TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-361-3p
miRNA Sequence: UCCCCCAGGUGUGAUUCUGAUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr121748 1153 ------
NM_000138chr152951 271 ------
NM_000208chr1944424 3743 3038 243 ------
NM_000212chr173892 172 103 ----1725
NM_000278chr103658 632 624 --11401 11454
NM_000332chr665699 2248 1203 825 503 392 21607 833 ----
NM_000461chr323255 1495 1251 --13923
NM_000462chr1521539 179 ------
NM_000615chr1131970 1136 1002 --1633 --
NM_000633chr1894953 4873 4125 1576 1557 1161 544 470 439 --1509 --
NM_000719chr1274740 4189 2582 2479 2457 1311 519 11782 14147 --
NM_000814chr1543771 3468 2956 618 ------
NM_000924chr127925 409 332 218 186 153 147 --1504 --
NM_000964chr1731327 396 119 --1280 21289 134
NM_000966chr1241002 697 36 30 1904 --184
NM_001001560chr224741 644 315 231 --1605 1578
NM_001002909chr172488 60 ------
NM_001003652chr1847259 5865 5247 3037 21302 578 ----
NM_001003681chr2231531 690 301 --1309 --
NM_001003792chr31882 ------
NM_001004304chr1283042 2563 1981 1182 1176 1008 826 354 33126 2762 1170 ----
NM_001004342chr196025 5226 4730 4548 2340 2242 2106 1198 156 15258 13897 --
NM_001004419chr1233960 852 351 ------
NM_001005505chr32490 347 --21682 1271 11675
NM_001006944chr115643 542 463 231 217 --1630 1488
NM_001008701chr1962611 2039 1233 821 791 694 1233 21964 167 --
NM_001009569chr1011159 ------
NM_001012393chr1131736 654 186 ------
NM_001012426chr673264 3223 2942 1211 604 577 28 --21356 701 11267
NM_001013635chr122808 419 ------
NM_001025079chr343351 959 610 98 ------
NM_001029863chr621020 701 ------
NM_001029998chr41220 ------
NM_001031690chr773079 2808 2575 2487 2381 2014 109 --12472 --
NM_001031695chr2285033 5025 4785 4561 3673 2163 1980 1102 ----1436
NM_001031738chr21329 ------
NM_001034841chr1685512 4419 3966 3909 3806 3604 1827 59 12081 25050 3505 --
NM_001037332chr512529 ------
NM_001038707chr141500 811 503 151 ------
NM_001040214chr61850 ------
NM_001040709chr192510 2055 1996 1904 1723 1588 768 321 262 ------
NM_001042601chr322111 827 ------
NM_001042603chr1255140 1755 1292 629 30 ------
NM_001206chr942158 1167 372 346 ------
NM_001241chr222114 1799 ------
NM_001332chr521324 445 1380 ----
NM_001364chr1131682 1601 1337 ------
NM_001406chr1761675 709 601 516 251 44 ------
NM_001420chr19102874 2572 935 740 728 642 432 365 190 165 --22892 2678 --
NM_002088chr191431 ------
NM_002101chr24437 401 365 349 ------
NM_002126chr1723702 1602 ------
NM_002140chr93742 371 221 ------
NM_002247chr10----12321 1236
NM_002267chr1321563 1502 ------
NM_002499chr1592163 2112 2037 1903 1845 1774 798 788 530 12123 1806 --
NM_002539chr2155 ------
NM_002628chr31229 ------
NM_002655chr841885 1633 1626 795 ------
NM_002843chr1153275 3058 2582 2566 170 12861 12658 --
NM_002868chr1242286 786 222 215 ----1495
NM_002874chr94844 724 564 122 ------
NM_002886chr354968 3868 3512 3248 350 ----1807
NM_002973chr121202 ------
NM_003011chr91165 ------
NM_003131chr6112126 1808 1782 1732 1441 864 826 574 497 488 388 21632 908 ----
NM_003164chr11131 ------
NM_003367chr192458 377 ------
NM_003413chrX11755 ------
NM_003458chr373716 3592 3085 1327 1309 1112 848 --1506 --
NM_003459chr21640 ------
NM_003468chr242750 1668 1616 311 ----11190
NM_003482chr1282193 1961 1943 1042 941 889 148 108 1340 11689 --
NM_003673chr171114 ------
NM_003722chr332691 719 375 ------
NM_003740chr691288 1186 659 652 439 369 217 121 95 ------
