TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3614-5p
miRNA Sequence: CCACUUGGAUCUGAAGGCUGCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr585361 3741 2067 1866 1606 1162 970 50 15235 43996 3634 1025 110 --
NM_000202chrX63264 3045 2464 1279 427 291 11450 ----
NM_000259chr1564658 4332 4319 2487 1865 1463 1666 24370 4356 14583
NM_000332chr6116836 6300 6122 6039 4815 4740 1737 1369 1230 187 148 1418 --14652
NM_000448chr1172859 2541 2394 1107 795 428 151 ----12674
NM_000480chr1161654 1129 370 328 262 46 ----11246
NM_000618chr1235501 5031 4108 11644 26310 397 --
NM_000618chr1235501 5031 4108 11644 26310 397 --
NM_000809chr478222 3479 3291 2610 1494 1174 286 11026 13265 --
NM_000826chr442456 1905 931 865 22280 911 --1978
NM_000827chr532578 2540 1902 1676 1635 1221
NM_000926chr11139366 8993 7795 7483 7380 7197 7163 7078 6657 3483 3355 1539 743 28723 2186 29303 3118 --
NM_000958chr52409 161 ----11320
NM_001001396chr162813 1115 1063 1031 665 149 --1232 1700
NM_001001419chr544744 1145 706 617 34879 4460 903 14002 --
NM_001001420chr544744 1145 706 617 34879 4460 903 14002 --
NM_001001481chr8113354 3263 3235 2846 1366 1006 872 652 626 295 227 ------
NM_001001557chr81755 --11377 21774 1665
NM_001001664chr284002 3683 3461 660 478 345 149 50 ------
NM_001002860chr1454445 4385 4239 4104 3033 ----13827
NM_001003652chr1848464 7873 7328 6283 28134 5733 --22853 2003
NM_001004419chr1244001 3178 1561 1347 --1568 12864
NM_001005386chr262153 1635 948 735 256 126 ------
NM_001007102chr641640 520 450 190 ----187
NM_001008738chr552844 2709 2229 1942 1925 22037 1902 1564 --
NM_001008925chr463339 3310 3095 2595 2280 2180 1503 ----
NM_001010888chrX124196 4022 3714 3656 1326 1257 688 536 275 260 242 206 2647 512 ----
NM_001010891chr565173 4936 2622 2001 1269 913 25316 2735 26812 61 11454
NM_001010984chr162601 2108 1982 1777 354 91 ----1418
NM_001013620chr1297014 7003 6664 3140 2948 1135 963 537 167 86329 5986 2413 2374 2322 2004 1636 481 17325 --
NM_001014797chr1066825 6344 5556 1756 1062 473 1651 17844 17358
NM_001017440chr796892 6023 5542 5188 2205 1697 1328 559 336 28025 3155 16081 --
NM_001018111chr763189 3059 1160 769 547 472 43627 3015 796 335 159 --
NM_001024680chr241707 1203 649 384 ----1423
NM_001025076chr1065365 4752 4667 2052 1548 1319 25800 4082 11981 --
NM_001025077chr1086723 6110 6025 5116 4901 2906 2677 575 27158 5440 ----
NM_001025233chr1262693 2493 2397 2210 2129 275 32573 985 957 --1380
NM_001025389chr1161654 1129 370 328 262 46 ----11246
NM_001025390chr1161654 1129 370 328 262 46 ----11246
NM_001025580chrX53907 3158 3117 2620 893 21668 1568 --13546
NM_001029858chr662931 2369 2350 1316 728 109 --12500 13030
NM_001037165chr7168727 8088 7728 7596 7558 7104 7071 6965 6354 5797 5424 3304 1758 1629 756 571 17216 27797 1593 --
NM_001039590chrX73953 3557 3074 2846 2826 1619 671 --13767 12620
NM_001039591chrX73953 3557 3074 2846 2826 1619 671 --13767 12620
NM_001039618chr1165603 5266 4318 4086 2046 657 1636 12321 --
NM_001039762chr1052268 958 769 519 472 --11593 1598
NM_001040152chr785157 4726 4670 4602 4271 3445 3412 766 175 --1777
NM_001040157chr462840 2605 2512 2285 607 311 32028 919 785 ----
NM_001040202chr44689 415 398 391 11629 ----
NM_001040429chr1353597 3063 2630 1271 1152 --12520 --
NM_001040441chr184852 4620 4333 4251 3982 3397 1686 1443 --14526 --
NM_001042555chr1254670 4377 1073 322 61 13990 14236 --
NM_001083620chr442454 1903 930 864 22278 910 --1977
NM_001099678chr386350 4685 4582 2562 1479 1375 255 104 11959 --11930
NM_001100108chr1128345 8048 7399 7090 6447 3309 2082 2035 1768 1353 1127 208 --16762 16304
NM_001106chr3179769 9641 9620 9132 8975 8634 8313 8187 8140 8090 8075 7340 6500 3707 3348 2995 1682 28343 3526 38154 2299 1149 --
NM_001146chr861821 1587 862 731 659 118 21872 1525 --161
NM_001167chrX75880 2387 1997 1227 661 648 111 55839 5714 4739 1816 311 1304 --
NM_001204chr257648 4781 3057 1235 1223 ------
NM_001304chr1773675 3006 2912 2599 1513 1407 802 ----13609
