TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3614-3p
miRNA Sequence: UAGCCUUCAGAUCUUGGUGUUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX86296 5571 5553 5062 4755 2623 2279 1584 11563 15607 --
NM_000104chr242184 956 502 277 --12485 --
NM_000125chr634096 1531 617 23079 212 13214 --
NM_000129chr611157 11120 21134 126 --
NM_000135chr166944 741 705 660 652 299 --1761 1210
NM_000142chr421041 582 ------
NM_000208chr1924247 211 --21293 722 --
NM_000214chr2021662 1362 --2708 42 --
NM_000217chr1274735 4169 3512 3264 2026 2006 1611 ------
NM_000232chr411254 32116 962 302 --12145
NM_000259chr1585310 4976 4864 2115 1445 1406 1252 390 --24680 1221 --
NM_000291chrX1684 --1866 --
NM_000314chr1052629 2485 2289 2220 198 ----1833
NM_000325chr4184 ------
NM_000332chr696752 6233 5925 5351 4750 4537 1600 1386 237 11680 16148 --
NM_000335chr371943 1876 1360 814 783 601 197 --21639 552 --
NM_000340chr31287 1220 ----
NM_000351chrX73702 3510 3266 2955 1204 563 325 --1140 --
NM_000408chr223064 2589 ------
NM_000430chr1753562 3381 3347 414 265 2617 494 1934 --
NM_000461chr343932 1059 668 403 13532 2783 224 --
NM_000493chr631108 234 224 ------
NM_000503chr8----21346 430 --
NM_000525chr11111176 1119 1092 608 570 557 474 452 258 249 83 --41348 1195 622 366 --
NM_000538chr1331840 1685 280 ------
NM_000555chrX57706 5434 2475 2125 1479 187 47680 2230 792 354 --
NM_000599chr2124014 3589 3523 3442 3419 3183 3017 2968 1781 1523 1037 165 --33757 3662 1589 --
NM_000609chr1083022 2570 2528 2422 541 477 300 117 1551 42605 2519 490 448 --
NM_000610chr1172128 2015 1070 1009 918 862 258 13044 ----
NM_000618chr1232412 1336 1041 --15221 11155
NM_000618chr1232412 1336 1041 --15221 11155
NM_000627chr2----2282 99 --
NM_000633chr1894929 4690 4632 3783 1943 1386 1006 477 38 --43928 2101 1286 466 1919
NM_000693chr1561744 1336 1319 509 473 403 --1114 --
NM_000701chr1----1226 --
NM_000719chr12115637 5165 4736 4309 4120 2068 1504 495 238 210 175 14344 ----
NM_000724chr101806 11689 11902 --
NM_000728chr11------129
NM_000801chr201838 ------
NM_000806chr531612 1516 402 --11911 --
NM_000813chr534735 1648 1228 --1320 --
NM_000826chr452320 1772 1740 663 41 ------
NM_000829chr1122257 1597 --11457 --
NM_000831chr1105483 5077 4984 4777 4738 3830 2401 1933 1690 334 --15584 24503 1860
NM_000834chr1241168 487 300 44 1379 --11064
NM_000840chr71516 ------
NM_000844chr32702 365 ------
NM_000875chr15126711 5585 5325 5282 5260 2135 2077 2050 1568 821 646 560 11658 --14705
NM_000891chr1722639 2272 ------
NM_000899chr1224276 1149 1996 13554 --
NM_000901chr412122 ------
NM_000935chr311144 11186 ----
NM_000944chr4--12172 ----
NM_000948chr6133 ------
NM_000958chr51364 197 1494 --
NM_001001323chr121744 ------
NM_001001389chr1172128 2015 1070 1009 918 862 258 13044 ----
NM_001001390chr1172128 2015 1070 1009 918 862 258 13044 ----
NM_001001391chr1172128 2015 1070 1009 918 862 258 13044 ----
NM_001001392chr1172174 2061 1116 1055 964 908 304 13090 ----
NM_001001395chr1232288 2171 116 ------
NM_001001396chr154309 1625 1571 1364 142 13417 11145 --
NM_001001481chr821134 778 1541 ----
NM_001001664chr253552 2824 2681 2667 958 1289 ----
NM_001001701chr422090 1607 --1396 11939
NM_001001890chr2143451 2931 1127 130 ----1909
NM_001002243chr2--1888 ----
NM_001002814chr853676 3548 1506 236 201 --53426 3122 2436 1227 1189 --
NM_001002838chrX21517 532 11577 --11555
NM_001002860chr1494404 4275 3483 3287 1663 1267 867 783 233 11772 1171 --
NM_001002909chr1731825 858 450 ------
NM_001002914chr1741102 297 250 186 --1224 --
NM_001002926chr712359 22594 84 22744 136 --
NM_001003406chr2293118 3006 2523 2441 1215 876 849 771 498 --22407 2181 --
NM_001003652chr1898442 7781 5874 5664 5592 2529 2170 2061 279 17279 36910 5897 3055 --
NM_001003674chr18116580 6440 5487 2753 2658 2409 2195 1860 1705 1454 1175 16697 22282 1194 --
NM_001003675chr18116580 6440 5487 2753 2658 2409 2195 1860 1705 1454 1175 16697 22282 1194 --
NM_001003681chr221207 11598 ----
NM_001003698chr631852 1645 196 --1611 --
NM_001003699chr631852 1645 196 --1611 --
NM_001003792chr32841 338 1812 1286 --
NM_001003793chr32841 338 1812 1286 --
NM_001003794chr392607 2596 2332 1247 738 657 621 518 369 --32217 945 699 --
NM_001004127chr133934 750 204 1413 1901 11034
NM_001004317chr653372 1493 638 549 309 ------
NM_001004354chr93394 367 106 --1981 --
NM_001004419chr124947 886 788 376 11395 ----
NM_001004441chr51297 1563 ----
NM_001005207chr17158 ------
NM_001005366chr121339 ------
NM_001005473chr556163 6013 4187 585 115 --11210 --
NM_001005476chr21243 ------
NM_001005502chr1264081 3794 1494 1324 1271 452 --43762 3623 1463 581 --
NM_001005781chr21379 ------
NM_001005782chr21828 ------
NM_001005861chr32960 34 1841 ----
NM_001006605chr121055 931 1857 ----
NM_001006605chr121055 931 1857 ----
NM_001006610chr163930 136 119 1809 ----
NM_001006636chr21650 ------
NM_001006939chr101479 ------
NM_001007024chr1763989 3477 1708 1638 263 235 13782 ----
NM_001007025chr1763989 3477 1708 1638 263 235 13782 ----
NM_001007097chr953682 3437 1529 1180 932 23428 607 1151 --
NM_001007237chr192419 2085 1774 1080 901 737 727 324 45 ------
NM_001007466chr645076 4261 944 241 13420 --1833
NM_001007538chr1321447 44 1747 ----
NM_001008239chr1823151 758 23830 878 ----
NM_001008408chr7125713 5650 4520 4362 4308 4301 2181 1950 1369 949 807 483 --42418 1978 1740 935 --
NM_001008660chr1121003 145 --11494 --
NM_001008777chr171652 ------
NM_001008801chr1962149 629 617 276 264 107 ------
NM_001009554chr474358 3378 1221 635 583 258 230 21085 836 ----
NM_001009554chr474358 3378 1221 635 583 258 230 21085 836 ----
NM_001009993chr293717 3004 2967 2848 1459 1364 1328 1276 1055 --13840 --
NM_001010853chr633089 2293 71 ------
NM_001010861chr142612 2151 2045 179 ------
NM_001010862chrX42329 888 706 577 1515 ----
NM_001010887chr941866 1631 1563 1275 --1428 --
NM_001010888chrX43981 1785 191 185 ------
NM_001010891chr566384 6095 5622 5484 435 70 1321 14713 --
NM_001010922chr143999 3775 3030 931 ----14060
NM_001010923chr621638 1427 --11762 --
NM_001010934chr7--21020 66 ----
NM_001010984chr131763 1719 319 ------
NM_001011537chr32743 701 1107 1136 --
NM_001011657chrX126 ------
NM_001011885chr1521477 1373 --1614 1576
NM_001012393chr1184423 4255 4051 3640 3279 1618 1552 712 14663 ----
NM_001012751chr101698 --11277 --
NM_001013031chr1072929 2871 2742 622 614 529 372 13410 ----
NM_001013399chr62800 213 ------
NM_001013438chr31753 --1885 --
NM_001013439chr31599 --1731 --
NM_001013843chr152715 22 ------
NM_001014797chr10117946 7635 7402 6648 6569 6166 5142 2923 2897 2493 1133 --27123 2745 --
NM_001015887chr32505 132 --1467 11625
NM_001017369chr41954 --1269 --
NM_001017395chr32722 368 --33006 2426 1153 --
NM_001017440chr7207303 6418 6332 6245 6223 6098 5535 5400 3168 2932 2478 2322 2285 2117 1900 1787 1719 455 202 145 --13074 --
NM_001017969chr92241 175 ------
NM_001017977chr1--197 ----
NM_001017995chr594377 3884 3783 1943 1387 1339 1194 742 25 --44086 3003 1353 213 --
NM_001017999chr142297 2287 1844 1596 ------
NM_001017999chr142297 2287 1844 1596 ------
NM_001018000chr142297 2287 1844 1596 ------
NM_001018000chr142297 2287 1844 1596 ------
NM_001018001chr142297 2287 1844 1596 ------
NM_001018009chr31950 11183 --1144
NM_001018050chr22103466 2104 1347 1072 819 744 702 662 348 42 ------
NM_001018052chr22103466 2104 1347 1072 819 744 702 662 348 42 ------
NM_001018065chr965930 5517 5467 4010 1483 1126 1748 123 24985 54
NM_001018066chr965930 5517 5467 4010 1483 1126 1748 123 24985 54
NM_001018067chr123608 1127 15093 ----
NM_001018068chr123608 1127 15093 ----
NM_001018069chr123608 1127 15093 ----
NM_001018090chr151157 11899 21940 824 --
NM_001018091chr151267 12009 22050 934 --
NM_001018102chr151157 11899 21940 824 --
NM_001018108chr1562069 1848 1679 1457 1415 842 --11962 --
NM_001020658chr13583 395 285 --1674 --
NM_001020658chr13583 395 285 --1674 --
NM_001024380chr852039 1944 1759 121 29 22459 2085 32427 1913 142 --
NM_001024381chr852039 1944 1759 121 29 22459 2085 32427 1913 142 --
NM_001024666chrX2245 97 ------
NM_001024808chr1292521 2315 2221 2189 1790 908 692 229 40 12041 22620 942 --
NM_001024855chr3--11264 2417 214 --
NM_001025076chr1045326 4637 4605 1367 21222 764 15115 12459
NM_001025077chr1066684 5995 5963 2725 471 82 22580 2122 16473 --
NM_001025079chr323837 918 22984 1350 ----
NM_001025201chr2--1594 ----
NM_001025580chrX43249 3070 787 675 1811 14232 --
NM_001025780chr9----2152 80 --
NM_001029859chr1172466 1913 654 630 371 267 66 1406 12049 --
NM_001029863chr61332 1772 --12711
NM_001029875chr51312 22525 2291 ----
NM_001029882chr11200 ------
NM_001029882chr11200 ------
NM_001030007chr1653573 3139 2628 755 200 ----1218
NM_001030055chr1411428 1895 ----
NM_001031679chr1292776 2580 1061 1030 883 717 673 542 454 --1852 --
NM_001031680chr172267 2053 1643 896 870 78 30 11675 ----
NM_001031690chr772619 2583 2539 1092 796 568 42 --2934 531 13111
NM_001031695chr2285296 5175 4901 4807 4354 1913 1838 1572 14094 ----
NM_001031804chr1611219 ----13979
NM_001031812chr512038 ------
NM_001032282chr82165 136 --2395 260 --
NM_001032288chr2021407 1121 --1459 --
NM_001032293chr172632 88 --1422 --
NM_001032999chr20145117 5050 4827 4476 4137 3938 3848 3554 3281 1211 776 399 366 120 25377 5109 44447 4323 3774 2115 14821
NM_001033044chr131229 612 476 ------
NM_001033056chr131229 612 476 ------
NM_001033057chr33779 678 40 ------
NM_001033087chr2052754 1064 947 477 94 ------
NM_001033117chr353941 3713 823 270 104 13005 21138 862 --
NM_001033602chr1332587 1738 440 ------
NM_001033953chr11279 23 ------
NM_001034837chr51285 ------
NM_001034838chr51285 ------
NM_001034954chr1052054 1096 897 754 662 23070 166 1385 --
NM_001034955chr1052054 1096 897 754 662 23070 166 1385 --
NM_001034956chr1052054 1096 897 754 662 23070 166 1385 --
NM_001034957chr1052054 1096 897 754 662 23070 166 1385 --
NM_001034996chr3298 28 ------
NM_001035005chr181433 --1269 --
NM_001037317chr142612 2151 2045 179 ------
NM_001037334chr181458 12181 ----
NM_001038707chr121742 146 12135 ----
NM_001038707chr121742 146 12135 ----
NM_001039538chr223398 334 --13011 1315
NM_001039547chr387584 7418 7298 6875 6527 5521 3032 1524 --47553 7292 5657 2230 --
NM_001039570chr22124487 4379 4302 4230 3510 3499 3022 1561 542 334 299 48 --73309 2917 1530 1396 970 938 803 --
NM_001039571chr22124487 4379 4302 4230 3510 3499 3022 1561 542 334 299 48 --73309 2917 1530 1396 970 938 803 --
