TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3613-3p
miRNA Sequence: ACAAAAAAAAAAGCCCAACCCUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX83394 3315 3248 3115 2132 589 306 216 --12531 11318
NM_000092chr284099 3494 3488 3265 3213 1826 1381 545 ------
NM_000104chr262927 2668 2220 377 209 71 11057 12146 1212
NM_000109chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_000112chr5155347 5292 5181 4830 4466 4417 3504 1944 1935 1794 1787 1778 1699 870 687 --25183 4470 --
NM_000115chr1342553 2516 870 239 1600 12483 1822
NM_000151chr1741783 1390 1380 1218 1425 --21393 1229
NM_000163chr582368 1961 1892 1673 1500 699 547 436 2336 283 31675 410 94 --
NM_000168chr7103145 3117 3108 3097 2775 2564 2353 1229 489 81 11348 ----
NM_000176chr5113831 3723 3650 3298 2386 1230 953 580 565 356 101 1434 ----
NM_000192chr1271393 1381 1362 1334 1324 1316 440 --21328 1318 11365
NM_000208chr19104716 4663 4191 3439 2989 537 505 496 340 278 24310 1866 44720 3009 498 356 --
NM_000214chr2061510 1201 610 499 484 381 1713 11512 --
NM_000216chrX53964 3384 1191 1060 471 1416 12961 22562 474
NM_000217chr12104532 3946 3646 2071 1983 1950 1555 1295 1082 359 --23305 1488 --
NM_000232chr453024 2937 2455 2293 49 12080 12060 12296
NM_000259chr1595816 5762 5740 5588 5461 5286 5262 4280 2523 --25846 4383 16071
NM_000264chr963281 3139 3008 2642 660 526 --33098 665 528 --
NM_000267chr17123490 3214 3027 2919 2632 2462 879 812 762 503 201 21 --53137 2913 2906 828 814 --
NM_000314chr1082590 1234 1129 1056 663 341 228 70 12330 ----
NM_000332chr6226944 6882 6491 5384 5274 5054 4843 4728 4386 4349 2769 2689 2485 2479 2393 1885 1829 1483 1243 1047 986 696 --15276 --
NM_000333chr371113 869 757 419 305 294 288 ------
NM_000337chr576621 5223 4401 2326 2241 1104 629 --25829 47 11769
NM_000346chr17131983 1705 1424 1392 1378 1364 1304 1279 593 388 126 108 100 --31990 1426 102 --
NM_000408chr272841 2371 1372 746 296 220 112 23335 2911 21360 1004 --
NM_000430chr1763358 1509 1308 886 877 554 21265 1193 11512 --
NM_000441chr73925 878 97 1384 --32023 881 700
NM_000448chr1183116 3024 2738 2704 2090 640 385 30 22867 447 43123 3038 2740 2315 --
NM_000461chr374483 4356 3826 2820 1773 1573 688 13507 175 --
NM_000489chrX83352 2299 1262 1162 1137 715 142 56 21387 1349 ----
NM_000555chrX136710 6321 5487 5284 5233 5080 4907 4762 2548 1965 1949 1426 1003 16699 37552 2551 1967 24923 1178
NM_000610chr1172954 2176 895 875 621 139 114 1578 3889 882 146 1903
NM_000618chr12176418 6226 5859 5700 5304 5291 5100 4483 4410 4404 4074 2557 2230 1949 1362 893 817 15145 35461 4983 4391 --
NM_000618chr12176418 6226 5859 5700 5304 5291 5100 4483 4410 4404 4074 2557 2230 1949 1362 893 817 15145 35461 4983 4391 --
NM_000633chr1874998 4962 3977 1834 1661 719 232 --11836 --
NM_000767chr1941097 1034 970 388 11349 --21046 235
NM_000809chr4199285 9001 8922 8407 8102 7712 7001 6457 6428 5930 5775 3001 2293 2154 1642 1290 1278 299 185 25968 1722 21505 1280 25662 3004
NM_000813chr5125132 5126 5120 4879 4601 4449 4146 4124 1533 1177 1084 693 --11181 --
NM_000827chr542583 2547 2141 377 --12549 21895 189
NM_000875chr15167039 6907 6776 6492 5989 5886 5777 5736 5666 5120 2638 2601 1769 1281 1225 184 --32593 2353 1284 --
NM_000891chr17113616 3038 3009 2747 2426 1420 933 737 652 579 420 1382 12776 1546
NM_000935chr361013 988 889 822 806 791 --2990 794 --
NM_000944chr452363 2196 939 787 21 --22365 764 146
NM_000950chrX123639 3167 3113 3019 2539 2433 2233 1215 1191 669 442 186 22442 966 22435 674 --
NM_001001323chr1282856 2454 2084 1268 887 759 479 432 11109 32890 1262 761 --
NM_001001389chr1172954 2176 895 875 621 139 114 1578 3889 882 146 1903
NM_001001390chr1172954 2176 895 875 621 139 114 1578 3889 882 146 1903
NM_001001391chr1172954 2176 895 875 621 139 114 1578 3889 882 146 1903
NM_001001392chr1173000 2222 941 921 667 185 160 1624 3935 928 192 1949
NM_001001395chr1252809 865 771 252 233 --3773 235 56 --
NM_001001396chr194450 4128 3289 2846 2833 2772 1750 1536 876 ------
NM_001001419chr5125209 4885 4045 1787 1755 1658 1011 1001 687 674 301 114 1826 1947 13762
NM_001001420chr5125209 4885 4045 1787 1755 1658 1011 1001 687 674 301 114 1826 1947 13762
NM_001001433chr20103177 3145 3078 2022 1979 712 396 357 279 189 --13136 --
NM_001001481chr8103466 3364 2906 2826 2205 1050 972 866 271 258 11126 ----
NM_001001664chr253841 3650 887 732 257 13936 34103 3843 889 --
NM_001001890chr21133743 3727 3580 3570 3470 3402 3366 3272 3256 2818 808 699 679 --33745 3582 683 1702
NM_001001928chr22128368 7102 7065 6998 6637 5831 1929 1896 1509 1491 1443 933 17169 ----
NM_001001974chr1082275 1810 1788 1767 904 868 735 287 21499 532 --11905
NM_001002243chr23720 244 40 1228 1722 1746
NM_001002257chr2113465 3223 2278 2263 1295 1283 1274 920 828 172 80 --11301 --
NM_001002838chrX71857 754 586 359 256 219 35 --21866 135 1598
NM_001002860chr14124013 3954 3730 3408 3359 3060 1535 584 474 293 180 130 --2387 295 --
NM_001003652chr18188415 8241 7565 6554 6307 3449 3008 2880 2797 1733 1328 754 739 676 666 650 477 465 26152 1571 55409 2802 2769 670 660 --
NM_001003688chr441093 819 798 778 --21095 1010 --
NM_001003712chr12153755 3646 3498 3471 3151 3042 1528 1350 1270 1195 1105 887 800 630 609 --42817 2807 2668 1197 --
NM_001003792chr39961 901 486 474 352 223 211 126 106 --1108 --
NM_001003793chr39961 901 486 474 352 223 211 126 106 --1108 --
NM_001004065chr963828 3811 3639 3049 1428 1151 --33830 2609 223 --
NM_001004317chr664167 3517 3388 1008 620 131 ----2683 634
NM_001005386chr262510 2360 2305 778 165 44 21992 620 11642 --
NM_001005463chr1072574 2073 1961 1943 955 761 464 --1466 --
NM_001005473chr5126583 6109 5806 5382 4634 4595 4043 2421 2234 676 603 532 25563 1185 26113 4586 --
NM_001005474chr361424 1393 1310 1190 1184 534 ------
NM_001005861chr37984 921 668 635 368 248 224 --2911 235 --
NM_001006600chr571658 848 771 665 445 294 271 ----22490 448
NM_001006657chr293014 2650 1057 1020 785 545 304 265 133 ------
NM_001006945chr16673 489 296 220 113 38 --2681 222 --
NM_001007097chr974945 4780 3924 3866 1487 1360 880 1344 11490 --
NM_001007257chr161259 1187 611 548 530 316 --31189 947 533 --
NM_001007278chr1385294 4333 4047 3705 1295 939 360 195 24928 701 64675 4630 4050 3716 532 197 25297 378
NM_001007466chr6105162 4938 4796 4706 4629 4530 1802 1753 1582 1576 13448 31570 1557 1544 --
NM_001007559chr1881927 1786 1625 1605 1597 686 369 107 --31612 1599 371 11632
NM_001008239chr18103709 3457 3358 3200 2959 1349 1343 1328 801 157 23156 348 13778 13806
NM_001008393chr4132300 2242 2145 2071 2048 1902 982 776 719 646 555 177 149 21115 902 2985 702 1623
NM_001008408chr774949 4544 4524 4163 4055 2013 825 12033 24526 2109 --
NM_001008495chr892121 1870 1815 1729 1487 558 462 254 139 11703 ----
NM_001008540chr25172 138 116 44 22 --1175 --
NM_001008541chr1032313 1943 547 ----1555
NM_001008541chr1032313 1943 547 ----1555
NM_001008564chr1382125 2070 1953 1894 1745 1673 307 172 --11804 11881
NM_001008738chr582624 2109 1969 1800 1072 1037 737 584 1179 --11819
NM_001008925chr452863 2729 2408 903 731 12989 43568 3025 1232 430 --
NM_001009571chr771186 298 217 193 180 58 51 --3219 195 182 --
NM_001009899chr3146550 4996 4807 4723 4135 4044 3998 2464 2283 1886 1763 1496 1323 218 --25051 4137 11892
NM_001009909chr1183957 3516 3335 2690 2389 1492 1151 752 --11555 22394 897
NM_001009960chr732695 2231 815 12276 --11029
NM_001009993chr284476 4338 4314 4286 4280 1781 972 230 ------
NM_001010000chr1873371 2452 2431 1405 862 392 203 1422 11286 --
NM_001010853chr6163117 3039 2926 2884 2570 1236 1225 1093 1074 676 515 344 245 179 84 46 22808 897 23244 517 12239
NM_001010862chrX93302 3244 3028 3001 1231 321 260 153 101 ------
NM_001010867chr165326 5306 5145 2148 1976 926 --15450 25155 1996
NM_001010888chrX63812 3499 3487 823 580 419 13977 14414 1427
NM_001010891chr5145459 5386 5249 5086 4842 4629 4447 2671 2502 2269 2229 1432 426 289 11222 14280 12512
NM_001010922chr1103782 3575 3317 3046 2922 491 471 195 142 101 --1653 --
NM_001010986chrX72514 2430 2322 629 600 422 352 --1354 --
NM_001011513chr483350 2992 2511 1615 1053 979 879 834 --13353 --
NM_001011537chr342308 2187 1728 140 1131 22318 1930 --
NM_001011553chr73659 238 139 --2969 145 --
NM_001011666chr7146443 5490 5467 4981 4505 4306 4282 2520 2311 1959 1334 1141 676 502 14693 --11346
NM_001012393chr1195042 5017 4566 4061 2073 136 130 101 95 ------
NM_001012761chr552556 2039 1930 278 25 --32559 1932 33 12368
NM_001013031chr1063462 3452 3338 3034 324 258 --13233 13222
NM_001013415chr461616 1441 1421 1291 544 519 11111 21443 557 --
NM_001013620chr12208026 7759 7195 6556 6535 6444 6433 5915 5706 5489 5439 3218 2992 2831 2819 2665 1759 1266 395 131 46399 5723 2159 1328 55922 2821 2457 2192 1761 --
NM_001014380chr13115587 4963 4650 4381 3553 1780 1488 1456 343 90 34 --44786 4371 769 670 14653
NM_001014797chr1073046 2447 2119 1158 755 413 156 16363 ----
NM_001015877chrX62895 2467 2460 2449 437 63 11070 22481 2469 --
NM_001017369chr451119 1019 976 426 416 ----1432
NM_001017371chr261401 1165 1137 1024 1012 105 --21078 1031 --
NM_001017395chr381190 1071 864 834 726 473 173 140 --31203 866 197 --
NM_001017999chr152168 364 358 352 329 1529 ----
NM_001017999chr152168 364 358 352 329 1529 ----
NM_001018000chr152168 364 358 352 329 1529 ----
NM_001018000chr152168 364 358 352 329 1529 ----
NM_001018001chr152168 364 358 352 329 1529 ----
NM_001018067chr1105383 4782 4626 4389 1574 1091 862 572 556 368 ----24785 4639
NM_001018068chr1105383 4782 4626 4389 1574 1091 862 572 556 368 ----24785 4639
NM_001018069chr1105383 4782 4626 4389 1574 1091 862 572 556 368 ----24785 4639
NM_001018074chr5113831 3723 3650 3298 2386 1230 953 580 565 356 101 1434 ----
NM_001018075chr5113831 3723 3650 3298 2386 1230 953 580 565 356 101 1434 ----
NM_001018076chr5113831 3723 3650 3298 2386 1230 953 580 565 356 101 1434 ----
NM_001018077chr5113831 3723 3650 3298 2386 1230 953 580 565 356 101 1434 ----
NM_001018111chr784034 3848 3205 3121 3110 3064 2962 2835 ----22965 2902
NM_001024094chr5113831 3723 3650 3298 2386 1230 953 580 565 356 101 1434 ----
NM_001024647chr1286255 4693 4660 2849 1365 1021 947 107 26194 1001 11025 12852
NM_001024956chr1195771 5429 4672 3917 3809 3795 894 838 61 --1896 --
NM_001025076chr10166168 5906 5463 4181 4038 3881 3819 2028 2021 1676 1526 1337 1052 999 611 341 --33913 3798 1301 1552
NM_001025077chr10227526 7264 6821 5539 5396 5239 5177 4989 4859 3034 2884 2695 2410 2357 1969 1699 1396 1009 309 302 293 282 --35271 5156 2659 11910
NM_001025079chr393916 3841 3784 3292 3262 3011 2846 2833 1249 23507 1473 53786 3742 2840 2641 241 24133 2874
NM_001025105chr541095 1087 1027 257 --1329 1946
NM_001025108chr2103990 2897 2886 1655 1560 1345 1332 1283 582 58 13385 12900 1530
