TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-361-5p
miRNA Sequence: UUAUCAGAAUCUCCAGGGGUAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX43336 3290 3074 2249 --12780 --
NM_000061chrX1158 ----1410
NM_000084chrX65585 4677 2188 769 681 601 24488 1001 34781 2496 2259 --
NM_000109chrX41743 1700 1053 320 11967 ----
NM_000115chr1342712 2368 2112 1982 12135 1373 --
NM_000125chr694284 4159 4118 3251 3150 2656 1624 653 566 13239 --1379
NM_000138chr1511698 --12194 12101
NM_000163chr5--21986 538 22076 285 --
NM_000168chr723022 2852 ----1875
NM_000176chr593314 2619 2526 1441 1201 841 696 518 435 1982 13854 13493
NM_000202chrX43389 3004 2890 2538 13092 --12553
NM_000210chr211863 1129 12028 --
NM_000214chr2051460 1196 1149 633 524 1542 1715 11608
NM_000217chr1234324 3708 3434 --23426 879 --
NM_000232chr422980 2123 12904 12082 --
NM_000248chr363058 2753 2113 921 622 604 22899 88 --1846
NM_000267chr1733181 2188 1028 --1228 11092
NM_000288chr61351 ------
NM_000305chr71400 1389 ----
NM_000321chr1331435 1223 468 1321 1586 11509
NM_000328chrX2448 377 --2154 86 --
NM_000332chr687116 7056 6455 6374 5755 2495 1401 686 15012 25938 2165 --
NM_000337chr564594 4164 4098 1524 808 496 14996 22573 1761 --
NM_000390chrX43331 2810 2634 65 22564 781 11173 --
NM_000406chr421204 950 11869 12565 --
NM_000408chr243336 3281 3255 625 --13123 --
NM_000441chr741538 1526 882 587 --1702 --
NM_000448chr1143170 2923 2868 1243 22572 170 --22254 764
NM_000449chr11185 --11450 --
NM_000459chr92903 856 --1340 1732
NM_000461chr394245 4214 2861 1756 1645 1076 866 663 392 --13720 --
NM_000484chr21------1684
NM_000493chr62777 362 ------
NM_000533chrX71800 1671 1542 1386 1291 470 354 1768 11914 --
NM_000555chrX97901 7578 7223 7037 6700 6234 6047 1911 1779 45722 2235 746 223 11180 --
NM_000589chr5----126 --
NM_000618chr1296630 6435 6027 5920 5664 4727 1602 1590 1098 14332 14816 2469 107
NM_000726chr211447 --11162 --
NM_000780chr811171 ----21255 1130
NM_000782chr20------11121
NM_000810chr15--1197 --1501
NM_000813chr562019 1711 1484 1197 829 63 24433 2231 15060 --
NM_000824chr41123 ----1316
NM_000828chrX1120 --1337 1721
NM_000868chrX92450 2100 2002 1722 873 781 740 229 221 12270 1514 --
NM_000877chr2------12946
NM_000880chr8------1920
NM_000901chr441683 647 576 285 --2339 292 --
NM_000902chr342555 1261 643 298 12605 22457 1202 21108 1031
NM_000925chr3------1380
NM_000935chr3--1302 1168 --
NM_000944chr4--2794 494 12296 --
NM_001001394chr2----138 --
NM_001001396chr154122 3221 2791 1596 1525 24457 1038 24284 2946 --
NM_001001419chr544093 1896 1006 550 --45138 3631 3586 1244 23765 888
NM_001001484chr1032449 1767 982 --22455 612 1124
NM_001001664chr254052 3510 2801 1407 1132 1330 11377 --
NM_001001924chr832098 1630 41 --1454 11730
NM_001001971chr101963 ----11369
NM_001001974chr1052122 1881 746 533 424 1142 12034 --
NM_001002296chr81232 --1894 --
NM_001002838chrX----2245 155 --
NM_001002840chr73155 107 93 ------
NM_001002860chr1454374 4008 3093 1176 754 24661 98 ----
NM_001003688chr431236 750 190 1102 ----
NM_001003760chr652844 1262 736 162 145 33299 2763 1098 13595 1644
NM_001004317chr621262 684 ------
NM_001004360chr21729 ------
NM_001004419chr1234429 4152 1493 21060 124 13356 11548
NM_001004441chr531580 1555 1344 --21426 1084 --
NM_001005463chr1032385 366 84 1385 31690 1652 641 --
NM_001005502chr1245233 4494 3520 1223 44799 4003 1586 1012 14399 --
NM_001005782chr231007 680 341 ----1124
NM_001006600chr531801 449 415 ----11918
NM_001006636chr2----1873 --
NM_001007024chr1743378 3280 3138 2906 193 22948 483 --
NM_001007075chr42832 125 --1846 --
NM_001007097chr934601 4093 1637 --1128 15119
NM_001008405chr741673 1603 1450 643 2336 298 --1122
NM_001008408chr796186 6103 6066 5808 5550 4867 4649 4275 1986 ----1399
NM_001008495chr821806 1464 ------
NM_001008539chr855172 4804 4629 3365 2104 14594 35385 1272 1200 --
NM_001008564chr1342283 1822 240 216 --1113 --
NM_001008925chr4102448 2317 1296 1215 1080 680 537 456 402 351 23462 1380 33505 2389 221 --
NM_001009899chr385407 5366 5252 2202 1308 1034 482 252 35156 401 349 14413 --
NM_001009959chr232440 2333 2263 21744 1642 42398 1022 424 373 1176
NM_001009960chr722642 589 22283 2111 1830 --
NM_001010861chr152590 2179 1050 798 80 ----12474
NM_001010862chrX93328 3175 2993 2982 2227 1010 790 759 687 1634 ----
NM_001010891chr566245 1223 907 670 460 359 --24998 2134 46895 4660 2149 635
NM_001010942chr121522 1233 1452 --
NM_001010984chr162515 2163 1831 627 75 46 12505 --1259
NM_001010986chrX32554 2520 55 --21643 1547 --
NM_001011513chr443919 2962 2934 258 11579 --12565
NM_001011537chr351793 1778 1687 1610 1584 11623 41996 1599 929 682 --
NM_001011666chr734694 1645 980 --25582 246 --
NM_001011713chr141240 ------
NM_001012393chr1183933 3895 3324 1547 1510 1289 850 772 --42052 1710 1586 1153 --
NM_001012418chr674087 3258 3193 532 304 203 111 34130 3136 2665 23361 86 --
NM_001012968chrX22277 952 22593 2213 22426 190 --
NM_001013399chr61269 --1910 --
NM_001013620chr1278047 6249 5724 2733 2045 1954 1539 27166 6684 15162 38506 7025 2673
NM_001013624chr17--1801 --11265
NM_001014286chr13----1293 --
NM_001014797chr1068048 6223 5129 2902 1038 688 12694 11524 --
NM_001015877chrX42490 2151 1213 195 1601 --12362
NM_001017963chr141919 ----153
NM_001017979chr43794 710 24 --1619 1696
NM_001018067chr134958 4706 485 23341 1383 22045 1985 --
NM_001018090chr1532441 2382 587 --2787 249 1897
NM_001018091chr1532551 2492 697 --2897 359 21007 103
NM_001024688chr851960 1810 1692 559 152 --21866 1585 --
NM_001024934chr62677 139 ------
NM_001024948chr11291 22516 683 --12467
NM_001024956chr1195510 5438 4988 3744 2211 1546 866 804 564 15834 23784 532 24970 4859
NM_001025068chr331655 1372 328 ----1101