NM_001039577chr173308 3284 2794 1611 872 813 784 1588 23937 88 --
NM_001039585chr163797 1524 1018 900 209 107 ------
NM_001039590chrX53731 3584 3053 2547 522 ------
NM_001039591chrX53731 3584 3053 2547 522 ------
NM_001039709chr20145117 5050 4827 4476 4137 3938 3848 3554 3281 1211 776 399 366 120 25377 5109 44447 4323 3774 2115 14821
NM_001039840chrX61779 1534 1438 1024 764 187 ------
NM_001039937chr1364173 3653 3311 1269 996 340 13350 12749 --
NM_001040107chr121164 ------
NM_001040108chr1432482 2001 135 --52453 2346 2182 2105 241 --
NM_001040113chr16146 ------
NM_001040152chr734287 3128 1692 ----11292
NM_001040157chr432556 1086 637 1556 1401 --
NM_001040202chr41330 11604 11570 --
NM_001040280chr62517 39 ----11096
NM_001040284chr1675958 4915 4890 4729 4264 760 227 ------
NM_001040402chr41300 --1188 --
NM_001040429chr1332685 327 119 ------
NM_001040665chr744437 3450 3194 485 11818 ----
NM_001040708chr831013 756 143 ------
NM_001040712chr91863 ----23301 2269
NM_001042404chr121803 1641 11350 ----
NM_001042413chr941259 1192 586 142 1791 ----
NM_001042424chr463284 2055 1199 443 283 68 --12003 --
NM_001042459chr3----1112 --
NM_001042473chr1011423 12205 ----
NM_001042475chr6----174 --
NM_001042533chr321011 548 12361 ----
NM_001042537chrX12240 11806 1644 --
NM_001042555chr1233166 1518 815 34517 1622 1534 1996 --
NM_001042599chr246994 6691 2522 1418 16014 --1828
NM_001042601chr312415 11205 ----
NM_001042632chr20102329 1028 1022 979 707 592 569 517 460 311 12136 1746 --
NM_001042633chr20102329 1028 1022 979 707 592 569 517 460 311 12136 1746 --
NM_001043318chr14114168 3370 3080 1347 1077 648 626 456 373 209 135 11127 63793 1308 1213 907 359 216 --
NM_001044305chr621216 397 ------
NM_001044385chr273462 1376 1246 1180 1012 712 697 11547 ----
NM_001044722chr512038 ------
NM_001044723chr512038 ------
NM_001083620chr452318 1770 1739 662 41 ------
NM_001099678chr335471 4944 4777 13976 14913 15769
NM_001100108chr1178369 8337 7452 7113 6455 6255 6227 5883 5620 3078 2806 2696 2416 2029 477 330 282 --57317 6984 6400 5589 2689 --
NM_001106chr3119106 7496 6243 3844 3700 3564 3026 2235 1485 1395 767 --23592 1714 1723
NM_001109977chr4143 ------
NM_001115chr8171 ------
NM_001128chr1653573 3139 2628 755 200 ----1218
NM_001167chrX126220 6056 5392 5385 5154 4826 4694 4396 4227 2453 992 926 --14196 --
NM_001173chr1411428 1895 ----
NM_001174chrX72321 2070 849 822 540 281 70 ------
NM_001200chr2011091 ----1461
NM_001204chr287752 5031 4999 4866 2936 1253 724 622 27363 1684 14723 --
NM_001206chr942844 1176 936 260 1729 ----
NM_001234chr31287 ------
NM_001253chr6--1210 161 --
NM_001256chr17------12541
NM_001257chr1611338 1452 ----
NM_001259chr754954 4012 3951 556 106 14417 ----
NM_001304chr172650 437 1595 ----
NM_001326chr11191 ------
NM_001332chr5--11488 1121 --
NM_001338chr2111243 ------
NM_001343chr5144 1445 ----
NM_001351chr3161 --11508 --
NM_001356chrX42332 2079 514 198 ------
NM_001364chr1134338 3380 685 --2216 77 --
NM_001396chr2132200 1050 124 32512 2284 2049 ----
NM_001412chrX43365 2766 1234 444 ------
NM_001415chrX--1136 21977 1270 --
NM_001418chr111153 ------
NM_001418chr111153 ------
NM_001419chr1953561 3377 3154 1261 867 --24108 135 --
NM_001422chr113560 368 78 ------
NM_001427chr721501 126 ----12109
NM_001438chr111130 ------
NM_001440chr862624 2553 2174 1770 377 59 11698 12211 --
NM_001446chr6------1103
NM_001451chr161948 1920 ----
NM_001482chr15161 ------
NM_001542chr192419 2085 1774 1080 901 737 727 324 45 ------
NM_001543chr5124669 4294 3917 3880 1776 1757 1676 1635 1556 1351 632 258 --64782 4616 3948 3933 1160 890 --
NM_001584chr112973 35 ------
NM_001609chr1062924 2848 1487 1466 1300 1000 ------
NM_001614chr171589 ------
NM_001614chr171589 ------
NM_001655chr1152178 1956 1694 1427 221 --21391 1337 --
NM_001682chr121458 11098 11076 --
NM_001684chr144026 1342 1288 1081 13134 1862 --
NM_001695chr844188 3749 2937 274 13631 ----
NM_001699chr1941600 383 301 278 ------
NM_001706chr3----2710 430 --
NM_001742chr711559 ------
NM_001743chr2184 ------
NM_001754chr2143451 2931 1127 130 ----1909
NM_001759chr1265139 4141 4102 3767 2122 803 24062 1563 13858 --
NM_001777chr323837 918 22984 1350 ----
NM_001789chr331207 657 158 ------
NM_001801chr5136 167 ----
NM_001806chr1921093 920 --32742 991 361 1122
NM_001822chr2--1594 ----
NM_001858chr625173 1058 33460 1729 1497 14747 --
NM_001873chr4--1697 ----
NM_001874chr1264081 3794 1494 1324 1271 452 --43762 3623 1463 581 --
NM_001896chr161454 ------
NM_001927chr21564 ------
NM_001930chr19122 ------
NM_001932chr171644 --1561 --
NM_001935chr2--1126 1291 --
NM_001938chr11202 11567 ----
NM_001945chr521208 1189 --21297 1281 --
NM_001946chr121348 1136 ----
NM_001954chr61847 ------
NM_001969chr1421276 289 11380 ----
NM_001978chr821048 185 ------
NM_002009chr1541927 1121 230 112 11717 ----
NM_002014chr121633 ------
NM_002017chr1111076 --1537 --
NM_002025chrX128581 8509 8410 8385 7314 5942 5917 3494 2801 2351 2035 1800 11717 12755 --
NM_002035chr1853343 1145 1101 682 250 --23312 3170 --
NM_002040chr2131131 825 232 ----1270
NM_002048chr91358 ------
NM_002065chr131229 612 476 ------
NM_002073chr2251567 1309 1281 426 382 --11116 --
NM_002114chr6148 ------
NM_002128chr1342454 2170 1684 99 ------
NM_002167chr12430 364 ------
NM_002187chr541290 1198 1006 414 1830 ----
NM_002202chr51977 1708 ----
NM_002203chr553535 3217 3125 2884 838 23650 3445 ----
NM_002221chr1102862 2615 2030 992 766 718 593 487 361 174 --32502 1078 670 --
NM_002222chr31159 ----189
NM_002223chr1283637 3200 2771 1388 1084 273 264 251 12849 13179 --
NM_002241chr142678 1168 380 278 --22967 2645 --
NM_002264chr344734 4205 3398 1538 14308 --13140
NM_002270chr544404 2106 1305 867 ------
NM_002271chr132892 668 --21995 545 --
NM_002293chr122466 2283 ------
NM_002374chr223398 334 --13011 1315
NM_002376chr141518 ------
NM_002387chr5103855 3600 3436 1562 1514 1216 1097 715 709 501 44362 3792 1180 1152 23813 106 --
NM_002389chr12112 23 ------
NM_002395chr6165 ----11299
NM_002397chr512109 1250 --1610
NM_002401chr1732321 2203 95 --22470 844 --
NM_002405chr223235 164 24 --2737 262 --
NM_002408chr142774 716 --1184 --
NM_002482chr14682 190 116 110 --1644 --
NM_002486chr931921 496 27 --21829 1695 --
NM_002505chr611334 ------
NM_002515chr14--1551 ----
NM_002545chr1184423 4255 4051 3640 3279 1618 1552 712 14663 ----
NM_002556chr1141885 1392 602 467 --11900 1252
NM_002578chrX1304 ------
NM_002581chr994716 4385 4342 2114 1693 1346 770 529 381 --13855 --
NM_002583chr121447 ------
NM_002595chr12168 --11732 11622
NM_002610chr262906 2493 2013 1210 735 56 1857 ----
NM_002613chr16124556 4494 4358 4271 3832 1886 1596 1441 1217 952 939 246 15090 2904 717 --
NM_002655chr844289 4229 3886 3858 ------
NM_002656chr621075 374 ------
NM_002657chr20103905 3803 3677 3013 2933 1415 503 456 332 81 ----11206
NM_002660chr202325 210 ----11020
NM_002687chr14----1491 --
NM_002698chr1992989 2898 2644 2507 1100 895 369 361 299 --12860 --
NM_002709chr221151 780 ------
NM_002713chr131176 768 214 --2878 468 --
NM_002725chr193578 3007 2840 1570 1399 1139 949 601 390 --43814 2976 1539 44 --
NM_002727chr101689 ------
NM_002729chr101345 ----187
NM_002736chr72389 257 11841 ----
NM_002737chr17106299 6274 5814 5703 5224 5156 2236 1980 479 116 ----15132
NM_002745chr2234058 3783 863 ----1435
NM_002758chr173488 465 220 ------
NM_002808chr31135 ------
NM_002823chr21565 ------
NM_002837chr1223832 1002 21611 414 14530 --
NM_002839chr91863 ----23301 2269
NM_002849chr122928 65 --1217 --
NM_002869chr112864 648 ------
NM_002890chr5--11003 ----
NM_002892chr141536 ----1201
NM_002955chr631852 1645 196 --1611 --
NM_002958chr32960 34 1841 ----
NM_002994chr431859 1550 1276 --1393 1642
NM_003010chr1742072 867 762 35 ------
NM_003011chr91521 ------
NM_003031chr163930 136 119 1809 ----
NM_003034chr1287653 6242 5866 5764 2781 2163 1110 321 --18082 --
NM_003042chr322268 1668 ------
NM_003045chr13114014 3891 3709 1669 1594 1444 968 959 653 615 64 --11625 --
NM_003051chr131504 1348 703 ------
NM_003054chr10--1125 ----
NM_003069chrX1137 ------
NM_003071chr331733 1474 1344 1240 ----
NM_003081chr202953 202 ------
NM_003095chr121263 ------
NM_003099chr15175810 5506 5386 4964 4743 4485 4419 4273 4153 4139 4090 1666 1325 1105 893 885 689 1363 26015 4782 --
NM_003107chr662032 990 939 719 412 132 11632 1563 --
NM_003108chr2106942 6654 2834 2513 2487 2469 2403 2366 1665 442 --36174 1910 1353 --
NM_003112chr721982 1095 ------
NM_003115chr11378 ------
NM_003136chr142322 304 ------
NM_003161chr1723200 2765 13143 ----
NM_003199chr18--11067 --15311
NM_003200chr1931471 902 144 ------
NM_003204chr1751700 1503 1198 344 54 --11490 1450
NM_003214chr641229 973 373 129 --2948 208 11080
NM_003236chr262987 2931 2178 804 763 57 13360 ----
NM_003247chr612030 1766 ----
NM_003253chr2151877 1719 1558 1271 240 ------
NM_003256chr31398 ------
NM_003262chr352019 1835 1512 1045 674 ------
NM_003269chr611298 ------
NM_003291chr131306 ------
NM_003292chr132219 1663 1500 ----1879
NM_003342chr1733292 877 500 12422 --11163
NM_003344chr731649 1213 108 ------
NM_003345chr161561 ------
NM_003348chr1221265 306 1200 ----
NM_003349chr2021407 1121 --1459 --
NM_003352chr21828 ------
NM_003356chr11----2850 317 --
NM_003392chr364163 3851 3046 2657 526 333 ------
NM_003404chr20--11457 1359 --
NM_003406chr831969 440 422 ------
NM_003412chr353067 2485 294 263 223 ------
NM_003413chrX21438 1431 1113 2339 145 --
NM_003418chr32608 80 ------
NM_003453chr13--1548 ----
NM_003457chr172632 88 --1422 --
NM_003466chr252152 2137 1657 672 471 --62375 2165 1901 1586 606 533 --
NM_003468chr234246 2797 330 22703 611 11198 --
NM_003470chr1641433 1310 700 139 ------
NM_003471chr311892 12143 1329 1815
NM_003473chr101139 1260 ----
NM_003478chr1121190 84 12517 ----
NM_003482chr1262593 2340 2140 634 326 156 --1144 11057
NM_003483chr12--1650 ----
NM_003489chr21----12147 --
NM_003507chr271480 1400 772 765 649 459 339 --21436 295 --
NM_003557chr11482 --11524 --
NM_003566chr12--13321 --13366
NM_003583chr1243490 2385 1039 583 --12552 --
NM_003590chr233539 3292 500 ------
NM_003603chr441845 1775 742 596 --21335 338 --
NM_003617chr154855 4240 4141 3824 187 ------
NM_003622chr1222456 1692 22592 686 ----
NM_003628chr21243 ------
NM_003629chr163074 2613 2265 2156 574 70 11361 2516 453 --
NM_003630chr61610 1653 ----
