TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3613-5p
miRNA Sequence: UGUUGUACUUUUUUUUUUGUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX63214 2221 1329 1080 472 271 22446 260 ----
NM_000091chr242774 2522 2212 122 --21158 806 --
NM_000109chrX42422 899 284 98 2382 137 ----
NM_000138chr1551979 827 564 159 121 12148 21046 97 --
NM_000139chr1172788 2204 1970 560 484 296 289 ------
NM_000167chrX11291 ----1725
NM_000210chr252096 1598 677 310 51 11783 --1795
NM_000248chr362878 2117 1020 929 218 191 12791 ----
NM_000259chr15116186 6064 4403 4077 2387 2378 1776 1717 932 711 351 21651 683 25250 361 --
NM_000264chr973162 3149 2972 2907 2404 385 372 32772 2479 2361 ----
NM_000325chr4----1599 2628 616
NM_000330chrX22023 1860 12153 31918 1884 826 --
NM_000332chr6117167 6779 5883 5510 5124 2780 2555 2080 1927 1551 516 36070 626 144 ----
NM_000393chr231668 1501 184 31924 1722 225 ----
NM_000408chr283482 3462 3448 3083 2879 2261 1018 680 --12284 12756
NM_000448chr1122483 2397 11205 --21135 547
NM_000489chrX52389 651 588 224 92 --11310 12095
NM_000555chrX116729 6636 6508 6452 5913 5614 5590 4983 3126 2428 33 31416 1262 370 ----
NM_000610chr112750 615 32310 2031 1127 12899 --
NM_000633chr1845267 4258 4250 3902 25094 767 14193 24988 4384
NM_000686chrX41331 561 223 194 --21530 1081 --
NM_000719chr1276509 4905 4396 4270 1433 1124 392 34642 2691 338 ----
NM_000724chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_000793chr1465119 4713 3165 1835 1307 1089 1453 11702 --
NM_000809chr4138524 7700 7511 6981 6732 6350 2861 2745 1945 1740 1471 1010 509 48737 3574 3357 787 28598 969 --
NM_000813chr544833 4483 3913 1503 24377 3410 157 --
NM_000826chr442493 2396 1992 420 12127 ----
NM_000868chrX3149 134 33 31774 1730 750 --12491
NM_000875chr1596841 5753 5201 5023 4460 1621 1258 1219 24 46379 6198 5901 5821 --11787
NM_000899chr1273923 1734 1617 1479 1086 835 516 34029 3836 2696 ----
NM_001001389chr112750 615 32310 2031 1127 12899 --
NM_001001390chr112750 615 32310 2031 1127 12899 --
NM_001001391chr112750 615 32310 2031 1127 12899 --
NM_001001392chr112796 661 32356 2077 1173 12945 --
NM_001001396chr194305 4133 3692 3341 3294 3182 730 226 34 ----14112
NM_001001433chr2011233 ----13184
NM_001001481chr863412 3121 1361 1282 673 312 11021 ----
NM_001001484chr1072248 2112 1944 673 523 166 34 1468 ----
NM_001001706chr66258 252 240 219 162 108 --2246 178 1856
NM_001001890chr2184289 4001 3815 3768 3564 1572 716 457 --11653 13863
NM_001001928chr2288331 8312 7964 7206 6768 6394 6311 1448 17542 ----
NM_001001974chr102523 377 32290 1719 1679 11994 --
NM_001001995chrX71751 1425 1237 625 107 73 37 31830 1347 698 ----
NM_001002257chr243485 3154 894 167 33068 2285 769 ----
NM_001002926chr772797 2404 2391 2296 1789 1007 289 2323 49 --1980
NM_001003652chr18168531 8452 8400 7905 7058 6741 6471 6164 5652 5588 3197 3169 2640 970 911 309 27763 1067 ----
NM_001003674chr1886265 2112 1612 1540 987 542 518 100 26002 5215 16778 16716
NM_001003675chr1886265 2112 1612 1540 987 542 518 100 26002 5215 16778 16716
NM_001003712chr12103998 3932 3266 3138 2760 2693 959 713 697 262 12629 13399 13889
NM_001004419chr1273833 3509 3342 3328 1838 741 451 23224 84 1834 --
NM_001004441chr531655 1243 645 --11360 --
NM_001005473chr576092 5022 1613 1412 802 358 163 36357 4212 2025 12104 --
NM_001006657chr253106 550 410 176 23 11031 11246 --
NM_001007023chr1465119 4713 3165 1835 1307 1089 1453 11702 --
NM_001007466chr694524 3872 3477 3429 3305 2054 1448 1357 827 ----13539
NM_001008239chr1863784 3485 2639 2624 935 373 --13658 --
NM_001008410chr262291 2280 2163 358 103 83 1213 194 --
NM_001009555chr461758 1507 1381 1159 700 468 1181 --11609
NM_001009894chr1271710 1610 1155 655 647 437 257 11111 ----
NM_001009899chr356329 5755 2027 1631 111 34181 2458 592 25361 1930 --
NM_001009909chr1163101 2457 2432 1155 394 98 --13226 1858
NM_001010853chr643100 2428 2032 585 23285 2876 11012 --
NM_001010934chr751162 1099 146 114 107 1454 ----
NM_001010942chr1231208 1157 507 --11219 1357
NM_001011537chr352205 2044 1869 893 163 --12064 --
NM_001011666chr776564 6160 5982 5199 2037 1977 1039 55759 5650 5003 4768 994 ----
NM_001011708chr242727 2625 874 31 11921 --22224 1818
NM_001012267chr941470 1430 184 171 21942 1548 21596 212 --
NM_001012418chr663991 3946 1462 984 558 360 ----14242
NM_001012751chr1071852 1702 1646 1622 1452 1310 289 21425 1237 ----
NM_001012754chr1362112 1883 1790 1558 721 101 --1378 11551
NM_001012755chrX104936 4844 4829 4177 4009 3984 3693 1260 917 94 14046 24988 1975 --
NM_001013031chr1063524 3286 3260 2907 2806 199 ----12198
NM_001013629chr1062124 1789 1556 1368 597 296 ------
NM_001014797chr10137297 6820 5970 5907 5342 5122 5044 2881 1929 1703 1454 1184 835 47783 6698 2829 1259 --16582
NM_001014812chr153405 366 187 ----1303
NM_001017371chr221201 96 11372 --1548
NM_001017440chr758223 8154 8104 1188 340 27092 800 26167 154 --
NM_001018089chr1533532 3314 3110 144 12548 1638
NM_001024460chr6--1179 1235 2415 60
NM_001024647chr1266846 5012 2391 1621 1537 1334 47059 2383 1869 848 17350 --
NM_001024808chr1242794 2045 793 131 --22844 2837 12788
NM_001024855chr341787 1496 626 196 11207 ----
NM_001025076chr1075362 2391 2188 1316 1180 753 624 --14139 --
NM_001025077chr1096720 4787 4670 2674 2538 2111 1982 687 384 1136 15497 --
NM_001025108chr244091 3698 1550 431 23647 438 --33730 3625 2597
NM_001025201chr21112 ----1620
NM_001025580chrX63982 3535 3245 3012 1640 791 14196 14104 --
NM_001030055chr14114214 3876 3861 3151 1897 1676 1374 901 682 253 234 ------
NM_001031804chr1653381 3317 1689 1008 930 24115 1677 11131 --
NM_001031812chr572084 2001 1739 888 576 376 329 1431 1754 --
NM_001033045chr24973 837 745 685 13023 11646 --
NM_001033047chr432471 2074 165 --1448 22579 2337
NM_001037132chr732205 1623 544 41426 663 255 140 --12097
NM_001037133chr732205 1623 544 41426 663 255 140 --12097
NM_001039538chr252824 2744 2482 497 140 43141 3112 1398 198 ----
NM_001039580chr485046 4768 4396 3984 3382 1655 1543 1047 34950 3661 1147 11970 --
NM_001039590chrX52714 1381 1247 361 168 13801 12752 --
NM_001039591chrX52714 1381 1247 361 168 13801 12752 --
NM_001039618chr1195939 4000 3844 3704 1431 1363 1241 671 664 12203 14397 --
NM_001039649chr13----1106 1238
NM_001039840chrX75971 5500 5310 2177 2072 2021 1341 13702 15131 --
