TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3607-5p
miRNA Sequence: GCAUGUGAUGAAGCAAAUCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531214 441 138 11010 1465 11089
NM_000038chr552111 1826 1682 1544 382 --21436 250 1586
NM_000081chr141528 1429 1393 447 --21276 251 1163
NM_000084chrX106087 5800 5778 4940 4550 2288 1604 1028 215 109 15632 1882 12122
NM_000091chr242686 1824 1783 268 22422 2119 21800 1775 --
NM_000092chr264057 3649 1290 939 322 25 ------
NM_000108chr761868 1178 423 263 176 60 --1345 --
NM_000109chrX52210 778 676 307 114 1545 12475 12105
NM_000115chr1392376 2163 1975 1773 1654 837 754 745 696 21067 159 ----
NM_000138chr1542084 2063 748 85 11071 2575 231 --
NM_000167chrX41767 1362 731 43 ------
NM_000176chr551557 1165 777 572 143 ------
NM_000217chr1275347 4109 4090 3990 3918 3321 1054 --3901 411 310 --
NM_000259chr1596301 6219 4165 2161 2103 1804 1501 884 246 12091 36183 4227 1855 15529
NM_000264chr962486 2155 948 626 347 195 --13180 --
NM_000332chr6156976 6889 6704 5390 4975 4855 2655 2202 1427 965 807 717 513 386 172 --25268 91 --
NM_000368chr943912 3892 3820 1246 ----2509 495
NM_000393chr252051 1997 1853 527 408 11875 ----
NM_000439chr542457 2155 1871 149 --1898 --
NM_000448chr1183086 2970 2767 2246 2042 608 537 475 ------
NM_000489chrX63129 2845 2134 1252 1132 388 1785 13223 11002
NM_000544chr6_cox_hap153039 2661 1213 1047 306 ----1289
NM_000550chr93787 733 118 1372 ----
NM_000554chr1962700 1254 1155 1074 1055 417 --11209 --
NM_000555chrX87839 7228 6920 6673 6489 3012 771 362 21042 810 17259 1818
NM_000599chr2134527 4286 4135 3864 3334 2903 1687 1233 976 849 802 755 411 11363 ----
NM_000612chr11101438 1389 1368 1312 1233 1176 1064 1020 832 250 41477 1403 1345 911 ----
NM_000618chr1296610 6529 6391 6264 6194 6107 5037 2280 722 --35617 5278 4692 --
NM_000618chr1296610 6529 6391 6264 6194 6107 5037 2280 722 --35617 5278 4692 --
NM_000633chr1865210 3569 1818 1337 806 236 1590 35132 1477 1188 1599
NM_000681chr1041341 1274 1259 506 ------
NM_000686chrX41576 1272 1004 488 --11043 --
NM_000726chr22199 157 ----1228
NM_000793chr1495088 5024 5013 4911 4776 4017 3268 2040 774 --23495 884 23746 3252
NM_000809chr4138828 8653 7815 7796 7789 7717 7675 6752 6598 6527 1767 1511 946 12312 37833 7807 419 23032 2877
NM_000813chr585046 3921 3706 3447 3420 2024 1653 231 15495 23478 1596 --
NM_000829chr1111993 11613 --21895 764
NM_000831chr1155285 5127 4947 4788 4164 4124 2497 2459 2361 2247 2193 2070 943 496 257 --1540 --
NM_000838chr662136 2013 1992 1746 404 277 22352 841 ----
NM_000868chrX72486 2133 560 457 317 121 43 1374 ----
NM_000875chr1597057 6965 6820 6214 5518 4737 4447 1428 482 --16257 --
NM_000891chr1753362 3330 2877 2495 600 1401 ----
NM_000899chr1253434 1226 1014 310 93 ----14377
NM_000901chr472526 2462 2030 1837 1724 1625 975 ------
NM_000902chr332494 901 522 --22423 279 --
NM_000910chr451524 1392 752 473 365 11456 11856 --
NM_000926chr11179412 9336 9251 8824 8810 8750 7866 7762 5709 3718 2662 1878 1340 1001 961 654 107 --56138 5920 2605 592 355 28621 6742
NM_000945chr251692 1615 744 595 321 ------
NM_000950chrX43570 3148 2722 256 --13289 --
NM_000990chr1184034 3928 3672 1466 1274 759 424 348 ------
NM_001001344chrX82627 2479 1708 637 615 84 66 22 ------
NM_001001395chr1262813 2678 2310 855 221 65 --12121 --
NM_001001396chr194004 3989 3746 2827 1713 1543 1152 376 194 ------
NM_001001419chr585012 4418 3811 3219 1923 979 601 86 ----1331
NM_001001420chr585012 4418 3811 3219 1923 979 601 86 ----1331
NM_001001484chr1052272 1877 1832 757 732 ------
NM_001001664chr244077 839 777 241 --13742 --
NM_001001668chr1984156 3811 3213 2800 1333 330 140 51 ------
NM_001001890chr2183346 2952 1685 1292 1170 1099 963 897 13306 ----
NM_001002257chr233112 927 820 1812 1373 --
NM_001002258chr24579 510 341 32 11548 11906 --
NM_001002814chr863748 3470 3435 2563 2494 448 12765 1121 --
NM_001002860chr1474201 3972 3687 1477 1419 798 712 --34222 3205 1810 1113
NM_001003407chr10135090 4978 4658 4346 3405 3274 1802 1496 1171 374 253 239 65 11507 11669 --
NM_001003408chr10135090 4978 4658 4346 3405 3274 1802 1496 1171 374 253 239 65 11507 11669 --
NM_001003652chr1878007 7948 6815 2985 2724 1605 1565 28228 6520 28565 855 --
NM_001003674chr1886914 6380 5904 2620 2593 2016 1759 935 --194 --
NM_001003675chr1886914 6380 5904 2620 2593 2016 1759 935 --194 --
NM_001003679chr192159 1748 1559 1508 711 337 288 139 79 ------
NM_001003712chr1273484 3345 3255 1627 1621 621 274 43585 3230 2464 256 12494 --
NM_001003760chr693083 2559 2375 1168 837 534 444 137 57 ------
NM_001003800chr953752 3434 2381 630 546 13693 23547 402 --
NM_001004317chr654109 3872 3317 359 162 1268 24392 657 --
NM_001004328chr1242168 893 797 236 135 1314 --
NM_001004346chr461191 872 436 320 149 100 ------
NM_001004419chr1264186 3668 3409 3200 344 68 23249 1721 ----
NM_001005404chr17104487 4220 4049 3865 3566 3537 3289 1415 1044 282 135 --12867
NM_001005473chr5125852 5303 5102 5051 4760 4297 2543 2221 2037 1965 1752 447 12499 ----
NM_001005746chr22199 157 ----1228
NM_001005747chr22199 157 ----1228
NM_001006600chr532249 1867 304 1310 ----
NM_001007023chr1495088 5024 5013 4911 4776 4017 3268 2040 774 --23495 884 23746 3252
NM_001007097chr964242 4225 3247 1683 854 462 --14353 13384
NM_001007214chr11109 21247 1220 --1258
NM_001008408chr775697 5423 4656 4620 2250 1296 217 2879 785 --12505
NM_001008539chr8105043 5008 4982 4373 4351 4270 3696 1953 1561 329 --11539 24428 4183
NM_001008564chr1362047 1772 893 337 323 245 ------
NM_001008738chr562962 2793 2601 2548 825 572 ------
NM_001008777chr171493 ----1532
NM_001008925chr453261 2501 1075 318 99 ----13253
NM_001009554chr4134687 4094 3989 3931 3242 3143 3010 2968 1679 1368 1002 879 601 13659 --14305
NM_001009554chr4134687 4094 3989 3931 3242 3143 3010 2968 1679 1368 1002 879 601 13659 --14305
NM_001009555chr461453 554 401 311 195 118 --11292 11143
NM_001009959chr232535 1798 1711 12344 --12452
NM_001009960chr742741 2327 559 301 --22800 317 --
NM_001010853chr673131 3122 2537 1098 828 307 161 ------
NM_001010861chr162722 2579 2434 2399 2330 405 ------
NM_001010862chrX53280 3044 2835 2453 2191 ------
NM_001010891chr576302 5841 4330 2305 1287 933 618 16220 41864 1842 1014 304 --
NM_001010986chrX52434 2409 1899 1705 387 11941 ----
NM_001011513chr433398 3265 2636 1588 --14083
NM_001011537chr342330 2090 1698 901 ----12389
NM_001011666chr7116521 6392 6022 5725 5713 4885 2429 2403 1760 1475 1100 ------
NM_001011708chr232537 1994 1984 ----1219
NM_001012393chr1185127 4307 3537 3449 1371 524 479 213 44281 4126 3136 989 23234 1562 --
NM_001012423chr1522237 2149 ----22274 940
NM_001012751chr1031919 1731 1241 --31817 1515 327 --
NM_001012755chrX54980 4377 1771 945 914 24269 1734 21065 674 13744
NM_001012761chr552727 2527 2398 344 172 ------
NM_001012968chrX41964 1728 756 453 12346 ----
NM_001013406chr741395 1343 1131 431 11525 ----
NM_001013620chr12108350 7725 7564 6408 5130 584 328 247 153 122 17547 27033 1152 27583 1236
NM_001014797chr10178214 8000 7982 7856 7070 6599 6037 5038 2161 2123 1890 1746 1307 799 750 609 55 11246 1206 --
NM_001015048chr1473212 3102 2752 2605 2205 430 356 --22390 44 --
NM_001015049chr1473212 3102 2752 2605 2205 430 356 --22390 44 --
NM_001015877chrX72761 2379 2261 2082 845 507 419 --12176 12114
NM_001015882chr921102 932 1893 1975 1236
NM_001015887chr341886 1233 602 521 --1641 1541
NM_001017371chr241214 970 923 473 1132 ----
NM_001017930chrX21073 1004 ----1938
NM_001018065chr9136080 5940 5339 4956 4889 4852 4770 3785 1832 1818 1723 1216 923 35893 4822 1196 35561 5089 944 14490
NM_001018066chr9136080 5940 5339 4956 4889 4852 4770 3785 1832 1818 1723 1216 923 35893 4822 1196 35561 5089 944 14490
NM_001018067chr164563 4478 1531 1429 716 458 21770 1149 ----
NM_001018068chr164563 4478 1531 1429 716 458 21770 1149 ----
NM_001018069chr164563 4478 1531 1429 716 458 21770 1149 ----
NM_001018074chr551557 1165 777 572 143 ------
NM_001018075chr551557 1165 777 572 143 ------
NM_001018076chr551557 1165 777 572 143 ------
NM_001018077chr551557 1165 777 572 143 ------
NM_001024094chr551557 1165 777 572 143 ------
NM_001024855chr351863 1623 1203 557 275 ------
NM_001024948chr133443 2641 822 23065 2494 23506 1337 --
NM_001024956chr1175678 4951 4935 4875 4096 1290 637 --11862 11631
NM_001025076chr1064027 2377 1836 1801 526 152 22132 719 12417 --
NM_001025079chr363318 1618 1536 1301 893 709 --12887 --
NM_001025108chr294201 3875 3809 3571 2863 2577 1298 915 868 --13618 --
NM_001025595chr421631 1281 11425 --1375
NM_001029863chr683086 2943 2594 2439 2320 2268 2213 1982 ------
NM_001029875chr582863 2550 1078 918 808 681 542 349 1622 12743 --