NM_003633chr512588 --22298 1007 --
NM_003644chr17156568 5652 5590 5516 4540 2594 1526 1071 854 759 451 381 348 276 223 --66466 5711 4781 4744 583 406 --
NM_003663chr333053 1008 601 11170 ----
NM_003670chr331398 444 417 --1434 --
NM_003679chr163179 2940 2812 2510 2171 445 1954 ----
NM_003743chr242050 1854 1702 446 --1321 --
NM_003749chr1341741 1680 1527 780 ------
NM_003758chr1531117 595 302 11515 ----
NM_003758chr1531117 595 302 11515 ----
NM_003759chr453157 1367 1342 1058 685 13879 ----
NM_003768chr12709 444 --31390 1282 27 --
NM_003783chr11186 ------
NM_003800chr642153 1734 970 275 1810 ----
NM_003819chr1157 ------
NM_003822chr152941 2824 1074 503 224 ------
NM_003850chr13128 ------
NM_003862chr51345 ------
NM_003864chr4--1196 ----
NM_003872chr282545 2301 2169 2156 1124 1117 762 126 12522 12552 --
NM_003895chr211882 1412 ----
NM_003913chr622737 533 21687 915 13313 --
NM_003924chr461446 1298 527 485 272 127 190 1600 --
NM_003939chr1063687 2905 2651 1617 1115 140 --13401 --
NM_003941chr752366 2234 1770 1561 172 ------
NM_003948chr432580 2452 141 22135 1963 ----
NM_003973chr3298 28 ------
NM_003994chr1224276 1149 1996 13554 --
NM_004050chr1482186 2163 814 706 639 385 326 246 --32358 838 671 --
NM_004067chr731558 1042 192 11372 ----
NM_004080chr721261 598 ------
NM_004085chrX131 ------
NM_004090chr1753233 1394 589 273 42 23201 2324 ----
NM_004093chr1353020 2119 904 743 521 --1344 1706
NM_004100chr642438 2411 2279 1734 --1937 --
NM_004136chr1553232 2695 2186 1195 611 11266 11217 --
NM_004167chr171456 --1203 --
NM_004171chr1198635 7468 3623 3316 3080 2405 1482 1324 134 ----12361
NM_004200chr11102687 2518 2414 1271 682 651 634 619 217 33 --2420 118 --
NM_004225chr811031 ----11411
NM_004229chrX--1682 128 --
NM_004232chr1832955 2805 615 13065 12867 --
NM_004233chr62517 39 ----11096
NM_004236chr151523 ------
NM_004242chr61428 ------
NM_004274chr1422038 1116 1828 ----
NM_004286chr2242569 1841 1109 179 ------
NM_004290chr52217 165 --11177 --
NM_004296chr14103870 3422 3318 3039 2515 1544 1108 1083 962 126 --23832 217 --
NM_004321chr2103557 3278 2624 2325 2282 2204 1309 527 242 186 --22748 1011 --
NM_004323chr951900 748 644 246 91 --2981 374 1676
NM_004338chr18116580 6440 5487 2753 2658 2409 2195 1860 1705 1454 1175 16697 22282 1194 --
NM_004350chr172267 2053 1643 896 870 78 30 11675 ----
NM_004352chr166493 79 65 41 35 24 ------
NM_004384chr512038 ------
NM_004392chr131837 22502 1724 1684 --
NM_004397chr1154276 3934 3804 165 30 1629 11068 --
NM_004430chr862303 2033 334 199 193 86 12546 ----
NM_004432chr972376 2293 2234 2159 1756 352 266 ------
NM_004437chr143593 3511 915 529 --22727 1198 --
NM_004458chrX41969 817 539 455 ------
NM_004459chr172759 655 ------
NM_004472chr5133 ------
NM_004480chr142540 191 1109 187 --
NM_004491chr19154191 3677 3451 3400 3168 3013 2817 2675 1700 1486 1190 1117 868 799 552 --14230 --
NM_004498chr151375 ------
NM_004501chr154020 3388 2683 1093 647 --2687 554 1704
NM_004504chr222622 2613 --32377 475 169 --
NM_004506chr61678 ------
NM_004525chr231160 589 232 ------
NM_004537chr1231390 1024 417 ------
NM_004561chr113497 272 218 --31622 678 523 --
NM_004569chr142500 204 ------
NM_004571chr2163288 3165 3039 2453 1215 237 --12956 --
NM_004586chrX75008 3793 3761 3618 3507 3495 1524 --11661 --
NM_004588chr11101171 1022 892 877 613 576 432 276 269 242 --21293 400 --
NM_004593chr33912 680 297 ------
NM_004596chr19177 ------
NM_004612chr952950 1590 1333 1188 1182 --14782 --
NM_004637chr311107 --1476 1461
NM_004650chrX5615 594 560 489 309 ------
NM_004660chrY22004 812 ------
NM_004661chr511223 --11125 --
NM_004685chr1332546 2279 2075 --1708 --
NM_004687chr171731 --2493 73 --
NM_004689chr141322 ------
NM_004703chr1722539 2065 --1486 1687
NM_004711chr22143616 3444 2874 2859 2638 2614 2371 2237 1430 1338 1318 1287 1030 728 --22660 890 --
NM_004726chrX54860 4711 4651 1550 885 11270 14721 --
NM_004736chr132101 695 676 ------
NM_004741chr1011024 ------
NM_004745chr876132 6074 5473 5137 570 448 426 16996 1766 --
NM_004748chr1553189 1344 1055 957 847 24249 53 ----
NM_004755chr141259 1281 ----
NM_004763chr26814 762 706 426 370 314 ------
NM_004774chr1752413 965 689 675 398 --1449 --
NM_004787chr4135 ------
NM_004788chr1152645 2553 2435 2413 1796 12304 --12701
NM_004808chr1063115 2947 2821 2729 2611 757 1230 23084 891 --
NM_004834chr262387 2097 1136 859 218 96 --12137 --
NM_004844chr31950 11183 --1144
NM_004845chrX42590 1618 142 48 13340 12698 --
NM_004856chr152537 419 ------
NM_004857chr1464766 4519 3825 1822 676 293 --1812 --
NM_004871chr1763989 3477 1708 1638 263 235 13782 ----
NM_004888chr91394 ------
NM_004898chr411868 ------
NM_004937chr17112602 1873 1706 874 514 363 319 250 103 70 54 12222 ----
NM_004938chr9----1865 --
NM_004948chr1841402 404 92 85 --11371 --
NM_004949chr1812048 --11383 --
NM_004956chr764116 3946 3614 3319 3313 2956 --13024 --
NM_004967chr4176 ------
NM_004973chr631745 574 340 ------
NM_004985chr1244090 1516 992 542 ------
NM_004992chrX158371 7758 7107 6758 6573 6565 6457 6047 5802 5715 3044 1422 789 275 77 --37604 5739 2636 --
NM_004992chrX158371 7758 7107 6758 6573 6565 6457 6047 5802 5715 3044 1422 789 275 77 --37604 5739 2636 --
NM_004995chr1451136 1049 321 228 52 --3968 420 216 --
NM_004999chr674038 3872 3829 3559 3257 3157 1563 1157 24007 1500 --
NM_005000chr7--11054 ----
NM_005006chr2--2202 128 ----
NM_005044chrX74122 3968 3797 3498 1534 1148 1096 11725 3970 835 217 --
NM_005045chr71960 ------
NM_005056chr122642 612 53734 3676 3618 3560 3547 24111 3443 --
NM_005076chr1124090 4066 3766 3246 3226 3017 2788 1444 1411 1386 826 602 --11570 --
NM_005077chr92502 155 ----1454
NM_005086chr121556 1569 1723 --
NM_005087chr31599 --1731 --
NM_005088chrX--1707 ----
NM_005093chr20145117 5050 4827 4476 4137 3938 3848 3554 3281 1211 776 399 366 120 25377 5109 44447 4323 3774 2115 14821
NM_005116chr2063628 3016 1790 1079 896 333 --1533 --
NM_005121chr1743788 2819 1111 91 1922 1517 --
NM_005151chr181458 12181 ----
NM_005156chr945053 1858 1498 189 ----11820
NM_005159chr1552204 1715 853 390 277 11735 2914 825 1628
NM_005188chr11108152 6673 5754 5372 5316 2436 2355 2103 462 220 --17700 --
NM_005190chr62800 213 ------
NM_005197chr14106069 6023 4286 4167 1778 1654 1574 601 475 388 24224 1406 14109 --
NM_005201chr32357 83 ------
NM_005214chr221013 453 --11044 --
NM_005225chr2041237 1105 897 292 --2481 169 --
NM_005235chr246994 6691 2522 1418 16014 --1828
NM_005245chr41739 ------
NM_005249chr141209 ------
NM_005259chr2--1596 143 --
NM_005274chr1122 ------
NM_005296chrX1130 ------
NM_005338chr783966 3485 2846 2737 2559 1568 1360 992 13036 23621 485 --
NM_005339chr453485 3053 1610 1420 1391 --34209 1589 1277 --
NM_005342chrX102737 2577 2433 1918 1120 1093 988 517 490 462 21825 1141 --11007
NM_005347chr931664 1286 1139 31642 1453 1439 11255 --
NM_005358chr131365 ------
NM_005359chr1876125 5675 5594 4639 1729 847 791 15451 ----
NM_005382chr8--125 ----
NM_005398chr1021018 385 1446 ----
NM_005399chr173292 1765 921 833 698 226 104 1689 188 11488
NM_005400chr252551 2424 2325 498 189 21127 780 --12854
NM_005406chr18----11152 --
NM_005414chr3141 ------
NM_005433chr1852230 1877 1062 720 282 ------
NM_005455chr111218 11710 ----
NM_005465chr121746 730 ----21457 369
NM_005475chr1253200 2387 1009 551 311 --11320 --
NM_005476chr92575 440 --1938 11323
NM_005487chr221207 11598 ----
NM_005497chr17105676 5510 5335 4955 4266 4217 2335 1373 1060 147 --35640 5169 4401 --
NM_005504chr1276533 6324 4601 4316 4204 1633 509 --36444 5736 5510 --
NM_005509chr521430 542 ------
NM_005542chr721957 462 ------
NM_005573chr51526 1491 ----
NM_005575chr5--1676 ----
NM_005576chr151293 ------
NM_005578chr344680 4426 3888 2029 1645 33588 3132 967 14931
NM_005596chr986107 5575 2288 1171 1010 772 528 280 14409 26230 4622 24275 522
NM_005599chr131094 499 381 --2182 89 --
NM_005604chr632384 1847 862 ------
NM_005638chrX21639 233 --1717 --
NM_005650chr22168 ------
NM_005655chr82165 136 --2395 260 --
NM_005659chr222435 333 ------
NM_005665chr154031 1840 1705 246 61 13388 ----
NM_005668chr544292 3509 2893 1021 ----13095
NM_005688chr32994 239 ------
NM_005704chr161086 980 893 810 400 297 ------
NM_005715chr652633 1916 943 519 450 --11890 --
NM_005759chr294420 4272 3690 3667 3526 1024 824 814 62 --11383 --
NM_005796chr161245 ------
NM_005800chr131130 ------
NM_005819chr143086 2506 2146 806 11016 33495 1336 524 --
NM_005828chr1794870 4288 4042 3854 3452 3346 2012 1760 215 --23133 1529 14930
NM_005840chrX157647 7372 7349 6979 6517 6036 5920 5524 5419 4877 4734 2780 1876 1479 1358 36742 6136 2255 25163 2989 --
NM_005845chr1321209 33 --1470 --
NM_005862chr31669 ------
NM_005880chr1641655 1178 1113 609 11583 ----
NM_005898chr1133148 2431 553 --12837 --
NM_005901chr1898442 7781 5874 5664 5592 2529 2170 2061 279 17279 36910 5897 3055 --
NM_005910chr1793822 3192 1518 1315 1100 783 542 530 346 11000 23058 948 --
NM_005920chr173742 2799 2572 1097 794 707 688 1804 33563 2967 785 --
NM_005922chr62479 453 --1188 --
NM_005933chr1162931 2088 1136 577 65 38 --12908 --
NM_005935chr464453 4363 3622 3615 1749 620 21407 1074 1208 --
NM_005937chr17103725 3389 3209 1358 1148 1137 1016 649 436 228 --1664 --
NM_005941chr843961 3955 3800 3178 33890 3042 3025 ----
NM_005955chr1134960 4511 4200 3450 1740 1526 945 921 789 488 462 444 47 25006 295 14676 --
NM_005966chr231647 911 264 ------
NM_005994chr175783 755 629 337 266 ------
NM_006007chr933656 3326 3133 13559 21179 1021 --
NM_006016chr632130 1561 722 ------
NM_006022chr13--1210 ----
NM_006033chr181808 12326 1384 1778
NM_006038chr2061638 1357 873 494 215 97 132 ----
NM_006079chr61108 ------
NM_006080chr712849 ------
NM_006133chr1142468 2025 880 854 ------
NM_006136chr7------1550
NM_006141chr163299 280 247 --12045 1182
NM_006154chr1512034 ------
NM_006194chr14----21007 857 --
NM_006203chr555103 5006 3531 3462 1265 --15114 --
NM_006216chr22610 226 ------
NM_006243chr13916 752 746 --1816 --
NM_006251chr552763 2650 2582 2114 294 --1105 --
NM_006252chr175893 5070 4903 2008 1742 1714 1098 --15039 --
NM_006277chr22260 41 1276 ----
NM_006282chr2084586 4151 1727 1458 557 490 149 21 --43939 1489 1067 508 --
NM_006283chr844336 3910 1260 1009 --1254 --
NM_006306chrX105889 5192 4883 4858 4548 4193 3803 1167 1101 980 13756 25487 4606 --
NM_006313chr1211058 ------
NM_006333chr23670 619 89 ------