NM_001025076chr10105679 4857 4128 4091 3824 2331 1951 1661 491 181 35796 842 406 21294 135 21150 555
NM_001025108chr283386 3170 1620 1153 1127 1117 531 33 11499 21339 1241 --
NM_001025266chr394890 3677 3277 3056 1082 473 237 87 60 ------
NM_001025366chr621919 68 ----11625
NM_001025366chr621919 68 ----11625
NM_001025580chrX44059 3808 2803 1417 11302 21278 487 13688
NM_001029858chr663161 2882 2294 1050 677 362 12618 13335 --
NM_001030002chr17----1386 --
NM_001030055chr1474247 3615 3387 1442 1182 602 406 1672 13146 --
NM_001031695chr2284045 1694 693 548 519 499 419 381 34569 1754 1537 24389 1036 --
NM_001031723chr4----194 --
NM_001032280chr611238 --11365 11054
NM_001032380chr1041849 329 233 48 1641 ----
NM_001032999chr2075232 4905 3345 3255 1671 718 25 23681 553 25262 1181 --
NM_001033045chr224136 1651 --11093 1238
NM_001033521chr201277 ----2672 510
NM_001033564chr63660 428 62 2701 605 1194 2439 72
NM_001033925chr102430 304 12054 1274 --
NM_001034845chr41938 --1889 --
NM_001034850chr571527 1513 1094 473 191 183 175 ------
NM_001034954chr1032948 637 595 --12610 13217
NM_001035260chr1031201 408 347 ----11407
NM_001037132chr722046 590 1241 21822 367 --
NM_001037165chr768569 3135 2477 2321 2263 157 16323 --38494 748 677
NM_001037334chr1852098 1524 1478 708 602 11618 21667 633 --
NM_001037637chr51368 1353 --1101
NM_001039465chr14--1526 --2207 87
NM_001039538chr22688 440 --1760 13579
NM_001039573chr172480 368 ------
NM_001039590chrX41458 1266 1229 216 1527 1609 --
NM_001039618chr1165777 4554 4382 4209 3915 485 44486 2374 1310 291 14460 14587
NM_001039840chrX105771 5097 4558 4243 4192 3898 3816 2034 1970 1173 25760 4506 11071 --
NM_001040142chr221858 161 1338 --1909
NM_001040152chr794237 4098 1539 1057 985 419 320 281 137 11990 13924 24915 4510
NM_001040152chr794237 4098 1539 1057 985 419 320 281 137 11990 13924 24915 4510
NM_001040153chr13----1890 --
NM_001040284chr1695594 5278 3820 2262 1901 1736 1006 846 530 14719 35730 4280 414 21247 240
NM_001040402chr442775 2675 2213 2044 12138 ----
NM_001040450chr1532559 2075 373 --22523 1949 --
NM_001040665chr724679 905 1646 23880 925 23501 3385
NM_001040876chr4--123 --1455
NM_001042440chr52498 453 1221 126 1291
NM_001042533chr332784 2368 691 ------
NM_001042537chrX62113 899 536 527 500 456 11939 ----
NM_001042555chr1254746 4675 3642 3317 1317 21079 106 13345 --
NM_001042599chr2117488 7274 6644 6391 5020 4965 2672 987 915 426 71 27111 1650 11565 16028
NM_001042683chr631505 371 137 --11762 1266
NM_001043351chr112202 ------
NM_001046chr542887 1981 679 294 1159 --22933 2061
NM_001071775chr1341725 1621 1576 1333 --1283 122
NM_001083621chr111566 1632 11584 23445 1084
NM_001106chr3107829 7404 7047 6614 6450 3006 2746 2372 1726 1136 --26881 3013 11629
NM_001121chr10--1373 11887 --
NM_001123chr10----1214 --
NM_001126chr12917 418 --1292 --
NM_001146chr822342 689 --2902 697 1498
NM_001195chr20----161 --
NM_001201chr453471 3319 2635 993 940 23209 1545 21371 460 12983
NM_001204chr277699 7539 5226 5168 1715 830 452 37193 1591 333 57666 5472 5464 1378 409 12602
NM_001206chr91141 --12399 --
NM_001241chr241860 1646 759 173 --11951 --
NM_001271chr1573253 2239 907 801 482 180 60 --13187 --
NM_001289chrX21587 1203 11133 1437 --
NM_001332chr51506 ------
NM_001338chr212346 71 --152 --
NM_001351chr331823 1313 639 ------
NM_001356chrX52458 2128 653 614 342 --32085 2032 522 1836
NM_001412chrX83610 3417 3340 2774 768 704 353 62 33283 1183 160 2526 429 13620
NM_001419chr1944640 3837 1195 1054 ----14488
NM_001423chr1232075 1959 211 --12034 --
NM_001432chr483596 3535 3452 3230 3122 2841 926 216 --1444 13812
NM_001465chr511931 11826 1620 11530
NM_001530chr143952 820 133 --1737 --
NM_001616chr242681 1401 1346 1197 --12585 --
NM_001650chr1823278 3140 21505 1102 --1982
NM_001655chr1111408 --1115 1191
NM_001660chr32728 609 --1573 137
NM_001709chr111875 3653 324 233 1470 --
NM_001759chr1284528 3567 1955 1125 928 252 62 45 15110 31892 1224 1096 --
NM_001769chr12----1408 --
NM_001792chr182851 51 ------
NM_001796chr16----1250 --
NM_001806chr1941161 1007 876 189 1894 32791 2269 1133 --
NM_001826chr1--1145 1105 169
NM_001854chr131368 1039 609 11400 1487 1535
NM_001859chr9104007 3515 3256 3133 1596 1363 1288 1088 991 959 --13877 --
NM_001901chr61758 --2990 701 --
NM_001918chr179086 5657 3097 2930 2272 2197 247 18070 47626 7263 3484 822 --
NM_001938chr12771 274 --11818 11853
NM_001942chr1821378 714 11289 11908 --
NM_001946chr1211076 ----11060
NM_001961chr19------1490
NM_001967chr3----1137 --
NM_001981chr122409 2323 --1243 21656 374
NM_002009chr1532700 2235 325 --12433 1335
NM_002015chr1373208 2975 2597 2583 2435 1280 753 1452 12470 --
NM_002024chrX22099 1780 --11383 1773
NM_002025chrX109044 7504 6892 6363 2376 1850 1764 1539 1461 61 22064 1526 27231 228 27614 6733
NM_002035chr1842930 2452 650 219 23911 1106 13934 11359
NM_002040chr2112967 --1116 1918
NM_002041chr15----151 --
NM_002076chr1232400 2326 216 1539 1393 151
NM_002137chr742078 1816 1743 1626 ----22050 326
NM_002158chr2103762 3579 3284 3215 2679 1285 1113 953 554 414 --33625 1424 1192 --
NM_002203chr564008 3929 3920 3476 428 123 ------
NM_002235chr1231725 1439 679 11209 --11338
NM_002239chr2135 ------
NM_002264chr324171 815 15076 11888 34246 3993 1669
NM_002267chr1342027 1748 341 118 11578 ----
NM_002270chr585480 4997 3897 2241 1713 1179 1140 802 13616 25398 3485 35549 4469 4261
NM_002310chr576283 5428 4049 2068 1083 1034 956 34991 4150 2560 --1576
NM_002353chr11646 ----1697
NM_002381chr211018 --2871 374 --
NM_002382chr1421238 1009 --2829 420 1884
NM_002397chr521399 787 --11423 --
NM_002401chr1711552 ------
NM_002408chr143603 247 163 1609 140 --
NM_002454chr521021 173 --1983 --