NM_001039937chr1331429 924 461 11313 --12953
NM_001039938chr1341217 964 474 88 11084 2437 322 11322
NM_001040402chr493118 3066 2936 2628 2563 1161 903 641 287 ----13176
NM_001040441chr184799 3612 3364 2196 1971 1510 264 129 11410 ----
NM_001040450chr1552647 1980 682 423 151 12773 ----
NM_001040453chr1552647 1980 682 423 151 12773 ----
NM_001040712chr983458 2909 2869 2850 1241 874 726 335 --12718 --
NM_001040876chr431790 1753 118 1134 ----
NM_001042355chr1664323 1847 1396 873 534 305 14888 ----
NM_001042361chr1031234 623 134 --11147 11559
NM_001042364chr1031234 623 134 --11147 11559
NM_001042365chr1031234 623 134 --11147 11559
NM_001042387chr1031234 623 134 --11147 11559
NM_001042393chr1031234 623 134 --11147 11559
NM_001042396chr1031234 623 134 --11147 11559
NM_001042397chr1031234 623 134 --11147 11559
NM_001042404chr161988 1359 575 415 154 105 ------
NM_001042412chr1664323 1847 1396 873 534 305 14888 ----
NM_001042493chr661774 1513 717 286 131 75 --12021 --
NM_001042494chr1543607 3025 2432 1240 33779 2445 830 13724 --
NM_001042495chr1543607 3025 2432 1240 33779 2445 830 13724 --
NM_001042496chr1543607 3025 2432 1240 33779 2445 830 13724 --
NM_001042497chr1543607 3025 2432 1240 33779 2445 830 13724 --
NM_001042533chr383096 3040 2527 2190 2175 1316 1184 930 13348 ----
NM_001042555chr12114456 4216 3835 3751 3654 3645 3414 3259 3239 1614 1370 ----23568 214
NM_001042599chr2137742 7262 7094 6518 6218 5877 4972 3009 1830 1444 1250 804 614 22680 499 ----
NM_001042603chr1265261 4211 3814 1350 498 374 24734 4060 14250 21996 216
NM_001042604chr384806 4066 3954 1758 1618 1494 1452 701 1965 33503 771 441 --
NM_001044722chr572084 2001 1739 888 576 376 329 1431 1754 --
NM_001044723chr572084 2001 1739 888 576 376 329 1431 1754 --
NM_001083620chr442491 2394 1990 419 12125 ----
NM_001099678chr395044 4316 4186 2344 1891 1840 1540 1091 748 36061 4249 596 34726 1352 326 14702
NM_001113490chrX23119 2579 32675 2286 918 --23086 381
NM_001167chrX106714 6129 5560 5442 5161 4935 4775 1929 1609 259 ----15131
NM_001173chr14114214 3876 3861 3151 1897 1676 1374 901 682 253 234 ------
NM_001198chr672406 2391 1555 503 448 416 378 ------
NM_001201chr483913 3655 3340 3096 2882 2677 2602 1237 13163 ----
NM_001204chr297557 7527 7498 6770 6203 5853 5608 1093 513 36558 5835 122 ----
NM_001233chr722335 463 3523 339 59 --1275
NM_001241chr262431 2108 2012 345 326 23 ----2795 647
NM_001241chr262431 2108 2012 345 326 23 ----2795 647
NM_001256chr1742925 1950 174 25 1496 --11855
NM_001364chr1131373 1157 433 3812 713 62 14214 1138
NM_001412chrX62606 1041 863 708 433 50 11278 --13427
NM_001427chr762043 1836 1589 1510 166 78 ------
NM_001432chr463521 3147 3062 1569 1037 179 1776 12456 --
NM_001438chr153347 2851 2607 818 692 12745 11343 1699
NM_001451chr1611248 --190 11322
NM_001609chr1043114 996 928 846 13908 --23428 640
NM_001621chr752268 1966 1218 1071 997 33057 2854 572 ----
NM_001621chr752268 1966 1218 1071 997 33057 2854 572 ----
NM_001650chr1843731 2776 2712 1423 1469 --11164
NM_001684chr174022 3850 3409 3058 3011 2899 447 ----13829
NM_001706chr351048 982 716 117 75 --1818 --
NM_001754chr2184289 4001 3815 3768 3564 1572 716 457 --11653 13863
NM_001797chr162693 600 --2663 508 1497
NM_001822chr21112 ----1620
NM_001858chr6125064 4953 4853 1955 1800 1790 1642 1154 675 578 504 224 11662 44684 3938 3894 1119 --
NM_001942chr1851938 1702 1615 1590 84 ----11444
NM_001969chr1473338 3057 2848 909 808 83 32 ----172
NM_002006chr485293 4792 4752 2301 2244 1851 1789 853 1571 13931 --
NM_002009chr1562741 2467 2241 1770 831 598 1905 1259 --
NM_002015chr1383255 2945 2554 2263 712 663 260 187 ------
NM_002025chrX159174 9159 9080 8994 8032 7164 7141 5889 3687 2999 2857 1796 1191 785 172 66663 6325 2344 923 363 286 17202 18311
NM_002033chr1163310 2598 2516 1484 835 783 13652 ----
NM_002053chr151042 744 650 408 356 --1137 1191
NM_002092chr474882 4601 4227 4011 1827 1593 967 --25105 664 --
NM_002136chr121450 166 --1194
NM_002158chr283848 3658 3519 3509 2758 1343 1279 793 23155 596 ----
NM_002210chr263546 3181 1292 860 679 489 23567 3188 --23589 589
NM_002214chr7165563 5152 4955 4896 4096 3877 3629 2292 2206 1239 1214 1116 758 540 386 252 25659 4985 14006 --
NM_002247chr1062335 2158 2062 2050 2028 955 --11987 12255
NM_002264chr364645 3473 1944 1609 1435 1203 34313 3962 429 ----
NM_002270chr5125456 5337 5301 5192 4197 3934 2023 1744 1535 1190 604 251 35026 2280 1884 1134 --
NM_002285chr244091 3698 1550 431 23647 438 --33730 3625 2597
NM_002310chr576419 6213 5398 5307 2139 637 606 15856 25294 4060 14764
NM_002336chr12115016 5001 4887 4442 4138 1075 665 311 229 160 114 25040 979 13218 --
NM_002356chr662794 2753 2403 858 818 96 2988 557 ----
NM_002374chr252824 2744 2482 497 140 43141 3112 1398 198 ----
NM_002397chr52233 171 2406 296 --1219
NM_002581chr974787 4624 4205 4171 3650 3538 1329 ----13941
NM_002594chr2062089 1898 1819 976 161 101 12227 ----
NM_002645chr1143073 2817 2550 2273 ----1845
NM_002655chr8135104 5067 4464 4378 4346 4213 3865 3761 1846 408 138 112 92 14108 13315 14555
NM_002667chr641097 395 243 235 11260 --189
NM_002710chr123834 705 50 1163 2327 303 11122
NM_002736chr73535 439 130 11900 11562 --
NM_002737chr1796504 4755 4465 2668 1893 1314 1007 1000 178 --36617 4739 309 --
NM_002745chr2294412 4193 3763 3713 3642 2772 1390 1033 858 23403 1052 --11093
NM_002837chr1273870 3123 2999 1819 1510 671 112 24554 1234 ----
NM_002839chr983458 2909 2869 2850 1241 874 726 335 --12718 --
NM_002901chr114991 789 131 68 184 --1255
NM_002940chr431790 1753 118 1134 ----
NM_002956chr1231056 1013 988 ----11229
NM_003034chr1297624 6408 3241 2932 2898 2718 1455 803 227 11525 11180 --
NM_003108chr2105945 5899 4823 4646 1451 1430 981 899 731 605 25493 390 11188 --
NM_003111chr221201 96 11372 --1548
NM_003128chr252703 782 751 734 727 12490 11040 --
NM_003161chr1772626 2302 2242 495 401 379 175 11087 ----
NM_003194chr61447 ----1572
NM_003199chr1885493 5228 5186 1725 1079 1062 268 254 21899 1430 1212 --
NM_003257chr1531264 511 465 ----1497
NM_003262chr395158 4484 3385 2033 1881 1684 1500 185 35 34898 3960 887 14956 --
NM_003274chr2142833 2401 1093 840 12461 ----
NM_003298chr3126004 5786 5757 5621 4080 4020 981 941 863 829 541 88 11437 ----
NM_003392chr373815 3063 2920 567 466 115 59 --24294 3617 --