NM_006352chr111428 --1619 --
NM_006359chrX12240 11806 1644 --
NM_006366chr611235 ------
NM_006367chr12407 206 ------
NM_006371chr3135281 4747 4210 4024 3945 3883 2122 2102 2082 1788 1654 1487 1268 --13533 --
NM_006374chr2282 33 ------
NM_006383chr152536 453 ----1180
NM_006393chr1033770 3677 2802 --13046 --
NM_006415chr911028 ------
NM_006416chr6177 1308 ----
NM_006420chr2031164 621 170 ------
NM_006434chr1052054 1096 897 754 662 23070 166 1385 --
NM_006454chr4132991 2701 2690 2616 2296 1926 1073 1030 1005 581 427 421 216 --22454 900 --
NM_006469chr121282 193 ------
NM_006482chr1243490 2385 1039 583 --12552 --
NM_006489chr14--1551 ----
NM_006496chr121643 366 ----1719
NM_006534chr2023444 2419 11106 1572 --
NM_006544chr1434643 1020 311 1520 35407 4543 1558 --
NM_006546chr17136376 6031 5443 5028 5012 4691 4660 4292 1952 1906 1511 1048 1005 --26630 5090 11935
NM_006548chr361630 1449 1245 241 191 132 ------
NM_006552chr11176 ------
NM_006558chr81335 ------
NM_006559chr14805 474 384 370 ------
NM_006561chr1045326 4637 4605 1367 21222 764 15115 12459
NM_006572chr1773005 2977 2317 1414 1074 594 474 --1523 13447
NM_006575chr141415 11385 ----
NM_006595chr11--21542 422 ----
NM_006599chr1656600 5722 3082 452 319 15551 --11577
NM_006620chr654256 3508 3275 1784 965 --33563 1746 1605 1491
NM_006625chr1157 ------
NM_006625chr1157 ------
NM_006625chr1157 ------
NM_006628chr1523797 1129 14077 ----
NM_006654chr1233166 1518 815 34517 1622 1534 1996 --
NM_006710chr2--1890 ----
NM_006717chr922825 2244 1778 12261 --
NM_006718chr621075 374 ------
NM_006724chr62479 453 --1188 --
NM_006729chrX74776 4744 3758 2190 998 943 308 1482 ----
NM_006738chr15154354 4251 3974 3838 3438 3121 1750 1399 1326 1177 1142 987 470 323 186 --1678 --
NM_006745chr41954 --1269 --
NM_006750chr1667668 6983 5944 2764 1364 208 12594 15913 --
NM_006751chr221030 1000 ------
NM_006763chr111330 32069 1518 357 ----
NM_006793chr10193 ----1269
NM_006811chr2031023 789 141 ------
NM_006814chr2021838 471 12680 --1780
NM_006836chr122566 537 ------
NM_006852chr172911 474 --11808 --
NM_006854chr71576 12040 1166 11680
NM_006857chr2--1180 ----
NM_006885chr161264 ------
NM_006906chr113845 708 21 ------
NM_006908chr71185 --11039 --
NM_006924chr1734180 1407 479 --11423 13354
NM_006941chr2231176 363 119 1453 2110 101 --
NM_006943chr2093246 3005 2917 2808 2668 2576 2546 86 79 ------
NM_006982chr121238 ------
NM_007005chr91362 --2420 307 --
NM_007011chr15136370 6138 5423 5380 4825 4804 2753 2731 2333 2144 902 657 351 --15559 --
NM_007036chr53909 772 621 --128 --
NM_007045chr6--1575 1556 --
NM_007050chr20157936 7684 7376 7352 6970 6735 6269 6171 3209 2638 2158 1900 793 442 37 --47706 6727 1854 367 --
NM_007114chr323250 1240 --12733 12796
NM_007129chr132394 74 --11006 --
NM_007159chr3--11422 ----
NM_007166chr1121003 145 --11494 --
NM_007173chr114831 676 545 225 12208 ----
NM_007185chr1----21078 271 --
NM_007200chr15154354 4251 3974 3838 3438 3121 1750 1399 1326 1177 1142 987 470 323 186 --1678 --
NM_007212chr122074 481 --12096 --
NM_007214chr621317 189 ------
NM_007238chr20114713 4685 4514 4052 3908 3717 3686 3502 1701 1694 301 21311 731 74808 3725 1663 1528 1108 574 362 --
NM_007249chr1389365 8077 2092 1501 1248 165 143 66 26387 6071 --19375
NM_007271chr621617 722 11591 11324 --
NM_007275chr31878 1363 11026 1217
NM_007283chr392607 2596 2332 1247 738 657 621 518 369 --32217 945 699 --
NM_007285chr161315 --1144 --
NM_007345chr1822183 1752 ------
NM_007350chr122816 29 ------
NM_007358chr111675 ------
NM_007372chr17175 --1862 --
NM_007373chr1021679 183 11552 ----
NM_007375chr13744 285 207 1823 22632 765 --
NM_012084chrX2421 401 ------
NM_012089chr111453 11169 ----
NM_012096chr343708 2290 542 66 11220 ----
NM_012120chr6------1540
NM_012124chr112869 255 ----122
NM_012141chr1364173 3653 3311 1269 996 340 13350 12749 --
NM_012153chr1192206 2081 2029 1937 1907 867 677 569 356 --22599 921 12409
NM_012164chr9107354 5915 5560 5530 5086 4566 2869 1723 622 158 16394 21249 175 1752
NM_012183chr1----1438 --
NM_012193chr1165053 4885 1951 1305 1282 226 --14844 --
NM_012199chr154098 3815 3770 3576 1741 ------
NM_012214chr246098 1698 1467 1301 --11436 15745
NM_012215chr1011902 --21614 1536 --
NM_012223chr231282 1058 103 1894 1488 --
NM_012249chr241191 710 234 169 ------
NM_012252chr761699 1551 1462 1303 1103 191 15072 ----
NM_012262chr155136 1832 1780 1334 316 44772 1823 996 295 ----
NM_012287chr343445 2944 1784 449 54241 4234 3852 814 228 ----
NM_012290chr221181 1062 11448 ----
NM_012294chr733718 1232 216 14012 21619 255 --
NM_012296chr1171587 1161 747 645 338 173 29 23049 837 42674 2636 906 561 --
NM_012301chr751637 1402 1368 888 726 ------
NM_012306chr12163436 3261 3110 2965 2877 2458 1351 1257 992 921 872 793 696 594 381 255 --21433 262 --
NM_012309chr11114324 3910 3777 3730 3440 1372 1282 1162 1138 903 312 ------
NM_012316chr1125194 5143 4820 4655 4383 3905 3657 2214 1846 1294 667 195 --45112 4969 4789 3460 1677
NM_012334chr564669 4117 3782 3231 1136 456 --44251 3197 1445 1422 11007
NM_012396chr15665 199 181 142 123 ----1190
NM_012410chr161358 ------
NM_012412chr71821 ------
NM_012419chr61159 --132 --
NM_012425chr1072396 2229 2154 1672 1096 1080 304 --12365 --
NM_012428chr151198 ------
NM_013231chr1434169 3845 2860 31657 948 875 11525 11470
NM_013233chr211115 ------
NM_013269chr124874 813 715 303 11322 ----
NM_013272chr152262 73 ------
NM_013281chr2011076 ------
NM_013313chr2273438 2460 2386 2354 731 401 335 1114 21193 700 1538
NM_013348chr1961240 1232 1182 1176 1170 140 11206 11043 1500
NM_013372chr1551017 617 543 399 388 12971 ----
NM_013423chrX31283 1032 183 ------
NM_013427chrX31283 1032 183 ------
NM_013437chr81429 ------
NM_013438chr911641 31631 1558 203 ----
NM_013951chr252152 2137 1657 672 471 --62375 2165 1901 1586 606 533 --
NM_013952chr252229 2214 1734 749 548 --62452 2242 1978 1663 683 610 --
NM_013953chr252229 2214 1734 749 548 --62452 2242 1978 1663 683 610 --
NM_013960chr82210 23 ------
NM_013992chr252229 2214 1734 749 548 --62452 2242 1978 1663 683 610 --
NM_013993chr61847 ------
NM_013994chr61847 ------
NM_014048chr16114676 4262 3943 3306 2087 1498 1028 1017 969 417 135 14750 11218 --
NM_014071chr201210 ------
NM_014106chr1512033 1986 ----
NM_014110chr131176 768 214 --2878 468 --
NM_014112chr865194 4995 4313 3594 1190 483 21251 1060 ----
NM_014141chr751984 1880 1569 700 124 11426 ----
NM_014153chr16--1280 ----
NM_014155chr1157534 7400 6811 5235 1536 26569 1231 ----
NM_014243chr411866 ------
NM_014250chr221207 11598 ----
NM_014253chrX41755 1627 947 327 ------
NM_014293chr2283571 3176 2544 1596 1345 1246 709 700 --11463 --
NM_014309chr2285286 5165 4891 4797 4344 1903 1828 1562 14084 ----
NM_014319chr122342 142 ------
NM_014325chr1282039 1958 1680 1554 1414 1395 96 84 ------
NM_014333chr1132147 1121 829 --1132 --
NM_014372chr11429 ----11533
NM_014381chr1432482 2001 135 --52453 2346 2182 2105 241 --
NM_014393chr8171 --12010 --
NM_014415chr31375 11110 ----
NM_014421chr42627 79 21608 1429 ----
NM_014423chr544087 3773 1728 1178 ------
NM_014445chr322075 148 --1768 --
NM_014469chr111710 ------
NM_014504chr762022 1693 1490 841 686 219 ------
NM_014521chr23585 523 323 ------
NM_014574chr1411409 176 --1115
NM_014592chr51285 ------
NM_014607chr242015 1755 581 149 ------
NM_014608chr15--1539 ----
NM_014612chr91447 ----11521
NM_014613chr541207 1171 821 556 21974 217 ----
NM_014615chr1651354 640 583 504 479 --1298 --
NM_014630chr15102876 2758 2619 2530 1566 1035 818 713 508 83 12559 ----
NM_014633chr111446 --1495 --
NM_014636chr973587 3515 2886 747 626 438 33 --1159 --
NM_014640chr21192 ------
NM_014647chr1632021 1696 1563 11410 1556 --
NM_014661chr1063025 1261 954 770 384 24 11406 21129 536 --
NM_014670chr221381 116 --11313 --
NM_014676chr13583 395 285 --1674 --
NM_014690chr772619 2583 2539 1092 796 568 42 --2934 531 13111
NM_014701chr1531085 454 325 ------
NM_014702chr611123 22312 285 ----
NM_014705chr751411 1350 730 574 453 ------
NM_014707chr722216 843 ------
NM_014727chr191230 ------
NM_014731chr2061664 1572 1129 349 305 228 --11310 1558
NM_014732chr16105872 5769 5459 4485 4190 3568 1956 1734 411 329 --11449 --
NM_014735chrX1531 2666 224 ----
NM_014737chr2052802 2745 2700 1571 1204 1978 11649 --
NM_014739chr633984 3958 2628 ------
NM_014747chr1185530 5455 5274 4859 4816 4616 4407 2095 2010 1738 1576 1012 984 937 872 708 657 544 --33900 1006 683 --
NM_014755chr253852 2602 1625 1481 1245 --14094 --
NM_014758chr113933 630 107 --12257 21750 647
NM_014767chr1083244 2632 1379 1346 1107 1097 747 725 12610 1867 --
NM_014776chr1232977 2185 1167 --22411 664 --
NM_014780chr6126 ------
NM_014786chr1151142 925 816 354 321 --21047 366 --
NM_014787chr152243 984 831 717 324 ------
NM_014790chr51136 ------
NM_014812chr121803 1641 11350 ----
NM_014819chr552159 2085 880 799 707 1672 --1558
NM_014820chr3--1481 ----
NM_014827chr121094 661 --1537 --
NM_014839chr13639 267 256 22085 27 ----
NM_014841chr61849 --1360 --
NM_014850chr353941 3713 823 270 104 13005 21138 862 --
NM_014868chr122891 240 ------
NM_014871chr121179 ------
NM_014873chr164747 4715 3119 1783 1171 913 1624 ----
NM_014877chr1767509 6790 6258 2159 1409 941 --16942 --
NM_014890chr3----1112 --
NM_014892chr6--1412 ----
NM_014893chrY2765 708 ------
NM_014903chr125763 752 663 459 136 11769 ----
NM_014909chr14133671 2839 1592 1562 1552 1481 1470 1437 1419 1356 292 113 83 --11189 --
NM_014912chr1052516 1029 847 74 60 ----12920
NM_014920chr662874 1348 1289 1145 818 92 1422 1907 1834
NM_014934chr1333287 2900 1434 13919 21395 560 --
NM_014935chr1103432 3332 3114 2694 2386 1458 1313 1234 703 530 11280 --13698
NM_014953chr1344267 3560 3350 2669 13211 ----
NM_014961chr422049 1931 ------
NM_014962chr2022047 223 ----12405
NM_014965chr371947 1748 913 772 373 319 143 ------
NM_014988chr432108 266 119 ------
NM_014989chr61595 11481 ----
NM_014991chr452612 2343 1323 371 72 12242 ----
NM_014996chr3127 ------
NM_015000chr121234 --1874 --
NM_015008chr32722 368 --33006 2426 1153 --
NM_015009chr34784 617 597 204 ------
NM_015026chr1242964 1447 207 182 11552 ----
NM_015027chr1661819 1731 1656 1598 1399 592 ------
NM_015039chr184137 3876 2987 2667 1043 658 417 339 23860 464 13353 --
NM_015042chr15103922 3352 2941 2765 1711 1017 735 283 138 73 14151 13593 13040
NM_015049chr253068 2269 1268 1226 235 --22678 884 --
NM_015050chr621196 500 ------