NM_002480chr1221055 425 --11241 --
NM_002486chr952325 2233 939 344 66 --137 --
NM_002520chr5164 ----1119
NM_002522chr1753891 3707 3414 2721 1514 ----12940
NM_002577chr323291 1415 13543 43903 3559 2503 1139 --
NM_002581chr945586 4664 4571 1258 --14478 13710
NM_002594chr201935 --12214 --
NM_002616chr17----1551 --
NM_002641chrX42048 1966 1382 677 ------
NM_002645chr1142787 2722 656 602 --1777 1675
NM_002655chr834302 1984 1212 11290 23742 1139 14044
NM_002670chr371546 1475 632 384 361 235 201 ------
NM_002709chr253607 3425 2399 1178 671 1883 ----
NM_002718chr321894 98 22465 802 --22389 643
NM_002731chr112075 --12663 --
NM_002738chr1631084 926 103 ----1113
NM_002828chr182855 363 1246 1639 --
NM_002834chr1233818 3355 514 33841 3772 3692 --1145
NM_002869chr1122085 579 ------
NM_002874chr932159 1962 813 --11008 --
NM_002886chr384471 4077 2009 1736 1706 750 712 208 ------
NM_002906chr1131747 723 533 1794 22087 651 --
NM_002941chr32404 183 ------
NM_002956chr1221261 139 1550 11318 --
NM_002977chr242476 992 445 135 2892 186 23072 2965 --
NM_002999chr2031967 1195 123 11656 11283 11947
NM_003016chr1721877 716 11829 --1306
NM_003045chr1384762 3908 3663 3533 1895 1736 1455 944 23403 1585 24828 1569 11842
NM_003069chrX1264 --1720 --
NM_003070chr92315 254 ------
NM_003079chr171293 --11025 2926 682
NM_003081chr201891 11061 ----
NM_003108chr276737 6426 6192 5480 1588 1045 669 2166 157 56985 4973 4814 4488 922 15536
NM_003115chr1----152 --
NM_003128chr23971 645 417 12349 22635 891 12239
NM_003130chr721151 520 ----1169
NM_003174chr101747 --1356 --
NM_003178chr341899 1598 798 163 21676 1607 1309 11775
NM_003205chr153691 654 445 12254 11604 --
NM_003221chr634190 1559 1339 1282 23733 3679 12924
NM_003262chr361851 1667 1489 990 565 445 --35265 4154 308 23980 220
NM_003292chr162269 1923 1507 730 474 97 11612 11645 --
NM_003319chr21921 ------
NM_003338chr1041520 1204 647 113 1518 11860 --
NM_003342chr1733083 1064 869 --23015 2614 22585 2394
NM_003370chr191643 ------
NM_003390chr112158 65 ----1793
NM_003392chr353130 1403 1043 462 69 --1264 14089
NM_003403chr143817 736 593 ----1143
NM_003404chr204318 227 221 164 --31843 1635 369 --
NM_003406chr821440 1413 ------
NM_003410chrX22781 715 --13052 --
NM_003411chrY21732 1289 1335 ----
NM_003412chr352919 2748 2433 1950 1924 ----12741
NM_003427chr61636 ----1668
NM_003468chr212814 13665 13832 --
NM_003483chr1222944 614 ----22475 325
NM_003489chr2143313 3292 3121 2396 --1678 --
NM_003566chr1242899 2527 2335 965 23389 2192 12826 --
NM_003574chr1875392 5055 4953 4098 2025 906 790 14837 23594 1207 22056 1707
NM_003583chr1223477 2488 23862 24 12558 13446
NM_003590chr243884 3506 1391 1050 22697 1123 --1506
NM_003607chr144350 3745 2656 1004 --14041 --
NM_003615chr363894 3236 2626 1608 1172 749 --33784 1190 1060 1674
NM_003622chr1232075 717 595 22674 2577 ----
NM_003655chr17----1633 --
NM_003672chr11410 11456 --21878 364
NM_003693chr17--1335 --1837
NM_003743chr23898 752 693 --184 --
NM_003750chr103343 330 45 ----1360
NM_003758chr151265 --1548 --
NM_003766chr171219 --1560 --
NM_003772chr112989 430 ----11179
NM_003800chr641696 962 557 109 --11798 1228
NM_003860chr11----1298 --
NM_003884chr321842 1615 11804 11434 1654
NM_003895chr213205 133 108 ------
NM_003902chr13602 575 172 ----1740
NM_003922chr15266 54 ------
NM_003948chr451826 931 800 103 74 12301 21730 658 --
NM_003958chr643033 2904 2832 1357 --22655 324 13304
NM_004040chr22418 342 --1961 11090
NM_004064chr122466 358 ------
NM_004075chr122521 418 ----1440
NM_004085chrX1809 --1314 --
NM_004124chr1422978 801 23066 2402 32524 2243 1204 11260
NM_004161chr261133 649 496 445 309 265 ------
NM_004170chr921246 108 1628 1114 --
NM_004215chr82551 516 --1532 --
NM_004272chr541843 641 619 302 --1632 11819
NM_004316chr121804 --11064 --
NM_004329chr1021351 235 --1917 --
NM_004331chr832400 1709 495 11773 21851 820 1756
NM_004342chr722334 2215 32229 891 567 ----
NM_004414chr2141400 1192 990 399 --1307 11254
NM_004430chr832563 1897 834 --12199 --
NM_004438chr242979 2750 2177 303 1965 ----
NM_004440chr621851 1296 --31832 688 633 11509
NM_004449chr212566 512 --1973 --
NM_004458chrX42440 2397 2286 2127 ----1942
NM_004480chr14192 ----1708
NM_004501chr143185 1219 739 24 ----13040
NM_004503chr122844 108 ------
NM_004525chr241493 1464 524 507 ------
NM_004535chr2021325 1302 ----11417
NM_004566chr1021871 820 --22340 1854 --
NM_004576chr53398 291 84 ------
NM_004586chrX64372 4341 1345 566 112 43 --13649 --
NM_004600chr11510 --21048 610 1402
NM_004612chr911826 --23808 3767 11781
NM_004654chrY2365 296 ------
NM_004660chrY52329 2114 2053 938 340 1125 22133 2010 1826
NM_004719chr1232321 1925 302 --11777 22912 110
NM_004734chr1322805 196 1821 13025 --
NM_004745chr876774 6002 4516 4406 2565 2226 1720 --11820 16520
NM_004748chr1563631 3267 1488 698 676 35 13101 --23409 472
NM_004768chr14970 359 245 215 1954 --11179
NM_004772chr521542 473 1552 1603 11130
NM_004774chr1741086 198 192 97 152 12539 13183
NM_004781chr11462 1233 11206 1453
NM_004788chr1152557 2488 624 430 76 12024 22453 2279 --
NM_004792chr2------1162
NM_004849chr61333 ----1569
NM_004852chr181412608 12366 11698 11600 10730 5644 5307 5192 4928 3698 3196 2177 1090 1037 313145 13137 2873 411450 8622 5287 4714 13828
NM_004866chr544896 4539 1602 568 --13667 1577
NM_004921chr142602 1721 596 355 1152 11727 11696
NM_004956chr764330 3010 1415 1038 728 333 11075 --13533
NM_004992chrX88406 7391 6814 6587 6259 5269 2836 1903 32844 2539 1515 --15591
NM_004993chr1431506 556 464 1471 --11235
NM_005053chr191402 ----1561
NM_005065chr14115231 4304 4040 3798 3763 3354 1513 1414 1244 859 69 11631 34279 1136 154 --
NM_005095chr122079 538 ----11747
NM_005100chr62866 259 1243 2941 736 --