NM_003410chrX93097 3001 2835 2752 2703 2338 1169 831 114 2976 87 ----
NM_003412chr3102892 1234 1139 914 843 814 743 665 658 597 12440 --12184
NM_003423chr1992628 2207 2182 1655 915 830 577 535 282 22454 878 12572 --
NM_003458chr363916 3882 3299 1422 1145 114 ----1104
NM_003483chr122551 270 11895 12508 1906
NM_003489chr2152865 2586 662 100 66 12820 ----
NM_003566chr1263418 3091 2974 2592 844 377 11329 12374 12476
NM_003574chr18115469 4776 4019 3779 3769 2241 1583 1314 1305 1185 555 --1119 24206 887
NM_003583chr1273856 3696 3264 3254 2761 1503 1450 22739 40 1234 --
NM_003590chr243600 531 309 193 21454 320 --1739
NM_003615chr383917 3839 3327 3240 3032 2431 723 698 ----13117
NM_003663chr373396 3285 2902 2368 1004 929 198 12241 --12644
NM_003677chr1241920 1662 510 309 12027 11987 --
NM_003722chr362712 2567 1914 1691 552 347 22046 897 ----
NM_003759chr483934 3870 3833 1606 1331 1213 758 263 24201 2816 13642 --
NM_003763chr2011233 ----13184
NM_003783chr141203 446 218 28 3983 177 167 ----
NM_003787chr1861693 1518 1259 1109 1102 314 1448 ----
NM_003895chr2172150 2128 1817 552 526 141 84 12120 ----
NM_003909chr882664 2314 1939 1159 1146 1097 998 406 11129 1640 --
NM_003958chr673193 3053 1416 976 959 951 569 33751 2788 2398 12734 --
NM_003966chr537765 2762 962 16512 --16265
NM_003994chr1273923 1734 1617 1479 1086 835 516 34029 3836 2696 ----
NM_004006chrX42422 899 284 98 2382 137 ----
NM_004007chrX42422 899 284 98 2382 137 ----
NM_004009chrX42422 899 284 98 2382 137 ----
NM_004010chrX42422 899 284 98 2382 137 ----
NM_004011chrX42422 899 284 98 2382 137 ----
NM_004012chrX42422 899 284 98 2382 137 ----
NM_004013chrX42422 899 284 98 2382 137 ----
NM_004014chrX42422 899 284 98 2382 137 ----
NM_004015chrX42422 899 284 98 2382 137 ----
NM_004017chrX42422 899 284 98 2382 137 ----
NM_004020chrX42422 899 284 98 2382 137 ----
NM_004028chr1843731 2776 2712 1423 1469 --11164
NM_004093chr1363014 2958 2926 2574 2266 469 12281 ----
NM_004113chr311999 ----1730
NM_004136chr1552579 2213 819 649 533 --12474 --
NM_004171chr11159546 8996 8979 8678 8438 7766 7123 6718 5858 2701 2124 1988 1214 749 203 39119 3030 2256 48816 7986 2583 1297 --
NM_004172chr541711 434 394 74 --1182 --
NM_004274chr1462103 896 885 871 462 59 --1862 1683
NM_004279chr741815 675 637 230 1650 12091 --
NM_004331chr862359 2008 1950 1795 650 358 22660 375 22670 1039 12475
NM_004337chr852188 2160 642 605 413 22170 1898 31486 571 326 --
NM_004338chr1886265 2112 1612 1540 987 542 518 100 26002 5215 16778 16716
NM_004384chr572084 2001 1739 888 576 376 329 1431 1754 --
NM_004392chr1392533 2522 2384 2215 1998 1733 808 258 226 11923 ----
NM_004612chr984476 4324 4116 3689 3146 1376 1221 361 24814 4485 ----
NM_004685chr1382297 2241 1145 1041 791 761 526 36 2624 534 1328 --
NM_004717chr761407 511 386 330 297 231 ----1170
NM_004733chr32565 86 ----1386
NM_004745chr8106563 6452 6054 2802 2601 1872 1578 1320 634 456 1846 --15944
NM_004815chr194732 3050 1957 1837 1499 1386 1012 649 345 14858 13277 --
NM_004857chr1453430 3253 1631 1298 981 44537 4463 3953 350 1123 --
NM_004859chr1752531 2098 1968 1897 819 ----12763
NM_004866chr574987 4045 3411 989 889 733 96 11845 --13684
NM_004904chr776564 6160 5982 5199 2037 1977 1039 55759 5650 5003 4768 994 ----
NM_004985chr1293717 3368 3015 1751 1632 1317 1141 819 39 --1880 --
NM_004999chr644136 3799 376 23 1412 --11740
NM_005010chr732205 1623 544 41426 663 255 140 --12097
NM_005036chr2288331 8312 7964 7206 6768 6394 6311 1448 17542 ----
NM_005056chr1285505 4455 4058 1594 742 618 149 140 24978 4304 24494 53 22240 460
NM_005121chr17103762 3440 1516 749 720 662 468 161 73 24 31415 800 231 ----
NM_005126chr341593 650 328 253 12046 11851 21814 793
NM_005135chr1543607 3025 2432 1240 33779 2445 830 13724 --
NM_005156chr943899 3870 1578 1359 21079 347 ----
NM_005159chr1572294 2160 1779 700 179 121 102 12252 11913 --
NM_005160chr2246841 1318 949 920 15700 16075 11079
NM_005164chr1282035 1996 906 839 766 648 577 489 22508 631 ----
NM_005197chr1454708 4315 2207 977 33 35556 5329 948 ----
NM_005233chr372464 2304 2250 1693 1602 707 133 --12539 --
NM_005235chr2137742 7262 7094 6518 6218 5877 4972 3009 1830 1444 1250 804 614 22680 499 ----
NM_005241chr331050 1012 398 ----11333
NM_005339chr453392 3156 3096 1711 1319 ------
NM_005359chr1874848 4453 2156 1065 607 429 57 --15986 --
NM_005436chr1083987 3214 1493 1093 1076 924 464 294 1184 --11200
NM_005504chr1255785 4639 4299 2501 21 45059 4477 2483 255 15083 --
NM_005596chr964652 1165 881 642 345 261 56161 5767 4683 1543 823 15969 --
NM_005668chr574208 4019 3991 3722 2995 709 246 ----11663
NM_005759chr294490 4393 4159 4103 1355 1293 1248 1020 510 22941 1774 1204 21285 262
NM_005779chr563516 3300 2849 2699 1104 675 22241 1017 ----
NM_005822chr62838 521 --1197 11674
NM_005840chrX66975 5356 3031 1727 1693 454 15087 --17011
NM_005880chr1621521 160 11537 2364 125 --
NM_005885chr5------21407 585
NM_005898chr1172929 2400 2052 1111 896 646 150 1704 ----
NM_005901chr18168531 8452 8400 7905 7058 6741 6471 6164 5652 5588 3197 3169 2640 970 911 309 27763 1067 ----
NM_005935chr475072 4816 4382 3395 1519 1497 256 ----15019
NM_005955chr195453 4740 4162 3729 3506 1354 1084 1070 720 14140 159 --
NM_005966chr242289 1793 1723 809 2622 211 1308 --
NM_006007chr994488 4266 3598 2871 2759 1488 1401 358 187 21096 801 14161 24370 1106
NM_006037chr264296 1852 1742 1721 1145 1125 --13684 1133
NM_006055chr2102305 2110 1010 946 640 535 498 317 250 23 ------
NM_006080chr752345 1967 720 274 113 12525 ----
NM_006095chr433338 3161 1799 11722 1174 13153
NM_006136chr71245 ----11270
NM_006154chr1552678 2665 2076 2026 47 1489 1926 1155
NM_006197chr851939 829 530 367 87 1348 ----
NM_006203chr574509 4369 2090 1522 1243 953 703 15390 25046 4144 --
NM_006251chr572759 2720 2149 1309 570 545 97 23258 2588 --12805
NM_006252chr146916 5281 2972 549 47083 2339 731 269 16953 13029
NM_006258chr1041470 1410 411 336 11107 --1395
NM_006281chr821009 102 1346 --1323
NM_006281chr821009 102 1346 --1323
NM_006283chr864526 4287 4232 1734 1610 1251 1164 23283 1873 --
NM_006380chr1773517 3354 3103 1577 1149 827 550 ----1669
NM_006420chr2053435 3359 2891 2790 1201 12557 22711 2412 --
NM_006421chr831270 1151 970 1152 21186 360 11199
NM_006482chr1273856 3696 3264 3254 2761 1503 1450 22739 40 1234 --