NM_015051chr983305 3263 2447 2229 2145 2122 1218 781 12439 13275 --
NM_015054chr121458 ----149
NM_015071chr5115936 5526 4563 4485 3966 2182 1811 1383 1329 1284 689 26098 1190 ----
NM_015076chr664167 3858 3409 3395 3111 574 11022 13271 --
NM_015077chr17114428 4351 4286 3659 3190 2902 1345 1233 1223 740 368 1843 11530 --
NM_015090chr1196140 5447 4560 4471 4285 4183 3924 2346 2079 1995 1942 1877 1778 1541 1179 1022 994 940 690 15064 ----
NM_015092chr1674696 4516 4098 3865 1723 1555 1371 2537 530 11692 --
NM_015093chr62429 107 11265 ----
NM_015094chr2294244 4080 3894 3810 3804 3472 1711 958 811 --34001 3826 109 1987
NM_015097chr3----1759 --
NM_015107chrX42132 2046 563 335 --1512 --
NM_015115chr41300 --1188 --
NM_015125chr191495 ----174
NM_015144chr1644033 3322 3176 990 33581 1315 617 13697 --
NM_015156chr1433579 3348 361 23749 3591 ----
NM_015170chr82757 292 ------
NM_015176chr121768 1508 11545 ----
NM_015178chr8112678 2533 2244 2232 2211 2016 1983 1686 541 362 324 --12385 --
NM_015191chr115979 761 675 269 232 12238 12605 12249
NM_015206chr1563701 2553 2421 1245 139 114 23193 526 ----
NM_015209chr142297 2287 1844 1596 ------
NM_015215chr152042 1980 1028 345 303 --1503 --
NM_015233chr1332587 1738 440 ------
NM_015236chr411291 ------
NM_015252chr21656 ------
NM_015254chr892677 2635 2517 2322 1068 614 566 420 139 --32533 734 231 --
NM_015261chr112486 73 ------
NM_015265chr212170 ------
NM_015271chr422965 535 1128 ----
NM_015291chr153373 2933 2434 1135 340 12896 1664 --
NM_015293chr6----2628 209 --
NM_015296chr1331175 446 298 --1472 --
NM_015299chr1463852 3230 1439 1223 511 331 23840 2483 23709 2963 --
NM_015305chr1431967 1866 1546 ------
NM_015310chr897076 7045 6712 2745 2537 2498 2412 2351 1559 1354 46558 2508 1752 714 --
NM_015313chr1133850 3259 1226 14107 14483 11046
NM_015315chr562987 2689 2287 1373 1071 432 22591 358 33261 629 475 --
NM_015317chr221967 157 ------
NM_015328chr721030 203 1519 --12378
NM_015332chr7103421 1377 1359 952 914 487 460 232 181 38 ------
NM_015338chr2041914 1679 1445 1370 --1334 --
NM_015345chr662700 1863 941 520 241 26 12736 32055 1875 465 --
NM_015347chr1231835 1071 99 ------
NM_015365chrX43249 3070 787 675 1811 14232 --
NM_015375chr1104648 4332 3932 3863 3480 1943 1561 1267 900 292 --54294 3146 1912 869 735 14427
NM_015378chr132290 371 85 --32821 2361 539 --
NM_015385chr1052054 1096 897 754 662 23070 166 1385 --
NM_015396chr311464 1566 ----
NM_015443chr1711289 ------
NM_015446chr12631 126 ------
NM_015455chr543634 3218 2775 2536 1535 ----
NM_015460chr361865 1350 415 141 117 107 1686 ----
NM_015461chr181644 ------
NM_015525chr611039 21018 235 ----
NM_015530chr21710 ------
NM_015532chr151157 11899 21940 824 --
NM_015534chr12310 211 ------
NM_015550chr733163 2785 2662 1313 ----
NM_015554chr1522549 2511 191 ----
NM_015557chr1133600 3464 3022 2571 2534 1433 1395 1203 1126 1111 762 679 673 --13589 --
NM_015569chr134807 1608 210 31685 1263 1032 1822 --
NM_015570chr71377 --11574 --
NM_015571chr622422 1717 --11998 --
NM_015575chr232753 1023 259 --22830 1417 --
NM_015578chr1931437 1301 316 --2403 191 1238
NM_015609chr1102745 2619 2407 2241 2044 2031 1198 1071 689 224 --22871 270 --
NM_015635chr94755 734 420 62 --21423 83 --
NM_015640chr123608 1127 15093 ----
NM_015678chr131282 11266 ----
NM_015680chr21159 ------
NM_015687chr61543 ------
NM_015713chr831349 1118 272 23604 2928 23583 3256 --
NM_015845chr18154 ------
NM_015850chr872183 1573 987 742 568 467 296 21670 426 ----
NM_015879chr1888399 8321 6567 5920 5584 2882 1640 612 25911 3035 15444 --
NM_015885chr11159 ------
NM_015888chr132850 680 492 22760 2316 12601 --
NM_015906chr164644 4232 3899 3575 3159 856 ------
NM_015938chr3--1670 ----
NM_015995chr1575363 5073 4773 4686 4296 1696 832 14005 34305 3764 1294 --
NM_016006chr3--1255 ----
NM_016009chr174330 3793 3355 3031 1103 683 22 13572 34392 3533 3398 --
NM_016021chr632949 2375 1155 12884 12961 --
NM_016045chr2021476 1147 1136 ----
NM_016072chr1212017 11670 1353 1267
NM_016073chr15------146
NM_016078chr1711104 ------
NM_016081chr441892 1672 1513 1497 2895 803 ----
NM_016083chr632935 2587 656 ------
NM_016087chr741475 1454 324 220 11263 ----
NM_016097chr1811021 ------
NM_016121chr11894 ------
NM_016131chr242246 2049 1637 1451 ------
NM_016132chr1543212 2109 462 399 12463 ----
NM_016133chr211452 ------
NM_016206chr398332 7686 7356 7140 5864 3019 2527 2520 1078 17547 12661 13043
NM_016210chr371241 1032 1018 261 241 226 178 --31542 1481 119 --
NM_016257chr1103452 2925 2624 2298 2139 1321 1237 1114 636 410 23145 2281 1647 --
NM_016258chr11525 ------
NM_016260chr297501 7181 4955 2729 2503 2241 1642 1129 148 21237 1223 ----
NM_016269chr41252 ------
NM_016289chr252192 2047 763 314 277 ------
NM_016300chr31512 ------
NM_016306chr3164 --1154 --
NM_016308chr121841 1642 ------
NM_016338chr511101 ------
NM_016396chr1522166 470 ------
NM_016422chr1153170 1250 987 609 303 --11122 --
NM_016424chr173450 356 66 11331 ----
NM_016447chr71179 ------
NM_016470chr203518 484 339 --141 --
NM_016483chr31315 ------
NM_016494chr23174 154 66 ------
NM_016507chr1732746 2584 369 ----11102
NM_016513chr662874 1348 1289 1145 818 92 1422 1907 1834
NM_016530chr1553214 2896 1204 498 38 11534 ----
NM_016531chr433542 3144 720 13245 --13322
NM_016545chr15862 844 375 190 57 ------
NM_016548chr921200 1102 21470 615 ----
NM_016577chr384334 3596 3498 3202 2910 2804 1782 1026 13253 31693 1254 157 --
NM_016605chr592094 1943 1740 1671 1079 974 569 477 76 --1113 --
NM_016607chrX21514 503 11709 ----
NM_016620chr131485 351 208 ------
NM_016834chr1793822 3192 1518 1315 1100 783 542 530 346 11000 23058 948 --
NM_016835chr1793822 3192 1518 1315 1100 783 542 530 346 11000 23058 948 --
NM_016841chr1793822 3192 1518 1315 1100 783 542 530 346 11000 23058 948 --
NM_016929chr654152 2993 2905 1546 165 ------
NM_016931chr112331 108 ------
NM_016937chrX1676 ------
NM_016941chr191326 1444 124 --
NM_017412chr81422 ------
NM_017420chr1423002 1316 1431 ----
NM_017423chr42729 380 ------
NM_017426chr4125 ------
NM_017443chr92395 32 ----1220
NM_017447chr2123960 3079 21249 182 --13670
NM_017455chr151198 ------
NM_017545chr201459 ------
NM_017563chr3105901 5870 5735 4925 4544 4122 2503 2409 1439 697 ----15329
NM_017577chr31455 ------
NM_017590chr2292312 2158 1033 910 787 452 342 203 60 --32406 923 551 11937
NM_017594chr952350 2245 289 269 147 ----12451
NM_017610chr1511792 1311 ----
NM_017612chr121122 ------
NM_017628chr445220 4596 3924 31 --21393 844 --
NM_017629chr121327 259 ------
NM_017632chr41432 ------
NM_017634chr81464 ------
NM_017635chr1121572 254 --11093 --
NM_017637chr988563 8301 8114 7712 6355 5886 5831 484 16172 ----
NM_017643chr1732860 1228 21 --12266 --
NM_017644chr365036 4910 4549 4014 3457 1630 1946 ----
NM_017646chr11267 ------
NM_017650chr725354 1555 --24573 4197 --
NM_017657chr2--1888 ----
NM_017658chr142524 496 44615 1286 953 585 1125 --
NM_017709chr123963 3548 33781 3604 45 ----
NM_017715chr76741 685 556 473 268 239 ------
NM_017736chr1651078 906 874 613 552 ------
NM_017741chr422115 998 22359 764 32109 349 214 12246
NM_017748chr17--1609 1273 --
NM_017754chr674438 4014 2020 1855 1679 1337 72 23132 39 11989 --
NM_017757chr1851151 379 229 112 44 ------
NM_017758chr1761195 1186 1009 253 227 162 ------
NM_017769chr1422424 172 --1664 --
NM_017770chr6--22343 1835 12947 177
NM_017779chr132331 2177 2088 1249 ----
NM_017811chr982923 2660 2431 2325 1227 662 576 496 ------
NM_017826chr131744 ------
NM_017848chrX53646 3536 2952 2902 1450 11761 21404 1164 --
NM_017860chr11651 ------
NM_017864chr8--167 ----
NM_017866chr8----1716 --
NM_017896chr2031093 705 524 --2319 253 --
NM_017902chr1095671 4848 4320 3809 2041 1641 1600 1431 999 11136 1606 12122
NM_017915chr121822 1128 1896 --
NM_017919chr995257 4698 4654 2175 1790 1482 1451 1311 573 25636 4617 15274 --
NM_017933chr22470 119 --1241 --
NM_017946chr731399 419 47 21057 570 11368 --
NM_018030chr1821116 870 --1303 --
NM_018045chr182380 2287 2146 1070 724 677 614 208 22661 529 ----
NM_018084chr21239 2965 321 ----
NM_018098chr31162 ------
NM_018105chr82932 494 ------
NM_018126chr41630 11010 11021 --
NM_018156chr132290 371 85 --32821 2361 539 --
NM_018159chrX21113 1072 --31143 1062 360 --
NM_018177chr41919 1300 21055 33 --
NM_018182chr1731692 1405 549 ------
NM_018195chr1121696 355 --1213 --
NM_018200chr1552292 791 630 521 230 ------
NM_018222chr1131306 576 470 --2237 228 --
NM_018237chr10177 ------
NM_018240chr1--1756 147 1287
NM_018247chr612954 ------
NM_018287chr102543 410 --11251 --
NM_018293chr3----12659 --
NM_018299chr821134 778 1541 ----
NM_018323chr421182 123 ----11304
NM_018330chr1031331 290 142 ----1486
NM_018362chr1124047 215 13843 ----
NM_018364chr123965 876 ------
NM_018368chr6121 ------
NM_018403chr363325 2957 2780 722 462 293 --12926 --
NM_018424chr961853 1660 1613 1301 218 211 --11735 --
NM_018429chr521105 1026 --1439 12154
NM_018439chr1812185 124 ----
NM_018440chr878144 7168 6349 6029 1478 940 435 13412 47127 6318 6180 2641 --
NM_018442chr1--197 ----
NM_018452chr6_random43636 3558 2677 591 --22665 2589 13317
NM_018469chr1711051 11404 ----
NM_018555chr1942138 1440 827 762 ------
NM_018566chr141621 1464 465 358 --2279 51 --
NM_018638chr1245613 4079 2144 549 --11203 --
NM_018640chr1232288 2171 116 ------
NM_018649chr101506 ------
NM_018650chr121473 593 1134 21895 1868 --
NM_018712chr1111095 ------
NM_018890chr71185 --11039 --
NM_018948chr121220 552 --1136 11351
NM_018955chr171130 ------
NM_018999chr1024394 1616 --13739 --
NM_019004chr72575 354 ------
NM_019027chr421595 987 1509 --1329
NM_019072chr533727 419 267 23027 342 ----
NM_019083chr121306 1033 ------
NM_019084chr1022461 445 --11837 --
NM_019089chr182762 2472 2425 2404 1299 1036 514 496 --32977 1195 1163 11320
NM_019091chr221083 365 ------
NM_019095chr201165 ------
NM_019096chr621036 710 ------
NM_019106chr2273233 3103 2215 2154 554 543 519 12741 ----
NM_019114chr932252 1994 550 1685 32470 2407 2307 --
NM_019557chr12792 194 ------
NM_019595chr22260 41 1276 ----
NM_019850chr22800 55 --1235 --
NM_019857chrX41740 1365 543 61 ------
NM_019896chr21296 ------
NM_020122chr285558 5071 4904 4743 3955 3699 1282 252 --34874 4667 3668 --
NM_020123chr1011335 11574 ----
NM_020148chr1822767 2751 ----1789
NM_020177chr533376 1257 254 --12195 --
NM_020182chr20133146 2942 2836 2692 2378 2266 1174 1161 1030 932 441 250 84 --11108 --