NM_005117chr111188 --1926 --
NM_005153chr161294 ------
NM_005168chr221561 375 --1710 --
NM_005171chr121493 --11340 1315
NM_005188chr1177980 6190 6020 5426 3232 1280 868 11568 36115 984 797 27538 1672
NM_005229chrX1108 --2965 823 --
NM_005233chr332392 1587 979 ----12418
NM_005259chr211359 ----21402 312
NM_005261chr82769 31 --1357 1930
NM_005263chr121168 1058 ----11201
NM_005269chr12--1184 --1165
NM_005277chr42400 306 --21806 1647 --
NM_005296chrX1396 ----1273
NM_005302chr7138 ------
NM_005339chr453790 3674 1643 1531 598 23507 2665 --11138
NM_005376chr1195 --1998 --
NM_005378chr22612 46 --1629 --
NM_005389chr62524 203 1746 ----
NM_005399chr152889 1343 1190 156 108 11600 --11057
NM_005436chr1053811 3615 3556 3487 813 13039 14107 14011
NM_005455chr131200 1173 78 ----21748 1488
NM_005465chr11341 ------
NM_005502chr942253 659 636 129 1797 12873 1648
NM_005504chr12116500 6218 6196 5725 4354 2636 1802 1747 1495 1445 553 24808 2338 --14044
NM_005634chrX----1617 --
NM_005711chr52366 190 ----1402
NM_005721chr22266 56 --1990 1972
NM_005730chr1222773 2747 13307 --33555 3004 1248
NM_005739chr1541810 1529 588 242 --12391 --
NM_005754chr52817 492 --11047 1430
NM_005795chr252904 2857 2808 1899 233 1150 11034 11223
NM_005813chr2148 12445 --12353
NM_005868chr722274 536 12428 1614 22373 62
NM_005871chr101751 ----1162
NM_005898chr1132701 678 638 1906 11105 --
NM_005907chr63462 328 92 --1528 169
NM_005909chr554274 3805 1105 1088 444 --11534 --
NM_005924chr711037 --1733 --
NM_005941chr833879 2712 1528 11297 --11072
NM_005966chr23832 628 136 ----1575
NM_005968chr19------1240
NM_005986chr1312074 ----11941
NM_006002chr13----182 --
NM_006047chr2052788 2755 1258 1074 682 ------
NM_006054chr1121191 517 2554 193 --1607
NM_006106chr1142582 2375 1088 1075 --1479 11205
NM_006136chr721059 133 --1362 --
NM_006141chr1662507 2109 1096 1063 1000 936 22014 1974 178 --
NM_006166chr1221949 133 11931 32469 1861 871 --
NM_006186chr2--1946 --11250
NM_006206chr442864 1950 531 463 21847 1126 12277 --
NM_006251chr543041 2818 2268 1090 --11156 --
NM_006252chr1157608 7564 7223 6736 6595 6450 5465 5334 2885 2182 1643 1127 1042 1023 903 15554 16730 --
NM_006257chr101305 ----11000
NM_006267chr231808 1782 1495 --172 1731
NM_006275chr203539 219 127 12259 11750 --
NM_006289chr9----1363 --
NM_006304chr7----1154 --
NM_006313chr1241575 1550 1142 281 --11230 --
NM_006352chr121591 547 ----1174
NM_006372chr62425 35 ------
NM_006380chr1711245 13718 31383 687 632 --
NM_006451chr51819 ------
NM_006467chr52792 393 11718 --182
NM_006504chr1072854 2843 2826 2726 2548 2532 1912 --12921 --
NM_006520chrX----11434 1631
NM_006544chr1475249 3841 2265 1940 1120 993 77 24751 3955 34448 3693 1651 --
NM_006546chr1796591 6505 6349 4882 2527 2060 1780 1738 1712 1965 14774 --
NM_006547chr731881 1861 1810 --12016 11395
NM_006557chr9189 1541 ----
NM_006572chr1752985 2533 2524 216 44 1648 1641 13208
NM_006595chr11--2399 338 21870 1408 --
NM_006599chr16118128 7817 6414 5808 5590 3243 3019 1794 1225 837 123 37860 7641 6554 46339 5386 2110 767 12136
NM_006620chr683279 3069 3042 1457 1058 425 363 99 --23823 1064 14096
NM_006624chr1041791 1687 1650 639 --11319 --
NM_006633chr51245 --1172 --
NM_006667chrX----11004 --
NM_006682chr732463 1095 997 12607 11962 --
NM_006699chr11236 11009 22249 204 --
NM_006704chr13161 --1327 --
NM_006729chrX35266 1999 583 12081 35409 5328 3578 14522
NM_006750chr1646392 5583 5491 659 ----17700
NM_006775chr642315 2230 2199 1066 178 1524 12882
NM_006777chrX32916 2343 97 1142 ----
NM_006807chr1731241 504 485 ------
NM_006815chr1241100 885 861 353 ----11032
NM_006822chr17------1527
NM_006828chr61228 --1480 --
NM_006873chr242965 2778 2382 304 13411 1123 1848
NM_006888chr1462920 2806 2776 2454 1387 536 --13461 --
NM_006895chr211544 1281 2663 606 --
NM_006910chr163387 320 141 ------
NM_006915chrX31598 910 902 1727 12347 2585 65
NM_006951chr10----1803 --
NM_007005chr931436 1246 39 2462 355 21483 377 --
NM_007007chr1273568 1400 932 841 462 437 392 14295 24766 638 14848
NM_007008chr22610 54 ------
NM_007011chr1566893 6824 6569 5300 4224 273 12610 25831 1258 45145 5102 2700 1172
NM_007033chr122266 815 --1661 --
NM_007034chr13656 70 59 ----132
NM_007038chr2195726 5410 5031 4664 3816 3769 1509 1003 52 21920 256 35618 930 320 24483 3736
NM_007039chr1421651 800 ----22212 381
NM_007050chr2086409 6374 5935 2722 1621 1416 1218 874 --17822 1684
NM_007052chrX2140 127 --1551 --
NM_007106chr1332044 1099 189 22015 657 31954 1797 998 --
NM_007114chr363326 3279 2456 2434 1263 612 --1921 --
NM_007136chr31983 --152 --
NM_007159chr331158 372 348 ----1379
NM_007204chr12528 164 ----1106
NM_007220chrX74416 4267 3784 1955 1922 804 551 ----197
NM_007240chr11174 --1194 --
NM_007246chr41867 ------
NM_007249chr1358755 3212 3006 866 329 23305 2645 --11909
NM_007269chr1------1173
NM_007271chr6----1258 11361
NM_007276chr7165 --2241 114 --
NM_007282chr33626 149 61 --1155 --
NM_007368chr132577 225 ------
NM_007373chr1041383 1321 521 211 --1239 --
NM_012096chr333551 983 666 --11462 11019
NM_012134chr12633 575 ----1713
NM_012158chr1331629 1283 568 --2110 76 --
NM_012214chr245098 3982 2183 1821 11113 25970 863 1791
NM_012234chr32819 545 --1467 11136
NM_012262chr195225 5184 4866 4535 4453 4038 3923 3301 1506 34990 4705 3240 44425 3411 1134 322 21524 338
NM_012281chr752221 2158 2063 849 262 --11995 1369
NM_012287chr384076 3613 3061 2995 1615 1544 1184 34 ----23803 3773
NM_012297chr442635 2420 115 103 1931 21980 1611 1876
NM_012300chr551705 1569 888 705 176 --1385 --
NM_012328chr731181 1051 56 --31247 526 118 11473
NM_012329chr1771449 1443 1397 1364 1308 523 255 --1614 --
NM_012388chr1563136 2761 2428 2245 270 236 --22373 183 1388
NM_012412chr71728 1253 --1171