NM_003957chr115999 807 796 790 258 --1932 --
NM_003971chr171586 ------
NM_003988chr103735 709 701 --11478 11531
NM_004050chr1451899 1813 1717 1711 948 --137 1252
NM_004074chr111165 ------
NM_004187chrX41195 541 294 87 --1193 1346
NM_004230chr1972305 2239 2222 1935 1907 247 82 ----12291
NM_004422chr171381 ------
NM_004432chr931650 868 544 ------
NM_004444chr71151 ------
NM_004457chr22400 269 ------
NM_004482chr21369 ------
NM_004529chr931287 1280 1153 ------
NM_004643chr145667 644 312 240 188 ------
NM_004660chrY31870 1645 540 1835 ----
NM_004739chr112446 250 ------
NM_004774chr1743080 3008 2603 1245 ----1563
NM_004783chr163559 461 153 --1609 --
NM_004852chr181012412 12054 10013 3340 3267 2531 2524 1592 1096 96 24876 3296 ----
NM_004859chr1722720 2624 179 ----
NM_004866chr544857 4057 920 727 24865 249 ----
NM_004922chr103920 811 286 --1115 --
NM_005020chr71197 ----1227
NM_005028chr1042039 927 238 151 1399 ----
NM_005121chr1723361 147 ------
NM_005161chr1141688 1422 714 603 1268 11931 --
NM_005207chr2233692 1143 545 ------
NM_005313chr1541274 263 247 63 1234 ----
NM_005324chr171367 ----1747
NM_005574chr11288 26 ------
NM_005596chr934997 2067 1815 ------
NM_005604chr611733 1616 --1951
NM_005910chr17114029 3520 3428 3375 3094 3081 2772 1090 709 517 414 --1384 1367
NM_005920chr1123718 3699 3553 3421 2977 2915 2792 1012 983 956 731 330 --1260 11063
NM_005937chr1763673 2943 1426 1160 626 568 11144 21007 951 12793
NM_006040chr1641352 1184 954 387 ------
NM_006106chr1142342 1093 756 267 --12114 1276
NM_006160chr1751264 1130 1117 1017 139 --11291 --
NM_006202chr1961800 543 531 421 208 202 11257 --1685
NM_006315chr423725 2977 ------
NM_006534chr2022945 1314 13389 --11147
NM_006546chr17136086 6080 6042 5379 5297 5250 5039 4762 4373 4079 4060 1912 760 26550 5485 12088 15433
NM_006690chr2041537 878 178 115 --12264 12297
NM_006769chr11266 --1285 --
NM_006772chr631479 1156 212 --31522 534 360 1335
NM_006888chr1422725 2461 13466 11111 --
NM_007144chr177892 873 392 302 272 115 108 ------
NM_007249chr1378492 8054 7508 7426 3040 2766 2580 ------
NM_012199chr163531 3312 1591 1196 844 831 23892 2860 ----
NM_012218chr1942634 1038 801 456 ------
NM_012297chr421928 1897 ------
NM_012470chr71198 ------
NM_012479chr742375 1891 978 71 184 ----
NM_013279chr1162025 1871 1860 1833 1705 548 ----21634 523
NM_013390chr93642 456 328 ----129
NM_013433chr19111993 1735 1676 1411 1366 1270 801 616 597 232 57 ------
NM_014154chr3197 ------
NM_014232chr1761580 1283 1224 1123 1106 1051 --11192 --
NM_014591chr1041011 930 525 136 --2112 33 --
NM_014620chr122546 284 ------
NM_014730chr12114582 4567 4392 4357 4202 3795 3611 1980 1965 871 744 ------
NM_014751chr82595 327 ------
NM_014757chr561949 1902 1884 803 390 102 12223 11550 --
NM_014770chr1281270 1252 933 864 858 821 473 415 ------
NM_014827chr11162 ------
NM_014848chr1532233 2214 188 ----12482
NM_014891chr72173 130 1167 1290 1187
NM_014901chr561986 1824 1698 1631 830 645 ------
NM_014925chr122961 950 ------
NM_014932chr31139 ------
NM_015042chr1543340 1421 972 555 ------
NM_015075chrX72222 2175 2168 1932 1856 1829 1689 --2699 251 --
NM_015092chr1633956 3493 421 --23569 110 --
NM_015176chr11641 ------
NM_015291chr121219 568 ------
NM_015317chr232469 2022 174 1183 ----
NM_015344chr81109 ------
NM_015457chr114990 193 179 163 1807 ----
NM_015553chr624952 3653 ------
NM_015578chr1931792 474 181 ------
NM_015686chrX91896 1753 973 827 749 376 291 106 63 1122 ----