NM_001025266chr384939 4640 4276 3708 3669 3497 1585 72 --23882 1749 23728 1594
NM_001025580chrX113748 3640 3552 3530 3523 2611 1541 1006 547 252 222 --1227 24058 485
NM_001029858chr662393 2209 1187 877 448 49 33333 3160 264 21361 450 11207
NM_001030055chr14124475 4027 3729 3392 3358 3247 3093 2991 2886 1456 1174 830 34305 3939 3461 14490 12893
NM_001031695chr22125335 4717 4544 3875 2088 1602 1050 790 676 245 237 153 --25337 3877 --
NM_001031732chr4142798 2754 2497 1332 1254 1244 888 855 509 490 335 326 314 53 --33594 316 58 21247 891
NM_001031804chr16144064 3647 3474 1585 1396 1368 1025 1017 727 627 556 511 434 315 --11426 11109
NM_001031812chr562371 1693 1607 1525 371 170 --11991 11612
NM_001032283chr125936 765 260 245 228 2288 179 2938 308 --
NM_001032284chr125936 765 260 245 228 2288 179 2938 308 --
NM_001032999chr2085272 4523 3803 1663 1530 1375 1343 706 --11357 --
NM_001033578chr841982 1957 342 297 1919 22296 281 --
NM_001033659chr1751181 1173 1015 413 29 ----21448 1022
NM_001033723chr8102770 1944 1803 1787 1754 1733 564 390 267 239 --1269 1393
NM_001034841chr16125298 5196 5023 4984 4562 4374 4024 4018 3781 3413 1949 1538 35157 3743 420 33571 1540 1038 14032
NM_001034845chr481419 1412 1377 1279 1109 1098 1091 541 --21379 1114 --
NM_001037164chr761774 1477 1449 1441 1353 514 1538 21443 740 1481
NM_001037165chr7178855 8766 8744 8445 8332 8130 8113 7747 7648 7394 7310 7290 7148 6985 6533 5663 2744 1651 47317 7292 6590 5842 26994 5688
NM_001037582chr44515 371 196 141 1218 2373 202 1523
NM_001038702chr542668 2163 1923 251 --32670 1944 222 --
NM_001039199chr2093907 3348 3329 3321 3052 3043 1564 987 283 11777 11572 --
NM_001039395chr952275 2249 460 234 88 11580 --12185
NM_001039535chr185493 479 294 111 81 --51552 656 455 303 100 2504 121
NM_001039547chr3167153 6638 6587 5983 5944 3135 3125 2781 2614 2517 2435 1943 1788 1772 1402 176 1980 11790 12628
NM_001039585chr162947 2730 962 924 452 42 ----1695
NM_001039590chrX143720 3633 3423 3282 3183 2705 2641 1527 1516 1500 1493 1475 587 289 13736 31518 1505 1339 23355 2895
NM_001039591chrX143720 3633 3423 3282 3183 2705 2641 1527 1516 1500 1493 1475 587 289 13736 31518 1505 1339 23355 2895
NM_001039618chr11165687 5450 5155 4880 4707 4685 4628 4129 4070 4037 2360 1475 1148 999 378 219 ----11931
NM_001039693chr273728 3685 1639 1111 1094 1015 699 11023 13935 1777
NM_001039709chr2085272 4523 3803 1663 1530 1375 1343 706 --11357 --
NM_001039802chr1101256 888 481 468 436 421 282 266 239 98 --3439 297 243 --
NM_001039840chrX85919 5798 5586 5339 4961 3891 2336 2013 25096 1172 1172 --
NM_001039937chr1364027 2723 1394 717 381 185 23777 3394 --12726
NM_001040157chr4112417 2152 2056 1860 1145 1035 689 321 210 138 22 32096 173 105 21062 691 --
NM_001040214chr652361 2315 1535 1466 50 --12319 12364
NM_003506chr841203 908 830 228 --1890 2436 335
NM_003566chr12133457 3252 2857 2756 2498 2270 970 738 617 417 302 208 173 --12217 --
NM_003574chr18115361 5105 4390 3979 3852 3637 1845 1356 1048 107 31 25120 4617 25661 109 --
NM_003583chr1293424 3415 3089 2591 2421 2390 1439 1279 217 --23094 2857 --
NM_003615chr3103994 3685 3647 3629 3615 3051 2651 1283 769 604 --13996 --
NM_003622chr1282600 2549 2412 2244 1854 967 816 42 1716 --12254
NM_003629chr183457 2298 2273 1339 853 265 237 39 --22957 1341 1241
NM_003659chr231103 992 37 1986 --11079
NM_003663chr383369 3350 2435 1223 874 774 311 77 --43372 3156 1057 878 --
NM_003677chr1282003 1680 836 799 784 601 442 324 ----2764 450
NM_003722chr3132721 2642 2543 2480 2417 1957 1944 1853 1842 1791 775 443 367 ------
NM_003750chr103965 698 337 ----1342
NM_003759chr4103391 2827 1633 914 885 764 748 241 216 194 --23380 865 --
NM_003763chr20103177 3145 3078 2022 1979 712 396 357 279 189 --13136 --
NM_003774chr12103397 3337 3306 2588 2432 2396 2388 500 487 454 ------
NM_003800chr6102312 2251 1660 1645 1580 795 617 388 125 67 --1582 --
NM_003816chr851451 1239 1226 1166 55 ----1285
NM_003825chr1541573 622 556 370 1488 41167 631 354 156 --
NM_003831chr1841745 1576 1570 575 11641 11747 --
NM_003842chr852134 1978 1584 296 47 --2567 402 11981
NM_003902chr14828 587 128 104 ----1142
NM_003913chr694088 3650 3404 3357 3028 2994 1376 1317 780 --23257 660 --
NM_003921chr1111572 1434 1372 1200 1132 734 727 719 333 250 221 1527 ----
NM_003934chr971162 1093 901 350 241 206 192 ------
NM_003939chr1094142 3272 3092 3066 2974 1295 1289 687 310 --23068 1298 --
NM_003941chr782496 2104 1863 1670 754 416 135 116 21871 745 2756 128 12499
NM_003953chr172868 2188 2163 1954 964 562 256 ----32850 976 565
NM_003955chr1781631 1419 1400 1388 1303 1297 1291 1285 --21402 1279 --
NM_003966chr576922 6407 6228 5091 2664 2291 1329 25574 2043 27788 6938 1284
NM_003983chr1684485 4385 4227 4166 3705 3694 3109 724 --14347 --
NM_004006chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004007chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004009chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004010chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004011chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004012chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004013chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004014chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004015chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004016chrX82488 2209 2046 2033 881 675 481 99 11656 1483 --
NM_004017chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004018chrX82488 2209 2046 2033 881 675 481 99 11656 1483 --
NM_004020chrX82574 2295 2132 2119 967 761 567 185 11742 1569 --
NM_004021chrX82488 2209 2046 2033 881 675 481 99 11656 1483 --
NM_004022chrX82488 2209 2046 2033 881 675 481 99 11656 1483 --
NM_004023chrX82488 2209 2046 2033 881 675 481 99 11656 1483 --
NM_004035chr17144812 4751 4471 4302 3677 3518 3384 3374 3367 3205 1197 1161 955 921 1385 14473 24320 3533
NM_004094chr1472518 2224 2217 933 836 808 111 --12238 --
NM_004124chr14103304 2733 2672 2567 2349 2296 2173 1434 874 245 11398 ----
NM_004133chr852643 2539 1911 1819 237 2616 370 --11835
NM_004171chr11148150 7337 6882 5999 5846 3836 3120 2602 2343 1937 1831 1786 1762 1451 29441 8666 32394 2110 916 16680
NM_004229chrX41905 368 357 94 1390 1350 --
NM_004285chr1106442 6237 6084 6016 5988 4069 2124 1965 788 781 ----26092 1975
NM_004326chr17974 403 383 377 235 221 205 ----1386
NM_004331chr892555 1693 897 882 875 826 805 452 197 21867 797 1600 --
NM_004342chr75740 618 555 384 378 1468 ----
NM_004384chr562371 1693 1607 1525 371 170 --11991 11612
NM_004392chr1352253 1957 688 569 322 ----11974
NM_004393chr361470 639 618 536 399 205 1268 1219 --
NM_004397chr11174305 4214 3725 3656 3549 3353 3345 2992 2831 2729 1054 1007 679 668 542 421 142 --44047 2758 1058 190 14023
NM_004429chrX51461 1400 1364 1358 392 ----1423
NM_004430chr882321 2182 2044 1994 1902 1880 1857 1850 ----12440
NM_004437chr173206 3014 2465 1311 1237 656 270 11253 11305 21314 1036
NM_004440chr661996 1797 708 694 596 285 --31892 1801 710 11850
NM_004458chrX42305 1813 686 285 ----2752 689
NM_004464chr4104207 4127 3862 3671 3622 3344 1530 587 415 361 23707 791 23675 419 1163
NM_004480chr145551 527 521 515 505 --1509 --
NM_004500chr1491859 1524 1456 696 689 626 597 498 230 ------
NM_004501chr153963 558 279 147 123 --23966 162 13037
NM_004504chr282794 2756 2716 1204 1065 1053 979 641 --21114 1067 12769
NM_004505chr1761762 1319 1268 571 565 528 ------
NM_004506chr63696 285 82 --184 1699
NM_004529chr941295 1089 55 41 --41297 78 64 48 --
NM_004537chr1251261 1207 981 132 126 ----1985
NM_004598chr553017 2479 1224 531 206 1360 3821 228 211 --
NM_004612chr9114799 4212 3725 3242 1114 1086 787 775 270 250 31 ------
NM_004622chr282186 1923 1912 1710 1581 1497 624 199 --31914 202 160 11985
NM_004643chr148867 835 806 737 715 707 685 118 --1709 --
NM_004654chrY31116 948 292 --1337 1295
NM_004725chr1051473 1139 1106 1009 154 1147 1287 --
NM_004726chrX135456 5324 5238 4943 4461 4397 1997 1841 1702 1671 1569 748 410 23601 1402 44405 3971 1835 1696 11844
NM_004736chr132126 1912 449 11899 42149 1969 1914 426 --
NM_004745chr886835 6684 6670 4864 4317 1755 894 820 ----16813
NM_004748chr1583974 3728 3489 2898 1639 757 608 540 --23810 2873 13493
NM_004775chr1882331 2307 2287 2233 2199 1948 894 443 ----11565
NM_004776chr20103338 3313 3223 2677 2247 2126 2030 1204 509 63 13181 167 --
NM_004788chr1172417 2364 2053 1915 580 376 113 --1871 --
NM_004796chr14102388 2214 2045 1702 1653 1600 623 613 437 150 --12047 1626
NM_004815chr1104814 4134 4072 4004 3562 1465 1214 504 263 24 1840 33210 371 26 --
NM_004834chr283414 3352 3092 2727 1012 954 868 189 --43355 959 600 505 --
NM_004850chr261426 1420 1409 1293 533 512 --11414 --
NM_004857chr1454694 3921 3488 1482 426 --11648 21891 1494
NM_004863chr14105187 4489 4395 4095 3532 2056 1440 1372 1214 1207 11829 14457 --
NM_004866chr584977 3746 3468 1891 1434 1060 553 244 11103 21685 917 --
NM_004904chr7146443 5490 5467 4981 4505 4306 4282 2520 2311 1959 1334 1141 676 502 14693 --11346
NM_004906chr67535 471 160 144 131 118 96 --2180 122 --
NM_004926chr1451864 1821 1321 1205 300 --31379 1361 1208 --
NM_004956chr784252 3670 1675 1507 1435 527 45 30 --24443 1496 --
NM_004973chr65415 309 292 169 38 21609 357 61769 1716 317 296 172 40 --
NM_004985chr12184494 4277 3816 3736 3723 3699 3679 3400 3313 3251 2862 1621 1285 1213 600 169 101 52 23233 210 ----
NM_004999chr6103810 2877 2806 1715 1659 1296 860 528 494 332 --1951 --
NM_005036chr22128368 7102 7065 6998 6637 5831 1929 1896 1509 1491 1443 933 17169 ----
NM_005056chr12114864 4364 4160 3817 3531 2039 1868 1744 1449 1396 1208 13802 21555 979 14254
NM_005063chr1053759 3557 3190 1452 823 --13201 11457
NM_005065chr14125340 5040 5030 4390 4118 4095 3893 1973 1602 1447 948 246 11519 24129 674 --
NM_005093chr2085272 4523 3803 1663 1530 1375 1343 706 --11357 --
NM_005105chr14441 278 269 152 --2711 557 1282
NM_005121chr17113358 3029 2618 2380 2324 1348 1328 1183 1037 614 257 --43430 3372 2622 616 --
NM_005135chr1583829 3730 2905 2508 2392 928 720 500 --13831 --
NM_005156chr9195057 5024 4555 4519 4328 3957 3666 3320 1676 1645 1230 1177 1143 945 931 855 602 261 152 --31678 989 159 14522
NM_005160chr22106612 5447 4833 4746 4720 4244 2420 2409 1520 1387 14309 32588 2429 1526 --
NM_005168chr251754 1683 337 329 144 21397 1289 1344 --
NM_005188chr1188271 7620 6093 5983 5354 3040 1223 480 ----12316
NM_005194chr203584 481 180 --2483 472 1588
NM_005197chr14175907 5719 5512 4802 4658 4492 1528 1522 1509 1503 1497 1488 1462 1310 112 102 93 --24495 1516 11557
NM_005207chr2263689 2660 740 585 551 489 13257 23279 555 1588
NM_005231chr1161376 1258 976 268 97 88 --1280 21409 118
NM_005233chr362621 2023 2000 1931 222 207 1623 1209 1785
NM_005235chr2187826 7542 7493 6417 5972 5893 5647 5140 2975 2663 2642 2373 888 699 648 641 360 315 17163 47363 6048 5480 2964 --