NM_001030007chr1663800 3779 3031 1398 1336 619 --33962 3319 2692 --
NM_001030055chr14134097 4091 3891 3856 3711 1566 1108 888 554 434 158 118 106 --11606 --
NM_001031695chr2275429 5220 4968 4401 1740 1622 542 14516 15042 --
NM_001031732chr4103376 3242 3050 3023 2420 1468 1384 1369 1100 386 12558 ----
NM_001031804chr1644058 2962 2701 427 ----14149
NM_001031812chr561932 1802 938 546 487 156 11632 138 --
NM_001033045chr284373 1612 1451 908 820 153 34 25 11726 23601 176 --
NM_001033087chr2032908 2787 871 --2756 317 12989
NM_001033117chr364452 1149 380 283 169 76 24768 1213 34627 1403 956 --
NM_001033557chr251238 1084 944 361 82 ------
NM_001033578chr832148 746 438 --11717 --
NM_001033659chr172389 383 11643 1605 --
NM_001033925chr1041627 697 406 158 ----1769
NM_001035260chr1061479 1369 1093 634 615 492 --11188 --
NM_001037317chr162722 2579 2434 2399 2330 405 ------
NM_001039199chr2044923 4873 3401 1000 11807 --21767 1455
NM_001039538chr232362 822 168 11110 1219 --
NM_001039547chr3107963 7396 6711 6469 6350 6067 4951 1662 1411 1358 27133 82 21714 1119 --
NM_001039569chr263040 2796 1050 839 527 34 --1920 --
NM_001039585chr163650 2812 1103 861 740 170 ------
NM_001039618chr1135612 4046 3627 23659 886 14159 --
NM_001039693chr273835 3793 3782 3757 2799 2681 753 2667 267 1461 12607
NM_001039840chrX125894 5446 5386 4667 4600 4433 1360 1250 647 606 354 224 ----12041
NM_001040057chr751350 1263 1241 1089 398 ------
NM_001040100chr341224 241 186 162 ------
NM_001040142chr271964 900 865 834 778 759 596 ------
NM_001040143chr271964 900 865 834 778 759 596 ------
NM_001040152chr784386 4163 4051 3230 3190 1892 948 619 1379 21910 394 --
NM_001040159chr461135 548 500 339 223 109 ------
NM_001040214chr642037 2007 1911 1776 1174 --11820
NM_001040284chr1654390 2109 1890 1773 567 --1248 24090 915
NM_001040402chr443102 1109 524 87 --22928 2706 --
NM_001040429chr1373580 3054 2363 1344 1006 725 663 11051 --1963
NM_001040441chr1105368 4929 4366 4117 4093 3602 1484 1096 590 43 24960 4130 13586 --
NM_001040665chr7105022 4760 4392 4360 4051 3161 3113 1361 1108 706 11023 --24635 3975
NM_001042355chr1695416 5120 4564 4157 3933 1906 1828 1135 82 --11238 21252 285
NM_001042357chr1021412 253 ----11423
NM_001042358chr1021412 253 ----11423
NM_001042360chr1021412 253 ----11423
NM_001042363chr1021412 253 ----11423
NM_001042389chr1021412 253 ----11423
NM_001042390chr1021412 253 ----11423
NM_001042392chr1021412 253 ----11423
NM_001042395chr1021412 253 ----11423
NM_001042404chr141953 1843 1791 1216 ------
NM_001042412chr1695416 5120 4564 4157 3933 1906 1828 1135 82 --11238 21252 285
NM_001042413chr994142 3909 3695 3540 3007 1427 1274 1152 539 1330 14075 --
NM_001042453chrX51381 1363 653 578 303 --2696 30 --
NM_001042481chr1472586 2458 2240 986 911 343 73 --1332 1358
NM_001042510chr831684 1660 270 --12117 11852
NM_001042511chr831684 1660 270 --12117 11852
NM_001042537chrX32004 706 42 ----21879 1702
NM_001042550chr921873 1839 31269 633 579 --1329
NM_001042555chr1284347 3744 3528 3337 2920 1650 1455 505 14295 ----
NM_001042599chr2137668 6926 5859 5816 4800 2832 2688 2566 2134 1707 1591 873 731 1504 25358 1296 17834
NM_001042603chr12104405 4330 4198 4040 3854 3642 2047 1413 790 170 11261 13837 --
NM_001042683chr651791 1624 1441 1349 624 1428 ----
NM_001042749chrX31978 406 352 --22045 1343 --
NM_001042750chrX31978 406 352 --22045 1343 --
NM_001042751chrX31978 406 352 --22045 1343 --
NM_001044387chr1973669 2794 2556 1267 1193 485 347 ----23909 1116
NM_001044388chr1973669 2794 2556 1267 1193 485 347 ----23909 1116
NM_001044722chr561932 1802 938 546 487 156 11632 138 --
NM_001044723chr561932 1802 938 546 487 156 11632 138 --
NM_001046chr552843 2815 2782 2379 775 ------
NM_001100108chr1128163 7701 7637 7243 7008 6959 6200 5050 2235 1743 1213 146 12655 11196 --
NM_001106chr3108712 7781 7428 7181 6491 6261 3857 2138 1371 445 --21873 1862 --
NM_001113490chrX63257 3209 3179 2334 1061 677 --13450 --
NM_001116chr1642973 688 496 237 --12873 11987
NM_001122679chr531214 441 138 11010 1465 11089
NM_001128chr1663800 3779 3031 1398 1336 619 --33962 3319 2692 --
NM_001146chr862323 2213 2060 1784 881 648 1385 1210 --
NM_001173chr14134097 4091 3891 3856 3711 1566 1108 888 554 434 158 118 106 --11606 --
NM_001177chr1262121 1788 1680 1643 874 612 ------
NM_001186chr2153211 2875 2725 2291 1253 22299 679 --12576
NM_001198chr642378 2122 1965 1679 1880 32261 1539 1472 --
NM_001204chr2177794 7457 7438 7214 6820 6604 6550 6460 6142 5709 5201 4699 2964 1755 1444 1403 1367 26635 2997 12136 --
NM_001206chr963135 2976 2742 834 551 407 ------
NM_001219chr732304 537 320 ----163
NM_001227chr1041331 881 276 58 ----1499
NM_001257chr1631351 1005 962 1250 11432 --
NM_001270chr51837 ----178
NM_001289chrX31607 1176 398 21262 423 21307 1275 --
NM_001315chr642066 1798 1682 760 11672 ----
NM_001412chrX43301 847 488 21 --33716 1381 774 --
NM_001419chr1943820 3474 3467 925 --24650 4245 --
NM_001423chr1242010 1856 1826 473 ----11787
NM_001438chr133470 2771 1270 33074 1353 1289 ----
NM_001440chr862776 2009 924 681 411 317 ------
NM_001455chr694952 4773 4622 4441 3767 3376 1935 576 550 --34740 4523 424 --
NM_001527chr684659 3840 3739 3666 3364 3259 3070 966 --1787 24683 1651
NM_001546chr641029 909 501 435 --11458 --
NM_001621chr7102989 2698 2541 2512 2485 1177 763 554 258 194 --1100 --
NM_001621chr7102989 2698 2541 2512 2485 1177 763 554 258 194 --1100 --
NM_001689chr24579 510 341 32 11548 11906 --
NM_001701chr931446 1058 992 --11501 1236
NM_001754chr2183346 2952 1685 1292 1170 1099 963 897 13306 ----
NM_001759chr1264852 4519 3897 1960 1730 128 ----22094 794
NM_001777chr363318 1618 1536 1301 893 709 --12887 --
NM_001858chr675127 5094 3712 2037 1972 1679 210 ------
NM_001859chr933016 1502 1422 --23099 1159 13982
NM_001918chr1109329 8782 8510 6329 6212 5955 5678 3403 207 71 --26843 2311 19117
NM_001931chr111915 ----1502
NM_001957chr431741 332 212 --12019 12112
NM_001969chr1461543 1341 1196 996 744 264 ------
NM_001977chr431325 487 341 ----1552
NM_002006chr495339 4370 3914 3583 2064 1313 648 408 331 13732 34103 4088 1834 23964 34
NM_002009chr1542586 2498 2182 838 12806 21952 1007 --
NM_002015chr1352915 2762 936 839 557 12534 --1576
NM_002024chrX42136 1909 701 376 11476 12106 --
NM_002025chrX158396 8284 7928 6648 6516 5702 3529 3346 2996 2783 2338 2045 1416 1092 376 21625 384 28164 7155 17945
NM_002040chr2173137 2129 2110 1956 1217 1086 424 22203 1127 ----
NM_002092chr474879 4752 4129 3906 3361 1628 1545 ------
NM_002128chr1352406 1784 711 698 574 ----2824 547
NM_002158chr283717 3500 3221 2704 1461 1439 1103 426 1195 12558 --
NM_002210chr263603 2623 2471 931 796 664 1549 1523 --
NM_002214chr765560 5536 5252 5064 2121 169 --34555 4519 3818 --
NM_002222chr331141 850 92 ----11074
NM_002223chr1263923 2892 2689 1059 811 701 1845 ----
NM_002247chr1062227 1906 921 866 468 130 1815 ----
NM_002267chr133468 194 103 --21888 177 --
NM_002270chr5125643 5259 5003 4635 4569 4170 3989 3847 3569 3493 1492 940 1498 24149 1619 11736
NM_002285chr294201 3875 3809 3571 2863 2577 1298 915 868 --13618 --
NM_002310chr596628 6265 4917 4562 1548 1397 1096 307 126 15129 35019 4461 2536 --
NM_002313chr10135090 4978 4658 4346 3405 3274 1802 1496 1171 374 253 239 65 11507 11669 --
NM_002336chr1273754 3704 3645 3573 1677 1041 433 ------
NM_002351chrX11735 31660 1278 1189 --11511
NM_002374chr232362 822 168 11110 1219 --
NM_002395chr621041 509 ----1171
NM_002397chr531472 706 689 --21980 333 --
NM_002460chr642382 1383 998 469 --33316 3148 2620 --
NM_002522chr1753444 2752 1053 428 317 --23434 1192 13801
NM_002545chr1185127 4307 3537 3449 1371 524 479 213 44281 4126 3136 989 23234 1562 --
NM_002547chrX63863 3852 3827 3087 2762 168 --1668 --
NM_002581chr9105046 4950 4937 3911 1805 1708 1526 1007 344 158 14010 ----
NM_002594chr2051861 1846 1769 811 411 ------
NM_002623chr203524 487 311 --1146 --
NM_002645chr1182601 2363 2246 1101 736 354 184 58 ----11109
NM_002655chr8115166 5127 5087 4132 2069 1924 1495 1030 1023 848 233 ------
NM_002709chr243021 785 566 249 1981 23447 2505 11203
NM_002716chr1163598 3207 2638 1385 431 388 --13515 --
NM_002736chr731434 363 123 21928 1637 1546 --
NM_002737chr17146447 6320 5619 5147 5018 4401 2178 1967 1723 1536 1442 1132 787 111 26392 2591 ----
NM_002745chr2283195 3061 3005 1802 1664 1425 918 610 1345 --11380
NM_002748chr152480 161 21057 437 ----
NM_002844chr631316 329 122 1964 21292 1176 --
NM_002886chr384766 4751 4482 3646 3489 1516 1307 481 1507 ----
NM_002906chr1182368 2271 2264 1885 1659 421 297 244 --11548 --
NM_003034chr12157698 7617 7049 6725 5256 5157 3230 2955 2870 1586 1129 994 616 266 214 --25359 1271 11202