NM_012420chr1042196 1613 464 397 --21480 349 --
NM_012461chr143528 246 240 ------
NM_013231chr14104396 4268 3867 3809 3102 2961 2786 2749 1393 740 14229 23949 769 44295 3340 916 93
NM_013255chr778015 6394 2988 2945 2776 2704 1616 --17480 11211
NM_013261chr433570 1289 609 13363 22344 1068 --
NM_013354chr8167 11099 --1285
NM_013374chr343072 3055 170 87 --32990 2365 539 1828
NM_013436chr22718 136 --1275 1283
NM_013437chr83308 265 249 ------
NM_013438chr921406 699 1458 --143
NM_013444chrX31029 838 100 ----2772 45
NM_013448chr14----1208 --
NM_013449chr1232389 2011 79 --22684 1083 12497
NM_013943chr163073 2639 2467 2219 758 747 12622 12982 --
NM_014048chr1645326 1578 421 365 1715 15279 1342
NM_014112chr834732 4429 154 25087 3473 22176 672 11954
NM_014154chr32496 381 11574 1357 1225
NM_014264chr41544 ----1480
NM_014267chr111679 1846 1356 1644
NM_014268chr1831071 506 436 --1367 --
NM_014289chrX1328 --1346 1134
NM_014294chr81108 ------
NM_014319chr1241939 1755 1441 1298 ------
NM_014331chr4127475 7037 6682 6502 6203 6144 6082 3094 2412 2127 1170 749 57328 2308 1502 1261 846 37849 7554 244 --
NM_014372chr12847 52 ----11813
NM_014382chr311445 --1188 --
NM_014394chr10----11172 --
NM_014409chr11769 ------
NM_014423chr573844 2110 1114 1050 668 534 27 35169 5121 232 55081 1975 1205 1030 975 1146
NM_014445chr342201 1949 232 62 --169 11760
NM_014469chr111766 1314 ----
NM_014498chr3------1366
NM_014570chr222272 135 --1172 1967
NM_014577chr223720 627 86 142 1260 --
NM_014587chr16------21568 613
NM_014604chr17----1684 --
NM_014612chr951481 1264 1151 452 408 --21338 145 --
NM_014613chr522647 2391 --11189 22082 597
NM_014635chr231681 1362 192 ------
NM_014647chr16145 --1732 11389
NM_014655chr142271 1491 616 558 --1251 --
NM_014682chr82517 150 12357 ----
NM_014683chr1722117 550 11339 1435 --
NM_014705chr72774 371 ----11775
NM_014707chr74674 513 381 354 22165 185 22084 814 11714
NM_014713chr2----195 --
NM_014720chr1021145 673 ------
NM_014737chr20114126 3994 3986 3697 3319 2919 2903 1441 1360 300 220 --24196 619 --
NM_014746chr244305 4186 3983 409 1721 --13809
NM_014747chr1105588 5491 5214 5061 5032 4956 4621 4214 3787 1315 --35358 4336 1537 14401
NM_014752chr1131892 716 482 --1191 --
NM_014764chr1241097 384 349 128 --2958 414 --
NM_014765chr12781 464 12414 2421 194 --
NM_014795chr2----11229 --
NM_014803chr1022448 776 --11994 2791 286
NM_014819chr532283 2116 458 --12073 --
NM_014830chr1293877 3648 3312 3128 2788 2732 922 331 54 --1823 --
NM_014839chr132231 2053 1586 22467 2343 --12177
NM_014874chr131181 297 288 1307 11858 --
NM_014877chr17117092 6623 6384 5510 5398 5355 5299 5055 2702 985 192 35319 1445 822 44834 2497 2022 746 12130
NM_014897chr1732889 2087 1237 1306 --1246
NM_014900chr23880 774 189 --1802 --
NM_014904chr1033364 2687 267 126 24015 3645 11004
NM_014905chr262035 1500 566 331 237 158 --21337 84 --
NM_014906chr1743844 3617 1332 386 23390 541 21218 392 --
NM_014910chr191548 ------
NM_014912chr1073473 3297 3113 1283 622 372 232 ------
NM_014917chr11224 ------
NM_014932chr3132 11454 11546 --
NM_014937chr1021205 491 ----11272
NM_014939chr182108 102 --2570 72 --
NM_014946chr253046 2723 2180 824 271 12063 32478 855 392 --
NM_014947chr143120 664 481 278 22365 1228 12867 --
NM_014949chr121016 63 --1393 --
NM_014988chr442489 2268 2071 1874 ----21909 545
NM_015000chr1232339 1026 837 22054 710 21181 1045 --
NM_015026chr1251454 812 490 380 226 21805 564 --14397
NM_015032chr1352784 2353 949 287 92 --1610 --
NM_015040chr252637 2562 2373 615 491 --1190 --
NM_015045chr1021919 1699 11832 --11446
NM_015061chr92826 595 --1606 --
NM_015071chr541773 1008 908 151 15615 11736 1236
NM_015076chr643399 889 255 157 --11791 1245
NM_015092chr1674532 4349 3047 1129 928 454 26 13172 11173 2815 779
NM_015097chr331941 740 637 22165 857 ----
NM_015156chr1443009 2458 1125 561 --23037 1553 --
NM_015161chr1641389 1291 1103 619 ----1474
NM_015163chr1431823 1403 336 --21998 1817 --
NM_015185chrX62888 2416 1130 898 480 454 --11220 1446
NM_015192chr2041915 1846 846 353 --12576 --
NM_015205chr1334583 1677 50 15078 14723 --
NM_015245chr622614 956 --12559 --
NM_015263chr1521240 974 --11208 --
NM_015265chr2------1569
NM_015267chr1232011 678 374 2701 36 1385 --
NM_015271chr474105 4099 3053 2782 2662 970 562 --11618 23589 2726
NM_015291chr183554 3502 3226 3045 2755 2377 1164 737 --23394 2667 --
NM_015310chr8107251 6734 5925 1502 1200 1152 873 729 208 190 26771 1995 38203 6050 3192 167
NM_015313chr1184770 3985 3480 3388 3128 3011 1162 254 13846 14813 13496
NM_015317chr212477 --32713 952 388 1543
NM_015328chr762275 2048 1229 1176 988 789 --12795 --
NM_015335chr1222552 2019 --11632 12576
NM_015336chr1231032 809 612 --12496 1673
NM_015352chr2051202 853 803 285 28 --1363 --
NM_015393chr473789 3683 3663 3478 1316 505 81 23859 917 23783 176 --
NM_015396chr3174 ------
NM_015397chr921886 65 1616 ----
NM_015435chr8------11395
NM_015455chr554026 3584 3423 825 125 --1841 1135
NM_015460chr372059 1965 1550 1513 1476 346 150 ------
NM_015483chr71794 ----1113
NM_015508chr331325 499 344 11248 130 1414
NM_015509chr12----21100 505 --
NM_015525chr61441 ----1340
NM_015550chr763462 2752 2666 2474 2198 852 --13233 11109
NM_015554chr1522455 1941 --12208 1736
NM_015565chr2132268 2146 773 1347 22108 478 --
NM_015569chr154745 4336 4310 4117 3666 --1874 162
NM_015576chr322501 204 --22733 2283 2355 94
NM_015578chr1921352 799 --1839 --
NM_015607chr12203 85 --1171 --
NM_015626chr172295 138 --1116 --
NM_015694chr7------1390
NM_015852chr7----13197 --
NM_015853chr11------1174
NM_015879chr1888256 7989 5618 5363 3398 3090 1893 627 1215 26753 698 16709
NM_015888chr143302 2507 2355 969 12377 32399 1347 750 22934 2650
NM_015891chr631519 521 38 11569 --180