NM_005238chr11113525 3431 3322 3234 3216 2912 2654 2193 601 114 93 --23472 1200 --
NM_005254chr1561191 1037 928 507 290 217 1304 11198 --
NM_005333chrX71065 1002 957 918 474 340 37 --1960 --
NM_005339chr494268 3983 3190 2906 2894 1676 905 567 220 11484 ----
NM_005358chr1351515 354 178 124 100 1287 2126 93 --
NM_005359chr18175753 5000 4988 4979 4271 4107 2088 1504 1441 1347 1140 1111 1057 1033 858 623 176 26553 4858 34109 1059 561 12092
NM_005375chr66862 849 799 329 269 107 --2906 864 1348
NM_005381chr25398 336 330 316 278 --2345 319 --
NM_005388chr991614 1505 1347 1338 1302 1170 1053 470 66 ----11515
NM_005397chr784034 3848 3205 3121 3110 3064 2962 2835 ----22965 2902
NM_005420chr45682 614 308 142 130 ----1155
NM_005433chr1892720 2582 2223 2115 765 485 449 316 154 ------
NM_005436chr10144146 3466 3456 3444 3423 3051 1626 1513 1212 708 569 372 363 300 --13434 13486
NM_005494chr74422 249 201 72 --1206 175
NM_005497chr17135061 4862 4109 2248 1967 1793 1621 1566 1488 1084 343 320 294 1664 44871 4716 1796 345 11626
NM_005502chr953113 3046 2413 311 244 1982 1322 11293
NM_005504chr1285688 5342 4750 4692 2441 1463 1407 456 15899 21418 370 1505
NM_005573chr56689 500 470 294 287 271 1149 2472 273 1264
NM_005578chr3135156 4985 4533 4451 4365 3897 3663 1796 1659 1005 534 237 151 --34869 1798 538 --
NM_005591chr1172343 1920 1725 972 543 437 166 --12018 11923
NM_005596chr9156274 6094 5530 5520 5203 5178 4950 4814 4380 4009 2039 1989 1770 1661 150 25444 1006 25166 1943 --
NM_005610chr15813 658 639 573 40 --1645 --
NM_005637chr1881927 1786 1625 1605 1597 686 369 107 --31612 1599 371 11632
NM_005665chr1104881 1979 1844 1622 1443 842 823 503 485 66 --34250 4223 664 --
NM_005668chr554641 3247 1244 668 523 --3826 679 528 --
NM_005722chr262510 2360 2305 778 165 44 21992 620 11642 --
NM_005738chr761774 1477 1449 1441 1353 514 1538 21443 740 1481
NM_005748chr1243107 1162 625 348 1561 22205 627 1617
NM_005759chr254753 3761 1736 529 125 --24425 130 --
NM_005795chr262715 2449 2229 1055 520 492 1103 1496 12856
NM_005797chr1181770 1546 1380 1300 1121 600 279 237 ------
NM_005798chr1385294 4333 4047 3705 1295 939 360 195 24928 701 64675 4630 4050 3716 532 197 25297 378
NM_005813chr2112625 2422 2402 2304 1978 988 633 591 357 257 226 --12404 --
NM_005832chr381479 1317 1295 1105 552 505 419 27 --11071 --
NM_005839chr110922 905 893 791 697 683 387 362 342 330 --4910 686 344 332 --
NM_005840chrX76575 5998 5769 4742 3071 2181 2080 --13073 --
NM_005841chr481027 957 763 389 277 77 71 65 --159 --
NM_005843chr281934 1817 1756 1488 576 500 164 86 --1539 --
NM_005871chr105918 785 685 668 320 --1679 --
NM_005895chr1284128 3197 3179 3027 2860 2570 545 478 --24184 480 22874 563
NM_005898chr1162680 2585 2254 2232 2212 972 2769 691 12256 12235
NM_005900chr441093 819 798 778 --21095 1010 --
NM_005901chr18188415 8241 7565 6554 6307 3449 3008 2880 2797 1733 1328 754 739 676 666 650 477 465 26152 1571 55409 2802 2769 670 660 --
NM_005902chr1584164 4065 3967 3194 3164 1531 1504 316 ----1319
NM_005903chr5125209 4885 4045 1787 1755 1658 1011 1001 687 674 301 114 1826 1947 13762
NM_005909chr593659 3372 3168 2729 1466 1368 988 572 169 --23665 2745 11508
NM_005935chr4125154 4755 4702 4530 3922 3639 2095 1459 467 422 304 41 --34804 3648 3641 --
NM_005941chr894139 4088 2938 1642 1322 447 439 431 423 1803 34141 4090 449 --
NM_005955chr175506 5205 5144 4894 4748 4576 1853 25408 2159 24919 3673 25209 1860
NM_005962chr1032313 1943 547 ----1555
NM_005962chr1032313 1943 547 ----1555
NM_005999chr161113 1107 1035 983 403 236 1229 1977 11526
NM_006007chr974523 3984 3813 3627 1586 1208 390 22890 1678 54525 3815 3805 3798 1184 --
NM_006037chr2134438 4428 3645 3565 3471 1716 1704 1673 1547 1535 703 680 485 13508 14441 --
NM_006060chr753544 3347 3192 3183 2709 1902 32711 143 136 --
NM_006079chr65811 796 203 192 180 1714 --1814
NM_006089chrX51268 758 675 162 85 1665 --11271
NM_006106chr1173442 3423 2214 986 881 740 731 12639 33362 734 725 --
NM_006135chr151373 1229 575 236 228 --1250 --
NM_006141chr1662502 2368 2175 1984 1957 866 --2881 101 12506
NM_006166chr1282647 2432 1611 808 695 564 527 228 11884 1529 --
NM_006197chr82242 206 --2322 228 1119
NM_006202chr1971555 1536 1496 246 190 152 137 --21577 192 1249
NM_006203chr5105423 4903 3961 3821 3746 1097 866 671 174 27 --1583 14302
NM_006206chr452913 2721 2595 1101 555 2776 512 --11160
NM_006212chr195395 5075 5048 4992 3887 3877 3386 1620 1181 11110 ----
NM_006241chr391948 1879 745 714 704 698 676 616 393 --31888 688 670 21972 1623
NM_006251chr5103168 2962 2676 2606 2534 2105 1016 968 507 265 13040 32768 2706 2608 1510
NM_006252chr1127581 7398 7270 7153 6706 6232 6017 2798 2348 1225 820 804 25203 4843 11227 36594 5867 2121
NM_006256chr192648 2481 2019 850 676 618 538 468 319 --62300 2100 1926 852 679 102 --
NM_006282chr2094667 4660 4528 4483 3416 3397 3203 3038 3024 1880 13026 13049
NM_006283chr884964 3529 3464 1955 1071 944 409 381 --34132 4122 383 1955
NM_006352chr191896 1802 1624 1563 434 367 352 332 128 --3825 361 354 --
NM_006371chr365285 4641 1792 689 658 222 --1660 1226
NM_006379chr762192 2064 1672 935 746 570 --1748 --
NM_006380chr1753441 3362 3022 654 264 14245 43613 1256 661 267 11625
NM_006386chr2282466 1853 1680 1639 110 103 92 68 ------
NM_006425chr531090 265 248 --1426 1272
NM_006457chr483350 2992 2511 1615 1053 979 879 834 --13353 --
NM_006482chr1293424 3415 3089 2591 2421 2390 1439 1279 217 --23094 2857 --
NM_006504chr1062962 2651 2093 1089 442 25 11160 12734 --
NM_006526chr2072063 2011 1964 1593 1449 530 316 11671 11871 --
NM_006534chr20112714 2631 2570 2434 2376 1272 1020 965 829 792 320 --52726 2378 1022 967 245 --
NM_006544chr14135756 5711 5504 3846 2270 2146 2086 2027 1346 1316 562 501 207 26067 4412 1503 --
NM_006546chr17126398 5789 5730 4835 2395 1801 1723 1717 1706 1676 903 488 --22402 1725 11711
NM_006547chr782138 1886 1866 1761 1729 1352 656 609 ----31498 762 613
NM_006561chr10166168 5906 5463 4181 4038 3881 3819 2028 2021 1676 1526 1337 1052 999 611 341 --33913 3798 1301 1552
NM_006572chr1742333 1223 67 34 143 13140 11171
NM_006599chr16168088 6907 5623 5450 4992 3132 2782 2084 1951 1742 1684 1594 1539 651 509 462 12765 22071 1953 17886
NM_006601chr124841 780 768 147 ----1783
NM_006609chr292881 2495 2400 1843 559 221 195 179 79 12833 ----
NM_006614chr383218 2919 2807 1464 1292 695 683 643 ------
NM_006618chr161476 1394 489 257 207 199 1190 1260 --
NM_006626chr982494 2346 2227 2144 1653 806 570 459 --12326 11656
NM_006628chr15104593 4569 3787 3602 3443 3278 1842 1313 1170 719 1167 14571 13451
NM_006629chr1842260 1059 853 270 --11063 22291 856
NM_006654chr12114424 4405 4246 3863 3798 3560 3443 3150 974 853 114 1487 14305 --
NM_006717chr952711 2269 2147 986 803 --42713 2640 843 807 1378
NM_006729chrX105027 4539 4413 4122 3947 3834 3534 1880 1775 908 21833 793 35082 4124 4114 --
NM_006734chr64516 282 53 45 --2353 47 --
NM_006745chr451119 1019 976 426 416 ----1432
NM_006750chr16127815 7611 6460 5329 5311 5305 2929 2115 1968 836 772 309 15099 15333 11975
NM_006756chr851533 1130 386 308 225 21459 131 11536 --
NM_006766chr8102648 2353 2211 1733 1707 899 740 729 169 145 --1171 --
NM_006773chr271560 1449 1428 351 319 77 51 --2622 444 --
NM_006775chr6122834 2668 2610 2586 1122 1115 1103 1061 977 800 576 190 --12940 --
NM_006827chr1493381 2652 2482 2231 1279 972 906 648 399 13208 22489 1157 --
NM_006852chr17102475 2415 2405 2397 2356 2209 899 776 602 135 1610 12576 --
NM_006884chr351856 1734 1728 1611 1581 --21605 1586 --
NM_006885chr16193748 3571 2906 2900 2894 2888 2690 2684 1506 1488 1469 1397 1340 1316 1241 947 849 568 559 --64060 3850 3432 2625 599 580 --
NM_006892chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_006892chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_006918chr1195771 5429 4672 3917 3809 3795 894 838 61 --1896 --
NM_006920chr282079 1869 1785 1776 1304 801 452 417 ------
NM_006922chr282477 2045 2004 1854 1745 1696 526 434 --32052 2039 1861 --
NM_006924chr1784232 3996 1616 1582 904 708 76 21 11631 21680 1386 34419 2713 1352
NM_006940chr1261358 1293 755 496 467 301 --1450 --
NM_006981chr982699 2580 2433 2165 1900 1070 616 143 --12702 12267
NM_006999chr552009 1339 1298 572 519 --12011 11301
NM_007006chr16103539 3211 2499 2468 2227 1307 894 430 256 91 --2228 93 --
NM_007007chr12184607 4195 4110 3994 3824 3773 3703 3480 3441 3400 3330 3302 1739 1706 1214 563 330 188 23567 1064 14620 --
NM_007084chr1331552 1255 395 1343 11102 11556
NM_007114chr372989 2349 1010 534 243 227 128 1201 --12840
NM_007125chrY61282 986 521 471 454 280 11006 ----
NM_007172chr2262517 2059 2035 1052 246 235 13295 1661 12900
NM_007173chr1161851 1797 1581 448 440 307 --31908 442 72 --
NM_007203chr963828 3811 3639 3049 1428 1151 --33830 2609 223 --
NM_007207chr16814 623 595 237 87 74 --193 1627
NM_007212chr1112121 1537 1491 917 776 607 411 248 205 176 35 --21554 779 --
NM_007231chrX72249 1786 1610 1603 268 126 43 --11620 --
NM_007249chr13149129 9102 8605 7771 5932 3457 2179 2158 1974 1708 1639 1615 1540 666 --39131 2181 1678 --
NM_007257chr892866 2760 2702 2628 1825 1035 395 201 57 ------
NM_007292chr17144812 4751 4471 4302 3677 3518 3384 3374 3367 3205 1197 1161 955 921 1385 14473 24320 3533
NM_007375chr162826 2394 1024 885 478 411 1145 22164 975 22831 2805
NM_012081chr5103124 2809 2742 1139 891 883 875 323 283 240 --32757 885 877 11083
NM_012090chr161052 987 829 449 147 138 --3989 831 451 --
NM_012096chr3133777 3764 3737 3674 2929 2651 2277 1473 1451 1269 779 282 182 --13086 12932
NM_012102chr172641 2109 1855 1038 658 596 563 ----12644
NM_012120chr662717 2476 2226 1995 1926 296 --22940 2365 --
NM_012129chr782306 2176 2046 1917 1791 1642 1579 190 22251 100 1743 --
NM_012141chr1364027 2723 1394 717 381 185 23777 3394 --12726
NM_012164chr9127194 6479 6384 5954 5504 4599 2971 2741 2211 900 660 396 15460 --12220
NM_012193chr11144754 4690 3902 3544 1889 1883 1822 1728 1717 1151 1143 1023 774 392 --13905 --
NM_012214chr2116181 5383 4904 4741 1986 1942 537 512 482 71 26 22550 498 22410 1052 1515
NM_012223chr231227 988 429 1436 --1961
NM_012234chr393756 3528 3410 3132 1380 1175 1033 719 333 --1327 --
NM_012262chr1144871 4845 4246 4121 4109 3791 3477 2010 1998 1982 1451 573 466 348 1335 14848 --
NM_012287chr3103896 3434 3354 1233 1031 699 492 454 338 73 --14166 13612
NM_012297chr472078 1944 1925 865 817 415 69 1102 174 12419
NM_012309chr1184303 3233 3223 3182 3128 1612 1598 1534 --13227 --
NM_012316chr1105263 4269 2233 1607 1167 564 392 357 348 334 ------
NM_012330chr1051576 588 370 203 188 --2537 206 --
NM_012334chr5104761 4405 3564 3390 3146 1762 1476 1466 1453 557 13628 ----
NM_012382chr594358 4344 3871 3455 3041 1664 1360 934 700 2474 38 24362 1638 1937