NM_003046chr8105043 5008 4982 4373 4351 4270 3696 1953 1561 329 --11539 24428 4183
NM_003099chr1596433 6388 5574 5022 2163 2091 1854 1596 1533 24358 2297 14066 1396
NM_003108chr2127297 7153 6582 6515 6460 6413 6363 6216 6166 5019 4839 1599 16797 ----
NM_003111chr241214 970 923 473 1132 ----
NM_003161chr1742709 2476 2372 115 --13122 --
NM_003199chr1843784 2118 1216 957 34755 4548 454 25510 1956 --
NM_003215chr421011 313 ----21292 546
NM_003221chr674196 3673 3558 1201 1012 857 530 ------
NM_003236chr242936 2711 2652 311 1562 --1484
NM_003246chr1532018 1509 762 --22082 520 --
NM_003247chr642041 1550 318 279 --11944 --
NM_003262chr395211 5186 4553 4311 3439 1009 382 290 80 --15240 --
NM_003274chr2122932 1039 1617 2823 734 12066
NM_003291chr135798 670 626 217 171 2761 724 ----
NM_003292chr152009 1911 1555 621 605 --11821 --
NM_003298chr3115957 5498 5074 4075 4054 3808 1721 898 597 101 54 ------
NM_003309chr621848 413 21484 198 1226 11636
NM_003326chr182516 2222 1980 1721 1101 905 624 111 --12755 --
NM_003338chr1031219 738 21 --1459 1334
NM_003340chr421365 394 11074 1151 1470
NM_003373chr1041330 582 284 104 11424 --1685
NM_003392chr364340 3296 2855 2772 659 588 1912 2615 374 --
NM_003410chrX52953 2597 909 645 81 ------
NM_003411chrY101837 1758 1441 1247 608 496 386 287 145 76 1712 --1483
NM_003423chr1932491 231 91 --31645 1028 55 --
NM_003463chr683107 2829 2740 2730 705 672 509 479 13087 13040 --
NM_003478chr1132749 160 104 --13198 13112
NM_003489chr2142490 1298 1220 512 ----12735
NM_003566chr1263199 2817 2768 956 900 388 --12325 --
NM_003574chr181126 14973 15068 15768
NM_003583chr1233084 925 720 33679 1427 177 ----
NM_003590chr253619 3494 3245 1170 115 33951 3450 1628 23193 47 13417
NM_003615chr393450 3304 2875 1182 1012 626 387 198 42 11352 ----
NM_003618chr231037 1009 259 ----1911
NM_003624chr192583 207 ----11434
NM_003644chr17105972 5849 5279 4934 4639 4246 2162 2004 1648 1004 --1323 --
NM_003663chr343382 2508 2336 2301 12966 ----
NM_003671chr953546 3519 3424 810 597 ------
NM_003672chr131803 1775 325 --21765 312 11257
NM_003679chr152300 2186 2138 1276 1015 ------
NM_003713chr161524 1340 1327 1148 612 361 1373 ----
NM_003749chr1342434 2058 2046 865 --135 --
NM_003772chr112976 233 11238 31041 840 225 --
NM_003783chr141021 310 107 73 ------
NM_003796chr193429 414 28 1547 183 --
NM_003825chr1541480 1035 954 270 11195 1240 --
NM_003895chr213606 515 494 ----12211
NM_003909chr852966 2922 2488 2384 221 --13038 1302
NM_003913chr652767 905 706 390 266 --14093 13103
NM_003916chrX61405 1220 530 457 422 302 21203 286 ----
NM_003922chr151388 ----1378
NM_003972chr1041312 1142 1124 43 1915 1224 --
NM_003980chr641318 1182 572 545 ------
NM_003983chr16144371 3847 3335 3329 3321 2891 2841 2828 1721 1130 887 774 733 115 ------
NM_003994chr1253434 1226 1014 310 93 ----14377
NM_004006chrX52210 778 676 307 114 1545 12475 12105
NM_004007chrX52210 778 676 307 114 1545 12475 12105
NM_004009chrX52210 778 676 307 114 1545 12475 12105
NM_004010chrX52210 778 676 307 114 1545 12475 12105
NM_004011chrX52210 778 676 307 114 1545 12475 12105
NM_004012chrX52210 778 676 307 114 1545 12475 12105
NM_004013chrX52210 778 676 307 114 1545 12475 12105
NM_004014chrX52210 778 676 307 114 1545 12475 12105
NM_004015chrX52210 778 676 307 114 1545 12475 12105
NM_004016chrX52124 692 590 221 28 1459 12389 12019
NM_004017chrX52210 778 676 307 114 1545 12475 12105
NM_004018chrX52124 692 590 221 28 1459 12389 12019
NM_004020chrX52210 778 676 307 114 1545 12475 12105
NM_004021chrX52124 692 590 221 28 1459 12389 12019
NM_004022chrX52124 692 590 221 28 1459 12389 12019
NM_004023chrX52124 692 590 221 28 1459 12389 12019
NM_004035chr1795038 4721 3807 3154 1680 1366 1215 783 332 ------
NM_004087chr352047 1700 1522 718 166 --31992 702 144 --
NM_004093chr1363231 3192 2348 2306 2249 1144 12836 ----
NM_004124chr1483527 3319 3263 3006 2931 2225 1097 941 --11377 --
NM_004136chr1573311 2552 2122 1289 1148 713 530 2698 625 ----
NM_004171chr11199455 9365 9336 8427 7887 7591 7192 7111 6877 3746 2845 2764 2687 2428 2086 1011 641 561 504 18043 19575 19168
NM_004229chrX41754 1667 1461 641 11881 --1461
NM_004232chr1863250 3243 1239 1227 706 476 --13640 --
NM_004274chr1483151 3123 2512 2230 1103 632 133 111 --23064 2622 --
NM_004293chr963766 3724 3037 1541 658 318 ------
NM_004331chr852664 2229 1818 870 118 --12394 --
NM_004338chr1886914 6380 5904 2620 2593 2016 1759 935 --194 --
NM_004384chr561932 1802 938 546 487 156 11632 138 --
NM_004392chr1352549 2004 942 576 522 --1803 --
NM_004397chr1163968 3234 2803 1021 877 727 1833 ----
NM_004426chr1261764 1443 1240 627 245 173 ------
NM_004432chr9112383 2333 2187 2131 2055 1572 948 488 437 318 237 --11833 1749
NM_004458chrX62561 2170 2134 2061 981 968 12448 ----
NM_004459chr1761915 1886 1813 1452 579 481 ------
NM_004464chr4124329 3941 3933 3920 3905 3849 3195 1447 1403 636 563 125 1345 ----
NM_004481chr172173 2093 1751 967 442 383 63 --1474 12312
NM_004501chr164058 3733 2666 2658 2502 473 11396 ----
NM_004504chr252662 2538 526 402 45 ------
NM_004523chr1031221 629 532 ----11173
NM_004578chr13912 233 174 ----1380
NM_004580chr1541670 493 370 68 --1385 --
NM_004586chrX95234 5203 4961 4803 4359 4040 886 513 474 21429 273 23338 772 --
NM_004598chr553012 1280 641 537 175 12843 ----
NM_004612chr9124754 4556 4401 4335 3781 3225 1867 1526 1232 1130 915 538 --33820 1386 615 --
NM_004686chr851680 1452 1335 1289 357 ------
NM_004726chrX34821 2233 424 45746 4834 610 134 24731 4479 --
NM_004730chr511875 --1465 11903
NM_004734chr1343249 3097 504 287 22971 807 12982 --
NM_004745chr8126406 6059 5353 4261 2790 2675 2589 2202 1188 1090 885 334 ------
NM_004748chr1552834 1595 1555 457 382 13609 ----
NM_004775chr1842412 2034 1903 475 ------
NM_004776chr2043285 3106 2241 926 22061 383 12794 12194
NM_004788chr1152595 779 519 411 279 --12544 --
NM_004815chr174313 3172 1946 1517 567 456 188 --1631 --
NM_004840chrX62139 1998 1750 391 178 162 --1594 --
NM_004857chr1474626 3239 3007 1843 499 402 264 13226 --11438
NM_004863chr1445218 4808 3468 811 25289 4641 14535 1103
NM_004866chr594514 3773 3510 3454 3145 1597 1208 1065 841 15041 1218 --
NM_004867chrX1500 ----1218
NM_004873chr1473212 3102 2752 2605 2205 430 356 --22390 44 --
NM_004896chr1061394 1284 1008 549 530 407 --11103 --
NM_004904chr7116521 6392 6022 5725 5713 4885 2429 2403 1760 1475 1100 ------
NM_004912chr741395 1343 1131 431 11525 ----
NM_004921chr162376 1588 582 442 259 29 --1836 --
NM_004985chr1274397 4337 3420 2932 1657 672 379 --1775 13955
NM_004987chr21159 ----1333
NM_004999chr651127 1037 402 295 248 --24154 3068 --
NM_005056chr12104649 4574 4442 4284 4098 3886 1657 1034 414 132 11505 14081 --
NM_005065chr1475394 2123 1696 1280 544 268 220 24618 1294 33713 3271 1799 --
NM_005121chr1793170 3007 2395 1540 1441 1226 815 744 368 --11025 --
NM_005126chr33808 743 81 --12244 11894
NM_005156chr964344 4251 3691 1878 1310 488 --23616 915 --
NM_005180chr1041525 358 156 89 ------
NM_005188chr1197038 6888 6366 5475 2973 2793 1924 882 131 --11088 1265
NM_005197chr1466109 4885 1751 1380 393 228 ------
NM_005233chr342398 2233 1614 800 22368 2351 ----
NM_005235chr2137668 6926 5859 5816 4800 2832 2688 2566 2134 1707 1591 873 731 1504 25358 1296 17834
NM_005254chr1531406 1374 946 1890 1564 --
NM_005259chr261544 1499 1138 611 510 248 ----11187
NM_005284chr63464 197 181 ------
NM_005339chr461699 1685 1652 1409 1201 843 11045 ----
NM_005359chr1856001 5454 4608 4602 1184 11810 14329 --
NM_005455chr121642 122 ----11180
NM_005497chr1775613 2147 2078 1328 507 231 197 --13991 15531
NM_005504chr1286030 5519 4636 4402 2057 927 413 341 ------
NM_005542chr721896 601 --21284 591 11594
NM_005578chr3103996 3944 3902 1582 1185 1163 572 506 353 183 ------
NM_005595chr13661 385 85 --2721 182 --
NM_005596chr996112 5866 5160 5115 4919 4465 2376 1686 485 25390 2451 14730 1363
NM_005604chr652329 739 497 486 431 ------
NM_005613chr13523 369 363 12237 21682 635 1353
NM_005638chrX41758 1286 1162 80 ------
NM_005665chr134759 3015 1103 1982 186 153
NM_005668chr532816 1600 1304 21622 593 --13550
NM_005670chr611333 1214 --11440
NM_005717chr141182 275 151 130 ------
NM_005746chr742656 921 486 309 ----11720
NM_005759chr254525 4467 4337 3086 1229 --22917 781 13900
NM_005789chr172725 634 --21719 626 2447 70
NM_005795chr222550 369 ----1130
NM_005840chrX105801 5634 5384 5118 5079 4884 4827 2942 2858 421 1866 ----
NM_005880chr1661319 663 521 327 253 186 ------
NM_005898chr1142926 2523 2490 614 1238 1945 --
NM_005901chr1878007 7948 6815 2985 2724 1605 1565 28228 6520 28565 855 --
NM_005903chr585012 4418 3811 3219 1923 979 601 86 ----1331