NM_020205chr153188 2172 918 656 507 --1324 131
NM_020228chr1131725 1030 731 ------
NM_020239chr121742 146 12135 ----
NM_020245chr644982 4167 850 147 13326 --1739
NM_020309chr193768 278 227 ------
NM_020336chr2083785 3731 3563 3018 2681 2543 2530 298 --12627 --
NM_020337chr443203 2650 1270 165 --11230 --
NM_020341chr2022011 1456 ------
NM_020348chr1042377 2280 1961 447 --32764 2150 476 --
NM_020403chr1311564 ------
NM_020443chr1126121 5563 5545 5062 4405 2676 2443 2335 2272 1498 1178 421 --26315 5085 --
NM_020466chr644775 4483 3379 3045 --2476 340 --
NM_020474chr1831933 716 123 ------
NM_020525chr121195 1482 ----
NM_020640chr332232 2184 674 ------
NM_020647chr811727 1826 22129 122 --
NM_020699chr1105078 4723 4277 3697 3691 3380 1709 1189 1033 594 ------
NM_020717chrX124891 4725 3904 1986 1963 1636 1213 759 552 459 416 375 14627 24860 1913 --
NM_020718chr1686387 6366 5783 2212 1407 1144 843 630 12582 ----
NM_020727chr214735 139 106 29 13791 ----
NM_020728chr772819 2647 2568 1273 948 926 645 --12788 --
NM_020734chr1223069 607 --13232 --
NM_020739chr1553189 1344 1055 957 847 24249 53 ----
NM_020748chr1721516 859 12090 ----
NM_020760chr211499 ------
NM_020762chr124906 355 342 278 ------
NM_020766chrX53883 2814 1669 632 497 14619 --14116
NM_020772chr17106271 5413 5360 2591 2201 2181 1635 1115 682 68 27905 7159 ----
NM_020773chr492530 2474 2322 2303 1986 1752 865 631 180 --11683 --
NM_020778chr1564768 1981 1365 1222 226 100 --44352 4340 767 310 11012
NM_020783chr182629 31 1679 ----
NM_020796chr553016 2509 1132 105 69 --1191 --
NM_020800chr311478 ------
NM_020809chr1141506 822 705 228 --1211 1274
NM_020810chr1442846 2797 1214 313 1164 ----
NM_020819chr611103 ------
NM_020834chr1451822 1744 1212 445 193 ------
NM_020856chr19155 11093 --1205
NM_020870chr442231 2148 1820 302 --11363 --
NM_020918chr1053493 3229 2848 82 31 12323 2975 748 --
NM_020922chrX21517 532 11577 --11555
NM_020947chr1662143 819 804 753 612 54 11935 ----
NM_020948chr123251 828 --13186 --
NM_020956chr19264720 4709 4683 4390 4291 4182 3939 3742 3693 3619 3588 3540 3466 3353 3346 3153 3130 3112 3081 3049 1546 1242 1059 973 811 727 --1868 --
NM_020993chr1292521 2315 2221 2189 1790 908 692 229 40 12041 22620 942 --
NM_021005chr15----11060 --
NM_021012chr1793101 3069 2752 2548 2489 1150 345 267 260 1208 22904 548 --
NM_021020chr8153276 2780 2458 2341 2191 1333 1088 898 625 541 330 272 141 51 45 --12473 --
NM_021033chr1333027 1193 1141 1997 1715 --
NM_021069chr441845 1775 742 596 --21335 338 --
NM_021072chr542308 2133 1062 763 ------
NM_021077chr15158 ------
NM_021090chr22105028 4578 4321 3911 3855 3776 3679 1546 1386 579 --43844 1592 1314 488 13948
NM_021096chr2293118 3006 2523 2441 1215 876 849 771 498 --22407 2181 --
NM_021111chr92899 398 ------
NM_021115chr221135 ------
NM_021120chrX62930 2823 2141 1092 1083 797 --22192 1204 --
NM_021183chrX12373 ----1665
NM_021190chr1--1423 ----
NM_021239chr141459 --11140 --
NM_021249chr1421191 31 ------
NM_021255chr1433742 2909 1290 12882 ----
NM_021629chr374972 3569 3360 3231 1924 1757 636 --11893 --
NM_021647chr474358 3378 1221 635 583 258 230 21085 836 ----
NM_021705chr611334 ------
NM_021728chr141339 ------
NM_021813chr6125665 5068 3968 3694 2183 1872 1796 1618 1600 1554 1453 692 ------
NM_021814chr611369 ------
NM_021911chr534735 1648 1228 --1320 --
NM_021913chr1941600 383 301 278 ------
NM_021940chr621216 397 ------
NM_021961chr1176488 5747 4890 4548 2934 2855 1074 21190 674 26185 2273 --
NM_021964chr332266 2017 792 --15274 12545
NM_021988chr2021407 1121 --1459 --
NM_022037chr22987 702 139 ----
NM_022041chr1631800 1792 493 ----2255 246
NM_022048chr15104279 2445 2390 1943 450 430 403 292 253 204 --15269 --
NM_022114chr1103723 3717 3124 3019 1553 1031 920 798 61 39 --14326 --
NM_022143chr731412 1379 289 1560 ----
NM_022154chr42461 190 ------
NM_022166chr1685655 5436 1326 1264 823 507 146 97 --35333 4841 658 11206
NM_022173chr22987 702 139 ----
NM_022334chr26814 762 706 426 370 314 ------
NM_022366chr1195 ------
NM_022442chr2021407 1121 --1459 --
NM_022459chr1336263 4677 1046 14736 ----
NM_022469chr12936 138 --13234 12111
NM_022496chr124345 147 102 36 ------
NM_022497chr383591 3010 2607 1347 1176 406 287 269 33523 3036 1493 22569 1006 --
NM_022552chr2----21214 166 1367
NM_022650chr5--11003 ----
NM_022652chr121348 1136 ----
NM_022716chr142913 2515 1199 574 11228 ----
NM_022720chr2261723 1522 1344 1129 611 453 --2322 147 --
NM_022755chr9102376 2300 2211 1722 1684 1655 976 630 341 293 --146 --
NM_022758chr683036 2396 2373 2007 1292 1011 366 42 1217 12150 --
NM_022771chr121104 --1373 --
NM_022832chr442478 1807 1762 888 --21994 664 --
NM_022844chr16146 ------
NM_022893chr232148 1243 1231 ------
NM_022897chr551106 779 773 355 54 1826 ----
NM_022898chr1474391 3482 2998 1328 1269 785 126 --1830 --
NM_022965chr421041 582 ------
NM_022977chrX41969 817 539 455 ------
NM_023000chr141536 ----1201
NM_023001chr141536 ----1201
NM_023016chr242352 2125 510 30 --32402 2275 1852 --
NM_023037chr132128 91 --1743 --
NM_023105chr872183 1573 987 742 568 467 296 21670 426 ----
NM_023106chr872183 1573 987 742 568 467 296 21670 426 ----
NM_023110chr872183 1573 987 742 568 467 296 21670 426 ----
NM_023111chr872183 1573 987 742 568 467 296 21670 426 ----
NM_023929chr812294 --179 --
NM_024007chr512644 12532 11170 --
NM_024019chr41212 ------
NM_024102chr11889 --1153 --
NM_024294chr683036 2396 2373 2007 1292 1011 366 42 1217 12150 --
NM_024295chr851816 1400 1297 677 488 ------
NM_024306chr161139 11083 2473 87 --
NM_024345chr976068 5340 5182 1749 1584 1267 1185 14880 11718 --
NM_024408chr173240 2544 950 783 619 189 67 --11440 --
NM_024529chr12326 77 ------
NM_024558chr143839 297 26 ------
NM_024582chr411035 ------
NM_024607chr863215 3074 2999 1159 992 78 --34287 1758 1128 --
NM_024613chr8----1269 --
NM_024639chr642772 2669 1848 1066 --12676 --
NM_024645chr821571 1061 1642 183 --
NM_024659chr21650 ------
NM_024665chr311552 --13291 --
NM_024700chr11974 ------
NM_024713chr1511294 ------
NM_024721chr822308 2032 ------
NM_024744chr2161 ------
NM_024755chr152715 22 ------
NM_024761chr964869 3388 3348 1553 539 122 12044 12004 14243
NM_024769chr1111036 --1290 --
NM_024770chr2105030 4671 2123 1965 1956 1912 1295 980 852 533 15452 36266 4418 2092 --
NM_024817chr15105791 5606 4524 4470 4226 2121 2087 677 630 416 ----12342
NM_024834chr1031232 670 474 --21494 354 --
NM_024857chr171268 ------
NM_024930chr542618 2110 1095 259 ------
NM_024939chr1661235 1179 1079 482 210 122 ----11394
NM_024941chr52511 377 --11392 --
NM_024947chr363634 3249 1917 875 416 250 --18785 19236
NM_024949chr494094 3307 3274 1834 1720 1294 1098 714 466 14805 ----
NM_024960chr201496 ------
NM_024991chr1052054 1096 897 754 662 23070 166 1385 --
NM_025054chr844070 3542 3361 426 13506 ----
NM_025074chr42420 256 ----12800
NM_025133chr211114 ------
NM_025160chr123978 1323 12806 21637 400 --
NM_025164chr11144 --1706 --
NM_025222chr352461 2295 2252 739 37 32691 2122 627 32661 2430 747 --
NM_025238chr1521274 1170 --1411 1373
NM_030569chr1082939 2846 2597 1296 1246 1222 904 717 22185 1083 23073 323 12831
NM_030625chr1021879 191 --1590 --
NM_030627chr521524 638 ------
NM_030634chr152164 2152 555 534 484 ----1627
NM_030637chr14--1287 1263 --
NM_030640chr121844 ----1853
NM_030647chr735613 2337 262 15356 1448 --
NM_030648chr433830 3667 1480 --24569 1527 --
NM_030674chr1254932 4743 4154 3579 2282 24862 1828 14988 --
NM_030885chr322132 1462 1284 --1533
NM_030939chr6--1948 ----
NM_030949chr631300 193 138 ------
NM_030964chr583531 3026 1439 1322 1012 895 550 100 ------
NM_031268chr16124556 4494 4358 4271 3832 1886 1596 1441 1217 952 939 246 15090 2904 717 --
NM_031412chr1221031 109 ------
NM_031417chr19102759 2560 2277 2244 2145 1963 1746 1094 1072 532 --12324 12506
NM_031426chr992608 2538 2300 885 730 621 579 436 247 --2722 294 --
NM_031431chr1361566 1408 1400 1393 391 375 ------
NM_031445chr233106 2719 573 --1358 --
NM_031468chr7207303 6418 6332 6245 6223 6098 5535 5400 3168 2932 2478 2322 2285 2117 1900 1787 1719 455 202 145 --13074 --
NM_031469chr653437 3076 1542 1133 810 11256 11368 --
NM_031844chr154020 3388 2683 1093 647 --2687 554 1704
NM_031845chr223398 334 --13011 1315
NM_031847chr223398 334 --13011 1315
NM_031886chr1992605 2494 2077 1910 1786 1671 73 67 55 --42581 2287 2046 992 --
NM_031892chrX2245 97 ------
NM_031940chr852039 1944 1759 121 29 22459 2085 32427 1913 142 --
NM_032012chr955149 3279 1645 1308 1116 11890 44737 1607 1463 452 --
NM_032042chr55937 797 481 257 25 11068 ----
NM_032047chr342054 1884 1614 220 12199 ----
NM_032102chr1142401 2058 111 95 12619 22571 2193 --
NM_032144chr221149 716 ------
NM_032153chr342739 2400 869 437 --32099 980 794 --
NM_032186chr131485 351 208 ------
NM_032199chr1032724 706 439 1111 ----
NM_032208chr232460 866 330 --1249 --
NM_032214chr2071287 1233 1082 472 234 84 34 ------
NM_032228chr1121160 927 ----1636
NM_032236chr12866 688 ------
NM_032256chr12187 1750 ----
NM_032288chr32743 701 1107 1136 --
NM_032291chr1--1599 ----
NM_032315chr1----1168 --
NM_032369chr121164 ------
NM_032382chr164518 449 174 116 ------
NM_032436chr1311032 ------
NM_032440chr101663 22124 1826 ----
NM_032441chrX126 ------
NM_032446chr543520 2551 892 149 13429 ----
NM_032449chr152256 550 193 179 131 --22656 908 --
NM_032458chrX22186 1364 --1507 1792
NM_032468chr811114 ------
NM_032510chr1842340 696 530 464 --1665 12279
NM_032521chr2043252 2644 2014 1076 22163 1966 --12513
NM_032558chr931327 1076 371 ------
NM_032582chr173764 490 253 11507 1661 --
NM_032638chr391160 1118 981 599 438 295 184 132 79 ------
NM_032664chr821341 1096 --21471 1199 --
NM_032731chr1761503 1493 1333 1069 243 220 ------
NM_032778chr321011 548 12361 ----
NM_032781chr113845 708 21 ------
NM_032810chr101523 ------
NM_032817chr1082939 2846 2597 1296 1246 1222 904 717 22185 1083 23073 323 12831
NM_032822chr241299 278 33 27 ------
NM_032826chr774109 1203 1048 739 525 315 56 --43671 961 923 788 --
NM_032873chr1153753 3478 3127 2764 226 24342 1178 ----
NM_032884chr11104 ------
NM_032889chr121161 ------
NM_032900chr1043812 2823 1114 567 13292 33378 2989 2384 --
NM_032932chr1796353 5012 4527 3902 1750 1490 1426 1112 270 14724 46263 1951 1377 153 --
NM_032968chrX33496 2693 246 --14164 --
NM_032969chrX33496 2693 246 --14164 --
NM_032973chrY23492 246 --14156 --