NM_012388chr1573083 2220 2043 526 405 318 147 1181 ----
NM_012463chr12101826 1551 1282 1147 671 661 497 427 263 212 --21435 663 1508
NM_012464chr482891 2346 1835 1116 1044 964 748 60 21132 345 1751 --
NM_013229chr1282832 2789 2722 2681 1897 739 587 576 31761 407 42 62791 2683 2112 1900 581 464 --
NM_013255chr7148719 7904 7417 7040 6863 6514 5645 2088 2054 1990 1534 1127 339 259 --22168 1179 --
NM_013257chr841982 1957 342 297 1919 22296 281 --
NM_013261chr493738 3672 3214 3206 3035 2779 2748 773 640 --43265 3037 2424 1142 --
NM_013282chr19101224 1093 1085 1079 1022 985 974 938 280 140 --11025 --
NM_013293chr75577 488 268 44 32 --2580 274 --
NM_013302chr16114312 3998 3840 3834 3526 935 861 655 620 457 279 11877 34326 628 282 24013 143
NM_013374chr353007 2743 1014 845 531 1689 22730 1236 --
NM_013381chr1262346 2279 931 168 130 60 12055 1149 --
NM_013412chr251239 1055 481 356 350 1828 1341 --
NM_013943chr152966 2584 1292 1271 1014 --1443 12638
NM_013995chrX92541 2342 1724 1714 765 687 468 423 351 1337 21733 1633 --
NM_014021chr173207 2962 2798 995 984 583 21 1731 ----
NM_014048chr1695301 5083 4857 4183 4073 3234 1970 859 582 --31972 612 584 --
NM_014089chr1382125 2070 1953 1894 1745 1673 307 172 --11804 11881
NM_014106chr1562550 929 737 580 491 317 12219 22812 502 1585
NM_014112chr895379 4800 4747 3536 2207 2199 1985 1837 678 --21989 1382 --
NM_014117chr1662659 2182 986 849 453 354 --31993 1692 362 --
NM_014141chr7105120 5111 4776 4140 3990 3809 3604 3491 818 381 --44557 4000 3822 3812 --
NM_014154chr341101 386 210 170 --31448 389 174 --
NM_014155chr11187411 7366 7241 7157 6743 6502 6020 5798 5326 5302 4989 4730 2113 2087 1254 1242 733 352 12567 37169 1427 303 --
NM_014181chr252588 480 474 468 451 --2462 455 --
NM_014240chr373565 3430 3266 2654 1128 973 773 --23569 779 13273
NM_014271chrX4814 347 297 257 --2299 151 1214
NM_014283chr121067 241 21168 453 31310 1071 35 --
NM_014294chr871418 1053 481 389 348 139 113 1263 1472 --
NM_014309chr22125325 4707 4534 3865 2078 1592 1040 780 666 235 227 143 --25327 3867 --
NM_014331chr4147796 6495 5412 5384 5156 4892 2923 2915 2487 2225 1863 987 730 691 22411 1888 ----
NM_014333chr11102579 2540 2471 2244 2151 1089 460 383 204 96 --22571 307 --
NM_014352chr1131226 1058 1042 1936 11410 11072
NM_014393chr862241 1774 1622 727 377 239 1183 11566 --
NM_014456chr1051825 679 178 171 76 --2342 183 --
NM_014494chr1682417 1696 1671 1642 761 598 341 294 --32375 763 365 1775
NM_014572chr1371175 575 565 513 506 500 290 1239 31443 1179 567 --
NM_014574chr1471413 1350 1274 982 434 337 311 --1358 --
NM_014606chr481425 1412 1108 1066 435 239 233 91 1176 ----
NM_014614chr231191 1138 224 --11083 1231
NM_014616chr373479 2162 1365 870 745 443 359 ------
NM_014666chr561279 1115 874 495 476 216 --1879 --
NM_014667chr372439 1954 1921 916 623 617 160 --32441 1958 1924 11851
NM_014674chr3114037 3934 3370 3339 2943 2933 2441 1300 426 402 383 --54039 3342 2948 1302 428 1405
NM_014682chr862235 1541 1437 558 336 265 --1271 --
NM_014701chr1553191 2824 2532 1345 128 12093 11347 23194 2432
NM_014707chr782308 2021 1891 1853 1798 1629 1434 490 1380 1387 --
NM_014711chr1652016 1811 1669 823 276 1387 22018 1940 --
NM_014720chr1041642 728 505 137 1672 2140 131 --
NM_014721chr6167369 6947 6597 6486 6183 6089 6060 5505 4929 2901 2740 2203 2172 1933 1067 1051 1470 25522 1829 14804
NM_014733chr581900 1847 916 794 773 682 581 554 1109 ----
NM_014739chr6123908 2723 2717 2711 2705 2699 2693 2675 1118 256 65 51 1484 12677 --
NM_014743chr483079 2711 2678 2353 1272 1254 292 189 --23081 2357 --
NM_014752chr1171866 1675 1651 765 668 553 462 11400 11666 --
NM_014755chr2113352 3342 3071 3042 1681 1111 1084 558 441 354 141 14086 --1201
NM_014774chr153295 2260 286 271 161 --12124 1289
NM_014779chr34958 942 929 844 --2950 933 --
NM_014781chr841227 224 210 37 --1217 --
NM_014795chr281289 1190 1184 938 921 553 510 32 --2941 883 --
NM_014803chr10112844 2804 2675 2089 2043 1974 974 853 600 585 243 --22549 1800 --
NM_014812chr161947 1460 790 781 309 302 1147 1696 --
NM_014824chr1161654 1563 1547 1317 182 69 11451 21831 187 --
NM_014829chr562348 2298 602 511 117 94 --1604 --
NM_014830chr1273838 3381 3291 2407 1515 1509 1485 ------
NM_014832chr1391782 1407 1372 847 750 444 372 295 203 --1583 --
NM_014840chr1273413 3396 3198 3179 3154 2196 1257 --13157 --
NM_014864chr1114086 3623 3075 1664 1185 1178 1170 1034 993 853 419 ----11191
NM_014868chr12350 44 38 1270 ----
NM_014873chr1144910 4879 4738 4371 4342 4002 3904 3389 1651 1552 1369 1212 1205 922 --24004 3443 33907 3739 735
NM_014877chr17187474 7264 6231 6079 6071 5909 5085 3037 2904 2830 1467 951 861 759 523 475 453 160 36506 5054 191 36238 704 533 1666
NM_014897chr1773075 2638 2453 2401 2056 648 584 ----12477
NM_014900chr231153 262 196 --1199 1188
NM_014903chr1252425 1636 960 757 213 11568 22427 356 1970
NM_014906chr1773561 1648 1240 922 657 626 499 13825 ----
NM_014912chr10113375 3119 2806 2701 2685 2474 2310 994 980 627 266 23395 2429 13182 33441 2914 2333
NM_014918chr153591 415 256 177 2568 61 1594
NM_014920chr673060 2377 1423 1416 572 165 155 33177 912 769 22698 201 11429
NM_014923chr134252 232 208 127 22198 1909 21489 211 --
NM_014925chr122937 254 --3939 692 619 1273
NM_014932chr341818 1524 1511 27 11916 --2256 31
NM_014934chr13104021 2929 2571 2502 2493 888 331 319 305 269 --1997 13115
NM_014942chr632567 2102 847 22334 551 --1882
NM_014947chr172937 924 916 542 509 397 258 12756 11081 1927
NM_014982chr14135437 4969 4752 3946 3464 2052 2035 1957 1352 1256 1062 566 212 --14341 --
NM_014991chr493286 2973 2829 2430 1194 1186 599 565 447 --22997 1188 --
NM_014999chr1271589 1102 575 243 233 222 212 --51157 402 237 227 216 1248
NM_015000chr1292945 2882 2614 2537 1915 912 804 213 193 --12109 --
NM_015008chr381190 1071 864 834 726 473 173 140 --31203 866 197 --
NM_015017chr151105 815 390 232 103 21131 871 1817 1237
NM_015020chr1673854 2999 2511 2459 279 102 88 33837 3828 909 22580 107 --
NM_015026chr1284725 3993 3127 1622 1307 1145 893 387 ------
NM_015032chr1392933 2305 2260 2162 2032 1787 273 266 51 11092 32315 2262 61 --
NM_015040chr273100 3094 3088 2782 2675 772 715 42636 863 604 188 13105 --
NM_015045chr1062246 2067 1890 1739 656 619 11443 31874 540 488 --
NM_015049chr2102853 2656 2471 2338 2237 2040 1233 1117 957 692 --1959 12447
NM_015051chr973371 3293 3280 3054 927 535 138 --22299 537 --
NM_015071chr585382 5161 2076 1667 1018 810 798 784 26534 4303 16034 21675 813
NM_015074chr184545 3456 3415 889 575 556 445 188 14720 ----
NM_015076chr644293 4112 2904 2743 13107 --12751
NM_015090chr186208 5968 5906 5668 5027 4166 677 480 11576 16041 16212
NM_015092chr16124301 4294 3943 3767 3553 3414 3365 3208 3059 1313 1150 967 14211 33359 2937 970 14304
NM_015094chr2253353 1798 907 635 629 1623 ----
NM_015100chr1122037 2021 1925 1729 1599 1463 540 398 354 262 252 110 --52025 1585 778 400 356 --
NM_015101chr182446 2232 2204 2147 2098 977 745 551 1163 1227 --
NM_015110chr962067 1911 1887 769 108 33 --21889 36 11914
NM_015115chr463011 1245 1184 787 655 367 --21259 768 22718 370
NM_015129chrX71744 1738 1460 1188 537 232 214 2295 147 11746 2540 235
NM_015137chr882306 2263 2049 1709 1694 479 401 316 22622 1745 ----
NM_015138chr1592800 2662 2136 1852 694 635 624 508 282 ----12142
NM_015155chr1073245 2742 2101 1249 373 298 252 1588 12105 --
NM_015172chr171567 1452 1296 1276 514 417 280 --1419 1283
NM_015199chr363023 835 666 590 575 461 --21010 577 --
NM_015206chr1523812 3336 ----23343 1426
NM_015208chr1873760 3544 3432 2667 1250 1085 916 21440 485 23762 2887 --
NM_015209chr152168 364 358 352 329 1529 ----
NM_015215chr193051 3034 2518 2115 1940 981 869 808 565 --23036 810 --
NM_015247chr1695348 5204 3845 1855 1807 1318 744 293 224 21426 663 ----
NM_015265chr292595 2506 2316 1690 644 122 108 100 94 3694 607 566 62679 2514 625 110 88 73 11702
NM_015271chr473993 3362 3030 2759 2643 1323 489 23586 1616 34000 642 491 --
NM_015277chr185682 668 631 562 450 1508 2684 459 --
NM_015282chr263000 2905 2888 1921 1080 353 --43002 2907 2897 2890 --
NM_015291chr153473 3458 3437 3142 2211 --13475 13466
NM_015310chr898118 5975 5793 5753 1936 345 198 142 126 --25755 3263 13087
NM_015313chr1184171 3380 3362 2942 2930 1645 1504 1154 ----11494
NM_015315chr5102927 2902 2468 2462 2456 2450 2440 906 891 880 --23055 2444 --
NM_015317chr272195 1909 996 453 151 101 52 --154 --
NM_015335chr12122663 2444 2388 2256 2191 2077 2039 1874 1844 1701 647 633 ------
NM_015336chr1252472 2456 2058 710 141 11798 21973 712 --
NM_015344chr861896 1656 1456 329 296 241 2816 735 21899 299 --
NM_015349chr672630 2380 1916 964 496 472 305 --1498 --
NM_015355chr1771564 1462 789 747 409 326 77 1528 1328 --
NM_015365chrX113748 3640 3552 3530 3523 2611 1541 1006 547 252 222 --1227 24058 485
NM_015443chr1761187 1160 1100 177 166 147 --21104 604 --
NM_015446chr151572 1510 1339 484 476 1288 1478 --
NM_015455chr5103712 3398 3278 2696 2635 1292 1255 1226 543 91 1912 --1355
NM_015475chr261027 911 869 380 233 164 --1871 1305
NM_015542chr1041128 1107 948 937 --1954 --
NM_015553chr665167 4807 4047 4036 1116 970 25070 3785 1237 --
NM_015554chr1592951 2425 2267 1080 1009 938 854 780 106 --12858 --
NM_015564chr563159 2894 2707 767 316 158 1133 12570 12851
NM_015569chr143630 3327 683 527 24772 4173 24605 685 --
NM_015570chr751731 1625 1490 744 232 1254 --11282
NM_015571chr691950 1753 1685 1640 967 938 890 868 217 1690 ----
NM_015575chr2103496 3444 3315 3309 3303 3227 929 382 364 176 13030 22454 2437 --
NM_015578chr1981451 809 769 680 595 320 301 126 1798 1133 --
NM_015602chr141425 677 517 344 21643 87 1531 --
NM_015640chr1105383 4782 4626 4389 1574 1091 862 572 556 368 ----24785 4639
NM_015641chr791085 1023 961 800 369 259 162 147 135 1485 21088 137 --
NM_015713chr893515 3483 3425 3340 3277 2786 2459 1030 867 23575 1354 33517 3428 869 --
NM_015866chr161259 1187 611 548 530 316 --31189 947 533 --
NM_015878chr841737 1363 657 573 --12079 11588
NM_015886chr895752 5580 5259 4589 3970 3818 1985 1927 612 1853 ----
NM_015888chr153311 2887 2836 807 400 --2409 402 --
NM_015906chr1144704 4677 4633 4546 4426 4065 3907 3865 3639 3011 1687 1032 539 389 --13095 --
NM_015939chr202665 85 --2609 577 1505
NM_016021chr692860 2720 2711 2635 2261 2120 322 256 118 ----1121
NM_016025chr1651977 1487 1245 551 280 --1497 1362
NM_016037chr171142 959 947 772 730 224 184 --1951 1787
NM_016045chr2051658 1487 1263 541 103 --11491 1118
NM_016075chr1383214 2520 2231 2139 2008 901 574 26 --12141 13217
NM_016083chr662878 1021 835 560 91 39 12405 --1838
NM_016096chr851779 1755 1711 879 241 1871 11757 --
NM_016131chr262200 2074 2004 1513 1500 101 11924 1549 --
NM_016132chr15173380 3369 3363 3147 3128 2901 2840 2714 2530 2515 1322 1304 1265 347 314 165 66 --43371 3149 1315 972 11330