NM_005907chr631322 557 182 21482 81 11526 --
NM_005909chr574181 3387 2891 1303 1051 926 675 ------
NM_005935chr484676 3542 1853 1581 1557 1216 750 378 ------
NM_005941chr864168 4063 3127 1154 757 616 23332 159 ----
NM_005955chr154316 4080 3548 1307 147 ----1969
NM_006007chr973577 3244 2799 1412 1033 795 112 12858 23455 1571 --
NM_006011chr1543789 3339 1489 33 21641 1041 1622 --
NM_006022chr1331011 374 131 1792 1166 --
NM_006036chr282552 2538 2338 2320 2260 949 593 192 1653 ----
NM_006038chr2052154 2126 1833 726 149 --11735 --
NM_006047chr2043137 1344 319 37 11250 1894 --
NM_006095chr494168 4000 3720 3524 3393 1763 1599 928 764 --43399 1492 1143 572 23120 2970
NM_006106chr1183415 3403 3015 3005 2817 2193 581 53 11051 13389 --
NM_006135chr121271 1184 ----161
NM_006141chr1642358 1894 87 22 --1186 --
NM_006154chr1572230 2182 1914 993 794 712 127 --12640 --
NM_006166chr1241747 820 722 327 1802 ----
NM_006194chr1461229 959 346 160 136 78 --11255 --
NM_006203chr565022 4060 4008 3544 2008 1714 1514 169 14547
NM_006251chr583063 2908 2889 1230 1008 831 327 313 ------
NM_006252chr177470 7445 6574 2083 1610 748 219 17519 25239 1616 25275 1794
NM_006283chr864474 1856 1660 703 524 126 13142 33090 1603 1437 23722 1175
NM_006306chrX74626 4393 2161 1594 1375 749 353 13764 1696 11752
NM_006315chr4104189 4177 4158 4145 4043 3840 3810 3529 3071 1210 ----13403
NM_006330chr861480 513 467 308 189 123 ------
NM_006359chrX32004 706 42 ----21879 1702
NM_006364chr1441098 1060 151 137 ----11187
NM_006371chr365319 5305 4096 3356 1146 543 ------
NM_006393chr1044172 2894 1730 958 13550 ----
NM_006403chr651769 1618 1309 1215 255 1566 ----
NM_006457chr433398 3265 2636 1588 --14083
NM_006467chr552148 797 607 407 157 --2636 462 --
NM_006482chr1233084 925 720 33679 1427 177 ----
NM_006496chr131412 658 648 21375 459 ----
NM_006504chr1052831 2816 527 282 267 ------
NM_006517chrX72179 2165 2128 941 823 660 69 ------
NM_006534chr2043314 2845 2830 2797 13373 23060 696 --
NM_006544chr1475991 4604 4592 2367 2284 272 217 ----15630
NM_006561chr1064027 2377 1836 1801 526 152 22132 719 12417 --
NM_006577chr231111 814 68 --1913 1160
NM_006599chr16148083 7541 7384 7233 6605 6159 6076 6045 3297 3138 2796 1417 1295 201 17521 ----
NM_006603chrX31978 406 352 --22045 1343 --
NM_006614chr393337 3006 2350 1422 1228 1159 1133 600 80 23661 1383 --13534
NM_006625chr13985 873 132 --11156 --
NM_006625chr13985 873 132 --11156 --
NM_006625chr13985 873 132 --11156 --
NM_006626chr962712 2620 2546 1020 356 215 --12705 --
NM_006628chr1543951 3364 772 452 ----11590
NM_006646chr1331130 600 236 22856 212 ----
NM_006654chr1284347 3744 3528 3337 2920 1650 1455 505 14295 ----
NM_006699chr121844 434 --145 1258
NM_006717chr973210 2322 2158 944 903 821 620 ------
NM_006720chr10135090 4978 4658 4346 3405 3274 1802 1496 1171 374 253 239 65 11507 11669 --
NM_006729chrX95440 4888 4604 3624 3457 2114 1957 1734 807 --11411 --
NM_006734chr631591 1503 1016 --21635 1248 --
NM_006754chr741118 443 404 143 --1193 --
NM_006775chr643004 872 772 757 ------
NM_006805chr531263 536 479 --11684 11581
NM_006827chr1443336 2409 1326 494 --42076 1026 738 687 --
NM_006873chr253328 3174 2803 1400 901 ------
NM_006902chr142948 2027 1143 44 12664 ----
NM_006914chr931340 528 522 ----1338
NM_006915chrX52367 2037 935 530 148 1258 ----
NM_006918chr1175678 4951 4935 4875 4096 1290 637 --11862 11631
NM_006920chr282074 1912 1675 1617 1336 1317 530 383 ------
NM_006922chr212389 --12237 12130
NM_006924chr1744193 4081 3506 799 --11021 13254
NM_006948chr2172094 1540 978 577 545 303 142 --21730 409 --
NM_006956chr782269 2189 2032 1994 1924 629 244 182 ----12103
NM_006963chr1011220 1879 --21073 180
NM_006996chr141765 1537 342 293 --1692 1614
NM_007006chr1643395 3292 2423 681 --11336 --
NM_007007chr1244646 4043 3531 1231 --24001 658 --
NM_007011chr1576814 6556 6463 2443 2041 1928 411 --12155 12462
NM_007013chr831054 943 658 1649 1733 --
NM_007038chr2155754 5559 5181 3919 1722 14972 --1182
NM_007042chr362346 2128 1852 370 219 43 ------
NM_007050chr2047719 5775 2401 2105 27486 5981 ----
NM_007054chr573966 3671 3380 3287 3031 1220 601 ------
NM_007114chr393235 2820 2450 2392 2377 876 430 318 284 ------
NM_007124chr671997 618 501 421 403 395 371 ------
NM_007125chrY3990 927 498 --1216 11418
NM_007137chrX44450 1611 960 498 45136 4825 1495 809 14746 --
NM_007147chr1931168 791 769 21000 149 ----
NM_007157chrX42877 2056 1958 409 --1829 --
NM_007159chr351644 1512 1263 479 410 11744 ----
NM_007172chr2232744 2431 1071 21176 882 ----
NM_007187chr1361054 986 722 711 312 24 ------
NM_007249chr13118555 8537 8030 7988 6727 6648 5738 5713 3151 2207 1055 16765 18206 --
NM_007287chr332494 901 522 --22423 279 --
NM_007288chr332494 901 522 --22423 279 --
NM_007289chr332494 901 522 --22423 279 --
NM_007292chr1795038 4721 3807 3154 1680 1366 1215 783 332 ------
NM_007350chr1254623 4541 4442 3622 1696 --33559 1840 1595 --
NM_007375chr142294 624 403 86 --11746 1201
NM_012081chr553365 2818 2463 565 556 ------
NM_012096chr363652 2406 1375 692 599 265 ----11327
NM_012158chr132473 209 11544 --11215
NM_012164chr966940 6823 5051 2076 1410 360 17383 ----
NM_012234chr333782 3328 903 11076 1881 --
NM_012249chr273109 2403 2339 1400 1126 762 278 ----1975
NM_012252chr7125145 4978 4745 4314 4233 4224 3912 3460 2145 849 784 411 13755 21875 78 14370
NM_012262chr144372 3193 1717 508 --12106 --
NM_012281chr742377 2330 2104 1644 21557 425 ----
NM_012287chr354081 4026 3891 1771 140 13391 14333 11114
NM_012290chr231632 1397 403 --21419 620 --
NM_012294chr732906 641 273 12997 --11301
NM_012309chr11104142 3902 3284 3277 3075 3028 1461 1023 1005 219 14940 1753 --
NM_012399chr2281882 1861 1534 1479 229 204 180 160 ------
NM_012420chr1062308 1998 1806 1547 389 313 ------
NM_012465chr1083437 3385 3356 3153 3089 2222 1324 1173 11371 ----
NM_012471chrX61990 1807 1725 1447 1307 700 11409 ----
NM_013231chr1474252 4075 3648 1667 833 816 86 12679 ----
NM_013255chr7168850 8510 8153 7939 7912 5923 3335 3093 2391 2330 1726 1495 1319 1261 1200 587 ----23383 3301
NM_013257chr832148 746 438 --11717 --
NM_013261chr473692 3064 2855 2720 1000 371 237 ----1187
NM_013269chr1254113 3595 3336 3127 271 23176 1648 ----
NM_013341chr232537 1994 1984 ----1219
NM_013381chr1272227 1863 1690 1490 731 704 677 21754 907 --11774
NM_013437chr831026 217 209 ----1516
NM_013447chr1953743 3547 3100 1346 222 23106 829 ----
NM_013989chr1495088 5024 5013 4911 4776 4017 3268 2040 774 --23495 884 23746 3252
NM_013995chrX12402 --12353 12170
NM_014000chr1041330 582 284 104 11424 --1685
NM_014028chr663310 3229 1100 762 652 586 ----134
NM_014043chr341369 1064 665 84 --11603 --
NM_014048chr1675173 4943 4425 4286 3203 1254 896 ------
NM_014089chr1362047 1772 893 337 323 245 ------
NM_014112chr8125489 5176 3718 2024 2005 1867 1624 1511 967 745 656 364 55371 4773 4558 3520 3433 25274 4420 24523 1929
NM_014155chr1167079 6844 6534 2694 2386 1600 21578 636 17447 --
NM_014243chr431369 548 70 11654 11647 --
NM_014253chrX52424 1979 1885 850 299 2897 684 ----
NM_014309chr2275419 5210 4958 4391 1730 1612 532 14506 15032 --
NM_014331chr4227857 7382 7322 6927 6541 5759 5044 4745 2800 2780 2748 2214 1495 1363 961 954 886 863 740 483 309 133 --36665 6413 5228 --
NM_014393chr881975 1821 1759 382 254 161 155 100 ------
NM_014415chr3199 --31317 1138 607 --
NM_014423chr595548 5212 4001 2088 1859 1562 855 644 51 45192 1604 1501 606 --14313
NM_014447chr421630 1280 11424 --1375
NM_014548chr1521457 544 --1397 1309
NM_014554chr1251780 1600 920 437 355 2731 656 ----
NM_014584chr1431544 1508 272 --21455 523 --
NM_014585chr22515 48 --1867 1312
NM_014636chr964314 3241 3230 1277 1252 671 ----11245
NM_014682chr842293 1816 905 831 11490 1232 --
NM_014701chr1563266 2886 2698 2202 781 716 --1830 --
NM_014702chr663467 3372 3267 3164 2846 2716 ------
NM_014707chr761783 1564 1554 852 636 413 ------
NM_014720chr1031451 1253 332 ----11706
NM_014721chr666894 4982 4575 2672 1398 1311 45492 5005 1465 1391 ----
NM_014733chr552245 2018 1414 599 23 ------
NM_014739chr663569 3310 3108 1494 933 926 14106 23457 263 --
NM_014743chr462928 2504 2331 1258 1249 755 --12824 --
NM_014746chr264132 4038 2678 1685 1070 1035 --14292 --
NM_014755chr2104248 4174 4023 3393 1420 1162 1144 920 790 648 24032 618 34201 2895 516 --
NM_014787chr162709 2463 2158 1876 1808 340 22495 2476 ----
NM_014803chr1052330 2240 1886 969 443 ------
NM_014810chr143554 3150 499 372 12348 13254 --
NM_014812chr141953 1843 1791 1216 ------
NM_014829chr552205 1650 1547 796 412 ----1440
NM_014839chr162221 2042 1641 860 167 45 11661 ----
NM_014850chr364452 1149 380 283 169 76 24768 1213 34627 1403 956 --
