TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3610
miRNA Sequence: GAAUCGGAAAGGAGGCGCCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX46663 2463 2111 1866 ----1603
NM_000217chr1253425 1551 951 878 531 --13709 1576
NM_000793chr1453636 1937 1366 525 309 ------
NM_000809chr458053 3721 3343 2105 1684 28198 7245 28337 3414 --
NM_000868chrX21973 513 --12101 1742
NM_001003652chr1888250 7700 7452 5658 3232 2793 2623 1470 23301 2085 17544 --
NM_001007023chr1453636 1937 1366 525 309 ------
NM_001007245chr72610 260 ----1171
NM_001008408chr755407 4893 4615 648 157 12330 ----
NM_001008564chr131253 ----1242
NM_001011708chr21891 1499 150 12820
NM_001018067chr145201 2044 1520 711 --14959 --
NM_001018068chr145201 2044 1520 711 --14959 --
NM_001018069chr145201 2044 1520 711 --14959 --
NM_001018090chr151248 ----22443 589
NM_001018091chr152358 101 ----22553 699
NM_001018102chr151248 ----22443 589
NM_001024956chr1155665 5438 3783 834 531 1648 ----
NM_001025076chr1066081 4631 4070 1951 1293 134 --44858 4092 3825 492 --
NM_001025077chr1077439 5989 5428 4895 4792 2651 1492 --46216 5450 5183 1850 11074
NM_001037954chr1122399 1116 ----13450
NM_001039538chr233577 3049 185 --1441 1690
NM_001039547chr366985 6863 3121 3047 2777 1518 ------
NM_001039590chrX53789 2889 1597 1112 608 ------
NM_001039591chrX53789 2889 1597 1112 608 ------
NM_001042599chr245643 5205 5020 673 16666 25847 2673 --
NM_001042762chr71359 --1144 1324
NM_001046chr522099 2059 12745 1680 --
NM_001099678chr322493 823 --36264 4648 1493 --
NM_001204chr235880 2600 669 --25169 1716 11621
NM_001412chrX43691 3618 520 122 ----1355
NM_001550chr72610 260 ----1171
NM_001918chr157665 7262 3723 3483 821 15718 19043 19088
NM_001981chr142169 609 417 372 ----12325
NM_002009chr1521858 333 --12701 12516
NM_002158chr253647 3624 2643 1423 452 --13580 13764
NM_002214chr714683 34293 4012 299 25570 1945 --
NM_002264chr363991 3235 2019 1887 1752 1090 ------
NM_002310chr554884 4129 2622 1636 1083 --26284 957 --
NM_002336chr1221941 1274 --13095 14669
NM_002374chr233577 3049 185 --1441 1690
NM_002481chr157272 5558 2990 446 407 ----15999
NM_002655chr833483 1198 215 13295 11213 --
NM_002734chr1711721 12218 --22230 778
NM_002886chr361736 962 617 249 200 186 13554 --11708
NM_003108chr267187 4972 4813 4487 1752 1372 --26669 687 --
NM_003412chr332739 2095 899 12592 --12435
NM_003909chr832650 2368 387 1427 32157 1047 525 --
NM_004432chr91915 ----21717 417
NM_004469chrX1487 --1393 1443
NM_004748chr1533281 2778 671 ----11490
NM_004795chr1311238 ----11514
NM_004857chr1434058 1864 344 14795 --12994
NM_005095chr131745 1716 1646 ----12081
NM_005197chr1465601 5429 3992 2455 1241 554 --25731 1711 --
NM_005235chr245643 5205 5020 673 16666 25847 2673 --
NM_005665chr123044 195 --23580 470 13470
NM_005901chr1888250 7700 7452 5658 3232 2793 2623 1470 23301 2085 17544 --
NM_006047chr2011120 1931 12756 13030
NM_006203chr545579 4407 1835 778 11893 ----
NM_006258chr1021524 1430 ----1296
NM_006464chr244412 2855 1080 109 ----1694
NM_006504chr1022920 2532 ----12856
NM_006538chr233743 3618 1145 1606 --12582
NM_006561chr1066081 4631 4070 1951 1293 134 --44858 4092 3825 492 --
NM_006599chr1697788 6618 6338 5385 3043 2134 2109 766 33 25438 3272 11795 --
NM_006614chr332694 2323 311 ----13490
NM_006918chr1155665 5438 3783 834 531 1648 ----
NM_007007chr1213476 --1928 11402
NM_007106chr1322793 1035 --1190 12046
NM_007249chr1343212 3110 1907 1406 --28756 679 11855
NM_012164chr977563 5927 4953 4558 1033 914 906 11481 ----
NM_012294chr72675 580 ----11094