NM_016206chr3187376 7360 6457 6240 6230 5834 5645 5562 2986 1583 1562 1213 737 605 460 401 302 285 1446 48115 7378 5647 1215 --
NM_016216chr35656 537 198 41 24 ----2542 44
NM_016227chr121067 241 21168 453 31310 1071 35 --
NM_016248chr1393624 3555 3443 1481 1442 1042 877 478 311 21011 546 33834 1444 1045 1881
NM_016260chr2217174 7041 6770 6674 6285 5754 5740 5519 5477 5455 5411 2670 2653 2482 2364 2208 2085 2002 1562 1064 108 12149 25457 471 --
NM_016271chr1852126 1496 625 482 273 3551 288 128 ----
NM_016275chr3102710 2581 1093 1044 820 583 415 362 312 278 22732 827 ----
NM_016287chr152068 1601 1493 1451 314 21840 1657 21290 704 --
NM_016308chr151851 437 246 161 148 --1164 11980
NM_016322chr972703 2662 2000 1028 1016 611 237 --22839 2707 --
NM_016396chr1572831 2592 2364 1845 578 247 99 1492 ----
NM_016424chr1781777 1663 1560 380 368 338 311 71 --2794 519 --
NM_016433chr1261474 1171 1154 1055 169 158 --41185 1156 327 182 --
NM_016441chr2112357 2198 2140 2134 1901 1539 931 900 778 674 404 --11903 --
NM_016488chr1271964 1870 1746 1286 1245 624 615 --11759 --
NM_016507chr1793167 2819 2774 2131 1282 1002 927 623 451 13110 1761 1930
NM_016513chr673060 2377 1423 1416 572 165 155 33177 912 769 22698 201 11429
NM_016530chr15144108 4076 3966 3770 3571 3394 3144 2905 2572 2539 2525 917 286 242 12628 12527 --
NM_016575chr1284504 4496 3822 2145 1554 1161 1136 247 --34277 2147 1145 --
NM_016577chr354156 4010 2742 352 346 11289 33022 301 212 --
NM_016617chr1361929 1795 1696 525 305 145 --155 11705
NM_016621chr1194556 4541 4535 1430 1253 1207 1005 996 990 ------
NM_016626chr1841318 1252 1188 467 ----11155
NM_016654chr1561191 1037 928 507 290 217 1304 11198 --
NM_016824chr1061769 1643 634 509 415 390 1620 11204 --
NM_016953chr295666 5638 5537 4336 4152 3857 1716 1537 441 ----24339 1561
NM_017420chr1492908 1396 968 916 810 398 321 197 27 ----1514
NM_017447chr21103436 3104 3095 3053 2900 2726 1586 1501 213 94 11600 ----
NM_017519chr67934 912 831 330 280 237 224 ------
NM_017548chr341912 806 774 757 --3828 795 764 --
NM_017563chr356370 6108 4156 3959 1502 26284 501 13961 12265
NM_017594chr983060 2597 2424 2410 2079 980 880 496 32921 2686 1060 ----
NM_017610chr1572095 761 387 352 346 241 198 12030 ----
NM_017628chr4144856 4843 4831 4504 3662 3553 3309 1653 1640 1159 1042 778 623 322 1522 54845 4834 1647 1634 59 --
NM_017633chr673957 3934 2615 1370 1301 1291 952 --23936 3450 --
NM_017635chr1131224 1059 328 1455 --21276 1227
NM_017637chr9269304 9270 9248 9061 8166 8156 8125 7580 7558 6987 6656 5807 5702 3660 2425 2194 2042 2030 1848 1840 1829 907 867 824 780 201 --59064 3453 1935 1666 589 --
NM_017644chr3145155 4833 4809 4515 4318 3978 3830 3657 3648 3536 3499 1710 1401 521 24865 3436 44682 3832 3667 200 14696
NM_017650chr7115605 5284 4968 3981 2380 2216 2059 2050 1927 1625 1347 --11341 --
NM_017657chr23720 244 40 1228 1722 1746
NM_017658chr1484602 4493 4345 3944 1548 885 858 328 ------
NM_017660chr1972285 1220 1146 941 933 505 433 13133 21154 435 --
NM_017709chr1114147 3153 1695 1574 1067 1052 864 855 815 519 126 13468 11046 --
NM_017741chr452765 2622 978 841 834 --22626 981 1852
NM_017753chr941042 1028 173 29 1395 31030 186 139 --
NM_017758chr1751471 1458 118 98 80 --2112 105 1122
NM_017769chr1442828 2661 1200 176 --32663 338 179 --
NM_017811chr952494 1161 1011 1005 255 --12762 1703
NM_017813chr8145514 4773 4077 4042 3956 2118 2108 1951 1726 1401 1171 977 563 381 21160 215 25190 2110 --
NM_017848chrX104485 4379 4039 3931 3389 3340 3144 619 461 451 --1455 13392
NM_017896chr2073326 3308 611 603 450 442 121 --13362 1125
NM_017919chr975406 4822 4204 3952 3592 1415 1396 --34348 4207 823 --
NM_017953chr15451 317 306 296 110 --2455 439 1320
NM_017954chr771186 298 217 193 180 58 51 --3219 195 182 --
NM_018011chr134159 94 88 82 --176 --
NM_018017chr1082816 2650 2321 2080 1768 628 207 89 --12818 --
NM_018084chr2143352 3250 2872 2829 2812 2227 1320 1123 985 858 753 568 360 232 ------
NM_018085chr176486 6093 1499 734 698 600 244 --11501 16496
NM_018133chr392177 2148 2018 1645 1552 1543 1522 776 385 11674 21560 387 12029
NM_018191chr1372012 1965 1930 1745 554 279 115 1298 11967 --
NM_018214chr641295 837 276 208 --31223 505 434 --
NM_018227chr4112921 2565 2161 2138 1977 1208 1032 958 949 907 610 13218 2952 392 --
NM_018243chr493961 3920 3707 3168 3036 2501 1561 1362 104 --13096 11522
NM_018254chr182422 1819 1765 838 572 445 433 293 12397 22179 841 --
NM_018293chr352738 2582 2495 2355 1076 --12966 12585
NM_018294chr103243 77 52 ----2237 81
NM_018299chr8103466 3364 2906 2826 2205 1050 972 866 271 258 11126 ----
NM_018312chr1151407 823 813 787 213 1571 2825 800 --
NM_018313chr392642 2446 2251 2094 776 367 345 326 216 --22645 218 --
NM_018315chr461616 1441 1421 1291 544 519 11111 21443 557 --
NM_018323chr461836 1611 646 594 576 219 --1159 --
NM_018351chr1284687 4618 4496 4468 4344 790 662 176 --21792 1779 --
NM_018361chr884017 3953 3306 2708 1471 1398 827 49 44062 3355 740 325 ----
NM_018362chr11203926 3514 3336 3173 3167 3149 2908 2901 2891 2653 2642 2484 1435 591 419 400 336 299 286 184 --83338 3161 3154 2674 2658 2647 2493 404 13178
NM_018364chr1114120 4098 3840 3675 3039 2634 1303 604 154 35 26 --24027 607 --
NM_018372chr16673 489 296 220 113 38 --2681 222 --
NM_018373chr14105584 5409 5184 5031 4835 3974 1637 1186 488 323 25314 1595 15283 25431 1035
NM_018374chr7135191 4760 4231 3984 1793 1598 1591 1266 1163 1034 932 554 436 14269 31602 1276 1036 --
NM_018416chr1262621 1669 1644 1027 209 118 --32623 1671 439 --
NM_018426chr65604 586 574 563 393 --3598 588 579 --
NM_018427chr1641495 1053 374 173 1302 41370 1180 285 175 --
NM_018439chr1872537 2108 1960 1868 1848 1047 685 --22111 687 --
NM_018440chr8158705 8047 7859 7305 7090 6884 6829 3333 3157 2999 2943 1803 1492 1227 1057 17321 ----
NM_018444chr882157 1682 1654 1634 936 723 553 58 --11483 11624
NM_018482chr872578 2414 2117 2105 1977 1017 870 --12119 --
NM_018490chr1151759 1532 695 362 288 ----11277
NM_018557chr231637 1485 1348 --3330 157 143 --
NM_018566chr1114933 4632 3413 3362 1944 1498 1042 1007 978 927 890 23871 1176 11054 24999 3424
NM_018569chr451561 1520 1332 1171 87 --21144 382 11580
NM_018638chr1293523 2266 1903 1844 1832 1226 954 618 381 75651 4946 3924 1569 890 856 153 34345 2102 1926 --
NM_018640chr1252809 865 771 252 233 --3773 235 56 --
NM_018685chr781121 1100 966 885 751 716 399 291 135 ----
NM_018695chr571658 848 771 665 445 294 271 ----22490 448
NM_018698chrX51966 1460 573 559 192 11950 2575 367 --
NM_018700chr531357 1248 410 11199 11360 11251
NM_018976chr1282625 2011 1772 970 692 623 596 171 --42022 972 440 155 2989 501
NM_018999chr1074614 4439 4198 3206 3171 2994 1902 --11896 11918
NM_019001chr3154749 4385 4137 4106 3487 3332 3277 3120 3076 1350 1243 1197 706 385 124 14673 24387 4377 --
NM_019022chr1873075 2866 2838 2639 2464 2195 1190 33147 1236 859 ----
NM_019027chr482438 1697 918 884 610 301 289 167 --2924 912 --
NM_019045chrX4776 741 615 89 ----1130
NM_019050chr472054 1898 1835 1806 1693 863 730 1575 1503 --
NM_019072chr553559 1660 1493 1340 960 --11242 21343 392
NM_019084chr1072392 667 640 551 473 466 449 2493 438 --12404
NM_019091chr251161 1047 823 232 84 --1996 21050 238
NM_019094chr12103659 3558 2861 2647 2549 1541 1247 565 213 161 --33669 2562 298 11256
NM_019116chr1673721 3563 2813 2539 577 450 356 --1463 --
NM_019903chr1061769 1643 634 509 415 390 1620 11204 --
NM_020122chr2112183 2050 1915 1729 1290 1223 1203 1163 1071 808 789 15203 21165 383 --
NM_020123chr1041010 560 531 452 ----1524
NM_020159chr461642 1303 447 422 320 148 --11644 --
NM_020177chr583293 3221 3207 3058 2294 716 449 367 --23230 706 22570 642
NM_020199chr581279 976 970 943 462 396 383 164 --1400 --
NM_020205chr162927 2841 2261 1071 1011 840 33338 2218 1224 12309 --
NM_020240chr542668 2163 1923 251 --32670 1944 222 --
NM_020245chr6105068 4844 4702 4612 4535 4436 1708 1659 1488 1482 13354 31476 1463 1450 --
NM_020342chr262568 2531 2424 770 746 594 --2783 401 --
NM_020353chr361854 1586 1503 1353 1254 613 21481 566 ----
NM_020357chr381202 1182 588 495 291 117 100 62 --21536 1120 --
NM_020390chr3154672 4657 3954 3845 3483 3216 3181 3118 1418 1325 1305 917 786 191 111 --23651 1087 44470 1247 933 195
NM_020440chr183359 3278 3082 3030 2632 1168 610 276 --1624 --
NM_020443chr1136716 6652 6640 6507 6481 5902 5718 4246 890 876 851 827 820 --36475 5720 878 --
NM_020456chr1372138 1798 1639 1622 482 428 353 12102 --11645
NM_020473chrX61776 1663 1652 1639 92 86 --1340 --
NM_020647chr872065 1910 1772 1542 651 383 278 ----1395
NM_020651chr251309 1262 693 408 123 1286 --11312
NM_020673chr20167618 7505 6315 5971 5962 5435 5345 5204 5051 5035 5026 4710 2770 2105 1713 824 16911 37604 7065 6134 15978
NM_020699chr185368 5212 4030 1881 1700 1682 1363 452 11497 1465 12010
NM_020718chr16135704 5694 5662 5617 5514 4818 4594 4193 2138 1634 1624 1382 816 --25721 2233 24857 102
NM_020727chr2183463 2612 1610 1484 569 328 321 86 --13496 --
NM_020732chr67934 912 831 330 280 237 224 ------
NM_020734chr12173357 3222 2894 2747 1327 1302 1291 1136 990 944 935 794 558 550 445 335 306 11201 32903 885 552 23225 765
NM_020739chr1583974 3728 3489 2898 1639 757 608 540 --23810 2873 13493
NM_020747chr55972 927 800 258 126 ----1712
NM_020766chrX72787 1761 1514 1439 1386 869 770 --1419 21643 1324
NM_020771chr631518 520 225 --11521 11376
NM_020772chr17177867 7857 6643 5919 5821 5391 3335 2303 2136 2128 1981 1781 1331 572 504 287 269 12596 67552 7524 6659 6645 6096 660 --
NM_020774chr18116241 6196 5335 4949 4409 1443 1278 1259 524 283 193 --36198 1085 187 --
NM_020779chr293014 2650 1057 1020 785 545 304 265 133 ------
NM_020782chr1284332 4021 3983 3890 3043 1597 200 44 --23969 645 --
NM_020801chr5122662 2550 2541 2359 2105 2019 933 898 646 503 400 376 ------
NM_020819chr631153 804 200 1996 --1483
NM_020841chr12153755 3646 3498 3471 3151 3042 1528 1350 1270 1195 1105 887 800 630 609 --42817 2807 2668 1197 --
NM_020871chrX72459 1648 744 634 625 378 333 1923 --12474
NM_020880chr193872 192 28 ----2828 40
NM_020922chrX71857 754 586 359 256 219 35 --21866 135 1598
NM_020935chr264645 4614 4494 3869 1452 840 --24647 848 --
NM_020948chr172966 2758 2266 920 543 373 168 11041 ----
NM_021005chr1541064 371 286 255 1300 2425 288 --
NM_021033chr1353241 3152 2746 2710 1287 12132 23154 3127 --
NM_021090chr2234549 1872 253 --11982 21854 263
NM_021097chr282789 2694 2682 2586 2025 368 344 292 --23071 370 12596
NM_021111chr951338 1206 977 168 136 1385 --11024
NM_021148chr782421 2353 1689 998 795 693 512 461 1847 2824 803 1753
NM_021190chr17480 431 262 124 109 103 94 11232 2111 97 --
NM_021215chr2052336 2252 2244 2238 2119 12466 12094 --
NM_021238chr1251852 1603 502 245 85 --11855 191
NM_021239chr1431397 1126 106 --2133 113 --