NM_014872chr942403 2137 2024 1584 ----11802
NM_014873chr184758 4330 4278 1917 1113 649 257 238 14450 173 --
NM_014877chr17146486 6359 5744 5153 5125 4950 4763 2944 2929 2566 993 399 376 256 16725 ----
NM_014893chrY12247 32034 469 205 1783 --
NM_014897chr1753166 2039 1084 755 296 12265 --1957
NM_014904chr10133768 3525 2865 2729 2456 1441 1430 1061 692 533 526 466 108 33762 3631 473 13381 --
NM_014906chr1764066 3052 577 526 432 88 11140 11156 13582
NM_014912chr1053292 3210 2379 1344 164 11303 ----
NM_014920chr643526 1396 1336 856 --11075 12665
NM_014923chr1352220 2011 1670 901 32 ------
NM_014932chr361519 1290 557 442 271 237 ------
NM_014946chr272900 2203 1997 1230 1060 731 119 ------
NM_014953chr1344152 4003 3188 1422 13968 24229 1433 --
NM_014982chr14125269 4659 4274 4151 4048 3995 3553 3526 1683 1577 1291 347 --44195 1541 1234 1034 --
NM_014988chr412119 --32672 2296 2016 12049
NM_014989chr641844 1763 1312 295 ----1172
NM_014997chr782932 2653 2426 2418 412 238 229 184 --1223 --
NM_014999chr1241354 1095 568 85 --11502 --
NM_015025chr252475 2406 2189 1067 666 --22430 787 --
NM_015026chr1273816 3475 1045 928 617 256 156 1666 1643 11632
NM_015032chr1352867 2157 1882 1138 182 --1165 --
NM_015035chr2065686 4817 2094 290 88 55 25804 5167 ----
NM_015068chr753238 3015 2903 1075 744 --1762 --
NM_015071chr545998 5831 1481 973 15867 26482 35 --
NM_015076chr634510 982 116 --21545 701 --
NM_015087chr1372566 2296 1909 1689 1033 777 280 ------
NM_015090chr1106153 6022 5213 5040 3800 3793 2256 1819 1035 590 ------
NM_015091chr143532 184 95 --1231 144
NM_015092chr1644624 3732 1092 744 11240 --13638
NM_015110chr982406 2215 1787 1710 1698 862 808 801 11660 ----
NM_015115chr443102 1109 524 87 --22928 2706 --
NM_015132chr761963 1875 1671 1649 1597 1273 ------
NM_015192chr2062944 2300 2167 1888 982 492 11059 11173 --
NM_015200chr442489 2313 2044 698 ----1164
NM_015205chr13233825 3805 3773 3754 3748 3678 3668 3631 3599 3582 3531 3476 3434 3400 3378 3325 3277 3233 3227 802 522 509 233 13729 ----
NM_015216chr541309 600 540 416 ----11419
NM_015247chr1695416 5120 4564 4157 3933 1906 1828 1135 82 --11238 21252 285
NM_015250chr942054 1736 683 317 11995 11849 --
NM_015265chr262436 2015 1678 984 435 341 ------
NM_015271chr462702 1461 911 852 321 237 22997 1129 14055 --
NM_015272chr1642147 2132 1964 1748 164 --150
NM_015275chr1271901 1826 1682 631 412 318 102 127 21722 1656 --
NM_015285chr1882558 2383 2088 1837 1653 946 935 206 --1516 --
NM_015294chr1721031 186 ----1858
NM_015310chr8118393 8097 7830 6528 6325 6313 2842 2827 2471 913 327 27316 2807 12969 12289
NM_015313chr1164436 4396 4204 4197 3764 1565 ------
NM_015317chr252651 1988 977 699 296 ----12767
NM_015323chr65698 281 264 253 25 --11342 --
NM_015326chr162850 2804 2021 509 448 425 12183 --1674
NM_015336chr1252656 2467 1784 999 902 --12172 11995
NM_015347chr1252523 867 656 319 22 --1803 --
NM_015355chr1761977 1628 652 574 309 42 --3433 182 91 --
NM_015436chr443080 2320 894 137 ----13072
NM_015455chr583988 3563 3405 3230 1503 1427 1103 686 ------
NM_015475chr241033 978 683 178 11002 --1412
NM_015525chr64808 146 50 30 ------
NM_015535chr253033 3020 2948 2755 405 --11633 --
NM_015548chr64961 649 400 197 --1203 --
NM_015564chr563583 3185 844 202 49 26 ----13512
NM_015565chr2142242 2160 422 224 --12053 --
NM_015569chr1104557 4350 4181 3295 2978 1659 1401 1046 748 657 --34813 1298 92 --
NM_015571chr652512 2406 1775 802 533 --1972 --
NM_015575chr263572 3522 3184 3052 2305 903 13264 ----
NM_015640chr164563 4478 1531 1429 716 458 21770 1149 ----
NM_015906chr164623 4126 3939 1661 1116 1110 ------
NM_015938chr34375 290 237 29 1413 ----
NM_016018chr852825 1909 1060 836 782 166 12833 --
NM_016023chr822024 1980 ----12001
NM_016040chr152685 2059 2046 628 497 --12285 --
NM_016076chr173029 2468 1121 1099 1055 820 781 22403 2376 11269 --
NM_016083chr673494 2841 2623 2558 2471 1533 1189 ------
NM_016090chr114873 670 173 112 ------
NM_016096chr831684 1660 270 --12117 11852
NM_016132chr1542866 2357 608 531 --12650 12708
NM_016156chr1172318 1804 927 604 533 410 190 --22343 1922 1201
NM_016205chr461287 1033 921 587 478 472 ------
NM_016206chr3128834 7697 7287 6717 6635 6592 6347 2991 2030 1670 1021 662 18718 --17252
NM_016217chr663110 2937 1240 1148 493 54 21460 617 ----
NM_016260chr2147359 6815 6651 5955 5606 5254 5230 4915 4740 4697 2905 2824 2784 798 35156 4832 49 11500 --
NM_016289chr242203 2147 2033 193 --1897 1923
NM_016308chr151664 1519 1289 702 127 ------
NM_016424chr1741441 1378 455 423 --11499 --
NM_016436chr2072165 1801 996 914 398 387 62 1100 ----
NM_016472chr1441144 320 241 73 --1232 --
NM_016513chr643526 1396 1336 856 --11075 12665
NM_016530chr1583945 3714 3434 3070 3064 385 341 222 12563 1459 --
NM_016531chr464142 3719 3449 1319 1094 153 13203 43804 3306 606 89 --
NM_016542chrX51381 1363 653 578 303 --2696 30 --
NM_016544chr263859 3089 1589 1552 229 23 --13931 --
NM_016603chr571876 1860 1537 1485 717 240 24 11498 ----
NM_016620chr12289 259 11028 1564 --
NM_016654chr1531406 1374 946 1890 1564 --
NM_016950chr461135 548 500 339 223 109 ------
NM_017420chr1453377 3265 2795 2528 922 11346 ----
NM_017440chr123599 460 195 --1239 --
NM_017563chr364902 4569 1388 1115 785 515 25595 1675 ----
NM_017594chr963130 2669 2419 2333 412 99 --12884 --
NM_017610chr1551675 1571 1336 600 356 --11452 --
NM_017633chr653511 2830 2737 1010 666 ------
NM_017637chr9149411 7192 7156 6623 3482 3234 2901 2883 2727 2054 1695 1166 609 292 38559 7219 6936 ----
NM_017643chr1732867 2766 450 ----11178
NM_017644chr3114742 4554 4343 4243 4122 3315 1546 612 374 97 78 25102 3885 15117 --
NM_017650chr774790 4578 4165 3791 1932 991 409 11446 14839 15266
NM_017651chr641380 1036 1000 274 ------
NM_017658chr14104187 4156 3737 3359 3022 2948 2870 1616 465 304 --23907 1188 --
NM_017666chrX72262 2167 2115 2001 1613 422 289 --21892 362 --
NM_017694chr252097 2060 590 517 113 ------
NM_017709chr143613 2884 998 296 --22722 643 1431
NM_017719chr352164 2135 1918 1761 222 ------
NM_017737chr142152 1350 534 320 11774 22215 46 --
NM_017747chr53358 320 305 --1276 --
NM_017754chr654873 4683 3919 3341 996 --13623 13783
NM_017813chr844842 1928 1510 350 1616 15310 1929
NM_017824chr1072466 2048 647 436 358 327 270 ----22600 230
NM_017831chr1894622 3396 3258 3093 1374 1204 1041 861 189 --24406 250 --
NM_017848chrX63379 3079 1346 1338 1100 328 ------
NM_017902chr1085554 5489 5471 5428 4004 3584 1486 353 --11102 13666
NM_017919chr9115807 5588 5301 4472 4400 2256 2158 1998 1205 1177 1079 14138 ----
NM_017938chrX51919 1804 1726 754 212 ------
NM_017994chr773000 2717 726 692 621 276 199 ------
NM_018015chrX3763 742 395 ----1108
NM_018017chr1042589 865 703 317 --12408 --
NM_018027chr1043280 3037 2149 2097 --22381 2373 --
NM_018061chr141736 1721 266 26 1206 11394 --
NM_018084chr243308 2978 2933 1005 12269 ----
NM_018085chr188038 6920 6692 6475 6251 2771 2640 651 16581 12122 --
NM_018105chr841114 938 463 192 --1479 1899
NM_018120chr881203 1174 449 305 286 252 140 124 --11517 --
NM_018126chr43391 118 109 11416 1980 --
NM_018155chr373390 937 885 833 650 454 335 1750 12970 --
NM_018157chr1272352 1305 1192 966 908 738 512 22403 402 ----
NM_018176chr451543 1230 1220 652 152 ----1572
NM_018222chr1171938 1833 1557 1220 711 705 651 ------
NM_018243chr483887 3478 3201 2723 1403 1254 1088 700 ------
NM_018247chr642645 2547 838 211 31163 353 273 ----
NM_018254chr132432 2104 506 --22052 968 --
NM_018287chr1031040 294 171 11320 ----
NM_018293chr342791 2385 2229 1932 ------
NM_018302chr462467 1875 731 660 174 125 12380 ----
NM_018313chr372591 1950 1072 909 787 472 224 ------
NM_018351chr1294206 3818 3148 1903 1424 897 824 621 345 11145 13964 34574 3664 2990
NM_018362chr1153766 3664 2628 746 322 ------
NM_018364chr173493 3479 1339 1184 1131 797 482 --13771 --
NM_018374chr784531 4104 3920 3820 2049 1960 1933 1539 --14045 --
NM_018409chr463041 2656 2384 1006 764 660 ------
NM_018429chr572281 2237 475 371 293 264 60 1839 12560 --
NM_018440chr868731 7920 5835 3356 2776 2227 --48648 8605 5244 95 12208
NM_018444chr862383 2120 1845 1608 1477 467 1412 ----
NM_018482chr831749 799 250 1741 22527 2041 --
NM_018555chr1972249 2233 1551 1508 532 519 459 1484 ----
NM_018566chr1104650 4438 3896 3355 1450 1125 854 446 339 215 --13532 14557
NM_018638chr12125412 5384 4607 4168 3527 1625 1407 1072 1006 979 527 339 --1916 --
NM_018640chr1262813 2678 2310 855 221 65 --12121 --
NM_018695chr532249 1867 304 1310 ----
NM_018704chr151975 1623 1457 737 191 22155 410 ----
NM_018710chr861311 863 387 375 274 234 1332 ----
NM_018834chr551029 883 815 794 179 ------
NM_018844chr752089 1752 1298 696 237 --12023 --