NM_015906chr173609 1806 1482 1402 579 282 135 23669 377 1902 --
NM_015912chr851801 1741 897 864 392 ----22083 1976
NM_015916chr10------1346
NM_015934chr2----1197 --
NM_015995chr15104372 4229 4187 3983 2046 1821 1665 1649 883 383 --1871 --
NM_016018chr841983 1085 879 105 22661 1857 ----
NM_016021chr652741 2213 2171 227 122 --1639 --
NM_016047chr2----1130 --
NM_016061chr231609 1415 1277 ------
NM_016072chr1222147 503 11816 --21984 961
NM_016073chr15----180 --
NM_016076chr183177 2708 2621 2491 2386 1239 847 707 12352 22888 988 --
NM_016083chr622957 2526 33781 3713 1234 13075 13347
NM_016087chr72237 171 11462 11344 --
NM_016107chr521240 261 21117 1103 21256 376 --
NM_016132chr1542595 2391 482 205 1619 --12127
NM_016156chr1132234 1978 1615 --1452 1320
NM_016206chr3108789 7405 5807 5681 3107 1990 1472 1385 779 297 --28311 1996 28952 897
NM_016226chr12------1392
NM_016235chr16----11521 --
NM_016287chr121786 80 --11633 --
NM_016297chr273335 2721 1417 698 679 460 425 23000 1100 --1257
NM_016308chr1--11749 21349 50 --
NM_016338chr521208 258 --1957 --
NM_016395chr1531708 196 46 1523 11806 1204
NM_016422chr1123190 133 12953 --1764
NM_016424chr1741701 1399 324 59 11408 ----
NM_016472chr1471385 1231 1093 381 297 49 36 ------
NM_016530chr15104065 4059 3884 3491 2947 1509 1346 1340 1051 452 ------
NM_016531chr443081 1695 940 105 --13874 --
NM_016559chr31541 1340 1620 11509
NM_016562chrX41176 1153 365 282 ------
NM_016631chr211945 ----11000
NM_016653chr22299 292 --1456 172
NM_016937chrX----1712 --
NM_017412chr82565 75 --1371 21221 259
NM_017423chr432100 1472 350 1147 12117 --
NM_017508chr1132286 2157 1971 1335 ----
NM_017544chrX2841 342 --1215 --
NM_017577chr3----2335 271 1159
NM_017593chr43471 181 153 ------
NM_017610chr154705 679 178 51 1374 --1784
NM_017615chr101152 --1122 --
NM_017643chr1722758 830 12132 12888 --
NM_017644chr313376 34386 808 535 14698 --
NM_017645chr952178 1999 1980 592 260 --12868 1756
NM_017650chr765827 5820 5095 2375 1912 1364 ----25775 2022
NM_017655chr151365 505 185 157 102 ----11304
NM_017666chrX82196 1936 1733 851 708 634 509 495 ------
NM_017672chr151292 1226 ----
NM_017680chr91181 ------
NM_017684chr1541934 1915 1846 1654 ------
NM_017694chr231784 814 383 --1787 --
NM_017736chr1623179 2732 22522 1053 22616 1281 11267
NM_017742chr1841686 1667 1239 187 --11896 11761
NM_017752chrX4691 439 241 61 1161 11845 --
NM_017754chr654467 4261 3756 3746 1381 1611 --14962
NM_017768chr1----1744 --
NM_017769chr1443119 2689 919 227 149 12507 --
NM_017810chr161219 ----2744 692
NM_017824chr102431 61 ------
NM_017848chrX94648 3905 3393 3335 3217 2962 1591 205 57 14336 --14142
NM_017922chr142641 231 ----1100
NM_017945chr33980 911 196 1243 --184
NM_017994chr752774 1845 1110 355 261 --1429 --
NM_018000chr231391 480 317 ----12179
NM_018036chr1424392 185 ----1970
NM_018056chr1------1149
NM_018061chr121405 1118 11362 31091 614 201 --
NM_018085chr155489 2143 1561 1519 687 43079 2952 1954 143 32278 798 420 --
NM_018092chr161366 1345 21171 1161 --
NM_018098chr35461 302 279 214 138 --1764 --
NM_018128chr1721003 550 2903 344 --1242
NM_018133chr372157 2030 1372 508 466 240 31 ----22003 1677
NM_018191chr1341922 1491 725 299 1710 12104 --
NM_018227chr452588 2239 2133 752 616 12882 21067 451 12429
NM_018247chr653031 2021 575 82 76 22516 2326 ----
NM_018364chr174138 3821 3024 2574 588 553 45 --1478 1872
NM_018373chr1495760 5380 5199 5169 4701 4556 4175 2466 115 --36407 1037 256 21959 601
NM_018374chr754742 3508 920 266 42 --11772 13832
NM_018424chr971728 1701 1456 1262 755 293 242 --11398 --
NM_018465chr9----189 --
NM_018469chr1721317 214 ----11148
NM_018490chr111293 ----11712
NM_018527chr131427 1317 --1114
NM_018569chr41167 ------
NM_018638chr12135292 5266 4408 4019 3838 3681 2058 1254 1068 1050 1030 857 504 ----25353 264
NM_018682chr71256 --2586 246 --
NM_018691chr521217 159 1374 11002 --
NM_018704chr132062 795 789 --195 12141
NM_018948chr12398 65 ------
NM_018970chr712868 22572 394 11240 12148
NM_019005chr72243 145 ------
NM_019080chr131251 --1309 11552
NM_019114chr942280 2036 753 352 1454 11686 1231
NM_019117chrX1761 1228 12934 --
NM_019845chr2------1582
NM_020122chr246040 5986 2381 1690 ----11337
NM_020156chr7----1193 --
NM_020159chr4----11132 --
NM_020184chr232329 2070 852 ----12023
NM_020205chr143339 2615 2584 1238 --22220 1226 --
NM_020336chr2032598 1402 449 22398 217 31357 157 66 --
NM_020337chr41901 1280 12763 --
NM_020340chr651713 750 363 252 214 2425 412 ----
NM_020341chr2021517 486 11279 --1470
NM_020342chr241804 765 255 247 ------
NM_020363chrY31844 1339 735 --1451 --
NM_020383chr10----1158 --
NM_020386chr32142 24 ------
NM_020403chr1311715 --11577 --
NM_020432chr751522 1425 841 574 249 1273 11720 1636
NM_020456chr131562 --1325 --
NM_020466chr634263 3069 2014 --24208 1266 --
NM_020546chr562395 894 662 611 330 88 --3604 386 164 --
NM_020640chr321506 1431 --11449 1575
NM_020699chr145225 4039 3922 3322 15033 1275 --
NM_020726chr52458 235 1401 --1426
NM_020747chr5------1715
NM_020748chr1731735 210 180 ------
NM_020752chr101443 12451 ----
NM_020772chr17118078 7934 7480 6362 6351 5859 3392 2926 2639 1976 1905 --28493 5766 11509
NM_020774chr1865567 5523 4054 4044 683 65 31790 1403 396 36081 5825 4247 185
NM_020801chr532174 414 312 --21697 1669 12251
NM_020802chr111447 1418 13343 --
NM_020818chr143341 70 35 ------
NM_020824chr10----1638 --
NM_020854chr1811084 ----11248
NM_020871chrX21841 281 1250 22529 2145 2962 216
NM_020872chr31651 1198 31406 1166 239 --
NM_020888chr111913 --11986 --
NM_020951chr1962014 1933 1537 275 166 33 --22086 551 1983
NM_021005chr152934 437 --11186 --
NM_021033chr1392991 2900 2850 2806 2757 2662 731 628 153 12364 23035 2444 --