NM_021255chr14113438 3286 2921 2798 2552 1468 1399 943 609 302 79 --1310 --
NM_021622chr1082275 1810 1788 1767 904 868 735 287 21499 532 --11905
NM_021809chr2072509 2499 1731 971 960 915 487 --42503 2476 917 515 --
NM_021813chr6125613 4282 4276 2340 2236 2230 2081 813 807 801 374 313 --24270 773 --
NM_021911chr5125132 5126 5120 4879 4601 4449 4146 4124 1533 1177 1084 693 --11181 --
NM_021914chr1492056 1896 1827 1728 1688 962 652 515 381 11740 2965 87 11692
NM_021943chr642197 883 599 244 ----21591 250
NM_021950chr1162232 1932 423 401 311 31 --2595 315 --
NM_021954chr1373643 3477 3175 2896 2820 2599 2386 ----13188
NM_021961chr11167523 7368 7246 7152 6534 6459 4789 4770 1661 1613 928 836 579 563 412 172 1590 ----
NM_021964chr396308 4122 2186 1700 1469 1344 1286 763 577 1948 15607 1580
NM_022048chr1586164 5841 5832 5261 4598 4584 4035 762 14696 24617 4586 1676
NM_022051chr14645 458 287 136 ----1650
NM_022114chr194237 3890 1659 1583 1476 1428 1382 539 506 ------
NM_022166chr1686199 5733 5142 4764 4052 4046 1878 1631 15118 46243 6201 6131 4766 --
NM_022456chr1286255 4693 4660 2849 1365 1021 947 107 26194 1001 11025 12852
NM_022459chr13145696 5597 5486 5215 4853 4561 4248 4231 2551 2326 1827 850 357 317 11072 14235 --
NM_022473chr1564312 3666 3300 3053 2858 1190 1596 --12861
NM_022491chr1273250 3178 3051 2968 2936 2783 53 33355 2790 306 22979 289 --
NM_022552chr24509 494 475 276 --3501 488 481 --
NM_022574chr741534 351 337 209 --21554 344 --
NM_022753chr192779 2558 1057 661 638 483 255 245 173 --3642 249 175 --
NM_022763chr362568 2367 2250 2128 331 196 2960 160 22829 339 22315 94
NM_022776chr361568 1494 1328 1155 1058 309 ----11068
NM_022781chr983234 2764 2090 989 939 814 603 268 12350 33094 2736 2715 12843
NM_022841chr1552769 2742 2547 2300 957 --12549 11879
NM_022845chr1682118 1865 1844 647 393 384 229 196 11397 2456 399 --
NM_022893chr2153134 3032 2753 2643 2395 2228 1978 1951 1935 1014 349 227 213 192 99 --53136 2853 2567 2353 1937 --
NM_022894chr281335 1260 1148 1125 1111 579 378 68 1145 4614 380 364 352 --
NM_022898chr14214740 4635 3743 3587 3572 3065 1867 1654 1301 1058 967 823 610 604 592 584 569 535 341 286 252 --53649 2925 597 538 254 21659 445
NM_022977chrX42305 1813 686 285 ----2752 689
NM_023000chr1461418 1157 472 463 447 162 1626 ----
NM_023001chr1461418 1157 472 463 447 162 1626 ----
NM_023929chr872650 2207 1776 892 467 258 162 1681 ----
NM_024055chr54570 265 109 93 --2646 572 1112
NM_024423chr1893984 3951 3337 3127 3103 1186 1155 468 315 ------
NM_024430chr1851309 1301 667 454 130 --11467 21313 196
NM_024524chr383059 2938 2881 2488 2009 1041 934 881 21989 342 --23205 968
NM_024569chr172945 2265 2240 2031 1041 639 333 ----32927 1053 642
NM_024613chr851696 1665 1152 713 402 --31668 1638 232 --
NM_024646chr1103606 3599 3226 2543 2535 1489 1321 1158 906 43 11145 23550 1492 11444
NM_024665chr3194469 4333 4119 3995 3936 3834 3509 3009 1389 1356 1278 1024 878 773 759 544 486 392 326 13304 84128 3296 3011 997 833 799 792 761 --
NM_024674chr1103184 3043 2252 2092 918 862 853 743 709 446 ------
NM_024721chr882582 2514 2328 1901 1878 1823 940 772 ----11951
NM_024740chr1173930 3097 2933 1674 949 896 217 --33933 2676 710 23458 736
NM_024744chr252368 1061 875 613 414 22646 856 11063 12210
NM_024828chr961313 1267 1040 542 306 162 ----1165
NM_024947chr3209296 9063 8946 8846 8591 7468 7307 7291 6612 6230 5801 3370 2959 2516 1793 1246 1009 641 391 293 23686 3443 58915 8219 8052 7670 6307 17317
NM_024949chr464993 1400 580 96 77 26 --199 --
NM_024989chr2178161 7791 7301 6120 5915 5411 5255 5242 5220 3235 3198 3182 2345 2170 914 519 385 22193 218 17114 --
NM_025040chr1962366 2304 2223 2026 2018 951 --1934 --
NM_025073chr1134785 4650 4225 4029 3862 1518 984 977 965 938 624 423 319 14599 44227 988 942 627 13878
NM_025146chr341878 822 756 210 11067 32648 1717 656 --
NM_025154chr761464 1276 1012 499 31 21 ------
NM_025160chr1103503 3330 2970 2962 2782 2698 1236 1225 671 297 ------
NM_025164chr1152177 1578 367 350 313 --1278 1387
NM_025184chrX3749 743 621 1280 1754 --
NM_025191chr1113086 2889 2754 2456 2433 1404 1270 1140 1134 617 593 12397 11276 --
NM_025205chr44667 542 276 223 --2544 228 1674
NM_025235chr1062181 2155 2047 849 493 201 ----12162
NM_030621chr14114220 4127 3895 3528 3162 3063 2800 1441 883 709 319 --34223 1449 208 1328
NM_030627chr5114034 3994 3959 3807 3741 3687 3115 2660 527 507 472 21042 920 23753 493 --
NM_030647chr7126245 5693 4695 2178 2137 2015 1605 1441 1228 630 380 349 1464 26266 5695 --
NM_030648chr4115405 4962 3936 2231 1330 1261 1034 913 620 519 372 --15480 --
NM_030650chr263744 3206 2797 1588 1442 83 31624 1512 645 31458 259 85 --
NM_030661chr76685 543 404 388 68 52 --1545 --
NM_030674chr1295807 5597 5403 4126 2217 759 270 219 138 15000 ----
NM_030755chr14142443 2391 2385 2379 2367 1125 1043 925 896 880 833 753 729 689 1224 22369 755 22453 92
NM_030774chr1161483 1416 561 391 356 345 ----1400
NM_030780chr861607 1483 662 490 338 172 ----1508
NM_030799chr582032 2014 1809 1770 1744 1539 1474 858 1302 22017 1959 --
NM_030806chr179411 7739 2542 2497 1893 1330 735 19308 27966 2499 --
NM_030816chr173197 2519 1370 1343 1164 1097 755 --1194 --
NM_030881chr2282466 1853 1680 1639 110 103 92 68 ------
NM_030885chr362191 1885 1868 760 686 348 11906 32284 2203 694 --
NM_030915chr252366 2346 2201 2050 175 1291 --22320 184
NM_030918chr1105309 2003 1815 1638 1452 1442 1284 755 502 173 --32135 2005 1454 11641
NM_030920chr151468 470 424 254 140 1647 1513 1488
NM_030949chr661414 382 197 179 113 107 --2181 128 --
NM_031216chr1871874 1571 1557 1481 692 498 460 --1179 1270
NM_031296chr4112360 2295 2245 2199 2107 2055 1825 951 782 435 427 --1429 1799
NM_031314chr1491859 1524 1456 696 689 626 597 498 230 ------
NM_031419chr361424 1393 1310 1190 1184 534 ------
NM_031427chr1464978 2176 351 333 238 141 ----23733 969
NM_031442chrX63181 3094 2888 2713 2344 1211 --21184 134 11992
NM_031469chr673835 2759 2647 1300 860 483 203 1141 12762 1921
NM_031483chr2073344 2655 2373 2344 1334 854 327 --33591 3346 857 --
NM_031844chr153963 558 279 147 123 --23966 162 13037
NM_032047chr3102326 2298 2180 2066 2007 1593 700 626 614 417 --1616 --
NM_032102chr1151237 1217 965 571 135 33088 2989 952 ----
NM_032116chr13115587 4963 4650 4381 3553 1780 1488 1456 343 90 34 --44786 4371 769 670 14653
NM_032121chrX62344 1951 809 654 640 109 12828 22552 2270 1657
NM_032160chr1874073 3778 3603 2761 647 605 309 13473 24250 3624 1608
NM_032199chr1063571 2413 690 684 627 165 23874 702 ----
NM_032208chr243657 2732 1008 984 --21002 987 --
NM_032226chr96809 779 761 686 119 107 --2811 763 --
NM_032228chr1173437 3395 2964 2618 1174 455 86 12518 22574 449 1707
NM_032256chr1221043 1037 --11031 --
NM_032288chr342308 2187 1728 140 1131 22318 1930 --
NM_032321chr283273 1136 1091 1004 995 872 540 366 ------
NM_032373chr10135865 5784 5777 5684 5586 5545 5325 3865 2300 1754 1657 511 357 1481 --22303 1660
NM_032435chr192402 2251 461 426 388 379 360 297 33 ------
NM_032440chr1042842 2205 334 315 --2319 309 12845
NM_032457chr443915 1268 1050 789 --13015 12749
NM_032458chrX123225 2797 2790 2779 2166 2143 2091 767 393 313 169 91 --22811 2799 --
NM_032466chr871548 1484 672 599 275 268 174 11604 ----
NM_032468chr871548 1484 672 599 275 268 174 11604 ----
NM_032505chr352442 1891 1794 489 219 21958 1922 22772 1893 --
NM_032510chr1862324 2166 1924 923 343 94 --2926 85 12522
NM_032521chr20103223 2654 2593 2391 1241 868 791 785 654 472 --1663 21254 887
NM_032558chr931276 189 166 ----21284 1119
NM_032582chr1791774 1338 1301 1287 1229 1175 586 580 539 ------
NM_032682chr3103355 3313 3140 3076 2322 1043 1025 602 485 202 1187 33049 1051 510 13446
NM_032804chr1051950 820 564 421 407 --11998 --
NM_032828chr19134968 4647 4166 3994 3434 3150 1639 1508 1394 1201 891 614 301 --34970 3456 1204 24013 737
NM_032833chr162541 863 561 469 135 95 1293 21763 141 1231
NM_032859chr13103933 3826 3656 3572 3421 3097 2824 699 572 156 22839 1203 ----
NM_032866chr152827 519 --22909 685 1530
NM_032869chr862012 1786 488 258 127 120 --11788 --
NM_032884chr14297 291 285 62 ------
NM_032900chr1083319 2465 2448 625 493 457 365 224 12425 --12469
NM_032968chrX63574 3462 1090 502 482 460 1476 53617 3465 504 462 289 --
NM_032969chrX63574 3462 1090 502 482 460 1476 53617 3465 504 462 289 --
NM_032973chrY53570 3458 1090 502 482 1476 53609 3461 504 461 289 --
NM_033020chr1144704 4677 4633 4546 4426 4065 3907 3865 3639 3011 1687 1032 539 389 --13095 --
NM_033044chr161052 987 829 449 147 138 --3989 831 451 --
NM_033083chr393335 3261 2954 2763 2340 2295 1288 1133 28 1192 43404 3337 2766 2357 --
NM_033138chr75740 618 555 384 378 1468 ----
NM_033139chr75740 618 555 384 378 1468 ----
NM_033140chr75740 618 555 384 378 1468 ----
NM_033143chr4114538 4458 4193 4002 3953 3675 2824 1861 918 746 692 24038 1122 24006 750 1494
NM_033157chr75740 618 555 384 378 1468 ----
NM_033181chr662878 1021 835 560 91 39 12405 --1838
NM_033224chr7147690 7646 7084 6594 6218 3175 3134 2501 2494 2024 1892 1797 1695 647 12099 27411 3136 27087 6603
NM_033225chr873130 2926 2908 2744 2721 1138 1127 --43133 1148 1132 653 12969
NM_033285chr894315 4195 4076 4051 2824 2782 1053 1046 203 --32928 1117 205 13389
NM_033290chrX43801 2965 2358 208 23196 2659 1210 12364
NM_033326chr1182322 2240 2205 987 674 315 303 215 --1182 --
NM_033360chr12194615 4398 3937 3857 3844 3820 3800 3521 3434 3372 2983 1742 1406 1334 721 290 222 173 140 23354 331 ----
NM_033389chr17114799 4549 3556 3541 3092 1827 1128 1103 1033 634 219 34711 3940 655 13633 --
NM_033430chr4103605 3527 3091 2604 840 522 370 347 314 130 --2316 186 --
NM_033437chr4103605 3527 3091 2604 840 522 370 347 314 130 --2316 186 --
NM_033505chr296555 5549 5400 4287 1309 1171 944 322 191 14897 35402 1727 1311 1901
NM_033512chr852842 2634 2363 2219 1235 --42371 2351 2344 2221 --
NM_033551chr5102927 2902 2468 2462 2456 2450 2440 906 891 880 --23055 2444 --
NM_033631chr153585 3042 1547 1370 154 --33587 3105 3044 13443
NM_033632chr461616 1441 1421 1291 544 519 11111 21443 557 --
NM_033637chr1094142 3272 3092 3066 2974 1295 1289 687 310 --23068 1298 --
NM_033656chr2195575 4785 4412 2332 2145 1680 613 510 78 14613 22334 80 14576
NM_052811chr1385294 4333 4047 3705 1295 939 360 195 24928 701 64675 4630 4050 3716 532 197 25297 378
NM_052832chr872978 2946 2678 968 183 171 80 1883 ----
NM_052867chr1351480 1242 1076 1070 206 --11064 --
NM_052879chr12143884 3529 3518 3149 3096 2982 2589 1301 1163 858 617 433 272 266 1649 --1398
NM_052885chr12164931 4882 4101 3594 3264 3153 1923 1866 1438 1158 1089 875 691 583 308 171 11006 1694 --
NM_052904chr661464 1431 1360 1303 1209 1196 --11433 --
NM_052907chr1274225 4212 3996 3957 3512 1087 715 1527 --147
NM_052918chr1073661 3651 3537 3233 523 457 98 --13432 13421
NM_052932chr1132159 695 265 21980 94 32161 522 271 --