NM_018940chr53949 910 87 2860 446 ----
NM_018945chr623606 2500 1835 11123 --
NM_018947chr7104685 4542 3931 3870 3210 3147 3049 1459 1165 607 11411 1631 --
NM_018958chr1542746 1561 807 191 ------
NM_018999chr1094701 4597 3655 3131 1541 1416 1397 1370 906 ------
NM_019022chr1882733 2224 1053 878 615 401 350 156 ------
NM_019045chrX2920 771 --2324 303 --
NM_019050chr442125 1398 224 29 1600 1358 --
NM_019067chrX74810 4753 3605 3537 3325 1807 178 14469 ----
NM_019114chr941596 927 661 532 12166 ----
NM_019117chrX103440 3202 3141 1001 937 756 717 521 210 80 1195 --13288
NM_019593chr2051022 785 636 326 277 --1503 --
NM_020122chr275012 4674 4459 1565 924 912 116 ----15360
NM_020123chr1031429 1058 247 ----1382
NM_020141chr152218 2061 1968 944 286 ------
NM_020148chr1892887 2228 2189 2125 1941 1916 560 404 138 1420 12070 12088
NM_020177chr543011 2099 991 734 --23354 2201 --
NM_020193chr113951 920 474 ----1887
NM_020198chr1721478 645 --11314 11590
NM_020297chr1263627 3133 2887 1296 1219 24 22613 1043 --11285
NM_020336chr2063615 2771 2413 589 546 323 ----13225
NM_020337chr482942 2184 1970 1948 1132 564 434 71 --22006 853 --
NM_020342chr242347 981 944 281 22312 1047 ----
NM_020346chr1121133 699 179 --1282
NM_020347chr352289 2059 786 88 32 --21892 239 --
NM_020357chr3--11496 --11475
NM_020390chr384786 3672 3421 3379 3085 1758 1622 531 --11549 1835
NM_020432chr762294 2223 1800 1495 177 122 ------
NM_020466chr61610 14622 11418 1904
NM_020640chr352042 2010 1926 842 330 1385 1550 11602
NM_020647chr831776 1482 717 12178 --12124
NM_020654chr361416 1396 1220 416 287 247 1343 1663 1326
NM_020673chr20117430 6519 6497 6372 2662 2341 2308 2100 1732 1157 877 27550 5881 1746 --
NM_020711chr232535 1798 1711 12344 --12452
NM_020717chrX64498 4131 3792 3346 769 724 13482 ----
NM_020718chr1666273 4869 4794 4087 1591 1105 --1110 --
NM_020728chr732528 736 711 --1375 13169
NM_020734chr1272315 2260 2105 1112 1074 812 386 --22493 2253 12471
NM_020739chr1552834 1595 1555 457 382 13609 ----
NM_020742chrX42723 2481 795 486 12102 --1877
NM_020748chr1782175 1998 1789 1622 1572 671 634 260 --11677 --
NM_020771chr631509 1107 979 ----11272
NM_020772chr17107297 7191 5728 5369 3415 2730 1420 1279 747 236 --17531 --
NM_020774chr18115774 5759 5507 4855 4825 4458 4061 1799 1378 781 550 25797 5559 24529 457 --
NM_020782chr1274633 4041 3950 1867 935 442 115 1794 --14322
NM_020794chr141408 1319 605 297 --11443 1575
NM_020801chr551728 544 343 329 282 22225 134 ----
NM_020802chr114606 596 575 265 --23354 3329 --
NM_020810chr1423141 650 --32271 466 39 1931
NM_020819chr63429 323 238 --1967 --
NM_020841chr1273484 3345 3255 1627 1621 621 274 43585 3230 2464 256 12494 --
NM_020844chr887551 6479 6363 6113 5585 5400 4895 302 35703 5147 1902 22826 2460 1859
NM_020866chr1341003 975 944 212 1890 ----
NM_020871chrX72335 1889 724 608 338 318 136 --1576 --
NM_020872chr391736 1602 1443 1430 1336 1315 336 222 215 1320 1303 11555
NM_020935chr2104293 3673 3610 3152 3139 2827 1608 799 256 194 --22964 683 11557
NM_020940chr1062948 2885 2332 1095 964 889 --11048 --
NM_020948chr143391 3090 872 700 --13214 --
NM_021007chr271964 900 865 834 778 759 596 ------
NM_021083chrX53638 3267 2782 2520 1347 ----13175
NM_021090chr2234496 4053 3332 13772 --23097 321
NM_021111chr92260 107 21179 253 --11196
NM_021148chr762029 1791 1678 1597 711 173 ------
NM_021252chr1041530 1407 1392 261 --11443 --
NM_021255chr1453965 3771 3226 661 338 13040 ----
NM_021647chr4134687 4094 3989 3931 3242 3143 3010 2968 1679 1368 1002 879 601 13659 --14305
NM_021813chr675508 5192 4984 4943 3739 2059 480 ------
NM_021911chr585046 3921 3706 3447 3420 2024 1653 231 15495 23478 1596 --
NM_021949chrX92922 2774 2003 932 910 379 361 317 218 ------
NM_021961chr1197301 7042 6833 6820 2964 2232 2052 1794 49 --16882 --
NM_021964chr385808 5505 5444 4254 2002 1519 899 828 16615 1194 --
NM_022048chr1544207 4172 2290 1820 15389 15659 11661
NM_022049chr141865 1474 1415 1349 --11590 --
NM_022058chr241923 1823 395 119 11408 --11797
NM_022080chr204789 597 310 268 32015 961 107 --12209
NM_022114chr184295 4200 3554 3220 1682 1191 1100 857 14776 34040 1853 1653 --
NM_022118chr136531 465 249 232 75 26 ----1568
NM_022133chr86694 603 506 208 133 119 --1499 --
NM_022458chr752805 2417 2117 958 949 1297 22040 1258 12686
NM_022459chr13116268 4848 4550 4153 1674 1613 1530 840 761 304 211 25303 1374 11542 --
NM_022473chr1574394 3861 3823 2831 752 651 50 12898 21709 335 --
NM_022735chr161782 1720 1575 1531 1343 270 ----1262
NM_022781chr973128 2816 2073 1254 1195 950 882 --21130 46 --
NM_022824chr551818 1550 1507 462 451 --1372 --
NM_022841chr1552572 1981 1835 248 44 12230 --12175
NM_022901chr961701 1614 1390 316 211 106 1124 11592 --
NM_022977chrX62561 2170 2134 2061 981 968 12448 ----
NM_023074chr1941023 847 362 25 1369 1962 --
NM_024341chr1973669 2794 2556 1267 1193 485 347 ----23909 1116
NM_024345chr9105957 5871 5704 5478 4785 4382 4262 3921 1232 291 24650 2270 ----
NM_024524chr362263 2237 2141 531 363 241 ------
NM_024557chr1141661 1540 1453 1308 --11338 --
NM_024569chr151862 730 310 194 158 --21815 685 --
NM_024590chr421696 1440 --1603 1524
NM_024596chr864911 4561 4003 3408 3344 1970 24395 4354 ----
NM_024613chr831840 1329 477 1450 --1515
NM_024638chr352219 2064 2008 629 396 22281 156 --11875
NM_024639chr632715 1950 676 --1847 1867
NM_024665chr344475 3920 3686 314 13286 11187 13665
NM_024700chr131054 772 215 --1912 11118
NM_024702chr172432 93 ----1657
NM_024744chr242661 937 733 538 11699 ----
NM_024745chr1641083 268 256 45 --1376 --
NM_024763chr13274 252 71 2941 267 11099 --
NM_024770chr2136565 6088 4820 4648 4551 4165 2328 2306 2261 1278 538 235 158 14399 ----
NM_024817chr1565769 5197 4073 3838 1326 292 12195 13762 1554
NM_024854chr1251440 1399 1217 1201 26 ------
NM_024884chr14114605 3340 3314 3304 3174 3134 2908 1513 1441 1408 191 ------
NM_024896chr952153 1939 1632 234 26 1813 1112 12371
NM_024899chr18--1619 --1609
NM_024900chr451850 1461 585 150 67 ------
NM_024900chr451850 1461 585 150 67 ------
NM_024920chr421063 454 ----1236
NM_024930chr562594 2480 2085 941 880 867 ------
NM_024947chr3169496 9355 9321 9112 8994 7935 7065 7039 3853 2718 2558 2262 1974 1379 512 354 16772 36827 2070 1885 1223
NM_024949chr464952 1627 421 315 214 140 13518 ----
NM_024953chr1272095 1897 1784 879 562 244 230 --1238 12232
NM_024979chr1321238 567 ----1508
NM_024989chr2128007 6605 6597 6393 6183 5402 5388 2696 2683 1671 964 558 15344 35951 5233 1974 --
NM_025054chr883859 3725 3512 2987 1591 1583 1298 409 --13069 13587
NM_025073chr1104557 3146 1138 949 714 668 652 343 296 193 ------
NM_025134chr1642298 2240 1796 616 11950 --1477
NM_025152chr1461968 1478 1386 1245 539 135 ------
NM_025160chr153953 1395 1364 631 603 1808 14249 --
NM_025208chr1172409 2317 2280 1975 520 333 22 ------
NM_025214chr1862693 1845 963 731 604 120 12651 ----
NM_025222chr352972 2135 1026 537 323 1859 1121 --
NM_025235chr1052235 1842 552 527 441 --22015 499 --
NM_025237chr1731470 1419 1243 31376 1369 601 11180 --
NM_030621chr1493981 3632 3034 2697 1597 1111 727 614 170 23720 1611 24112 832 --
NM_030627chr523978 3827 --33105 2947 2931 12527
NM_030647chr746130 5648 5162 4815 --1482 --
NM_030648chr495150 5076 5045 4861 3853 1350 412 142 107 --1741 15441
NM_030650chr243737 3251 2815 491 --11430 --
NM_030664chr1052272 1877 1832 757 732 ------
NM_030670chr1221923 757 22191 1531 1160 1130
NM_030671chr1221923 757 22191 1531 1160 1130
NM_030674chr1255685 5104 1879 510 242 25373 4632 ----
NM_030755chr1492859 1143 1052 956 845 684 573 547 304 12412 ----
NM_030806chr1129424 9401 8668 8207 7450 6382 2844 2552 2154 2038 1782 1711 28625 1047 26193 1886 --
NM_030816chr173593 3201 3192 2670 2578 2561 2462 ------
NM_031362chr232612 1750 194 22348 2045 11726 --
NM_031365chr242748 1886 1845 330 22484 2181 21862 1837 --
NM_031366chr242748 1886 1845 330 22484 2181 21862 1837 --
NM_031418chr1152538 1986 579 400 107 ----12515
NM_031435chr1253196 3013 2512 773 198 13052 1161 --
NM_031461chr8102213 1977 1687 1534 1483 831 744 422 295 269 11658 ----
NM_031469chr673873 3621 2956 1077 1052 853 64 21628 1151 11478 12734
NM_031483chr2052690 2537 2396 1260 1232 1530 ----
NM_031844chr164058 3733 2666 2658 2502 473 11396 ----
NM_031845chr232362 822 168 11110 1219 --
NM_031847chr232362 822 168 11110 1219 --
NM_031911chr442508 1097 1033 738 ----11968
NM_032012chr995103 4627 3809 1437 1086 1066 1054 1009 137 21301 928 13212 13330
NM_032121chrX32155 1993 408 ----12692
NM_032160chr1844189 3234 1709 784 11692 ----
NM_032186chr12289 259 11028 1564 --
NM_032189chr13223627 3607 3575 3556 3550 3480 3470 3433 3401 3384 3333 3278 3236 3202 3180 3127 3079 2013 604 324 311 35 13531 ----