NM_006496chr121465 590 --11750 11474
NM_006504chr1042717 2259 935 554 --22365 470 1715
NM_006529chr441602 1577 1266 620 ----11481
NM_006538chr244139 2700 2604 750 11076 23544 3488 12736
NM_006546chr1726357 4913 21850 1568 --21306 616
NM_006547chr752083 1772 1557 1300 585 --11442 1300
NM_006561chr1075362 2391 2188 1316 1180 753 624 --14139 --
NM_006599chr16127050 6948 6635 5933 3197 2740 2728 1828 1549 1173 1100 304 16141 16172 13182
NM_006624chr1041956 1871 1561 613 1623 ----
NM_006646chr1363048 2380 1946 1212 319 108 12125 ----
NM_006654chr12114456 4216 3835 3751 3654 3645 3414 3259 3239 1614 1370 ----23568 214
NM_006717chr973282 2516 1031 1010 918 751 154 23094 2186 13418 --
NM_006722chr362878 2117 1020 929 218 191 12791 ----
NM_006729chrX44005 3846 1568 1352 21651 1142 11337 --
NM_006731chr9105749 5550 4978 4411 4272 2046 1584 1011 324 191 14442 ----
NM_006750chr1698039 7750 7690 7553 7533 6471 2037 1629 1397 18025 ----
NM_006823chr8--11226 --1507
NM_006827chr14113235 2561 2536 2518 2148 1343 1331 1191 1014 1008 764 1225 --12304
NM_006851chr1272660 1960 1121 880 652 278 184 1672 12391 12062
NM_006922chr282220 1829 1674 713 315 277 168 41 32283 2141 1782 ----
NM_006940chr1241808 1734 416 340 1192 --11209
NM_006948chr2111644 1536 1244 12387
NM_006981chr962654 1831 610 483 332 165 --11875 --
NM_007006chr1663468 3007 2408 644 554 529 22290 341 1491 1235
NM_007007chr12114571 4399 4368 4254 3838 2997 1826 1056 1002 293 252 44288 3858 865 399 24378 1508 --
NM_007038chr2185494 4371 4113 3994 2021 1911 1082 956 15367 --15697
NM_007042chr362574 2377 2057 1950 647 362 12639 22414 1027 --
NM_007050chr2077807 7124 6445 6264 2242 2110 475 18091 36874 6570 1905 --
NM_007054chr553920 3282 2717 1286 913 33473 1294 179 1194 --
NM_007106chr132440 356 2606 406 --12256
NM_007146chr1752335 1946 1926 875 629 1964 ----
NM_007159chr341716 1376 124 115 1314 --11699
NM_007214chr641297 264 144 87 1489 21112 171 1870
NM_007249chr1399349 7681 7447 6482 5983 3644 2194 1544 441 36760 1131 1035 --16492
NM_012096chr353769 3746 2705 2489 495 1907 13574 --
NM_012104chr1163825 3233 1141 609 520 499 ----13257
NM_012104chr1163825 3233 1141 609 520 499 ----13257
NM_012120chr662664 2244 1169 1124 1066 902 21162 846 ----
NM_012129chr772481 2453 1995 1745 784 337 59 ------
NM_012141chr1331429 924 461 11313 --12953
NM_012164chr9107220 7012 5547 4685 2786 2283 2258 1811 1475 194 27236 439 2818 61 --
NM_012234chr332750 471 317 1566 13466 --
NM_012250chr112520 162 --11217 21342 1121
NM_012252chr7104031 3598 3535 3525 3333 3294 2051 1949 1177 516 33367 1060 558 --1268
NM_012281chr741918 1515 737 620 1585 1758 --
NM_012287chr373307 2968 1213 960 641 630 54 24555 2918 14382 --
NM_012297chr482453 1748 1012 941 839 777 394 385 2516 259 ----
NM_012428chr1551002 992 920 848 649 ----1394
NM_013231chr1443371 2994 2870 265 44042 3963 3634 1000 1276 --
NM_013254chr12199 ----1135
NM_013255chr7138735 7771 7539 7304 7273 6984 6594 5928 5535 2625 1828 1069 292 36634 6034 730 16370 --
NM_013261chr433166 1149 121 32505 1129 150 --23251 1332
NM_013269chr1273760 3436 3269 3255 1765 668 378 13151 1761 --
NM_013341chr242727 2625 874 31 11921 --22224 1818
NM_013374chr3102847 2835 2778 2368 1145 603 217 204 140 126 ------
NM_013381chr1272210 2200 2180 1806 936 736 279 11906 ----
NM_013989chr1465119 4713 3165 1835 1307 1089 1453 11702 --
NM_013995chrX62505 2142 2014 1897 230 48 21890 218 ----
NM_014011chr262435 2075 1702 988 886 404 11716 ----
NM_014106chr1552119 1928 646 293 166 ----12424
NM_014112chr854197 3754 1974 1328 890 35366 5243 1570 ----
NM_014155chr1157198 5981 5203 708 262 17065 16892 --
NM_014181chr262466 2177 967 647 608 347 --11088 --
NM_014263chr1051513 1469 1265 1119 76 ------
NM_014331chr4117788 7693 7313 6147 5872 5651 5290 5071 1165 177 92 46956 5605 2863 305 --1766
NM_014421chr442111 1936 1854 214 31919 504 442 ----
NM_014423chr565303 4792 3677 3486 1928 1093 21517 720 25604 3600 --
NM_014445chr322081 391 --21750 369 --
NM_014607chr241896 1519 816 23 11777 --11432
NM_014636chr974355 3966 3725 3475 3186 2659 1681 23855 3732 1457 --
NM_014702chr642780 2351 540 503 2393 224 13215 1246
NM_014721chr6127097 7008 6869 5771 5531 5081 2275 2233 2215 1526 1228 586 ------
NM_014729chr862213 1986 849 782 445 70 --11880 --
NM_014755chr242985 726 674 563 34290 1388 123 24116 3884 --
NM_014774chr143177 2622 1261 216 12776 --11272
NM_014787chr132294 2260 1974 22199 785 ----
NM_014803chr1042615 1816 1805 569 12324 ----
NM_014812chr161988 1359 575 415 154 105 ------
NM_014829chr541904 808 593 72 11540 ----
NM_014838chr2252368 2045 1137 528 368 31975 562 418 12624 198
NM_014877chr17117773 7430 7384 6747 5980 5955 2095 1601 919 437 151 67467 5136 2627 2541 1853 1379 22697 298 --
NM_014903chr1252196 2080 906 341 87 --1546 --
NM_014904chr1083999 3983 3956 3888 3819 2777 1281 872 ----13902
NM_014912chr1092977 2954 2924 2834 2359 1318 1093 921 188 23485 2720 --12498
NM_014920chr683650 3619 3183 3146 2710 1491 412 206 21172 403 ----
NM_014946chr273088 2948 2907 1176 1155 901 176 22042 735 ----
NM_014950chr1461704 1670 1656 523 285 64 1271 ----
NM_014962chr2052896 2024 1932 915 160 12785 21881 440 --
NM_014982chr1495249 4993 4065 1608 1338 1298 1210 483 468 24581 572 --14554
NM_014988chr421854 412 22814 1093 12022 11975
NM_014991chr452984 2878 2807 1063 168 13245 12701 13047
NM_015025chr262674 2527 2462 1948 1904 1751 11874 22300 2039 --
NM_015026chr12123806 3657 3301 2951 1566 1105 527 517 505 462 406 300 13261 --11256
NM_015032chr1352771 2458 2334 2244 1978 22002 1847 --32666 2533 2177
NM_015040chr263149 3080 2605 2338 956 720 22540 661 ----
NM_015049chr283132 3015 2965 2222 909 832 713 194 --12144 --
NM_015076chr693892 3876 3756 3712 3192 1294 816 760 615 13944 ----
NM_015092chr16104715 4510 4490 4196 3651 3469 2873 874 207 104 --23446 377 --
NM_015115chr493118 3066 2936 2628 2563 1161 903 641 287 ----13176
NM_015132chr741696 745 602 405 2659 226 1413 --
NM_015156chr14113920 3744 3622 3253 2970 2646 2634 1170 669 592 565 12842 ----
NM_015206chr1583671 3556 3443 3401 3168 2860 1122 228 13607 33847 3735 26 --
NM_015208chr18103096 2936 2805 2560 1596 684 600 573 473 99 21370 707 23695 1465 --
NM_015215chr152456 2155 828 611 374 2598 82 12660 --