NM_021072chr5183 --22144 316 --
NM_021090chr2254890 3751 1855 583 264 --35016 1812 1257 --
NM_021132chr1011040 --11138 1186
NM_021136chr141731 ------
NM_021148chr722324 2023 --11764 --
NM_021161chr14----1492 --
NM_021163chr753702 3441 2744 1234 1079 ----1808
NM_021218chr9----1107 --
NM_021252chr103588 309 33 --11722 --
NM_021639chr12904 604 ----1667
NM_021648chr662618 765 610 486 431 376 --1590 --
NM_021814chr621721 39 --21404 1112 --
NM_021821chr123617 232 206 --169 --
NM_021914chr1452479 2157 2134 1964 1575 ----11916
NM_021961chr11127419 7144 7084 6919 6529 5712 5436 2904 2804 2226 1521 1290 27432 5257 26936 212 --
NM_021964chr3106531 5200 5027 4900 4583 1561 1464 1107 949 125 45766 5109 5008 313 44925 2169 989 607 14829
NM_021998chrX197 ------
NM_022037chr21362 1670 --1227
NM_022048chr15126290 5810 5696 4980 4966 4542 4152 3921 1928 1684 914 809 --36051 1981 1896 --
NM_022066chr171142 ----11006
NM_022373chr7196 --2952 833 --
NM_022443chr32186 32 --1125 --
NM_022459chr1396208 5383 4464 4183 1804 1689 1273 620 492 26191 4775 2814 132 16046
NM_022735chr161698 1490 515 440 328 110 1635 1121 --
NM_022766chr2252682 2353 2202 394 78 11754 1111 --
NM_022776chr31357 --11334 11439
NM_022780chr22544 218 1371 --1460
NM_022784chr152437 41 ----1409
NM_022826chr21937 1230 11096 1472
NM_022841chr1522436 1017 ----21882 1120
NM_022843chr13--1289 --11150
NM_022912chr233067 2910 611 --1569 --
NM_023016chr252657 2583 2280 958 373 --22794 2593 12418
NM_024056chr121646 --1623 --
NM_024077chr9------1682
NM_024324chr22----1186 --
NM_024415chr53196 56 33 ------
NM_024513chr333567 3510 889 13159 12519 11012
NM_024525chr1----1106 --
NM_024529chr14986 829 345 110 1920 1224 --
NM_024665chr354528 4050 4019 1766 1323 --34741 4207 922 --
NM_024670chr1031312 1214 190 2325 26 ----
NM_024700chr151103 847 767 54 26 ------
NM_024721chr831952 187 146 1469 21691 803 --
NM_024828chr911124 11387 2990 641 11082
NM_024830chr521437 832 ----11934
NM_024834chr1021453 146 2277 137 1256 --
NM_024920chr441279 1249 1037 575 --21364 94 --
NM_024921chrX41384 1311 656 267 1518 21923 384 --
NM_024944chr2121276 486 ----1424
NM_024947chr3119263 9197 7980 7242 6055 3101 1877 1681 1116 686 369 122 1889 --
NM_024953chr1262730 2368 2321 411 130 77 127 22497 631 --
NM_024969chr2----1220 --
NM_025027chr19------11197
NM_025074chr453084 2682 2631 2574 64 --11138 --
NM_025133chr21439 ------
NM_025146chr322766 1041 --22322 1911 --
NM_025152chr142170 31 11361 --1583
NM_025160chr193993 3628 3534 3226 1536 1388 787 405 90 ------
NM_025179chr144783 3292 445 329 23930 3875 1901 11449
NM_025191chr153514 3014 2536 1302 459 --11165 --
NM_025232chr82365 132 ----1449
NM_030647chr756240 1798 1347 563 139 24316 891 55778 4590 4391 532 466 --
NM_030650chr2103535 2998 2587 1143 1061 646 592 529 433 48 13798 ----
NM_030755chr1422090 647 11170 2932 372 139
NM_030796chr71760 --32198 1864 118 --
NM_030806chr199309 8883 8177 7237 6573 2747 2312 1603 630 21139 858 11344 --
NM_030816chr153154 2938 2574 2380 905 11312 1182 12433
NM_030963chr61627 --1405 --
NM_031291chr42604 517 --183 1546
NM_031412chr121172 --1239 --
NM_031435chr1223042 2494 3978 812 677 33420 2915 2340 --
NM_031461chr831703 1529 605 21577 142 1540 --
NM_031866chr101981 ----1727
NM_032042chr532503 2399 733 22635 2340 ----
NM_032109chr5------11014
NM_032138chr13------1596
NM_032177chr51161 191 ----
NM_032182chr1051624 1465 1141 591 233 1256 --1488
NM_032199chr1063875 3372 2981 2437 1513 1260 --33811 3497 3247 --
NM_032239chr41521 --11090 --
NM_032268chr1622931 2706 --1984 --
NM_032312chr23722 662 218 1358 ----
NM_032352chr142514 153 ----11422
NM_032373chr1044644 4441 2304 2018 22193 503 14377 1748
NM_032408chr71270 ----1824
NM_032446chr542417 1401 978 760 31468 1240 887 23697 2574 --
NM_032456chr42535 504 ------
NM_032457chr463748 2750 2578 1291 1184 405 ------
NM_032458chrX42820 2481 525 53 1931 --12692
NM_032466chr821179 538 11517 1238 --
NM_032491chr1221223 401 --1951 --
NM_032505chr352819 2787 1721 583 360 --160 --
NM_032539chrX------1591
NM_032582chr1711740 --21455 1163 --
NM_032623chr41147 ----150
NM_032632chr141308 11361 1633 21413 364
NM_032800chr11910 --1635 1206
NM_032873chr1144491 4233 3623 605 23277 1538 13086 --
NM_032876chr1441958 1720 470 281 ----11890
NM_032968chrX53563 2881 1610 477 80 1617 1275 12706
NM_032973chrY53559 2876 1609 477 80 1617 1275 12701
NM_033030chr241596 1539 1324 168 --1388 --
NM_033081chr2011381 --1175 11055
NM_033103chr191136 ------
NM_033133chr1752912 2312 490 312 65 33472 1227 1032 --1755
NM_033224chr757854 7338 7280 5706 2100 26520 377 15515 --
NM_033225chr812970 --41176 995 502 45 1688
NM_033396chr111332 --1298 --
NM_033427chr71790 2782 87 ----
NM_033505chr286017 5696 4527 1465 1353 902 765 609 36735 1892 354 24876 1046 --
NM_033540chr341157 1062 378 300 ----1141
NM_033656chr21145767 5454 5130 4577 4375 4221 3629 2243 2093 1568 1458 1387 1239 560 35613 4942 675 35438 4615 1660 15704
NM_052879chr1223087 689 12888 23375 724 --
NM_052898chr831899 461 139 --11448 --
NM_052911chr1831028 736 398 --1914 --
NM_052936chrX3629 602 97 ----1926
NM_052937chr842272 1026 857 289 132 ----
NM_052958chr82770 578 --1289 --
NM_052978chr1421417 748 ----21545 193
NM_053023chr1143018 2842 871 629 --1343 12533
NM_053025chr321570 158 11118 11413 --
NM_080672chr201530 --141 --
NM_080743chr642079 2014 1714 102 --2795 503 --
NM_080867chr1454729 1372 1092 649 640 1985 1483 11991
NM_080874chr41412 1741 --11308
NM_080927chr322753 2476 --32356 1269 226 1725
NM_133493chr654386 4214 3484 2961 589 --11055 14358
NM_133638chr52583 179 ----11165
NM_133646chr255551 3851 3596 1529 703 --15488 --
NM_138333chr962510 2285 2095 930 447 375 ----1336
NM_138423chr1542291 1548 1497 905 12121 ----