NM_015872chr1101667 1657 1641 1586 393 352 282 194 173 94 21320 520 21313 667 1551
NM_015955chr2194 ------
NM_016231chr172434 304 --1516 --
NM_016559chr311315 ------
NM_017628chr424699 3822 1404 13471 --
NM_017643chr1722500 763 1146 ----
NM_017813chr81438 24005 3940 --14334
NM_017848chrX54549 3712 3699 3489 3452 ----1666
NM_017902chr1033652 1786 1753 --14897 --
NM_017944chr11196 ----130
NM_018028chr1951168 1142 471 417 220 ------
NM_018469chr1711055 ------
NM_018489chr111791 ------
NM_018951chr73983 364 305 ----1219
NM_018979chr1242516 1828 536 65 --132 --
NM_019106chr2242730 523 500 412 --1512 1338
NM_019596chr2152858 1901 917 867 401 22593 2009 ----
NM_019884chr191234 ------
NM_020310chr1732417 593 501 --12457 --
NM_020699chr1115101 5095 4380 3670 1438 1431 846 721 651 606 298 --33942 1595 1194 --
NM_020772chr1786626 6084 2750 1540 1531 1244 629 621 159 --18319
NM_020795chr1731884 1664 1450 --1216 21905 683
NM_020899chr1742268 864 276 121 1678 ----
NM_021637chrX31287 211 99 ----11154
NM_021831chr21249 ------
NM_022048chr1576135 5318 5114 4628 819 569 33 21231 98 1435 --
NM_022455chr5153 ------
NM_022574chr752070 2064 1610 1458 434 41758 1587 828 663 1531 1186
NM_022658chr121198 ------
NM_022753chr132620 1886 652 ----12348
NM_022758chr632825 2700 54 1318 ----
NM_022894chr21264 ------
NM_024017chr1711597 ------
NM_024076chr1951837 1779 1720 633 608 ------
NM_024336chr161240 ------
NM_025134chr1622205 255 ------
NM_025250chr772964 2942 2572 2376 2267 830 414 ------
NM_030579chr1673399 2647 2389 840 815 64 40 ------
NM_030629chr1631380 283 84 1303 2295 134 --
NM_030964chr572870 2860 2691 1303 545 267 202 --11030 --
NM_032560chr1411056 ------
NM_032701chr194620 573 474 463 ------
NM_032804chr1041847 574 228 175 ------
NM_032873chr111408 13851 12940 1386
NM_033132chr1312056 --1270 --
NM_033211chr531544 1328 181 ------
NM_033224chr747414 4962 1465 820 ------
NM_033449chr561602 1397 609 381 370 271 11523 21379 739 --
NM_033656chr2145640 5550 1097 221 ------
NM_052925chr192242 213 ------
NM_133264chr1763546 3489 3382 2508 554 296 23553 382 13597 --
NM_133443chr1642168 569 481 291 11734 1582 --
NM_138396chr12195 ------
NM_138761chr191111 ------
NM_138795chr141319 1064 491 127 --1644 11579
NM_145008chr11----1178 2239 101
NM_147202chr942279 1980 346 236 ----1260
NM_152272chr821331 1097 ----11090
NM_152424chrX124436 4430 4424 4245 4144 3119 1839 1071 749 546 85 77 14176 ----
NM_152638chr121887 ------
NM_152860chr1241488 1155 1122 518 ------
NM_153207chr1213984 ------
NM_153350chr162360 339 ----11190
NM_153810chr1064575 3272 1437 800 203 80 ------
NM_172070chr22712 693 183 ----
NM_173463chr444196 4138 3412 23 --11719 --
NM_173502chr161175 ------
NM_173510chr222458 132 ------
NM_173595chr12174835 4670 4607 4566 4403 4395 4192 4154 3984 3919 3704 3483 1803 1211 555 340 134 --34684 1261 493 --
NM_173808chr113169 ------
NM_175736chr12106753 6502 2565 2545 2348 1839 1410 1017 975 792 --11501 --
NM_181358chr123206 1031 ----1159
NM_182487chr923228 96 --11125 13754
NM_182498chr193279 269 68 190 ----
NM_183397chr2083989 3936 3914 3142 1882 1326 474 80 14394 14787 --
NM_198270chrX22172 1005 ------
NM_198446chr11176 ------
NM_198507chr53486 217 95 ------
NM_198935chr201298 ------
NM_199131chr1033362 2943 2879 ------
NM_199262chr1771950 1857 1765 1638 279 175 75 1528 2537 272 --
NM_201521chr61312 ------
NM_206914chr1221506 181 --1137 192