NM_012465chr1013113 --12308 11089
NM_013231chr1474293 4258 3948 2961 768 577 532 --23868 741 --
NM_013341chr21891 1499 150 12820
NM_013989chr1453636 1937 1366 525 309 ------
NM_014089chr131253 ----1242
NM_014423chr531974 1204 1029 --32111 669 28 --
NM_014707chr731712 813 354 ----1372
NM_014739chr643932 920 479 61 13799 1324 --
NM_014848chr1562695 1894 1767 818 540 183 ------
NM_014877chr1757118 2496 2128 2021 1483 --37093 5399 5300 16386
NM_014899chr522047 2008 ----1362
NM_014905chr232058 1336 158 ----1568
NM_014982chr1445202 4683 1670 991 15090 ----
NM_015026chr1254547 3147 1844 946 775 ------
NM_015076chr641790 428 255 243 11525 ----
NM_015455chr52840 480 ----1127
NM_015532chr151248 ----22443 589
NM_015550chr72953 188 ----13464
NM_015640chr145201 2044 1520 711 --14959 --
NM_016260chr237273 6426 1699 --45962 5538 2471 333 --
NM_016395chr1531805 1727 202 --147 11710
NM_016604chr531289 439 303 ----11090
NM_017563chr365538 2563 2069 1455 1125 622 --152 --
NM_017583chr1111614 --177 1712
NM_018227chr452285 1066 809 450 412 --12240 --
NM_018362chr112639 372 --14039 12559
NM_020443chr156099 4994 2471 1298 998 15375 ----
NM_020718chr1656453 5848 5161 4440 1982 --15258 --
NM_020739chr1533281 2778 671 ----11490
NM_020766chrX53867 3305 3178 2924 1085 14351 11370 --
NM_020772chr1748492 7235 1507 253 17724 --12928
NM_020783chr1822317 1918 ----12242
NM_020800chr31603 1256 11380 151
NM_020871chrX22528 2144 ----11843
NM_020948chr123510 1223 ----13533
NM_021964chr334924 4827 606 ----15029
NM_022116chr71359 --1144 1324
NM_022458chr752598 2455 1056 757 192 1592 1568 --
NM_022459chr1372478 2398 1516 1160 1008 927 813 15672 ----
NM_022462chr1922462 516 --73042 3012 2706 2644 2523 1453 584 --
NM_022484chr71913 1279 --21406 1083
NM_024665chr344206 4007 1742 921 --11324 --
NM_024757chr94799 728 303 296 155 ----
NM_024761chr944906 4678 3241 514 --35163 1463 1295 --
NM_025191chr123528 1164 --13015 1461
NM_030816chr132515 2431 181 ----1907
NM_031845chr233577 3049 185 --1441 1690
NM_031847chr233577 3049 185 --1441 1690
NM_032160chr1833987 3671 2801 ----13998
NM_032682chr32965 308 --22950 1370 12330
NM_032968chrX42704 338 322 274 --13564 182
NM_032969chrX42704 338 322 274 --13564 182
NM_032973chrY42699 338 322 274 --13560 182
NM_033136chr511798 11736 11177 1180
NM_033137chr511798 11736 11177 1180
NM_033225chr863061 994 686 501 44 26 ------
NM_033425chr1122399 1116 ----13450
NM_033656chr2135702 5437 1659 --15131 12095
NM_053043chr755407 4893 4615 648 157 12330 ----
NM_130435chr1022920 2532 ----12856
NM_138333chr962640 2402 1988 1857 437 334 ------
NM_138621chr233743 3618 1145 1606 --12582
NM_138713chr1697788 6618 6338 5385 3043 2134 2109 766 33 25438 3272 11795 --
NM_138714chr1697788 6618 6338 5385 3043 2134 2109 766 33 25438 3272 11795 --
NM_139177chr1721583 133 ----1144
NM_145320chr72953 188 ----13464
NM_145321chr72953 188 ----13464
NM_145322chr72953 188 ----13464
NM_152838chr2011120 1931 12756 13030
NM_172071chr177216 6840 1865 1323 1225 1041 776 --17102 --
NM_173214chr1697788 6618 6338 5385 3043 2134 2109 766 33 25438 3272 11795 --
NM_173359chr321217 37 --21783 275 1485
NM_173468chr435063 4869 1488 --15278 1149
NM_173683chr81409 ----1641
NM_175624chr1247749 7383 6740 96 1881 12693 16120
NM_175625chr1247749 7383 6740 96 1881 12693 16120
NM_178496chr33368 42 29 11259 1194 --
NM_181789chr1563060 2946 2695 1262 845 576 --12497 --
NM_198581chr246623 6235 6169 1833 1435 11699 --
NM_207445chr1532058 1812 521 --2117 104 --
NM_212471chr1711721 12218 --22230 778
NM_212472chr1711721 12218 --22230 778