368
NM_194455chr731379 578 483 1536 --11368
NM_194456chr731379 578 483 1536 --11368
NM_198128chr1862303 2212 1883 1835 532 78 1436 --12160
NM_198158chr372151 1122 1018 704 529 463 189 --11984 --
NM_198159chr372151 1122 1018 704 529 463 189 --11984 --
NM_198177chr372151 1122 1018 704 529 463 189 --11984 --
NM_198178chr372151 1122 1018 704 529 463 189 --11984 --
NM_198181chr1552922 2420 905 329 234 1476 52079 205 175 147 117 --
NM_198225chr1061830 1327 729 615 353 295 11569 1407 --
NM_198268chr184200 4005 3790 1553 1252 1088 620 486 1564 11664 --
NM_198269chr184200 4005 3790 1553 1252 1088 620 486 1564 11664 --
NM_198270chrX113354 3198 2967 2935 2686 2133 1262 991 758 403 244 --12394 1544
NM_198273chr573064 2927 2860 2380 2280 1087 545 12040 12679 --
NM_198279chrX81105 824 437 394 329 224 183 158 1839 ----
NM_198281chr483335 3219 1243 722 623 597 449 236 --138 --
NM_198336chr751843 1773 1194 1187 501 1422 11419 11710
NM_198400chr1562770 1000 916 717 196 45 --1950 1969
NM_198468chr6164576 4484 4407 4246 3972 3803 3364 3167 2975 1446 1358 638 506 389 211 132 --23518 3197 --
NM_198503chr1102049 2005 1925 1919 1734 1639 1579 954 429 269 ------
NM_198549chr1123272 2776 2593 2547 2253 1317 1309 1302 607 346 210 157 1584 22365 2265 1254
NM_198581chr2256943 6723 6683 6219 6106 6076 5739 5636 5603 5111 4977 2386 2166 2123 1991 1907 1879 1198 1183 789 693 341 183 170 145 16547 16030 16803
NM_198793chr373845 3740 3626 3292 3056 2722 816 --33813 3785 2545 --
NM_198859chr384487 4181 4140 3589 2046 402 198 148 --11499 13917
NM_198889chr451315 1274 1246 1001 398 ----1129
NM_198896chr1151917 1616 589 206 199 11850 11594 1522
NM_198900chr1257601 6840 6727 5912 5643 15195 25159 377 27555 5110
NM_198904chr532134 1808 141 --1312 11693
NM_198968chr1393993 3828 3398 1365 1007 999 766 418 343 11187 --14026
NM_198990chr743249 3107 1058 1020 12293 --1911
NM_199003chr841499 1397 1292 475 ----1576
NM_199040chr1293432 2949 2864 2818 2378 1505 1373 1109 132 12663 1473 22521 815
NM_199072chr7123164 3089 2843 2717 2463 2379 2267 2233 2104 640 208 106 --22711 2244 --
NM_199132chr1951887 1877 1732 282 131 11786 --22145 1921
NM_199168chr1061399 1331 1239 1211 1196 206 --21279 186 --
NM_199188chr1273909 3532 3486 2828 2529 2490 1394 --23843 1206 33435 3060 287
NM_199190chr1273909 3532 3486 2828 2529 2490 1394 --23843 1206 33435 3060 287
NM_199320chr4102957 2864 2811 2465 2112 1987 1917 501 467 187 --1321 12019
NM_199320chr4102957 2864 2811 2465 2112 1987 1917 501 467 187 --1321 12019
NM_199324chr493595 2876 2474 2318 1401 1195 999 339 279 23437 305 31171 1115 376 --
NM_199421chr1494690 4132 3833 3410 1970 1823 1561 297 272 ----23514 920
NM_199436chr232938 1056 502 1326 42983 2922 967 99 --
NM_199454chr194771 4619 4378 3398 1687 631 581 554 418 14206 ----
NM_199462chr164890 4753 3954 3859 911 596 13141 1603 14984
NM_199482chr261803 1636 1416 797 231 93 1818 2497 257 --
NM_201269chr171260 1039 964 581 181 127 88 1301 1332 --
NM_203301chr1461557 1469 1458 618 401 363 ----1119
NM_203341chr161077 982 753 378 272 129 1763 ----
NM_203351chr1762528 2475 1586 1562 1534 724 11966 --11640
NM_203382chr551609 1498 1283 588 491 1526 1436 272 60
NM_203390chr891709 1638 1631 1165 670 603 593 338 38 ------
NM_203391chrX61796 1505 702 661 112 42 11642 ----
NM_203394chr1282736 2462 2437 2146 1668 608 572 520 12199 11691 --
NM_203406chr562734 2202 2061 554 375 98 --1891 --
NM_203446chr2142936 2896 2438 2166 12635 --42953 2377 2042 803
NM_203451chr1382412 2148 1682 918 861 799 615 357 32044 1987 53 ----
NM_203459chr1122539 2423 1854 1615 944 933 844 760 609 584 576 44 --1548 --
NM_203463chr294041 3891 3714 3375 1950 1697 1616 480 232 1719 --13473
NM_206594chr163560 3406 3199 2647 1399 817 13255 12548 --
NM_206595chr163560 3406 3199 2647 1399 817 13255 12548 --
NM_206853chr6163970 3953 3714 3430 3293 2996 2829 1653 1617 1608 1406 1293 885 270 195 123 --23945 3734 13807
NM_206854chr6145231 5214 4975 4691 4554 4257 4090 2146 1531 1456 1384 1064 409 215 1855 25206 4995 15068
NM_206855chr6206196 6179 5940 5656 5519 5222 5055 3997 3879 3843 2496 2421 2349 2029 1374 1180 867 410 242 82 11820 26171 5960 26033 922
NM_206876chr2143630 3445 3344 3270 3229 3020 2952 2571 2382 2293 1371 1273 690 203 --1665 1484
NM_206907chr5123062 3008 2699 2617 2521 894 871 764 312 276 242 128 --3403 152 29 --
NM_206909chr8168279 8103 8096 7815 7623 7375 6029 5795 5447 2381 2037 1773 1324 1157 438 200 36913 5526 5376 78306 6877 5369 5252 2982 1301 297 11687
NM_207012chr1053278 3217 2368 887 619 --32923 2705 658 1469
NM_207299chr93806 780 327 --1800 1823
NM_207303chr10113983 3712 2735 1574 1302 1238 951 892 323 236 175 12747 21482 806 --
NM_207304chr1382568 2299 2212 2138 985 670 645 593 1800 --12227
NM_207352chr472618 1913 948 535 475 338 67 11746 --176
NM_207404chr382071 1749 1413 911 291 249 235 29 21714 358 ----
NM_207406chr496349 5012 4829 4360 2403 2268 1764 655 582 --14919 --
NM_212471chr1771865 1751 1641 1435 632 125 83 12265 ----
NM_212472chr1771865 1751 1641 1435 632 125 83 12265 ----
NM_213589chr275561 4778 4712 4166 3930 3892 386 14971 22047 1238 14644