NM_053016chr976055 5534 1688 1303 868 537 148 11330 15236 12939
NM_053023chr1163038 2505 1314 1254 876 826 12182 53137 2218 1258 1090 883 --
NM_053043chr774949 4544 4524 4163 4055 2013 825 12033 24526 2109 --
NM_080599chr1041128 1107 948 937 --1954 --
NM_080664chr1461791 605 463 305 299 291 --2465 293 1311
NM_080717chr1271393 1381 1362 1334 1324 1316 440 --21328 1318 11365
NM_080759chr1352253 1957 688 569 322 ----11974
NM_080760chr1352253 1957 688 569 322 ----11974
NM_080832chrX71362 539 484 329 257 204 99 1394 11272 2207 104
NM_080867chr14104362 3729 3570 1976 1671 1614 1325 256 222 40 11091 --13575
NM_080872chr863303 3251 1611 1271 760 655 11381 11626 --
NM_080927chr3113121 3101 2986 2494 2321 2089 2062 2048 1019 480 51 11267 13105 --
NM_130386chr185642 525 516 487 147 --1533 --
NM_130391chr9123241 3229 3170 2931 2366 1003 847 721 648 625 563 507 ----11058
NM_130392chr9123241 3229 3170 2931 2366 1003 847 721 648 625 563 507 ----11058
NM_130393chr9123241 3229 3170 2931 2366 1003 847 721 648 625 563 507 ----11058
NM_130435chr1062962 2651 2093 1089 442 25 11160 12734 --
NM_130436chr21122668 2312 2176 2114 1998 433 412 399 280 234 138 55 --2437 282 12179
NM_130438chr21123245 2889 2753 2691 2575 1010 989 976 857 811 715 632 --21014 859 12756
NM_130439chr1032313 1943 547 ----1555
NM_130439chr1032313 1943 547 ----1555
NM_130798chr1541573 622 556 370 1488 41167 631 354 156 --
NM_130809chr582462 1213 1129 1096 957 770 698 585 32658 2086 869 ----
NM_133265chrX83425 3059 2879 2607 2303 567 342 115 11080 --12882
NM_133330chr493289 3262 3158 2182 866 814 646 535 302 --1537 --
NM_133331chr493289 3262 3158 2182 866 814 646 535 302 --1537 --
NM_133335chr493289 3262 3158 2182 866 814 646 535 302 --1537 --
NM_133370chr4142798 2754 2497 1332 1254 1244 888 855 509 490 335 326 314 53 --33594 316 58 21247 891
NM_133372chr582624 2109 1969 1800 1072 1037 737 584 1179 --11819
NM_133443chr1661836 1778 1725 1709 1700 269 ------
NM_133477chr463099 1146 843 701 536 39 --11149 1546
NM_133493chr693768 3413 3225 1754 1653 1174 553 255 106 --33773 3646 257 --
NM_133496chr1154374 4125 3968 3213 3069 2899 2891 1072 977 843 682 670 464 305 297 1244 53864 3425 2902 2893 299 1691
NM_133646chr2115336 5260 4534 3679 3562 2088 1452 1397 1069 439 168 14462 11226 --
NM_133647chr1583829 3730 2905 2508 2392 928 720 500 --13831 --
NM_138270chrX83352 2299 1262 1162 1137 715 142 56 21387 1349 ----
NM_138286chr19164402 4280 4121 3788 3286 3140 2896 2887 2708 1731 1701 1113 935 743 547 494 ----24215 1122
NM_138316chr1041149 1064 230 210 21271 1157 1516 --
NM_138333chr95999 724 716 287 27 ----1120
NM_138348chr585116 4446 4301 2226 1871 1497 387 370 21517 704 --24149 1501
NM_138400chr753465 875 720 293 140 ----33257 723 144
NM_138423chr1542267 2254 577 410 --1206 21451 423
NM_138444chr1374856 4656 4423 4354 4338 3948 3382 33512 1283 516 14329 --
NM_138459chr673605 3530 3235 2901 1017 404 340 12986 33551 3237 907 --
NM_138473chr12105197 5115 3392 2058 2040 1824 799 764 677 517 24621 3532 25128 3350 --
NM_138494chr732695 2231 815 12276 --11029
NM_138565chr1161376 1258 976 268 97 88 --1280 21409 118
NM_138572chr693255 3011 3000 2834 2819 2176 518 383 218 --13003 12846
NM_138576chr14214740 4635 3743 3587 3572 3065 1867 1654 1301 1058 967 823 610 604 592 584 569 535 341 286 252 --53649 2925 597 538 254 21659 445
NM_138638chr1492056 1896 1827 1728 1688 962 652 515 381 11740 2965 87 11692
NM_138713chr16168088 6907 5623 5450 4992 3132 2782 2084 1951 1742 1684 1594 1539 651 509 462 12765 22071 1953 17886
NM_138714chr16168088 6907 5623 5450 4992 3132 2782 2084 1951 1742 1684 1594 1539 651 509 462 12765 22071 1953 17886
NM_138731chr14143959 3462 3424 3154 2942 2735 1696 1443 1331 1191 847 773 713 627 14061 13861 13891
NM_138771chr731556 1550 1544 --1373 --
NM_138782chr582371 2126 1735 913 901 831 703 260 12365 --1706
NM_138799chr231533 1476 27 ----21690 35
NM_138959chr176806 6740 2564 2247 1837 602 83 12277 16424 --
NM_138970chr14102388 2214 2045 1702 1653 1600 623 613 437 150 --12047 1626
NM_139015chr1231120 1110 505 --21112 507 11127
NM_139207chr12101935 1881 1655 806 800 361 337 319 113 84 21568 1487 1328 11659
NM_139242chr1581196 1182 1038 988 960 500 254 83 ----1101
NM_139281chr592610 2534 2346 2195 1190 1165 1046 1022 567 13614 21074 1060 1433
NM_144567chr172301 1887 1733 1725 1049 171 92 1512 --1760
NM_144571chr4186906 6791 6487 6452 6257 6086 5961 5269 5075 5005 4805 2359 2109 1229 896 679 657 150 --42111 1390 1232 681 22273 660
NM_144578chr1465433 4893 4847 4389 3780 3529 35481 3944 38 31605 1381 674 --
NM_144664chr11102569 2231 1606 999 686 546 362 349 157 97 11963 42233 452 351 235 --
NM_144728chr16814 623 595 237 87 74 --193 1627
NM_144729chr16814 623 595 237 87 74 --193 1627
NM_144963chr862483 2451 973 805 219 41 --22557 807 11653
NM_144973chr1285217 5140 4069 3685 3641 3573 1027 399 14743 14193 --
NM_145049chr53851 736 384 --1135 1159
NM_145055chr18103709 3457 3358 3200 2959 1349 1343 1328 801 157 23156 348 13778 13806
NM_145060chr185493 479 294 111 81 --51552 656 455 303 100 2504 121
NM_145117chr1173229 3095 3036 2342 933 812 621 1924 ----
NM_145206chr1073076 2061 1156 630 608 257 224 --23080 633 --
NM_145259chr2116561 6199 4849 2606 2405 1578 1388 911 372 82 73 --187 --
NM_145284chrX42230 2198 407 270 22082 249 22442 411 --
NM_145307chr10103830 3775 1857 1742 1731 1640 1555 1116 1100 884 11764 ----
NM_145341chr1051825 679 178 171 76 --2342 183 --
NM_145350chr1741555 1466 1270 1104 --11272 11117
NM_145351chr1742695 2606 2410 2244 --12412 12257
NM_145686chr283414 3352 3092 2727 1012 954 868 189 --43355 959 600 505 --
NM_145687chr283414 3352 3092 2727 1012 954 868 189 --43355 959 600 505 --
NM_147150chr963828 3811 3639 3049 1428 1151 --33830 2609 223 --
NM_147189chr842262 1712 1686 829 21519 385 2844 823 --
NM_148174chr841737 1363 657 573 --12079 11588
NM_148977chr1041149 1064 230 210 21271 1157 1516 --
NM_148978chr1041149 1064 230 210 21271 1157 1516 --
NM_152221chr2241203 1107 1043 1021 ----11229
NM_152265chr161530 1324 1240 282 258 195 1245 3267 260 197 --
NM_152275chr2102268 2145 1971 827 789 782 640 507 55 23 22307 710 ----
NM_152277chr572158 1898 1821 1758 536 442 373 1359 ----
NM_152344chr1781564 1522 1459 1429 519 512 502 485 1283 21431 531 --
NM_152388chr293685 3123 3021 2843 2696 2678 791 580 50 1407 --22977 106
NM_152409chr563436 3166 758 665 460 129 ----13244
NM_152519chr232132 1506 378 --1627 11683
NM_152556chr752547 1612 547 467 139 21870 844 1516 --
NM_152557chr71268 --2262 255 --
NM_152594chr1582339 1681 1619 1481 894 785 304 295 --1906 1475
NM_152608chr152328 1939 888 647 492 --1243 1496
NM_152622chr5123452 3236 3217 2675 2669 2499 2394 2311 1239 565 497 410 12151 21064 499 13455
NM_152624chr5137093 6825 5697 5286 5183 5147 2883 2734 2673 1883 1868 1861 1319 37318 7307 1626 11870 --
NM_152629chr993880 3735 3648 3342 3307 2644 1441 1116 616 --23882 3352 --
NM_152630chrX51049 556 447 408 95 1155 11288 1561
NM_152641chr1272922 2638 957 880 868 861 851 --31057 987 886 --
NM_152673chr374426 3567 3538 1523 1281 1139 665 11536 --11695
NM_152699chr343763 3255 2850 2690 22583 399 1142 23766 2697
NM_152756chr5174284 4261 4183 4062 3725 3706 3319 3235 2877 2706 1751 1529 1454 1358 1171 1075 744 --14264 11302
NM_152829chr791085 1023 961 800 369 259 162 147 135 1485 21088 137 --
NM_152835chr172933 2712 2020 948 632 605 133 1512 32620 615 122 12470
NM_152866chr1162232 1932 423 401 311 31 --2595 315 --
NM_152989chr1261358 1293 755 496 467 301 --1450 --
NM_153013chr551654 1569 1013 727 414 22494 592 21824 86 21671 1576
NM_153050chr2234549 1872 253 --11982 21854 263
NM_153051chr2234549 1872 253 --11982 21854 263
NM_153184chr351862 1733 564 353 340 ----11867
NM_153188chr5154930 4834 4772 4624 4303 3902 3859 3808 3631 2156 2110 1414 1114 477 453 15546 55577 4140 3633 1416 702 --
NM_153207chr12123956 3677 3584 3410 3226 1546 1003 898 871 835 327 107 2861 770 --13964
NM_153226chr1051093 758 328 218 28 1135 2221 190 1762
NM_153332chr873189 3031 2465 2350 885 706 285 ----1739
NM_153367chr1073203 2930 2920 2909 2699 2547 229 12744 12673 --
NM_153371chr1362220 2012 1967 773 478 40 150 1635 1483
NM_153607chr553036 2440 710 412 370 33015 2431 1246 32470 908 712 1738
NM_153631chr76685 543 404 388 68 52 --1545 --
NM_153632chr76685 543 404 388 68 52 --1545 --
NM_153645chr2262517 2059 2035 1052 246 235 13295 1661 12900
NM_153649chr162326 2246 1562 817 644 637 11409 22248 301 --
NM_153759chr24509 494 475 276 --3501 488 481 --
NM_170606chr761766 1370 1177 271 251 93 2630 116 2287 276 11821
NM_170672chr251791 510 450 360 262 --3460 362 316 --
NM_170709chr841982 1957 342 297 1919 22296 281 --
NM_170710chr462472 2146 1990 1218 609 30 ------
NM_170731chr1172654 2587 1056 1006 593 569 552 ------
NM_170732chr1172654 2587 1056 1006 593 569 552 ------
NM_170733chr1172654 2587 1056 1006 593 569 552 ------
NM_170734chr1172654 2587 1056 1006 593 569 552 ------
NM_170735chr1172654 2587 1056 1006 593 569 552 ------
NM_172071chr1286844 6752 6744 6724 6483 6451 6245 6183 6092 5928 5720 5162 4768 4609 2999 2506 2362 2187 2008 1941 1905 1829 1739 1327 1194 650 253 192 27221 2032 46746 2993 2207 2013 --
NM_172128chr471857 1421 1282 804 604 414 371 --1820 --
NM_173198chr982699 2580 2433 2165 1900 1070 616 143 --12702 12267
NM_173200chr982699 2580 2433 2165 1900 1070 616 143 --12702 12267
NM_173214chr16168088 6907 5623 5450 4992 3132 2782 2084 1951 1742 1684 1594 1539 651 509 462 12765 22071 1953 17886
NM_173354chr2192190 2109 1994 1937 1931 1726 580 155 144 ------
NM_173359chr361760 1583 621 532 279 237 --2289 241 11867
NM_173468chr4146044 5926 5449 5331 5250 5155 4275 4217 4079 2438 1848 611 264 95 --15451 --
NM_173473chr1062742 2669 2461 898 587 495 --11064 1909
NM_173475chr1671224 332 322 311 257 206 180 --4346 326 316 182 1260
NM_173496chr1053063 2918 2645 2169 2108 --12019 12181
NM_173510chr2282653 2448 2421 986 875 843 621 178 --42664 2645 2318 637 --
NM_173511chr263776 3125 3019 2860 1399 274 1702 13793 11415
NM_173531chr1993864 3630 3479 3305 2613 1362 1130 791 770 1994 23495 959 23324 1012
NM_173545chr25806 694 476 339 266 --1187 1809
NM_173552chr362131 2056 591 464 453 23 22367 1882 11862 --
NM_173582chr1195971 5696 5638 3995 2199 1215 1014 212 140 ------
NM_173654chr382265 1703 1659 808 613 447 286 178 1622 21967 294 --
NM_173667chr552369 857 692 279 258 --12371 1704
NM_173694chrX72580 2496 2388 695 666 488 418 --1420 --
NM_173797chr561334 1246 1204 1036 1022 94 21098 298 11251 --
NM_173803chr1651218 1049 571 254 112 1235 21600 587 11065
NM_173808chr154286 2757 1752 443 218 23117 1476 --33463 453 175
NM_173825chr382583 2364 2291 2235 1068 1053 1001 828 --13074 --
NM_173829chr5115861 5584 5464 5411 5190 1831 1220 673 519 500 257 25075 4193 25863 5803 11775