NM_015225chr993169 2948 2835 2187 1975 1210 1193 934 790 ------
NM_015235chr1052204 1683 1602 446 65 ----1420
NM_015247chr1664323 1847 1396 873 534 305 14888 ----
NM_015251chr163580 339 169 ----1670
NM_015271chr454243 3650 2931 1690 602 ----13828
NM_015272chr16----1811 11517
NM_015310chr8108404 8105 6694 6268 2933 2857 2715 1163 202 157 17938 ----
NM_015313chr1154317 4228 3671 3357 1696 14285 11832 --
NM_015317chr282805 2352 1822 1125 678 646 398 355 1479 ----
NM_015335chr1292555 2215 2150 2082 1772 1662 670 366 47 11036 ----
NM_015336chr1242569 2236 2121 409 ----12109
NM_015361chr22612 349 --1924 1324
NM_015365chrX63982 3535 3245 3012 1640 791 14196 14104 --
NM_015387chr2--1628 --21444 598
NM_015429chr331127 110 99 2714 322 ----
NM_015455chr533307 881 430 1596 22923 2811 13981
NM_015458chr8105149 5002 4259 1800 1342 1194 1066 779 703 695 24930 3611 --14650
NM_015550chr753399 1390 1208 1040 169 11260 ----
NM_015569chr153460 3083 1793 1700 1531 34867 3346 662 14563 --
NM_015576chr392917 2906 2513 2470 2213 2014 1989 991 515 22345 1070 ----
NM_015605chr1031234 623 134 --11147 11559
NM_015646chr1231208 1157 507 --11219 1357
NM_015713chr883598 3471 3324 3282 2997 2676 2444 943 22659 1280 ----
NM_015852chr7103548 3376 3354 3313 2649 2399 2352 2243 1409 977 ------
NM_015879chr1888527 7555 5825 3272 2579 1887 1243 510 35843 1839 733 --15472
NM_015886chr8105772 4684 4666 4424 4314 3917 3779 1667 914 136 45418 4388 1548 1506 11024 --
NM_016009chr184334 1759 1632 1401 855 796 379 52 --11976 --
NM_016023chr842126 2118 1928 702 --11361 --
NM_016025chr1641737 1583 1515 1330 ----12019
NM_016083chr663854 3757 3725 2570 1158 585 ------
NM_016107chr52880 152 2532 470 1950 11035
NM_016131chr232205 2189 336 ----1374
NM_016206chr3138877 8857 8483 7724 7080 7040 6669 6180 5925 5787 5512 1341 921 57781 7313 6569 6508 5627 1237 --
NM_016260chr296885 6247 6241 5766 5262 5107 2122 418 69 1650 17444 15241
NM_016297chr293623 3580 3475 3218 2914 2832 1461 1387 547 ------
NM_016308chr131338 578 570 11497 ----
NM_016322chr962208 983 763 746 658 470 --22742 2647 --
NM_016374chr171581 1466 1315 1232 1048 484 434 --1174 --
NM_016374chr171581 1466 1315 1232 1048 484 434 --1174 --
NM_016396chr1552721 2504 1045 476 255 --1231 11065
NM_016442chr52471 202 128 21585 619 12224
NM_016448chr12466 98 ----11780
NM_016513chr683650 3619 3183 3146 2710 1491 412 206 21172 403 ----
NM_016531chr474149 3710 3474 1578 1243 909 891 13327 1488 --
NM_016599chr441357 1077 429 199 11241 ----
NM_016626chr1851484 1326 1283 1198 59 1478 ----
NM_017412chr841097 1082 1032 114 11241 --1553
NM_017420chr1472610 2559 2551 2397 1024 631 390 12432 ----
NM_017423chr472146 1908 1832 1560 1497 406 81 1164 ----
NM_017447chr2131712 1253 557 24421 692 --11576
NM_017455chr1551002 992 920 848 649 ----1394
NM_017519chr691316 1162 1132 1027 1011 849 494 203 53 ------
NM_017628chr475184 4618 4494 4368 3860 682 306 33295 1085 600 11948 --
NM_017633chr663740 3642 3367 1025 971 115 23915 2605 ----
NM_017637chr9159343 8527 8469 8171 7420 7048 6921 6881 6875 6697 3580 2536 2347 1027 928 1765 39457 3260 333 12816
NM_017641chr1221029 218 ----11098
NM_017643chr1763093 3082 2909 581 482 74 --22404 879 --
NM_017658chr141957 54098 4082 3820 3143 947 --1790
NM_017769chr1452611 2561 2309 2025 1086 13265 ----
NM_017813chr8115637 4062 3834 2280 1992 1808 1587 905 408 400 23 1498 ----
NM_017848chrX74664 3633 3603 3576 3567 3179 815 ------
NM_017919chr9104749 4627 4532 4033 3957 3872 3569 859 796 290 ------
NM_018036chr1464400 3447 2786 760 661 157 13950 14185 --
NM_018085chr146444 5006 1842 926 68233 5753 3132 2667 868 562 ----
NM_018155chr373136 3130 3027 1381 1314 1006 385 ----12274
NM_018225chr9115247 5111 5095 4753 4724 4066 3992 3317 1512 1372 463 35429 4160 1863 13331 1843
NM_018234chr262291 2280 2163 358 103 83 1213 194 --
NM_018246chr842610 219 193 96 12875 --12503
NM_018299chr863412 3121 1361 1282 673 312 11021 ----
NM_018351chr1283563 3530 3037 1618 1297 1164 149 83 ----11735
NM_018374chr795206 4560 4379 3422 978 878 788 759 127 54899 4111 3490 823 801 --2726 285
NM_018555chr1982273 1821 1683 813 747 661 624 545 ------
NM_018557chr251698 1573 1447 36 28 1230 1222 --
NM_018566chr145049 3764 173 100 --13573 --
NM_018638chr1285285 5206 3435 1461 1423 673 630 238 --14976 24575 1950
NM_018841chr143095 2579 1557 614 33205 2484 711 11580 --
NM_018898chr552316 1792 1490 576 480 --11934 12261
NM_018899chr552316 1792 1490 576 480 --11934 12261
NM_018900chr552316 1792 1490 576 480 --11934 12261
NM_018901chr552316 1792 1490 576 480 --11934 12261
NM_018902chr552316 1792 1490 576 480 --11934 12261
NM_018903chr552316 1792 1490 576 480 --11934 12261
NM_018904chr552316 1792 1490 576 480 --11934 12261
NM_018905chr552316 1792 1490 576 480 --11934 12261
NM_018906chr552316 1792 1490 576 480 --11934 12261
NM_018907chr552316 1792 1490 576 480 --11934 12261
NM_018908chr552316 1792 1490 576 480 --11934 12261
NM_018909chr552316 1792 1490 576 480 --11934 12261
NM_018910chr552316 1792 1490 576 480 --11934 12261
NM_018911chr552316 1792 1490 576 480 --11934 12261
NM_018945chr693431 3109 2506 861 715 561 446 420 174 ----12587
NM_018947chr774703 3811 1838 1570 1159 679 341 11406 ----
NM_018963chr214968 534 330 164 11075 --11056
NM_018999chr1084868 4677 4234 3877 3764 1980 1728 269 --14102 --
NM_019001chr384806 4066 3954 1758 1618 1494 1452 701 1965 33503 771 441 --
NM_019080chr1351513 1392 1234 386 70 ------
NM_019084chr1042499 2303 916 569 42531 798 759 210 --1281
NM_019590chr1021188 352 162 --11095
NM_020122chr275220 4641 4188 3802 3759 1346 1024 36005 4574 1625 11157 --
NM_020245chr694430 3778 3383 3335 3211 1960 1354 1263 733 ----13445
NM_020337chr43753 502 127 33187 2550 2539 22697 1214 --
NM_020390chr394867 4564 3197 3065 1463 995 978 535 185 11972 ----
NM_020403chr1371785 1645 1379 239 147 119 89 31459 1130 159 ----
NM_020425chr661774 1513 717 286 131 75 --12021 --
NM_020466chr684501 3839 3723 3317 3138 1515 670 104 24075 1561 ----
NM_020640chr3--2896 50 --141
NM_020673chr2096040 5115 2083 1077 1052 808 582 216 116 15399 16891 27733 1268
NM_020718chr1646353 4232 1545 1254 46614 5830 1585 1455 12561 --
NM_020727chr2193618 3280 3258 3193 2850 2503 1304 301 184 11097 ----
NM_020732chr691316 1162 1132 1027 1011 849 494 203 53 ------