NM_032288chr342330 2090 1698 901 ----12389
NM_032321chr243014 2420 2337 2117 --22761 2343 --
NM_032373chr10104433 4061 2255 1746 1489 1472 1041 852 735 377 22244 1173 12106 --
NM_032410chr851173 1139 1067 874 230 ------
NM_032435chr152386 1795 1543 771 607 11890 12159 --
NM_032439chr1051371 636 614 595 106 1407 ----
NM_032440chr1072880 2444 1856 850 591 465 269 ------
NM_032445chr1521793 781 ----11667
NM_032446chr563548 3542 3526 2857 2527 947 12962 ----
NM_032458chrX113091 2709 2591 2412 2095 1175 837 749 308 301 61 --12506 12444
NM_032521chr2012324 --13076 13098
NM_032689chr192531 168 21627 1604 --21592 581
NM_032804chr1021989 1022 ----1813
NM_032839chr33498 389 145 ----1364
NM_032859chr13103984 3924 3821 3681 3375 2934 2533 512 231 160 --21165 493 --
NM_032869chr851339 813 598 448 415 --11846 --
NM_032873chr1153722 3041 1791 906 744 1524 11441 --
NM_032968chrX43314 2723 1296 1040 23140 1229 13440 --
NM_032969chrX43314 2723 1296 1040 23140 1229 13440 --
NM_032973chrY43309 2718 1296 1040 23135 1229 13436 --
NM_033020chr164623 4126 3939 1661 1116 1110 ------
NM_033030chr251262 1144 449 401 379 ------
NM_033083chr353369 3103 2308 730 140 1822 ----
NM_033135chr1172409 2317 2280 1975 520 333 22 ------
NM_033143chr4124660 4272 4264 4251 4236 4180 3526 1778 1734 967 894 456 1676 ----
NM_033181chr673494 2841 2623 2558 2471 1533 1189 ------
NM_033224chr757446 6555 5669 3217 815 --25061 2732 --
NM_033225chr863086 2667 2046 753 315 194 ------
NM_033285chr884162 3331 3040 1795 882 833 174 113 13632 147 --
NM_033331chr953546 3519 3424 810 597 ------
NM_033338chr1041331 881 276 58 ----1499
NM_033339chr1041331 881 276 58 ----1499
NM_033360chr1274518 4458 3541 3053 1778 793 500 --1896 14076
NM_033389chr1754403 3660 2975 1066 626 ------
NM_033656chr2185940 5218 4738 4380 4243 4091 1317 444 14998 --14702
NM_052832chr852499 1129 1107 934 57 --13022 --
NM_052834chr1882558 2383 2088 1837 1653 946 935 206 --1516 --
NM_052851chr1332180 354 346 11943 11936 --
NM_052879chr1274024 3585 3134 1553 1539 1374 977 --11396 --
NM_052885chr12104913 4870 4306 3868 3436 1832 1129 949 369 124 --13815 --
NM_052886chr852006 1791 1764 760 208 11669 ----
NM_052905chr21570 21894 56 --1470
NM_052917chr273341 2819 2803 2175 1141 577 537 12122 13095 --
NM_053016chr9136431 5791 5743 5203 3141 2884 2774 2656 2122 2092 1372 548 54 25801 1557 --16240
NM_053043chr775697 5423 4656 4620 2250 1296 217 2879 785 --12505
NM_053064chr1473068 2965 2817 2579 793 742 311 1686 12048 22616 2082
NM_054016chr141351 637 337 331 ------
NM_054016chr141351 637 337 331 ------
NM_054016chr141351 637 337 331 ------
NM_080676chr2032908 2787 871 --2756 317 12989
NM_080759chr1352549 2004 942 576 522 --1803 --
NM_080760chr1352549 2004 942 576 522 --1803 --
NM_080867chr1444582 4133 401 251 31183 302 277 24920 4711 --
NM_080872chr873130 1533 1280 1250 1173 938 195 1888 1844 --
NM_080927chr332149 92 42 ----12967
NM_130386chr184678 556 236 223 ----123
NM_130435chr1052831 2816 527 282 267 ------
NM_130798chr1541480 1035 954 270 11195 1240 --
NM_133170chr2047719 5775 2401 2105 27486 5981 ----
NM_133265chrX63257 3209 3179 2334 1061 677 --13450 --
NM_133329chr241744 456 427 59 --1463 --
NM_133334chr496004 5563 4206 2459 2065 1647 949 229 201 ------
NM_133370chr4103376 3242 3050 3023 2420 1468 1384 1369 1100 386 12558 ----
NM_133372chr562962 2793 2601 2548 825 572 ------
NM_133477chr463155 3122 2736 2552 2364 1210 1920 22258 1270 --
NM_133478chr231794 687 521 12470 12445 --
NM_133638chr541157 1148 98 42 11069 --11078
NM_134447chr193429 414 28 1547 183 --
NM_138270chrX63129 2845 2134 1252 1132 388 1785 13223 11002
NM_138286chr1963857 3821 3749 2703 253 206 14137 23342 853 --
NM_138423chr153274 179 164 ----1896
NM_138444chr1343809 3390 3217 1124 --11673 --
NM_138468chr295458 4669 4451 4037 2336 1508 981 958 181 --16170 --
NM_138473chr1244615 3471 635 29 11414 1616 --
NM_138494chr742741 2327 559 301 --22800 317 --
NM_138713chr16148083 7541 7384 7233 6605 6159 6076 6045 3297 3138 2796 1417 1295 201 17521 ----
NM_138714chr16148083 7541 7384 7233 6605 6159 6076 6045 3297 3138 2796 1417 1295 201 17521 ----
NM_138731chr14153679 3651 3547 3526 3519 2782 2689 1301 1079 699 607 433 348 340 36 13439 --11021
NM_138811chr741050 845 321 128 --11076 --
NM_138959chr1116801 6632 6506 6312 6193 5172 5078 4212 2518 462 431 ------
NM_139012chr642066 1798 1682 760 11672 ----
NM_139014chr642146 1878 1762 840 11752 ----
NM_139279chr293447 3205 2552 2399 2246 2196 945 531 329 --1380 --
NM_139321chr2042584 1411 848 570 22726 2621 ----
NM_144571chr4105148 4270 4244 2774 2665 2217 2210 1778 1770 551 36940 6297 622 11131 --
NM_144578chr1435302 4706 46 159 1175 --
NM_144599chr1595397 5008 4373 4320 4214 4114 4032 3439 1392 11984 34447 4330 805 1352
NM_144664chr1141018 840 782 556 11591 22509 1039 --
NM_144684chr1942869 2280 1873 818 22297 847 ----
NM_144973chr1264956 4863 4182 3601 3251 109 --34105 3872 3777 --
NM_145203chr133783 727 317 1764 184 1952
NM_145251chr143453 237 219 --1112 --
NM_145259chr256001 5667 2822 2473 1477 1341 14445 --
NM_145307chr1084439 4084 3566 3533 3323 3142 958 716 --23577 1608 --
NM_145808chr752966 2388 2341 1165 1112 --22497 643 1854
NM_145893chr1631173 263 195 ----11164
NM_147156chr1051225 949 386 339 251 ------
NM_147190chr122249 31 ----1497
NM_148894chr421156 1130 --11226 11011
NM_148955chr1596433 6388 5574 5022 2163 2091 1854 1596 1533 24358 2297 14066 1396
NM_152261chr1241612 897 393 339 12563 ----
NM_152330chr1472586 2458 2240 986 911 343 73 --1332 1358
NM_152332chr1442379 2139 764 572 ----12762
NM_152407chr551251 734 557 310 122 186 ----
NM_152409chr592581 2235 862 797 753 710 586 514 158 --23506 2213 --
NM_152424chrX54330 4230 1655 1594 424 --11572 --
NM_152446chr142719 294 ----131
NM_152529chr284373 1612 1451 908 820 153 34 25 11726 23601 176 --
NM_152538chr341886 1233 602 521 --1641 1541
NM_152594chr1552046 1761 607 541 120 ------
NM_152608chr132599 2405 237 --22249 1645 --
NM_152624chr5106539 6072 5482 5345 5069 4605 2832 1072 919 446 15887 22717 681 --
NM_152629chr994142 3909 3695 3540 3007 1427 1274 1152 539 1330 14075 --
NM_152636chr1152039 826 708 232 118 33019 2628 638 ----
NM_152641chr1262796 2660 2322 1083 330 52 1352 12155 --
NM_152673chr343999 1503 253 181 44405 4383 4125 4076 1653 11626
NM_152678chr342432 2293 643 483 11817 --12096
NM_152687chr521245 239 21148 352 --11185
NM_152716chr1141630 1504 1350 485 --11247 --
NM_152734chr674701 4635 4009 3839 3747 1983 1803 25063 3573 ----
NM_152754chr793386 3326 3141 3126 2824 2807 1475 1430 888 13609 ----
NM_152756chr553104 2731 1652 523 46 24048 141 ----
NM_152758chr862919 2202 1982 1950 1148 939 ----12940
NM_152774chr742669 2439 1983 1907 1780 1897 1348
NM_152787chrX63571 3185 2763 2506 1088 579 --12423 --
NM_152789chr751350 1263 1241 1089 398 ------
NM_152793chr743541 3351 2012 1349 --11020 --
NM_152826chr1596433 6388 5574 5022 2163 2091 1854 1596 1533 24358 2297 14066 1396
NM_152836chr86694 603 506 208 133 119 --1499 --
NM_152837chr86694 603 506 208 133 119 --1499 --
NM_152838chr2043137 1344 319 37 11250 1894 --
NM_152902chr151596 1507 629 196 190 ------
NM_152903chr1352454 2146 1119 853 296 12153 ----
NM_152919chr1953743 3547 3100 1346 222 23106 829 ----
NM_152924chr1576814 6556 6463 2443 2041 1928 411 --12155 12462
NM_152999chr7105022 4760 4392 4360 4051 3161 3113 1361 1108 706 11023 --24635 3975
NM_153050chr2234496 4053 3332 13772 --23097 321
NM_153051chr2234496 4053 3332 13772 --23097 321
NM_153188chr5125643 5259 5003 4635 4569 4170 3989 3847 3569 3493 1492 940 1498 24149 1619 11736
NM_153207chr1243461 2912 804 461 ----13482
NM_153332chr883024 2401 1229 953 745 331 222 144 23009 2967 12313 --
NM_153456chr1355855 5074 4143 3818 1933 35588 1201 352 36138 5961 4045 16001
NM_153607chr563088 3003 2841 847 119 47 11966 1235 1976
NM_153619chr1553644 2716 2690 2502 1399 12366 ----
NM_153645chr2232744 2431 1071 21176 882 ----
NM_153686chr431549 707 175 2920 819 1167 --
NM_170665chr1244517 1230 720 634 11144 --193
NM_170709chr832148 746 438 --11717 --
NM_172069chr251704 1657 1449 873 638 --12320 --
NM_172070chr262000 1866 1801 1508 701 160 ------
NM_172071chr1107197 6410 6052 4561 2056 1657 843 733 393 179 ----11836
NM_172127chr461864 716 679 197 176 165 ------
NM_172128chr461820 672 635 153 132 121 ------
NM_172344chr241744 456 427 59 --1463 --
NM_173082chr651528 1361 1178 1086 361 1165 ----
NM_173214chr16148083 7541 7384 7233 6605 6159 6076 6045 3297 3138 2796 1417 1295 201 17521 ----
NM_173468chr495483 4874 4369 4303 2267 1981 1551 743 724 --12277 --
NM_173470chrX32882 1965 211 --12343 12821