NM_032983chr763070 2974 1279 1119 622 298 ----1714
NM_033020chr164644 4232 3899 3575 3159 856 ------
NM_033030chr211316 ------
NM_033071chr6----2628 209 --
NM_033082chr121185 ------
NM_033089chr2031194 1121 915 --1998 --
NM_033102chr181369 1035 918 273 263 224 210 29 1901 ----
NM_033102chr181369 1035 918 273 263 224 210 29 1901 ----
NM_033181chr632935 2587 656 ------
NM_033224chr787876 6200 4967 2898 1857 1832 1661 108 --35252 5131 2961 --
NM_033271chr142408 84 ------
NM_033290chrX41355 670 135 43 ------
NM_033326chr112739 340 ------
NM_033360chr1244211 1637 1113 663 ------
NM_033389chr1771757 1580 1568 1562 1428 749 530 --33258 1147 484 --
NM_033402chr81562 ------
NM_033429chr1552289 2203 1168 1132 1044 1137 12563 --
NM_033495chrX1349 2992 862 ----
NM_033551chr562987 2689 2287 1373 1071 432 22591 358 33261 629 475 --
NM_033631chr1103815 3770 3356 2717 2690 2651 1559 1506 1123 1008 11296 12658 13610
NM_033637chr1063687 2905 2651 1617 1115 140 --13401 --
NM_033656chr2155710 5232 4057 4020 1638 35827 2358 918 ----
NM_052832chr81749 32554 2143 487 ----
NM_052840chr1561545 1539 282 263 226 129 --31601 1038 1016 --
NM_052845chr12102833 2755 1253 1055 797 706 598 509 328 107 ------
NM_052864chr422051 407 21850 289 11439 --
NM_052875chr1192181 1697 1673 1582 1576 1548 1494 847 91 --21989 716 --
NM_052879chr1253177 3027 2896 2843 1172 ----12727
NM_052882chr192774 106 --1521 195
NM_052900chr81574 11667 ----
NM_052904chr6--11109 ----
NM_052906chr22144921 4731 4099 3768 3743 3695 3632 3501 3426 3310 3257 3222 1983 1469 --41926 1160 1040 40 24397 1919
NM_052910chr134736 461 36 25 ------
NM_052918chr1083128 3070 2941 2319 821 813 728 571 13609 ----
NM_052927chr531731 626 420 --11443 --
NM_052934chr172122 1961 1798 1652 760 721 613 --1780 --
NM_052978chr1471368 771 738 654 521 460 236 ------
NM_053002chr31766 --1953 --
NM_053016chr967402 4961 4874 3199 2624 1918 27236 6922 16806 --
NM_053023chr1132815 973 753 13213 1489 --
NM_053043chr7125713 5650 4520 4362 4308 4301 2181 1950 1369 949 807 483 --42418 1978 1740 935 --
NM_053056chr1172997 2819 2201 1210 1074 375 43 --11184 --
NM_054027chr572218 2050 1498 870 652 552 137 --22186 843 --
NM_057168chr741475 1454 324 220 11263 ----
NM_057169chr1232977 2185 1167 --22411 664 --
NM_057170chr1232977 2185 1167 --22411 664 --
NM_057749chr82887 489 1244 ----
NM_058172chr441558 1503 1331 26 ------
NM_078473chr852039 1944 1759 121 29 22459 2085 32427 1913 142 --
NM_078487chr933313 825 692 22662 2267 2384 160 --
NM_080491chr1171587 1161 747 645 338 173 29 23049 837 42674 2636 906 561 --
NM_080597chr1821116 870 --1303 --
NM_080617chr202929 847 ------
NM_080626chr121345 1133 ----
NM_080669chr17114979 4292 4282 3842 3826 3349 1653 1539 1357 769 26 --44443 4072 1268 358 --
NM_080676chr2052754 1064 947 477 94 ------
NM_080759chr131837 22502 1724 1684 --
NM_080760chr131837 22502 1724 1684 --
NM_080797chr2083454 3071 2806 2798 2617 275 130 67 12284 ----
NM_080872chr853697 1288 519 323 277 11060 1206 --
NM_130385chr1132629 566 266 ------
NM_130391chr91863 ----23301 2269
NM_130392chr91863 ----23301 2269
NM_130393chr91863 ----23301 2269
NM_130436chr2132200 1050 124 32512 2284 2049 ----
NM_130438chr2132777 2126 701 33089 2861 2626 ----
NM_130811chr202953 202 ------
NM_130846chr122928 65 --1217 --
NM_133170chr20157936 7684 7376 7352 6970 6735 6269 6171 3209 2638 2158 1900 793 442 37 --47706 6727 1854 367 --
NM_133177chr161086 980 893 810 400 297 ------
NM_133178chr161086 980 893 810 400 297 ------
NM_133330chr463284 2055 1199 443 283 68 --12003 --
NM_133331chr463284 2055 1199 443 283 68 --12003 --
NM_133335chr463284 2055 1199 443 283 68 --12003 --
NM_133646chr263995 3828 951 614 571 90 --13964 1746
NM_133650chr6----2628 209 --
NM_134325chr171657 1496 1333 1187 295 256 148 --1315 --
NM_134428chr9182 ------
NM_138316chr1031060 206 67 ------
NM_138333chr922384 2355 2819 91 1880 --
NM_138338chr22103466 2104 1347 1072 819 744 702 662 348 42 ------
NM_138423chr1511543 11595 ----
NM_138426chr711810 --11624 --
NM_138444chr1351568 1522 849 588 530 --1546 --
NM_138459chr663452 3211 2525 1142 355 32 ------
NM_138468chr2105912 5697 5138 4866 4189 2252 2227 1901 1566 773 --56007 3897 2363 1535 1401 21175 601
NM_138555chr152537 419 ------
NM_138558chr131176 768 214 --2878 468 --
NM_138576chr1474391 3482 2998 1328 1269 785 126 --1830 --
NM_138713chr1656600 5722 3082 452 319 15551 --11577
NM_138714chr1656600 5722 3082 452 319 15551 --11577
NM_138730chr61453 ------
NM_138771chr7------1585
NM_138779chr131215 ------
NM_138809chr5112772 2445 2370 2119 2106 1866 1801 1736 825 660 261 --22432 397 --
NM_138811chr711260 ------
NM_138931chr3----2710 430 --
NM_138959chr1106642 5255 4816 4555 4365 2498 2395 2131 1145 846 14251 ----
NM_139035chrX1137 ------
NM_139048chr31896 ------
NM_139076chr411199 --1242 --
NM_139126chr61921 128 ----
NM_139207chr1222064 1698 ------
NM_139242chr15--11543 ----
NM_139283chr1222498 789 ------
NM_139323chr20--11457 1359 --
NM_144571chr456170 4757 2460 1350 180 16952 35956 5903 5238 --
NM_144574chr14--1259 ----
NM_144579chr272808 2465 984 948 613 534 419 ----12503
NM_144609chr1711227 ----11295
NM_144632chr231926 412 158 ------
NM_144633chr331216 451 351 1586 ----
NM_144664chr1122609 2080 12145 ----
NM_144767chr15154354 4251 3974 3838 3438 3121 1750 1399 1326 1177 1142 987 470 323 186 --1678 --
NM_144775chr17204984 4566 4180 4150 4078 3827 3657 3650 3606 3139 1894 1887 1562 939 820 562 531 455 338 330 --34287 1602 1165 13039
NM_144963chr82559 431 ------
NM_144967chrX2105 91 ------
NM_145055chr1823151 758 23830 878 ----
NM_145173chr1992419 2300 2282 1866 1759 1678 997 920 175 --21637 334 --
NM_145206chr1083359 2816 2713 2657 2489 2035 867 236 --12237 --
NM_145251chr1431198 1081 417 ------
NM_145259chr236741 1820 840 1760 ----
NM_145274chr171149 ------
NM_145307chr1032875 1517 417 --11654 --
NM_145320chr733163 2785 2662 1313 ----
NM_145321chr733163 2785 2662 1313 ----
NM_145322chr733163 2785 2662 1313 ----
NM_145686chr262387 2097 1136 859 218 96 --12137 --
NM_145687chr262387 2097 1136 859 218 96 --12137 --
NM_145690chr831969 440 422 ------
NM_145698chr1011423 12205 ----
NM_145808chr731962 522 347 22404 2146 1982 --
NM_145814chr191466 ------
NM_145891chr16----1211 --
NM_145892chr16----1211 --
NM_145893chr16----1333 --
NM_145912chr22104039 3987 3335 1722 1536 1093 722 618 288 190 12989 21674 673 --
NM_147156chr1021412 530 --1444 --
NM_147189chr841767 1640 922 238 --157 --
NM_147223chr242233 2037 1885 629 --1504 --
NM_147233chr242050 1854 1702 446 --1321 --
NM_148955chr15175810 5506 5386 4964 4743 4485 4419 4273 4153 4139 4090 1666 1325 1105 893 885 689 1363 26015 4782 --
NM_148977chr1031060 206 67 ------
NM_148978chr1031060 206 67 ------
NM_152233chr1421191 31 ------
NM_152253chr22134210 4163 4112 2872 2861 2693 1720 1554 950 940 628 472 47 --43959 3543 990 316 --
NM_152261chr1262381 2362 1705 1585 877 675 --1183 --
NM_152265chr121512 1000 ------
NM_152280chr122941 926 12154 13411 --
NM_152283chr541101 798 313 169 ------
NM_152287chr16112158 2067 2038 2026 1998 1940 1000 781 420 371 123 --32322 2290 1672 --
NM_152298chr14682 190 116 110 --1644 --
NM_152309chr1052034 1666 568 504 200 ------
NM_152376chr141985 1455 1345 248 --21779 1497 --
NM_152388chr273462 1376 1246 1180 1012 712 697 11547 ----
NM_152406chr531222 391 273 11369 11627 --
NM_152455chr1522101 30 --11925 11961
NM_152487chr14995 541 193 149 --1331 --
NM_152538chr32505 132 --1467 11625
NM_152594chr151341 ------
NM_152605chr191480 11386 1146 --
NM_152624chr575771 5468 5407 4948 515 246 109 11441 37386 5157 736 --
NM_152629chr941259 1192 586 142 1791 ----
NM_152641chr1242805 2024 1851 979 ------
NM_152654chr1911109 ------
NM_152660chr11909 ------
NM_152667chr2041269 617 374 139 ------
NM_152716chr11191 ------
NM_152721chr18------1140
NM_152722chr1181610 1264 1237 1147 732 582 178 164 ----11678
NM_152724chr1072396 2229 2154 1672 1096 1080 304 --12365 --
NM_152733chr6186365 6124 5995 5951 5794 5560 5412 5314 5238 4597 4540 4485 4441 4353 2537 1609 1327 394 16142 21712 802 11527
NM_152737chr611831 ------
NM_152739chr7------1904
NM_152745chr741034 765 77 57 --1315 --
NM_152753chr631748 774 397 11982 ----
NM_152756chr573315 2934 1674 1167 1161 703 453 ------
NM_152758chr8------12893
NM_152787chrX23903 438 13550 ----
NM_152826chr15175810 5506 5386 4964 4743 4485 4419 4273 4153 4139 4090 1666 1325 1105 893 885 689 1363 26015 4782 --
NM_152835chr112256 ------
NM_152857chr61790 ------
NM_152858chr61790 ------
NM_152903chr1352669 2041 740 569 162 22537 1027 1702 --
NM_152914chr17134327 4067 3933 3891 2943 1726 1548 1230 396 334 258 205 156 --14135 --
NM_152924chr15136370 6138 5423 5380 4825 4804 2753 2731 2333 2144 902 657 351 --15559 --
NM_152996chr121591 265 ----1793
NM_152999chr744437 3450 3194 485 11818 ----
NM_153013chr512087 ------
NM_153020chr61517 11058 ----
NM_153035chr162986 2575 2529 2462 1980 675 1600 23209 3171 --
NM_153050chr22105028 4578 4321 3911 3855 3776 3679 1546 1386 579 --43844 1592 1314 488 13948
NM_153051chr22105028 4578 4321 3911 3855 3776 3679 1546 1386 579 --43844 1592 1314 488 13948
NM_153182chr321011 548 12361 ----
NM_153188chr544404 2106 1305 867 ------
NM_153207chr1241605 709 648 296 ------
NM_153223chr511433 ------
NM_153235chr621852 23 186 1195 --
NM_153260chr1561268 1126 961 461 247 162 --21316 1095 --
NM_153261chr1631437 1349 1012 ------
NM_153365chr422335 2233 1553 --1647
NM_153426chr4184 ------
NM_153427chr4184 ------
NM_153450chr111322 ------
NM_153607chr543139 3071 2382 2250 --11992 --
NM_153619chr1562234 1449 1418 1042 796 306 ------
NM_153640chr201496 ------
NM_153686chr41857 12332 ----
NM_153756chr1111941 1885 1877 1862 1773 1532 1319 655 368 320 231 --2709 327 1473
NM_153759chr2----21214 166 1367
NM_153810chr1054851 4833 3704 1550 1114 13163 ----
NM_153825chr4146 --11374 11730
NM_170662chr31127 --1538 --
NM_170665chr1234111 2910 1566 23386 734 23443 970 --
NM_170706chr184137 3876 2987 2667 1043 658 417 339 23860 464 13353 --
NM_170720chr1961240 1232 1182 1176 1170 140 11206 11043 1500
NM_170774chr2052802 2745 2700 1571 1204 1978 11649 --
NM_172037chr821455 1229 ------
NM_172058chr8----21346 430 --
NM_172059chr8----21346 430 --
NM_172060chr8----21346 430 --
NM_172070chr21859 ------
NM_172071chr167364 4636 1900 1894 1190 305 ------
NM_172103chr642438 2411 2279 1734 --1937 --