NM_020752chr1052925 688 564 388 376 22861 2627 12638 --
NM_020772chr17128595 8341 6997 5657 5259 3195 3005 2785 1926 1739 828 698 36970 2627 2091 22035 873 --
NM_020779chr253106 550 410 176 23 11031 11246 --
NM_020783chr1872055 1579 889 858 709 491 253 12167 ----
NM_020803chr452305 2050 952 97 46 11509 21736 144 --
NM_020805chr1861918 1750 1586 1495 560 184 1591 197 --
NM_020809chr1182155 1769 1712 1626 804 593 394 82 ------
NM_020810chr1452907 2885 2414 1016 203 41220 827 215 197 ----
NM_020830chr242449 2327 997 361 13044 13104 13084
NM_020841chr12103998 3932 3266 3138 2760 2693 959 713 697 262 12629 13399 13889
NM_020844chr8187528 7264 7258 7241 6946 6819 6613 5918 5890 5874 2964 2396 1967 1824 1745 1577 431 415 27007 5907 16468 11268
NM_020856chr1941560 1465 317 152 --1145 1538
NM_020940chr1092728 2508 2473 1925 504 441 247 220 176 ------
NM_020948chr173693 3674 3408 2344 1275 760 742 ------
NM_020951chr1952043 1710 901 439 418 2556 266 ----
NM_020993chr1242794 2045 793 131 --22844 2837 12788
NM_021032chr311999 ----1730
NM_021033chr13103483 3390 2765 2456 1362 939 780 372 318 227 ------
NM_021072chr542496 2336 2266 2052 22564 884 12258 --
NM_021116chr759044 8776 8196 3474 1890 28835 368 --27987 3463
NM_021145chr731029 335 55 1907 --1856
NM_021148chr752361 885 641 303 141 12411 11854 --
NM_021622chr102523 377 32290 1719 1679 11994 --
NM_021813chr6115778 5117 4616 4548 4388 4360 3651 2089 1732 836 121 1286 25463 914 --
NM_021814chr611385 51630 1089 283 257 107 1387 --
NM_021911chr544833 4483 3913 1503 24377 3410 157 --
NM_021914chr1442287 1717 765 282 2720 492 --1972
NM_021961chr11127337 7104 6887 5968 5355 4895 4542 1904 1182 876 381 215 12501 ----
NM_021964chr376063 4866 4415 1503 1208 744 88 24651 1374 --11384
NM_021970chr41690 278 42 2740 500 --
NM_021999chr134768 675 617 267 --1603 --
NM_022351chr873821 3165 2636 1359 1147 152 37 21109 659 ----
NM_022456chr1266846 5012 2391 1621 1537 1334 47059 2383 1869 848 17350 --
NM_022459chr13146144 5876 5634 5589 5015 4681 4475 2355 1968 1567 1555 1335 1298 275 25841 2163 ----
NM_022461chr31151 11435 11384 1145
NM_022726chr641520 1182 1166 533 31627 1551 1289 ----
NM_022763chr362603 2474 2277 807 737 642 12900 ----
NM_022776chr321146 657 ----11540
NM_022782chr124371 324 116 50 ------
NM_022832chr472584 2166 2059 645 511 489 377 --1982 --
NM_022893chr283064 2421 1942 1049 949 527 513 323 ------
NM_022912chr262540 2207 2186 905 656 467 --12403 --
NM_024315chr73392 386 354 1452 ----
NM_024345chr996112 5391 5251 4778 4420 4059 4038 1082 846 24885 592 --15323
NM_024563chr531791 1776 1622 --11699 11919
NM_024596chr8104383 4296 4285 3810 3398 1990 1940 1472 297 272 11753 11577 14566
NM_024611chr1533532 3314 3110 144 12548 1638
NM_024646chr193767 3662 3531 3436 3248 1301 959 772 422 1784 ----
NM_024665chr384573 3607 3258 2884 1487 1293 424 113 11174 ----
NM_024721chr8102447 2213 1991 1817 1729 1649 1078 601 550 536 ----12120
NM_024921chrX71982 1966 1903 1879 1388 448 26 1747 --1225
NM_024947chr388127 7377 3675 3472 2448 2270 1781 160 29587 7055 29220 2163 --
NM_024989chr2147992 7814 6813 6373 5864 5849 4960 3078 2273 2254 1467 1036 975 301 56688 5629 5275 2978 123 27935 5994 --
NM_025054chr873873 3555 3095 1252 862 599 479 1581 13533 --
NM_025073chr163938 2944 1823 1698 857 450 14740 --13822
NM_025160chr163837 3524 2674 1095 1072 74 11430 1782 --
NM_025191chr133329 2926 2349 23435 255 --11218
NM_030627chr583711 3400 3199 3083 2614 1251 907 128 44021 404 369 278 ----
NM_030647chr746306 6288 6075 5432 32501 2048 1009 15300 14809
NM_030648chr475623 5303 4027 3522 1077 466 388 54244 3642 1699 1611 201 12179 --
NM_030650chr293619 2634 1322 774 663 595 532 461 220 33713 3440 945 1313 --
NM_030664chr1072248 2112 1944 673 523 166 34 1468 ----
NM_030751chr1051729 1613 1607 1422 533 11447 1412 11284
NM_030751chr1051729 1613 1607 1422 533 11447 1412 11284
NM_030777chr2042157 892 598 526 42490 2474 2336 2320 --12371
NM_030806chr1119372 8922 6889 6373 5734 3443 3427 3074 2831 1620 245 28786 667 16127 --
NM_030816chr143321 2537 2528 683 13697 12818 11245
NM_030821chr42771 307 175 --1517
NM_031157chr121450 166 --1194
NM_031362chr242700 2448 2138 48 --21084 732 --
NM_031365chr242836 2584 2274 184 --1868 --
NM_031366chr242836 2584 2274 184 --1868 --
NM_031371chr171581 1466 1315 1232 1048 484 434 --1174 --
NM_031371chr171581 1466 1315 1232 1048 484 434 --1174 --
NM_031411chr552316 1792 1490 576 480 --11934 12261
NM_031468chr758223 8154 8104 1188 340 27092 800 26167 154 --
NM_031469chr653925 2619 2557 1580 1467 11283 11070 --
NM_031845chr252824 2744 2482 497 140 43141 3112 1398 198 ----
NM_031847chr252824 2744 2482 497 140 43141 3112 1398 198 ----
NM_031849chr552316 1792 1490 576 480 --11934 12261
NM_031857chr552316 1792 1490 576 480 --11934 12261
NM_031860chr552316 1792 1490 576 480 --11934 12261
NM_032012chr984717 4599 4388 3994 2102 962 597 556 25184 3616 15058 --
NM_032145chr651450 610 490 91 44 1399 ----
NM_032228chr1173100 1095 497 384 313 70 54 --1306 --
NM_032288chr352205 2044 1869 893 163 --12064 --
NM_032321chr262678 2662 837 702 594 85 ----22148 2134
NM_032373chr1085838 5828 5721 5172 4869 4238 542 241 --21588 1564 14801
NM_032439chr1041118 1099 590 578 11310 ----
NM_032445chr1542611 2519 259 88 31023 702 546 12485 11948
NM_032446chr563187 3037 2782 641 400 381 ----13606
NM_032457chr483884 3696 3055 1510 1326 1258 539 336 13938 1183 --
NM_032521chr2063247 3144 3117 2659 2050 1295 33084 2202 132 ----
NM_032778chr383096 3040 2527 2190 2175 1316 1184 930 13348 ----
NM_032828chr19124975 4899 4391 4075 4050 3946 3058 1714 1272 1168 799 210 34439 3955 3428 21013 727 --
NM_032859chr1373867 3786 2944 2510 1114 709 255 33939 2812 484 13734 --
NM_032873chr1194495 4203 4188 4101 4034 1531 962 648 354 ------
NM_032968chrX123150 2816 1437 722 678 663 654 311 280 239 137 62 14106 11604 11501
NM_032969chrX123150 2816 1437 722 678 663 654 311 280 239 137 62 14106 11604 11501
NM_032973chrY113145 1437 722 678 663 654 311 280 239 137 62 14098 11603 11501
NM_033181chr663854 3757 3725 2570 1158 585 ------
NM_033224chr7106670 6573 6009 5403 4917 3111 1790 1017 567 525 18030 27371 2370 --
NM_033285chr871604 1585 1514 668 325 93 70 24369 3848 --13760
NM_033360chr12103838 3489 3136 2818 1753 1438 1262 940 160 128 --11001 --