NM_173478chr174865 760 684 188 --1766 11073
NM_173511chr242501 1231 446 269 --23268 2522 11345
NM_173519chr871402 1284 677 622 270 92 67 22022 1983 1787 11916
NM_173531chr1952745 2618 443 436 324 12936 23266 1079 13553
NM_173536chr495210 4064 3493 3303 1578 1363 1051 967 228 --1925 --
NM_173545chr251619 1406 463 33 22 21920 388 ----
NM_173552chr34896 754 624 100 ----1180
NM_173576chr1032279 662 328 --1427 12016
NM_173582chr11115569 5245 4495 2005 1910 1825 1605 1110 1009 911 38 --14997 --
NM_173602chr1221248 799 1110 21156 255 23201 347
NM_173642chr199157 9030 8279 7705 7002 6338 5948 1292 251 17157 28736 7677 18340
NM_173644chr2041868 684 431 402 11830 11735 --
NM_173698chrX21680 1323 --1467 1745
NM_173797chr53376 325 212 ----11043
NM_173808chr113020 1865 1113 21350 529
NM_173826chr361744 1459 612 546 478 94 ------
NM_173851chr882996 2729 2509 2498 2473 1283 1246 586 11400 ----
NM_175061chr772195 1775 1490 561 466 411 189 --12075 --
NM_175767chr551675 1494 1417 694 55 ----11833
NM_175854chr1352144 1873 1741 770 91 ------
NM_175861chr1241572 783 635 76 14450 11582 12180
NM_175876chr152598 2324 1859 1026 684 ------
NM_175921chr584191 3886 3345 3146 1727 1601 1469 916 --1711 --
NM_176823chr1103892 3626 3447 3210 3075 2753 2686 2370 1094 480 ------
NM_176863chr172725 634 --21719 626 2447 70
NM_177414chr161524 1340 1327 1148 612 361 1373 ----
NM_177438chr1493981 3632 3034 2697 1597 1111 727 614 170 23720 1611 24112 832 --
NM_177968chr22238 158 --1804 11509
NM_177974chr153274 179 164 ----1896
NM_178006chr1332180 354 346 11943 11936 --
NM_178007chr1332180 354 346 11943 11936 --
NM_178011chr1083313 3279 2953 2683 949 646 374 317 11143 ----
NM_178151chrX87839 7228 6920 6673 6489 3012 771 362 21042 810 17259 1818
NM_178152chrX87839 7228 6920 6673 6489 3012 771 362 21042 810 17259 1818
NM_178153chrX87839 7228 6920 6673 6489 3012 771 362 21042 810 17259 1818
NM_178313chr272194 1987 1653 1608 1384 764 122 --12108 1257
NM_178496chr341454 978 181 86 ----1460
NM_178509chr1783693 3225 3167 473 426 278 242 29 --33500 1238 309 --
NM_178539chr1252022 1685 639 540 441 ------
NM_178826chr126770 689 601 577 264 186 ------
NM_180989chr1342153 2037 881 474 11592 ----
NM_180991chr532728 371 103 11971 --12548
NM_181332chrX42723 2481 795 486 12102 --1877
NM_181354chr831409 1211 663 1643 1289 --
NM_181358chr143835 3767 1253 590 --1884 --
NM_181457chr231036 919 146 --2967 139 --
NM_181458chr231169 1052 279 --21100 272 --
NM_181459chr23935 818 45 --2866 38 --
NM_181460chr23982 865 92 --2913 85 --
NM_181481chr1886914 6380 5904 2620 2593 2016 1759 935 --194 --
NM_181482chr1886914 6380 5904 2620 2593 2016 1759 935 --194 --
NM_181483chr1886914 6380 5904 2620 2593 2016 1759 935 --194 --
NM_181659chr2043314 2845 2830 2797 13373 23060 696 --
NM_181659chr2043314 2845 2830 2797 13373 23060 696 --
NM_181705chr5105493 4457 4407 3592 2229 1991 1317 811 380 133 15254 11387 --
NM_181723chr8112317 2309 2174 2101 1983 1841 1745 1620 1474 608 406 22201 301 ----
NM_181782chr662113 2084 1823 1780 347 146 ------
NM_181869chr1262814 2795 2783 2505 809 35 ------
NM_181886chr421365 394 11074 1151 1470
NM_181887chr421365 394 11074 1151 1470
NM_181888chr421365 394 11074 1151 1470
NM_181889chr421365 394 11074 1151 1470
NM_181890chr421365 394 11074 1151 1470
NM_181891chr421365 394 11074 1151 1470
NM_181892chr421412 441 11121 1198 1517
NM_181893chr421365 394 11074 1151 1470
NM_182485chr453250 2715 2624 764 127 --1920 --
NM_182503chr685184 4824 4381 3588 3444 1879 1581 1227 --31431 1299 87 --
NM_182551chr233112 927 820 1812 1373 --
NM_182641chr1761915 1886 1813 1452 579 481 ------
NM_182646chr453250 2715 2624 764 127 --1920 --
NM_182715chr741118 443 404 143 --1193 --
NM_182734chr2063191 2547 2414 2135 1229 739 11306 ----
NM_182757chr633422 905 789 --11234 142
NM_182762chr7106232 6063 5988 5064 4486 4332 4215 3906 1085 398 ------
NM_182765chr1062269 2144 2095 1665 443 217 ------
NM_182767chr1251775 1439 1388 231 183 ------
NM_182898chr7116521 6392 6022 5725 5713 4885 2429 2403 1760 1475 1100 ------
NM_182899chr7116521 6392 6022 5725 5713 4885 2429 2403 1760 1475 1100 ------
NM_182907chr642378 2122 1965 1679 1880 32261 1539 1472 --
NM_182972chr152591 2566 2420 1871 754 1713 11897 --
NM_183004chr1461543 1341 1196 996 744 264 ------
NM_183234chr1541670 493 370 68 --1385 --
NM_183235chr1541670 493 370 68 --1385 --
NM_183236chr1541670 493 370 68 --1385 --
NM_183380chr64961 649 400 197 --1203 --
NM_183416chr151837 770 688 638 104 ----11289
NM_183422chr1331011 374 131 1792 1166 --
NM_194071chr784983 4409 4147 3839 3525 1357 579 47 --14166 --
NM_194247chr253493 2943 2807 1431 315 13743 --1782
NM_194282chr452707 2260 827 426 313 ------
NM_194283chr554199 2805 355 303 107 1451 23436 689 --
NM_194285chr1112634 --22653 532 12430
NM_194291chr862807 2361 2105 523 376 339 1658 1738 22290 1163
NM_194314chr174964 3823 2104 2045 1979 1669 847 --11071 11817
NM_194317chr262604 1851 717 587 311 94 --12544 --
NM_194328chr973128 2816 2073 1254 1195 950 882 --21130 46 --
NM_194329chr973128 2816 2073 1254 1195 950 882 --21130 46 --
NM_194330chr973128 2816 2073 1254 1195 950 882 --21130 46 --
NM_194332chr973128 2816 2073 1254 1195 950 882 --21130 46 --
NM_194434chr181126 14973 15068 15768
NM_194454chr741395 1343 1131 431 11525 ----
NM_194455chr741395 1343 1131 431 11525 ----
NM_194456chr741395 1343 1131 431 11525 ----
NM_197970chr251262 1144 449 401 379 ------
NM_198181chr1521893 964 --11983 1957
NM_198268chr143835 3767 1253 590 --1884 --
NM_198269chr143835 3767 1253 590 --1884 --
NM_198270chrX83355 2820 2808 2246 695 596 449 404 12486 --150
NM_198273chr593144 2577 2418 2171 2148 968 879 856 499 --32382 947 35 --
NM_198336chr721808 513 --21196 503 11506
NM_198400chr1572230 2182 1914 993 794 712 127 --12640 --
NM_198465chrX72845 2716 2252 2134 1938 1840 776 --12696 --
NM_198503chr192399 1837 1649 1640 895 624 466 402 107 12311 ----
NM_198578chr1241386 1085 481 94 --178 --
NM_198581chr2126944 4984 2995 2636 2251 1908 1433 1425 1230 739 694 585 26842 137 --1710
NM_198715chr185391 4166 3841 3831 2452 1626 696 456 42225 1850 1041 337 14990 --
NM_198793chr363314 1614 1532 1297 889 705 --12883 --
NM_198859chr384772 4551 4185 3671 3134 1942 1930 1906 --2599 404 --
NM_198935chr2092785 2358 2038 1248 1097 1034 1024 662 470 12442 12984 12571
NM_198947chr1141066 893 855 327 ------
NM_199000chr742128 2016 734 282 --1838 --
NM_199003chr831398 1222 476 ----11183
NM_199072chr753090 2295 2268 2211 167 12334 --12965
NM_199188chr1274024 3585 3134 1553 1539 1374 977 --11396 --
NM_199189chr551029 883 815 794 179 ------
NM_199190chr1274024 3585 3134 1553 1539 1374 977 --11396 --
NM_199320chr432678 947 462 11922 --12819
NM_199320chr432678 947 462 11922 --12819
NM_199421chr1444582 4133 401 251 31183 302 277 24920 4711 --
NM_199436chr272900 2203 1997 1230 1060 731 119 ------
NM_199454chr184295 4200 3554 3220 1682 1191 1100 857 14776 34040 1853 1653 --
NM_201269chr12289 259 11028 1564 --
NM_201278chr1172318 1804 927 604 533 410 190 --22343 1922 1201
NM_201281chr1172318 1804 927 604 533 410 190 --22343 1922 1201
NM_201432chr17105972 5849 5279 4934 4639 4246 2162 2004 1648 1004 --1323 --
NM_201433chr17105972 5849 5279 4934 4639 4246 2162 2004 1648 1004 --1323 --
NM_201548chr261502 1471 1246 1132 232 216 ------
NM_201559chr694952 4773 4622 4441 3767 3376 1935 576 550 --34740 4523 424 --
NM_203301chr143686 525 33 11157 ----
NM_203349chr1562143 2021 1409 877 503 383 --1306 --
NM_203390chr831710 1639 215 --21568 1167 --
NM_203391chrX41767 1362 731 43 ------
NM_203406chr552116 1856 1092 944 562 ------
NM_203459chr151680 1020 952 934 560 1704 ----
NM_206594chr133470 2771 1270 33074 1353 1289 ----
NM_206595chr133470 2771 1270 33074 1353 1289 ----
NM_206853chr673452 3263 3059 2781 1441 1335 1019 1589 13955 13338
NM_206854chr694713 4524 4320 4042 3494 1103 1096 702 374 11850 15216 14599
NM_206855chr6125678 5489 5285 5007 4459 2068 2061 1667 1339 740 420 243 --16181 25564 870
NM_206866chr2153211 2875 2725 2291 1253 22299 679 --12576
NM_206876chr243021 785 566 249 1981 23447 2505 11203
NM_206907chr583063 2908 2889 1230 1008 831 327 313 ------
NM_206909chr8118393 8097 7830 6528 6325 6313 2842 2827 2471 913 327 27316 2807 12969 12289
NM_207303chr1073514 3481 1608 1440 1239 1217 307 13531 --1531
NM_207361chr131395 --35078 1689 234 26109 5234
NM_207406chr4146534 6515 5933 5784 5640 4407 4366 4321 2296 2082 1660 1143 500 465 12171 ----
NM_207647chr962548 2167 1616 1012 904 314 12130 22280 475 --
NM_212558chr954103 3478 3011 1375 854 --14129 11131
NM_213589chr294836 4564 3931 3712 1212 991 791 694 148 21445 577 15563 --