NM_172105chr642438 2411 2279 1734 --1937 --
NM_172115chr41143 ------
NM_172127chr41157 ------
NM_172159chr311892 12143 1329 1815
NM_172160chr311892 12143 1329 1815
NM_172164chr14682 190 116 110 --1644 --
NM_172337chr141339 ------
NM_172354chr12112 23 ------
NM_173054chr71960 ------
NM_173083chr121201 933 ------
NM_173177chr23670 619 89 ------
NM_173214chr1656600 5722 3082 452 319 15551 --11577
NM_173463chr454187 3741 3261 1632 101 23040 53 23454 1112 11773
NM_173468chr455504 4826 4784 2330 437 ------
NM_173470chrX32633 2114 980 ------
NM_173519chr812079 ------
NM_173536chr454887 4501 3600 3416 1481 24922 4082 13909 14130
NM_173557chr182506 165 ------
NM_173576chr1022037 1451 ------
NM_173582chr1155856 5137 5041 2167 1563 --55272 1631 1445 1413 1280 --
NM_173589chr113258 180 128 --1214 --
NM_173595chr12125094 4085 4033 4018 3576 3499 3384 2055 1901 848 796 688 ------
NM_173647chr22446 352 ------
NM_173808chr154159 3923 2903 377 22 ------
NM_173825chr362811 2651 2635 2461 2230 720 --11909 --
NM_174909chr51579 ------
NM_174911chr862635 1077 1000 805 717 549 --33789 793 510 --
NM_174916chr1532059 1490 50 --182 --
NM_174934chr1193513 3485 2856 2679 1377 950 643 459 181 1249 23256 2958 --
NM_174938chr91353 128 ----
NM_175039chr91131 ------
NM_175040chr91131 ------
NM_175077chr2081390 1336 1185 575 337 187 137 82 ------
NM_175607chr321274 512 ------
NM_175612chr321274 512 ------
NM_175629chr2----21214 166 1367
NM_175733chr1142137 2034 1690 1639 11763 --21545 601
NM_175736chr12157363 7224 6736 6631 6561 5636 5287 3065 2360 2118 2006 1418 872 132 79 1259 22504 91 --
NM_175748chr1451887 1714 1635 1568 758 --21622 402 --
NM_175852chr192803 2770 2405 2157 999 759 443 364 67 --22759 483 --
NM_175859chrX41740 1365 543 61 ------
NM_175861chr1264395 4067 1711 1567 377 215 24208 546 ----
NM_175866chr131010 598 97 ------
NM_175873chr5--1282 ----
NM_175920chr5--1676 ----
NM_176814chr7127 ------
NM_176871chr893078 3010 2741 1140 861 680 215 208 179 1924 33069 2530 989 --
NM_177452chr1422500 21 --12064 --
NM_177937chr921200 1102 21470 615 ----
NM_177947chrX21514 503 11709 ----
NM_177948chrX21514 503 11709 ----
NM_177974chr1511543 11595 ----
NM_177990chr2022011 1456 ------
NM_177999chr993534 3156 2570 2558 910 855 821 484 217 33695 3169 2316 23095 2963 --
NM_178011chr1022352 874 ------
NM_178151chrX57706 5434 2475 2125 1479 187 47680 2230 792 354 --
NM_178152chrX57706 5434 2475 2125 1479 187 47680 2230 792 354 --
NM_178153chrX57706 5434 2475 2125 1479 187 47680 2230 792 354 --
NM_178154chr142540 191 1109 187 --
NM_178155chr142540 191 1109 187 --
NM_178156chr142540 191 1109 187 --
NM_178157chr142540 191 1109 187 --
NM_178439chr21122 ------
NM_178539chr1231471 1456 30 1678 ----
NM_178554chr3102747 2604 2277 1318 1303 1206 1072 1033 923 426 --32487 176 60 --
NM_178566chr9------11500
NM_178568chr17111588 1580 1491 1456 1405 694 649 436 423 375 108 ------
NM_178578chr2021838 471 12680 --1780
NM_178585chr452612 2343 1323 371 72 12242 ----
NM_178842chr1542225 2175 2076 1918 11683 ----
NM_181308chr14--1259 ----
NM_181358chr123305 2624 --1146 --
NM_181443chr2022047 223 ----12405
NM_181481chr18116580 6440 5487 2753 2658 2409 2195 1860 1705 1454 1175 16697 22282 1194 --
NM_181482chr18116580 6440 5487 2753 2658 2409 2195 1860 1705 1454 1175 16697 22282 1194 --
NM_181483chr18116580 6440 5487 2753 2658 2409 2195 1860 1705 1454 1175 16697 22282 1194 --
NM_181504chr554206 2899 1320 180 66 21327 1057 1428 1792
NM_181523chr554206 2899 1320 180 66 21327 1057 1428 1792
NM_181524chr554206 2899 1320 180 66 21327 1057 1428 1792
NM_181656chr173817 362 154 ------
NM_181659chr2023444 2419 11106 1572 --
NM_181659chr2023444 2419 11106 1572 --
NM_181672chrX61806 1716 1463 1340 453 254 ------
NM_181673chrX61806 1716 1463 1340 453 254 ------
NM_181706chr1112131 1489 1466 --
NM_181782chr62180 167 1416 11486 --
NM_182641chr172759 655 ------
NM_182697chr731649 1213 108 ------
NM_182758chr1573817 3720 3261 3059 2916 2827 678 1659 ----
NM_182765chr101814 1715 ----
NM_182811chr202325 210 ----11020
NM_182830chr1412040 --1482 --
NM_182943chr311144 11186 ----
NM_182961chr6----2628 209 --
NM_182970chr2094132 4069 3926 3803 3293 2845 1495 1271 984 --11225 1853
NM_183004chr1421276 289 11380 ----
NM_183397chr20114937 4909 4738 4276 4132 3941 3910 3726 1925 1918 525 31535 955 25 75032 3949 1887 1752 1332 798 586 --
NM_183398chr52217 165 --11177 --
NM_183399chr52217 165 --11177 --
NM_183400chr52217 165 --11177 --
NM_183401chr52217 165 --11177 --
NM_183422chr13--1210 ----
NM_194247chr273647 3624 3423 3337 2749 1395 452 --23312 3181 --
NM_194259chr161561 ------
NM_194260chr161561 ------
NM_194261chr161561 ------
NM_194278chr14114168 3370 3080 1347 1077 648 626 456 373 209 135 11127 63793 1308 1213 907 359 216 --
NM_194282chr432813 2790 2391 1676 ----
NM_194285chr1182914 2745 2670 2620 2287 1317 860 348 22563 2157 12883 --
NM_194286chr12115725 2493 2373 1949 1867 1822 1716 1338 546 377 286 14071 55973 4952 2334 1423 98 --
NM_194291chr852907 2623 2197 1991 974 --1900 --
NM_194298chr1021532 1443 11750 1297 --
NM_194314chr122132 1712 13457 24841 4439 --
NM_194317chr242765 2550 1921 931 ------
NM_194429chr6--1575 1556 --
NM_197968chr13--1548 ----
NM_197970chr211316 ------
NM_198056chr371943 1876 1360 814 783 601 197 --21639 552 --
NM_198123chr81574 11667 ----
NM_198124chr81574 11667 ----
NM_198189chr2--1890 ----
NM_198243chr152213 54 ------
NM_198256chr232023 1934 1909 ------
NM_198268chr123305 2624 --1146 --
NM_198269chr123305 2624 --1146 --
NM_198270chrX12846 ----13195
NM_198320chr1264081 3794 1494 1324 1271 452 --43762 3623 1463 581 --
NM_198336chr721869 374 ------
NM_198381chr113560 368 78 ------
NM_198391chr2011076 ------
NM_198400chr1512034 ------
NM_198467chr71473 ------
NM_198503chr121860 313 ----11606
NM_198513chr841274 637 227 29 --1547 --
NM_198560chr363657 3407 3066 2767 2530 2524 --1366 12658
NM_198578chr1211504 ------
NM_198715chr135201 4129 1638 ----16189
NM_198793chr323833 914 22980 1346 ----
NM_198794chr141415 11385 ----
NM_198829chr71185 --11039 --
NM_198834chr1772075 1895 1689 618 320 269 87 22127 47 --1446
NM_198836chr1772075 1895 1689 618 320 269 87 22127 47 --1446
NM_198837chr1772075 1895 1689 618 320 269 87 22127 47 --1446
NM_198838chr1772075 1895 1689 618 320 269 87 22127 47 --1446
NM_198839chr1772075 1895 1689 618 320 269 87 22127 47 --1446
NM_198844chr172933 170 1688 ----
NM_198859chr385041 4985 4227 4151 3164 1212 1176 138 21160 145 33813 1792 1346 --
NM_198896chr112864 648 ------
NM_198900chr12157363 7224 6736 6631 6561 5636 5287 3065 2360 2118 2006 1418 872 132 79 1259 22504 91 --
NM_198968chr1333287 2900 1434 13919 21395 560 --
NM_198993chr1741690 1348 661 534 --1645 --
NM_199050chr2173828 3479 3403 2535 2468 1327 337 --22878 175 12780
NM_199054chr1941785 316 246 57 --1155 --
NM_199132chr1962149 629 617 276 264 107 ------
NM_199144chr2021407 1121 --1459 --
NM_199169chr20133146 2942 2836 2692 2378 2266 1174 1161 1030 932 441 250 84 --11108 --
NM_199170chr20133146 2942 2836 2692 2378 2266 1174 1161 1030 932 441 250 84 --11108 --
NM_199171chr20133146 2942 2836 2692 2378 2266 1174 1161 1030 932 441 250 84 --11108 --
NM_199188chr1253177 3027 2896 2843 1172 ----12727
NM_199190chr1253177 3027 2896 2843 1172 ----12727
NM_199203chr2021407 1121 --1459 --
NM_199320chr42295 289 21127 484 21955 1856 --
NM_199320chr42295 289 21127 484 21955 1856 --
NM_199321chr172933 170 1688 ----
NM_199324chr433251 2904 1024 --22326 58 --
NM_199437chr1131725 1030 731 ------
NM_199438chr1131725 1030 731 ------
NM_199439chr1131725 1030 731 ------
NM_199454chr1103723 3717 3124 3019 1553 1031 920 798 61 39 --14326 --
NM_199461chr1062840 2447 2287 1367 378 86 --42416 1087 574 245 --
NM_199462chr1104648 4332 3932 3863 3480 1943 1561 1267 900 292 --54294 3146 1912 869 735 14427
NM_201266chr282545 2301 2169 2156 1124 1117 762 126 12522 12552 --
NM_201269chr131485 351 208 ------
NM_201279chr282545 2301 2169 2156 1124 1117 762 126 12522 12552 --
NM_201348chr193578 3007 2840 1570 1399 1139 949 601 390 --43814 2976 1539 44 --
NM_201432chr17156568 5652 5590 5516 4540 2594 1526 1071 854 759 451 381 348 276 223 --66466 5711 4781 4744 583 406 --
NM_201433chr17156568 5652 5590 5516 4540 2594 1526 1071 854 759 451 381 348 276 223 --66466 5711 4781 4744 583 406 --
NM_201436chr71821 ------
NM_201517chr71821 ------
NM_201567chr331207 657 158 ------
NM_201570chr101806 11689 11902 --
NM_201571chr101806 11689 11902 --
NM_201572chr101806 11689 11902 --
NM_201575chr161358 ------
NM_201590chr101806 11689 11902 --
NM_201593chr101806 11689 11902 --
NM_201596chr101806 11689 11902 --
NM_201597chr101806 11689 11902 --
NM_203327chr2063628 3016 1790 1079 896 333 --1533 --
NM_203342chr143593 3511 915 529 --22727 1198 --
NM_203343chr143593 3511 915 529 --22727 1198 --
NM_203350chr111113 11605 ----
NM_203351chr1732321 2203 95 --22470 844 --
NM_203406chr52419 260 11101 ----
NM_203413chr1721071 146 ----1452
NM_203437chr2--1888 ----
NM_203451chr1312396 ------
NM_203458chr122603 1540 11550 23800 506 11258
NM_203487chr1311564 ------
NM_203499chr17175 --1862 --
NM_205768chr111428 --1619 --
NM_205860chr152941 2824 1074 503 224 ------
NM_206594chr111130 ------
NM_206595chr111130 ------
NM_206853chr653601 3342 2929 1504 776 1372 ----
NM_206854chr674862 4603 4190 2037 635 445 185 21633 1260 ----
NM_206855chr665827 5568 5155 1600 1410 1150 12225 ----
NM_206876chr221151 780 ------
NM_206907chr552763 2650 2582 2114 294 --1105 --
NM_206909chr897076 7045 6712 2745 2537 2498 2412 2351 1559 1354 46558 2508 1752 714 --
NM_206943chr2----2282 99 --
NM_207043chr11140 32217 378 241 1904 --
NM_207044chr11140 32217 378 241 1904 --
NM_207047chr11140 32217 378 241 1904 --
NM_207111chr7102549 2530 2319 1969 1779 984 946 554 498 76 1153 11730 --
NM_207116chr7102549 2530 2319 1969 1779 984 946 554 498 76 1153 11730 --
NM_207303chr1021393 87 13131 --11462
NM_207361chr1344904 3931 434 382 ------
NM_207371chr1021302 354 ------
NM_207380chr15143660 3452 3207 3140 3118 2923 2655 2639 2229 1462 1149 336 265 155 --22626 1330 --
NM_207406chr495553 5260 4977 4896 2410 2128 1245 631 373 11297 22251 1221 11322
NM_207481chr22251 118 11220 ----
NM_207517chr15------11699
NM_207577chr1162497 2251 970 680 208 103 --1748 1694
NM_212467chr1572602 2048 1702 1001 847 618 471 --21032 317 --
NM_213589chr265105 4504 4054 2164 508 379 13418 ----