NM_174911chr8103780 3669 3634 3477 3399 3207 3183 2942 1482 1101 --13545 --
NM_175610chr1581288 1139 1014 867 443 266 257 87 ----1875
NM_175623chr1286255 4693 4660 2849 1365 1021 947 107 26194 1001 11025 12852
NM_175629chr24509 494 475 276 --3501 488 481 --
NM_175736chr1277205 7020 6126 4814 691 374 358 --32097 804 711 --
NM_175848chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_175848chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_175849chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_175849chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_175850chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_175850chr2071381 1316 1102 1091 516 294 245 1429 11319 --
NM_175854chr13122387 2302 1957 1764 871 785 573 436 405 379 305 274 22633 2026 1895 11863
NM_175861chr12105867 5814 5541 4618 4607 2334 1838 1267 921 260 24843 4495 21423 341 2924 602
NM_175863chr67934 912 831 330 280 237 224 ------
NM_175876chr162620 1853 546 483 322 315 --1492 1330
NM_175921chr5104140 4114 3698 3588 1712 1694 1019 717 306 293 12658 1760 13701
NM_177401chr19101628 1443 1257 1234 1226 636 163 155 145 129 --21445 639 11580
NM_177438chr14114220 4127 3895 3528 3162 3063 2800 1441 883 709 319 --34223 1449 208 1328
NM_177538chr2178466 8292 8200 8102 8075 7031 6403 6273 6265 5957 5779 3394 2657 2265 271 248 242 28866 2642 57463 6405 5798 2660 2235 18313
NM_177966chr36651 494 337 331 325 319 --1305 21594 340
NM_177968chr271430 829 795 754 526 423 355 --1213 --
NM_177974chr1542267 2254 577 410 --1206 21451 423
NM_178010chr1261358 1293 755 496 467 301 --1450 --
NM_178011chr1042707 2601 690 258 ----1216
NM_178126chr174766 743 444 42 ----2776 449
NM_178135chr451327 1196 908 880 87 --41074 1065 902 873 1911
NM_178151chrX136710 6321 5487 5284 5233 5080 4907 4762 2548 1965 1949 1426 1003 16699 37552 2551 1967 24923 1178
NM_178152chrX136710 6321 5487 5284 5233 5080 4907 4762 2548 1965 1949 1426 1003 16699 37552 2551 1967 24923 1178
NM_178153chrX136710 6321 5487 5284 5233 5080 4907 4762 2548 1965 1949 1426 1003 16699 37552 2551 1967 24923 1178
NM_178154chr145551 527 521 515 505 --1509 --
NM_178155chr145551 527 521 515 505 --1509 --
NM_178156chr145551 527 521 515 505 --1509 --
NM_178157chr145551 527 521 515 505 --1509 --
NM_178496chr381470 418 410 309 249 211 82 21 --11071 --
NM_178509chr1763789 3313 3277 1572 456 148 24104 2726 13324 1234
NM_178585chr493286 2973 2829 2430 1194 1186 599 565 447 --22997 1188 --
NM_180989chr1362477 2139 1850 595 583 75 1636 --12160
NM_181054chr1461214 1132 491 433 315 173 --2366 175 --
NM_181265chr462472 2146 1990 1218 609 30 ------
NM_181358chr1133983 3966 3729 2921 2893 2816 2687 848 811 799 618 476 231 --33985 3968 2878 --
NM_181361chr381479 1317 1295 1105 552 505 419 27 --11071 --
NM_181486chr1271393 1381 1362 1334 1324 1316 440 --21328 1318 11365
NM_181504chr5103959 3612 2570 1520 1079 945 933 917 885 235 12680 23251 1082 --
NM_181521chr16107212 6168 5914 5768 4855 4687 2830 2702 2542 1220 15584 ----
NM_181523chr5103959 3612 2570 1520 1079 945 933 917 885 235 12680 23251 1082 --
NM_181524chr5103959 3612 2570 1520 1079 945 933 917 885 235 12680 23251 1082 --
NM_181659chr20112714 2631 2570 2434 2376 1272 1020 965 829 792 320 --52726 2378 1022 967 245 --
NM_181659chr20112714 2631 2570 2434 2376 1272 1020 965 829 792 320 --52726 2378 1022 967 245 --
NM_181714chr651951 1779 1745 1275 22 --11772 1202
NM_181783chr1261616 1521 1458 1320 757 494 --1699 --
NM_181787chr873792 3216 3177 3083 2510 791 686 13435 23529 3219 --
NM_181836chr5102521 2383 2123 1936 1671 990 983 604 570 169 11966 1993 --
NM_181861chr1282832 2789 2722 2681 1897 739 587 576 31761 407 42 62791 2683 2112 1900 581 464 --
NM_181868chr1282832 2789 2722 2681 1897 739 587 576 31761 407 42 62791 2683 2112 1900 581 464 --
NM_181869chr1282917 2874 2807 2766 1982 824 672 661 31846 492 127 62876 2768 2197 1985 666 549 --
NM_182485chr4183529 3522 3343 3197 3172 3091 3048 3006 2775 2672 2641 2605 2547 2419 1250 502 237 205 --33199 504 239 11476
NM_182493chr16134939 4771 4735 4556 4032 3915 2141 2124 1872 1725 1548 192 94 15163 --24035 1735
NM_182515chr19146613 6605 6492 6277 5505 5496 5195 5039 5018 2699 2441 2023 1726 1341 15891 45197 2444 1528 1191 21729 1587
NM_182551chr2113465 3223 2278 2263 1295 1283 1274 920 828 172 80 --11301 --
NM_182646chr4183529 3522 3343 3197 3172 3091 3048 3006 2775 2672 2641 2605 2547 2419 1250 502 237 205 --33199 504 239 11476
NM_182697chr741685 1509 1260 90 21609 1574 11511 2601 425
NM_182729chr1261799 1600 1155 431 379 371 ------
NM_182742chr1261799 1600 1155 431 379 371 ------
NM_182743chr1261799 1600 1155 431 379 371 ------
NM_182757chr663467 3211 3069 2921 2415 2339 --42755 2593 2353 1095 --
NM_182762chr765869 5486 4911 4291 272 206 25104 3848 22429 1348 --
NM_182765chr1072274 2244 2225 2175 2139 2042 1962 1494 12312 1943
NM_182898chr7146443 5490 5467 4981 4505 4306 4282 2520 2311 1959 1334 1141 676 502 14693 --11346
NM_182899chr7146443 5490 5467 4981 4505 4306 4282 2520 2311 1959 1334 1141 676 502 14693 --11346
NM_182943chr361013 988 889 822 806 791 --2990 794 --
NM_182964chr1173229 3095 3036 2342 933 812 621 1924 ----
NM_182972chr172822 2670 671 295 204 166 138 --22511 665 2170 142
NM_183050chr672221 2210 979 714 550 373 198 12252 --1562
NM_194247chr263888 3631 3010 1087 1031 752 --23509 2984 11091
NM_194278chr1473949 3192 3183 2783 2775 2597 1281 --14042 12620
NM_194282chr493093 2962 2575 2402 2246 2146 941 590 238 --11111 1955
NM_194283chr583118 2902 1635 836 827 802 511 125 13647 2646 147 --
NM_194291chr882008 1197 978 863 701 448 435 175 --11135 --
NM_194298chr1071818 1381 550 199 163 144 26 ------
NM_194314chr1115430 5163 4845 4042 3991 3429 1446 667 300 211 28 12128 75165 4661 3995 3432 2225 1448 264 --
NM_194318chr1352268 1812 878 283 189 11862 --1152
NM_194328chr983234 2764 2090 989 939 814 603 268 12350 33094 2736 2715 12843
NM_194329chr983234 2764 2090 989 939 814 603 268 12350 33094 2736 2715 12843
NM_194330chr983234 2764 2090 989 939 814 603 268 12350 33094 2736 2715 12843
NM_194332chr983234 2764 2090 989 939 814 603 268 12350 33094 2736 2715 12843
NM_194434chr18115361 5105 4390 3979 3852 3637 1845 1356 1048 107 31 25120 4617 25661 109 --
NM_194442chr151549 1085 654 354 113 21733 125 3656 628 356 --
NM_197941chr533052 2912 2235 --22914 2790 13055
NM_198066chr1482996 2791 2425 2057 976 824 789 409 21992 918 23001 2304 --
NM_198128chr1852126 1496 625 482 273 3551 288 128 ----
NM_198268chr1133983 3966 3729 2921 2893 2816 2687 848 811 799 618 476 231 --33985 3968 2878 --
NM_198269chr1133983 3966 3729 2921 2893 2816 2687 848 811 799 618 476 231 --33985 3968 2878 --
NM_198270chrX103280 3051 3008 3000 2551 2423 1327 927 842 399 1467 12951 --
NM_198273chr582879 2766 2098 1986 1926 1166 663 303 --23127 1928 22054 153
NM_198281chr463408 3309 2819 2635 1112 1036 12923 182 --
NM_198401chr861352 652 483 422 394 117 1644 11259 --
NM_198484chr371887 1387 1165 1030 901 383 67 --11398 170
NM_198503chr172047 1967 1629 1621 676 558 25 12150 ----
NM_198513chr841760 751 447 21 ----1340
NM_198578chr1231508 1448 931 --1316 1101
NM_198581chr2237522 7218 6940 6585 6432 6060 5642 5633 5444 5312 5304 5152 5141 4847 4820 4782 2283 1988 1652 1482 1380 931 768 --35314 4613 3001 36440 5481 5155
NM_198715chr194894 4323 2170 1603 1270 445 274 217 115 ----14314
NM_198793chr393912 3837 3780 3288 3258 3007 2842 2829 1245 23503 1469 53782 3738 2836 2637 237 24129 2870
NM_198859chr3114858 4846 3276 1887 1727 793 769 644 563 451 353 ------
NM_198900chr1277205 7020 6126 4814 691 374 358 --32097 804 711 --
NM_198935chr2063201 2637 2448 2283 668 256 --22265 258 --
NM_198968chr13104021 2929 2571 2502 2493 888 331 319 305 269 --1997 13115
NM_199040chr12103659 3558 2861 2647 2549 1541 1247 565 213 161 --33669 2562 298 11256
NM_199168chr1061429 1233 1221 1207 1194 356 ------
NM_199188chr12143884 3529 3518 3149 3096 2982 2589 1301 1163 858 617 433 272 266 1649 --1398
NM_199190chr12143884 3529 3518 3149 3096 2982 2589 1301 1163 858 617 433 272 266 1649 --1398
NM_199320chr482925 2892 2475 2161 1912 490 165 138 22853 1791 22894 1915 --
NM_199320chr482925 2892 2475 2161 1912 490 165 138 22853 1791 22894 1915 --
NM_199324chr483617 3301 3028 2340 1452 850 324 276 22522 677 22602 1454 --
NM_199327chr481027 957 763 389 277 77 71 65 --159 --
NM_199421chr14104362 3729 3570 1976 1671 1614 1325 256 222 40 11091 --13575
NM_199454chr194237 3890 1659 1583 1476 1428 1382 539 506 ------
NM_201437chr851533 1130 386 308 225 21459 131 11536 --
NM_201624chr151105 815 390 232 103 21131 871 1817 1237
NM_203342chr173206 3014 2465 1311 1237 656 270 11253 11305 21314 1036
NM_203343chr173206 3014 2465 1311 1237 656 270 11253 11305 21314 1036
NM_203364chr113369 320 307 1157 --1372
NM_203390chr871791 1355 349 271 224 190 81 1115 ----
NM_203437chr23720 244 40 1228 1722 1746
NM_203463chr274913 4673 3762 3526 1603 1210 264 --1266 24936 611
NM_203504chr472078 1944 1925 865 817 415 69 1102 174 12419
NM_203505chr472078 1944 1925 865 817 415 69 1102 174 12419
NM_205768chr191896 1802 1624 1563 434 367 352 332 128 --3825 361 354 --
NM_206594chr173498 2856 2324 1053 842 389 245 --11055 --
NM_206595chr173498 2856 2324 1053 842 389 245 --11055 --
NM_206853chr6123704 3693 3330 3282 3030 2539 1472 1402 1007 935 697 121 33914 2652 1564 23695 990 13895
NM_206854chr6114965 4954 4591 4543 4291 3800 3541 1958 1382 189 115 25175 3913 24956 3430 15156
NM_206855chr6145930 5919 5556 5508 5256 4765 4506 3994 3890 2347 1154 1080 915 26 26140 4878 25921 4395 16121
NM_206866chr21123094 2931 2772 2674 2627 2468 2438 977 772 502 408 102 1992 --12472
NM_206876chr2112973 2752 2422 2404 1297 1183 929 918 439 398 151 --12424 2995 948
NM_206907chr5103168 2962 2676 2606 2534 2105 1016 968 507 265 13040 32768 2706 2608 1510
NM_206909chr898118 5975 5793 5753 1936 345 198 142 126 --25755 3263 13087
NM_207171chr1122037 2021 1925 1729 1599 1463 540 398 354 262 252 110 --52025 1585 778 400 356 --
NM_207299chr941042 1028 173 29 1395 31030 186 139 --
NM_207352chr491830 989 845 679 507 368 204 193 186 --1370 1212
NM_207396chr151425 1321 1308 97 88 1105 2563 259 --
NM_207429chr1142390 742 554 393 --12325 1402
NM_207481chr241455 1232 1171 521 --1553 1524
NM_207518chr1951188 532 48 41 34 --151 --
NM_207647chr941936 1733 587 272 1756 12392 1774
NM_212460chr761774 1477 1449 1441 1353 514 1538 21443 740 1481
NM_212471chr1772256 1682 1569 582 546 353 287 --12258 --
NM_212472chr1772256 1682 1569 582 546 353 287 --12258 --
NM_212554chr1041488 1430 1370 424 11290 --21601 1383
NM_213590chr1385294 4333 4047 3705 1295 939 360 195 24928 701 64675 4630 4050 3716 532 197 25297 378
NM_213598chr1941411 1086 1004 255 --1421 1267
NM_213654chr341101 386 210 170 --31448 389 174 --