NM_138444chr1354651 3776 3513 3241 3197 --11818 13743
NM_138459chr673657 1261 1103 913 854 375 24 --93127 2988 2481 1324 703 662 654 632 63 --
NM_138473chr12104917 4811 4622 4469 3625 3234 1179 853 744 238 23927 363 21807 1643 --
NM_138779chr13195 ----145
NM_138782chr532366 707 552 --1417 --
NM_138819chrX----186 2451 33
NM_138927chr212812 285 --1960 --
NM_139321chr2084266 3434 3359 962 920 640 565 250 23051 1089 ----
NM_144567chr122568 1075 --12359 1525
NM_144571chr446361 5413 1896 854 1280 ----
NM_144574chr141532 ----1170
NM_144578chr1464032 3981 1373 1119 987 752 --25483 1613 --
NM_144632chr242233 2023 1876 1811 2873 296 1811 --
NM_144664chr1122302 144 1857 21965 219 --
NM_144726chr54827 294 235 73 --21092 30 1766
NM_144778chr1332085 1861 343 12623 --11725
NM_144979chr4--1220 1638 --
NM_145000chr51177 ------
NM_145257chr143565 2609 1100 157 13064 1248 --
NM_145313chr1061600 1407 1319 436 304 65 --11584 --
NM_145735chr1352291 2191 2125 304 124 12403 --1525
NM_145753chr321478 621 ----1242
NM_145808chr762780 2734 2122 1093 799 352 --33014 2381 1922 --
NM_147128chr71390 1296 --11134
NM_147188chr153961 441 122 --11136 1527
NM_147223chr22935 876 --2267 66 --
NM_152261chr1232122 1822 409 12522 --22260 217
NM_152265chr13496 246 161 11221 11462 --
NM_152316chr11----1161 --
NM_152332chr1462487 2480 2337 2172 2020 361 --32894 2774 142 1155
NM_152409chr563488 3364 2369 1356 1312 400 --23287 76 --
NM_152423chrX21584 123 --11096 --
NM_152470chr1854149 3724 1566 980 800 13190 --11361
NM_152487chr141421 1056 383 52 ------
NM_152512chr22----2628 24 1204
NM_152522chr21389 --11004 --
NM_152523chr21666 ----1734
NM_152556chr752203 2023 1961 1871 392 --1896 1524
NM_152594chr1532079 237 102 11786 2821 674 1736
NM_152606chr19------1514
NM_152622chr532747 2225 1151 22259 869 ----
NM_152641chr1272141 1910 1785 812 291 281 153 12790 --1272
NM_152653chr31636 1744 ----
NM_152739chr72270 197 1978 ----
NM_152787chrX22919 2724 22477 722 12485 23560 2735
NM_152995chr4----1918 --
NM_153183chrX11097 11186 ----
NM_153184chr331868 1805 784 21374 588 1626 --
NM_153207chr1253862 3760 3025 2984 685 ----1568
NM_153261chr1621489 191 11037 11063 --
NM_153332chr873004 2952 2723 2076 946 722 466 22094 1026 1203 --
NM_153346chrX2217 204 --11467 22012 306
NM_153371chr1351923 825 379 320 108 11618 22307 1940 --
NM_153456chr1376058 5231 4842 4706 1531 1516 1443 23969 3908 13988 15341
NM_153607chr542464 2425 1996 932 32378 1234 633 22433 2193 12307
NM_170606chr731199 631 138 11677 11515 --
NM_172069chr222199 148 32229 1922 1800 12176 --
NM_172070chr221824 325 --31931 1916 1788 --
NM_172071chr167101 2837 2633 1667 976 343 25272 4811 31703 1289 1226 --
NM_172127chr412105 ----11699
NM_173468chr485946 5277 3929 2318 1254 1177 683 147 22417 208 ----
NM_173469chr1551467 1452 1341 1263 1079 1232 11303 --
NM_173496chr1032866 2706 910 --11130 --
NM_173533chr12109 51 1310 ----
NM_173552chr32832 127 --2440 305 11976
NM_173576chr101935 --31835 1560 562 11723
NM_173582chr1195952 5821 5617 5526 4302 4013 3818 1169 721 34384 4152 2357 1638 --
NM_173631chr1921194 1057 --11352 --
NM_173645chr2----1116 --
NM_173647chr21130 --1136 --
NM_173797chr521099 182 --1300 --
NM_173808chr184496 3927 3654 1580 1522 1169 176 49 34061 4050 4006 167 1456
NM_173814chr151601 ----1132
NM_173822chr211429 21944 699 11479 11712
NM_173826chr321075 684 --176 --
NM_174921chr41811 --1379 --
NM_175056chr331833 711 305 11737 --22179 117
NM_175061chr721476 781 --1221 --
NM_175607chr3----11551 --
NM_175624chr1277749 7387 6118 2768 1366 742 169 15657 197 --
NM_175854chr1322241 321 --21034 1017 11118
NM_176812chr203719 493 487 ------
NM_176814chr71977 ------
NM_177968chr241629 1612 1409 29 11710 ----
NM_178450chr52731 28 ------
NM_178496chr32444 193 --1369 144
NM_178509chr1741365 690 594 508 21042 496 1162 1402
NM_178812chr82446 343 --1642 --
NM_178815chr101729 --1391 --
NM_180989chr131795 11890 ----
NM_181354chr82619 263 --11480 1688
NM_181358chr193896 3745 3724 2832 2785 1567 1441 832 431 1723 13934 1452
NM_181457chr22871 334 ------
NM_181504chr563640 3429 2816 2681 1411 81 11110 --33292 3020 3002
NM_181723chr83745 416 135 ----11944
NM_181787chr863498 3454 3127 1484 806 185 --21505 709 13407
NM_181789chr1562946 2870 2496 2462 2322 845 32836 1240 407 23061 2696 --
NM_181836chr582302 2040 1788 1740 1024 514 342 298 ------
NM_182485chr453116 2828 2662 976 550 13667 23458 1142 --
NM_182493chr1665193 4290 1506 696 674 409 --13298 --
NM_182503chr664831 4757 4687 3677 3618 3499 23855 3715 23894 3385 --
NM_182734chr2042162 2093 1093 600 --22823 236 --
NM_182756chr2----1218 --
NM_182765chr101944 --2588 496 --
NM_182976chr1----1827 --
NM_194282chr422075 1981 122 23073 282 --
NM_194314chr155357 2122 933 914 283 25267 426 35645 5548 584 --
NM_198270chrX73480 3042 2941 1333 1298 837 239 11178 --1470
NM_198273chr552908 2507 773 429 198 --1747 --
NM_198279chrX1864 21198 114 --1460
NM_198513chr82183 86 11710 ----
NM_198859chr355138 4677 4321 969 328 ----23643 441
NM_199328chr2131127 197 91 ------
NM_203364chr1131094 970 800 --11113 --
NM_203390chr82232 158 --11898 --
NM_203394chr1262697 1986 1771 1016 247 152 --12411 --
NM_203403chr9--11071 1808 1364
NM_203406chr532834 389 26 ------
NM_203458chr193775 3744 2913 2552 525 357 301 292 103 23840 812 21201 718 --
NM_206853chr674046 3896 3400 2967 1467 1110 900 ----1677
NM_206855chr686272 6122 5626 5193 4701 1139 951 907 24155 1842 ----
NM_207015chr31413 --2367 264 --
NM_207322chr151496 --12128 21825 1367
NM_207406chr486250 6200 5820 5454 2007 867 641 229 45813 5291 2133 1399 14969 14867
NM_212558chr942850 1266 111 30 1895 24188 137 12789
NM_213589chr254001 1157 879 468 95 14325 21909 1311 --