NM_033429chr1542058 1304 1178 678 ----1957
NM_033656chr21105730 5542 5201 5093 4661 3836 2047 1075 913 89 1404 1996 13731
NM_052879chr1263544 2740 1561 1079 541 252 12531 ----
NM_052885chr1274230 4179 1749 1713 1470 377 156 ----13915
NM_052907chr1264036 3180 2847 1149 266 255 ----1749
NM_052918chr1063723 3485 3459 3106 3005 398 ----12397
NM_052932chr1162316 2117 475 220 129 105 --11838 11568
NM_052937chr882051 1691 1039 804 704 583 517 364 1252 ----
NM_052954chr2131732 1574 545 42283 2253 2062 709 ----
NM_053025chr331752 1619 1381 11511 --11315
NM_053026chr331752 1619 1381 11511 --11315
NM_053027chr331752 1619 1381 11511 --11315
NM_053028chr331752 1619 1381 11511 --11315
NM_053031chr331752 1619 1381 11511 --11315
NM_053032chr331752 1619 1381 11511 --11315
NM_054016chr131631 1546 81 1303 11963 1419
NM_054016chr131631 1546 81 1303 11963 1419
NM_054016chr131631 1546 81 1303 11963 1419
NM_058241chr252331 2008 1912 245 226 ----2695 547
NM_058241chr252331 2008 1912 245 226 ----2695 547
NM_080546chr942244 1901 559 420 12311 12285 --
NM_080759chr1392533 2522 2384 2215 1998 1733 808 258 226 11923 ----
NM_080760chr1392533 2522 2384 2215 1998 1733 808 258 226 11923 ----
NM_080867chr1474900 4319 4212 3639 3614 3102 705 --24646 4517 --
NM_130391chr983458 2909 2869 2850 1241 874 726 335 --12718 --
NM_130392chr983458 2909 2869 2850 1241 874 726 335 --12718 --
NM_130393chr983458 2909 2869 2850 1241 874 726 335 --12718 --
NM_130435chr1042717 2259 935 554 --22365 470 1715
NM_133170chr2077807 7124 6445 6264 2242 2110 475 18091 36874 6570 1905 --
NM_133265chrX23119 2579 32675 2286 918 --23086 381
NM_133334chr475959 4549 3948 1934 1374 1065 132 24417 1470 ----
NM_133473chr1941926 1508 763 336 11756 11864 --
NM_133477chr453068 2172 610 585 530 4837 446 432 331 ----
NM_133493chr634012 3895 3219 1865 --1141
NM_133496chr194308 2978 1526 1470 1031 752 534 106 56 11722 --13440
NM_133646chr275410 4522 4231 3534 2241 709 75 45019 4877 751 267 14719 11676
NM_133647chr1543607 3025 2432 1240 33779 2445 830 13724 --
NM_138270chrX52389 651 588 224 92 --11310 12095
NM_138348chr5106639 5555 4759 4716 4503 4211 1145 523 379 248 1658 --11838
NM_138444chr1354415 4270 3828 845 681 11628 --14886
NM_138468chr275819 5729 4982 1872 1860 780 49 34378 1823 118 ----
NM_138473chr1275141 3829 2008 1587 1544 1031 990 ------
NM_138621chr244139 2700 2604 750 11076 23544 3488 12736
NM_138638chr1442287 1717 765 282 2720 492 --1972
NM_138713chr16127050 6948 6635 5933 3197 2740 2728 1828 1549 1173 1100 304 16141 16172 13182
NM_138714chr16127050 6948 6635 5933 3197 2740 2728 1828 1549 1173 1100 304 16141 16172 13182
NM_138731chr1494083 3501 3041 2596 2581 908 571 533 244 11007 --12751
NM_138771chr731181 626 278 41374 364 343 102 --11041
NM_138782chr572094 2086 2017 922 802 621 579 31719 1690 213 ----
NM_138811chr7--157 --21040 311
NM_138931chr351048 982 716 117 75 --1818 --
NM_138959chr186755 6616 5612 1600 1519 576 310 262 21874 1450 21109 964 --
NM_138971chr1163825 3233 1141 609 520 499 ----13257
NM_138971chr1163825 3233 1141 609 520 499 ----13257
NM_138972chr1163825 3233 1141 609 520 499 ----13257
NM_138972chr1163825 3233 1141 609 520 499 ----13257
NM_138973chr1163825 3233 1141 609 520 499 ----13257
NM_138973chr1163825 3233 1141 609 520 499 ----13257
NM_139312chr1051513 1469 1265 1119 76 ------
NM_144571chr4107040 6766 6753 5815 5094 2286 1043 696 460 50 16100 ----
NM_144578chr1494455 3738 3463 2173 1349 1296 1080 348 183 31818 859 639 ----
NM_144599chr1564546 1062 1042 778 732 423 --1933 34335 965 469
NM_144778chr1342385 2287 1903 976 42583 2254 2222 1885 12755 12301
NM_144949chr262435 2075 1702 988 886 404 11716 ----
NM_144963chr862660 2623 2579 2408 2375 102 12705 1586 --
NM_144973chr1285118 4404 3910 1999 1791 1451 715 189 14252 22007 383 --
NM_145044chr31478 1332 --11637
NM_145055chr1863784 3485 2639 2624 935 373 --13658 --
NM_145165chr1452606 674 527 363 26 148 11938 --
NM_145176chr683291 3177 2915 2840 2786 563 409 196 22979 1417 ----
NM_145259chr275033 4692 1934 1231 1027 277 114 25355 2122 11741 --
NM_145305chrX41255 1006 465 241 --2527 270 --
NM_145307chr1054060 3255 1278 216 39 1968 13589 --
NM_145320chr753399 1390 1208 1040 169 11260 ----
NM_145321chr753399 1390 1208 1040 169 11260 ----
NM_145322chr753399 1390 1208 1040 169 11260 ----
NM_145735chr1372836 2760 2634 2447 2425 1028 321 11014 ----
NM_152261chr1252216 2208 446 344 74 11647 12274 --
NM_152519chr272224 2060 1971 1820 445 262 227 11763 ----
NM_152529chr24973 837 745 685 13023 11646 --
NM_152594chr1542349 704 531 493 32245 1926 1656 22213 449 --
NM_152624chr567369 4774 2896 1177 222 185 15853 26306 2636 --
NM_152756chr584289 4214 3221 2972 1390 563 486 80 11659 14149 11377
NM_152765chr842277 2248 2107 677 --1456 --
NM_152774chr731900 436 365 22162 761 --1208
NM_152989chr1241808 1734 416 340 1192 --11209
NM_153020chr641669 1292 1045 680 11703 --1671
NM_153182chr383096 3040 2527 2190 2175 1316 1184 930 13348 ----
NM_153184chr361825 1366 1314 644 465 262 ----11759
NM_153188chr5125456 5337 5301 5192 4197 3934 2023 1744 1535 1190 604 251 35026 2280 1884 1134 --
NM_153207chr1263896 2864 2839 2558 749 725 23212 389 ----
NM_153332chr853255 2372 1189 244 86 --12171 --
NM_153426chr4----1599 2628 616
NM_153427chr4----1599 2628 616
NM_153456chr1335811 1713 435 25688 1325 --16206
NM_153810chr1095135 4747 4546 4109 3881 1986 1406 623 456 ------
NM_170665chr1284455 4288 4196 3543 1019 296 267 212 --14048 --
NM_170710chr432388 2365 2240 32928 2704 2287 --2789 354
NM_172071chr186251 5802 2711 2371 2271 1097 415 406 1970 ----
NM_172193chr1431310 1063 243 2341 251 ----
NM_173198chr962654 1831 610 483 332 165 --11875 --
NM_173200chr962654 1831 610 483 332 165 --11875 --
NM_173214chr16127050 6948 6635 5933 3197 2740 2728 1828 1549 1173 1100 304 16141 16172 13182
NM_173468chr495739 4830 4378 4280 1676 1660 1098 410 335 --14359 --
NM_173517chr71340 1426 --1360
NM_173552chr352489 2136 1866 1552 850 ------
NM_173582chr1165076 4536 4348 2298 609 169 23932 2474 ----
NM_173607chr1441742 839 832 91 1558 --11380
NM_173642chr186181 6069 3139 2530 2103 1976 1858 1760 37513 6947 2670 ----
NM_173644chr2031928 1859 409 1696 ----
NM_173645chr22468 64 2526 96 --1558
NM_173808chr1104172 4139 3845 3528 3179 1305 679 564 287 70 54015 1219 963 625 502 ----
NM_175610chr1531264 511 465 ----1497
NM_175623chr1266846 5012 2391 1621 1537 1334 47059 2383 1869 848 17350 --
NM_175624chr1266941 5107 2486 1716 1632 1429 47154 2478 1964 943 17445 --
NM_175625chr1266941 5107 2486 1716 1632 1429 47154 2478 1964 943 17445 --
NM_175863chr691316 1162 1132 1027 1011 849 494 203 53 ------
NM_177538chr298374 8357 7371 6174 5866 5369 2304 1225 366 --17093 --
NM_178010chr1241808 1734 416 340 1192 --11209
NM_178140chr592677 2159 2097 2030 1888 1806 831 644 99 12493 11029 1166
NM_178151chrX116729 6636 6508 6452 5913 5614 5590 4983 3126 2428 33 31416 1262 370 ----
NM_178152chrX116729 6636 6508 6452 5913 5614 5590 4983 3126 2428 33 31416 1262 370 ----
NM_178153chrX116729 6636 6508 6452 5913 5614 5590 4983 3126 2428 33 31416 1262 370 ----
NM_178509chr1774133 4097 1558 1246 855 503 337 1573 ----
NM_178585chr452984 2878 2807 1063 168 13245 12701 13047
NM_178815chr1042750 2159 1760 323 32788 676 100 1220 --
NM_181265chr432388 2365 2240 32928 2704 2287 --2789 354
NM_181443chr2052896 2024 1932 915 160 12785 21881 440 --
NM_181457chr23995 428 344 1116 --1313
NM_181458chr231128 561 477 1249 --1446
NM_181459chr23894 327 243 ----1212
NM_181460chr23941 374 290 162 --1259
NM_181481chr1886265 2112 1612 1540 987 542 518 100 26002 5215 16778 16716
NM_181482chr1886265 2112 1612 1540 987 542 518 100 26002 5215 16778 16716
NM_181483chr1886265 2112 1612 1540 987 542 518 100 26002 5215 16778 16716
NM_181504chr543970 2592 1031 961 32994 2801 272 13140 --
NM_181523chr543970 2592 1031 961 32994 2801 272 13140 --
NM_181524chr543970 2592 1031 961 32994 2801 272 13140 --
NM_181571chr1031075 763 168 158 --1370
NM_181705chr555716 5233 4737 527 52 13729 14804 --
NM_181712chr151800 1321 638 234 149 11717 --11728
NM_181714chr631904 627 131 11812 11564 --
NM_181782chr632107 1434 766 126 1392 11766
NM_181787chr863493 2419 2403 2378 819 332 21045 465 --1448
NM_181839chr8--11226 --1507
NM_182485chr453083 2965 2942 2474 1033 12896 --1929
NM_182515chr19105472 5079 4249 2590 1896 1791 1503 1306 324 172 55951 5355 4516 2600 920 1754 16353
NM_182551chr243485 3154 894 167 33068 2285 769 ----
NM_182646chr453083 2965 2942 2474 1033 12896 --1929
NM_182691chr731218 983 381 11073 1431 --
NM_182692chr731218 983 381 11073 1431 --
NM_182718chr1031075 763 168 158 --1370
NM_182719chr1031075 763 168 158 --1370
NM_182724chr1031075 763 168 158 --1370
NM_182725chr1031075 763 168 158 --1370
NM_182758chr1552983 906 759 176 77 1731 13832 23653 605
NM_182762chr755911 5749 4098 1195 628 14405 --14670
NM_182765chr1082317 1990 1759 921 890 793 683 315 1457 ----
NM_182767chr12--21767 803 --12083
NM_182769chr1031075 763 168 158 --1370
NM_182770chr1031075 763 168 158 --1370
NM_182771chr1031075 763 168 158 --1370
NM_182772chr1031075 763 168 158 --1370
NM_182850chr1031075 763 168 158 --1370
NM_182898chr776564 6160 5982 5199 2037 1977 1039 55759 5650 5003 4768 994 ----
NM_182899chr776564 6160 5982 5199 2037 1977 1039 55759 5650 5003 4768 994 ----
NM_182907chr672406 2391 1555 503 448 416 378 ------
NM_182915chr262291 2280 2163 358 103 83 1213 194 --
NM_182972chr172600 1992 1946 807 764 732 126 --11070 --
NM_183004chr1473338 3057 2848 909 808 83 32 ----172
NM_183060chr1031075 763 168 158 --1370
NM_183078chr683099 2959 1501 1322 882 865 857 475 23657 2694 12640 --
NM_194282chr493037 2413 2051 1987 1017 992 918 842 36 ------
NM_194283chr542670 964 754 291 1920 21410 327 --
NM_194291chr843024 2097 954 910 32834 2754 2408 1685 --
NM_194314chr165562 5281 5043 1923 1209 433 31595 1190 838 ----
NM_194434chr18115469 4776 4019 3779 3769 2241 1583 1314 1305 1185 555 --1119 24206 887
NM_198158chr362878 2117 1020 929 218 191 12791 ----
NM_198159chr362878 2117 1020 929 218 191 12791 ----
NM_198177chr362878 2117 1020 929 218 191 12791 ----
NM_198178chr362878 2117 1020 929 218 191 12791 ----
NM_198215chr1031260 931 443 21454 195 ----
NM_198240chr1231056 1013 988 ----11229
NM_198273chr533053 2680 521 22077 557 12305 --
NM_198400chr1552678 2665 2076 2026 47 1489 1926 1155
NM_198465chrX62969 2041 1117 705 485 174 1310 1216 --
NM_198581chr296031 5543 4916 4899 2779 1993 1200 500 185 11154 16478 --
NM_198904chr531841 1741 855 42137 1375 780 280 21685 535 --
NM_199188chr1263544 2740 1561 1079 541 252 12531 ----
NM_199190chr1263544 2740 1561 1079 541 252 12531 ----
NM_199421chr1474900 4319 4212 3639 3614 3102 705 --24646 4517 --
NM_199436chr273088 2948 2907 1176 1155 901 176 22042 735 ----
NM_199482chr2--1628 --21444 598
NM_201570chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_201571chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_201572chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_201590chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_201593chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_201596chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_201597chr1061807 1762 1733 1670 1511 1378 --21294 50 --
NM_203391chrX11291 ----1725
NM_203394chr1252414 2288 610 522 510 --12430 --
NM_203403chr961179 962 818 514 216 31 1348 ----
NM_203406chr562683 2212 892 591 576 548 ----11985
NM_203446chr2192960 2938 2627 2125 1992 951 894 667 173 12930 ----
NM_203459chr162602 2496 2090 986 946 611 21676 578 ----
NM_203487chr1371785 1645 1379 239 147 119 89 31459 1130 159 ----
NM_203504chr482453 1748 1012 941 839 777 394 385 2516 259 ----
NM_203505chr482453 1748 1012 941 839 777 394 385 2516 259 ----
NM_206594chr153347 2851 2607 818 692 12745 11343 1699
NM_206595chr153347 2851 2607 818 692 12745 11343 1699
NM_206853chr674025 3486 3070 2745 2702 1610 1318 2888 531 ----
NM_206854chr675286 4747 4331 4006 3963 3510 398 53697 2149 1792 41 29 178 --
NM_206855chr696251 5712 5296 4971 4928 4475 1363 776 644 34662 1006 994 11043 --
NM_206907chr572759 2720 2149 1309 570 545 97 23258 2588 --12805
NM_206909chr8108404 8105 6694 6268 2933 2857 2715 1163 202 157 17938 ----
NM_207303chr1083485 2975 2668 1518 1483 1407 379 119 21631 808 1622 11337
NM_207304chr1342272 2174 1790 863 52470 2141 2109 1772 1025 12642 12188
NM_207361chr1385889 5667 2216 2160 1800 1146 976 386 --11253 25395 415
NM_207406chr485664 5549 5082 4720 4372 4293 2504 2476 35150 2623 184 14257 --
NM_213589chr2135536 5353 5269 5152 4023 3939 3829 3737 1721 1141 435 169 47 1787 11374 --