NM_001364chr1164582 4158 3937 1464 587 532 --34398 4330 240 --
NM_001609chr1083878 3506 2730 992 754 407 390 77 ------
NM_001616chr263527 3016 2987 2209 889 730 13474 ----
NM_001858chr655061 4619 4136 4019 1709 ----14530
NM_001918chr1118313 7977 7785 7712 7601 7025 6810 3730 3433 3361 754 27136 1389 31931 1485 344 --
NM_001949chr662536 2464 2025 1085 284 255 1265 ----
NM_001969chr1453670 3087 2459 1148 1052 22673 1247 --13357
NM_002025chrX128694 8104 7250 5746 3576 2868 2402 2108 2082 948 860 367 21689 495 18802 --
NM_002092chr4104665 4648 4499 4274 4086 3857 3139 1990 1419 1227 21912 1240 ----
NM_002158chr283295 3235 2474 2423 2339 1390 1218 826 13685 13468 --
NM_002214chr741675 854 727 721 33804 1534 1397 ----
NM_002268chr371879 1637 1494 1341 673 510 213 1224 ----
NM_002310chr584829 4026 1991 1428 1212 653 418 387 21598 427 ----
NM_002356chr642507 2399 945 69 ----12616
NM_002381chr22678 233 ----1726
NM_002547chrX74215 3814 3700 3224 1429 181 46 ----11399
NM_002581chr9105387 4751 3457 2026 1841 1744 1734 1132 1033 177 23504 1506 1496 --
NM_002645chr1142293 589 517 502 1939 12253 --
NM_002655chr875006 4058 3949 3709 3259 866 474 11312 ----
NM_002687chr1421290 975 ----1985
NM_002709chr221264 63 ----13403
NM_002734chr1742287 2065 1605 1541 22150 363 192 --
NM_002837chr1293921 3184 3167 3138 2862 1772 1415 1193 1141 24094 1503 --11733
NM_002886chr343327 1895 1562 469 --14807 24576 4215
NM_003034chr1287090 6757 6448 5188 5046 3079 645 79 16590 ----
NM_003042chr342042 1916 1797 104 ----11848
NM_003112chr753111 2565 2396 2065 78 11240 ----
NM_003199chr1855408 4937 3770 1774 476 13848 14679 --
NM_003298chr3105970 5684 4926 4785 4715 2322 1874 1691 893 659 1879 24420 1316 --
NM_003320chr1193210 2759 1766 1238 1034 889 685 618 592 13404 23899 3626 --
NM_003590chr283905 3628 3182 2470 1447 854 610 347 13918 ----
NM_003861chr1442679 1933 852 606 12787 --1234
NM_004171chr1187981 7730 5946 3639 3157 2323 2065 1911 28724 7749 29638 3207 --
NM_004464chr484293 3892 3169 3069 1097 978 871 846 13836 ----
NM_004586chrX64847 4689 4316 4031 1535 721 14261 --34061 2002 1183
NM_004685chr1332748 2588 2002 11823 --12790
NM_004745chr886412 5893 5853 5607 4972 4847 2597 258 12625 26281 442 --
NM_004748chr1543980 3396 782 242 34154 747 288 ----
NM_004834chr262564 2318 1275 712 266 257 13190 22508 2378 --
NM_004857chr1484772 4659 4295 3908 3406 1603 1153 156 13155 1978 --
NM_004859chr1742953 2789 2094 664 ----11173
NM_004956chr754390 4162 3591 3249 467 --24341 1844 --
NM_004992chrX127425 7409 7151 6663 6605 6082 5756 5301 2713 2193 1656 567 --37674 5993 1176 15731
NM_004992chrX127425 7409 7151 6663 6605 6082 5756 5301 2713 2193 1656 567 --37674 5993 1176 15731
NM_004999chr674343 4139 3017 1440 1025 902 880 ------
NM_005156chr962125 1195 799 699 436 126 13506 ----
NM_005197chr1445100 4391 1565 932 14319 24162 2246 34716 1015 919
NM_005233chr342245 1944 1715 105 1327 1713 --
NM_005339chr493768 3247 3099 2845 1435 1213 1011 854 674 --13528 --
NM_005359chr1836201 2538 2220 25931 2313 15733 15311
NM_005397chr763189 3059 1160 769 547 472 43627 3015 796 335 159 --
NM_005471chr57870 512 479 351 253 115 25 ----1448
NM_005517chr121293 70 ----11374
NM_005520chr5----1241 1747
NM_005669chr5--1631 12007 11576
NM_005722chr262153 1635 948 735 256 126 ------
NM_005840chrX117028 6811 6793 5540 5481 5362 2797 1529 1471 892 148 21840 259 11015 --
NM_005895chr1254141 4058 3734 3000 640 43945 3093 2547 783 21540 1315 23929 1361
NM_005901chr1848464 7873 7328 6283 28134 5733 --22853 2003
NM_005903chr544744 1145 706 617 34879 4460 903 14002 --
NM_005941chr874108 4057 4018 3991 1307 864 596 13859 ----
NM_005955chr185291 4952 2118 1967 1938 1326 1010 223 32077 537 232 1996 --
NM_006095chr474176 3333 2925 2899 548 223 54 12932 ----
NM_006166chr1292503 2412 2035 1999 1646 912 828 587 355 ------
NM_006252chr196825 4926 4624 2613 1561 1534 1069 696 527 ------
NM_006283chr864907 4728 4687 3230 1404 570 --11080 --
NM_006544chr1485379 5275 5047 4975 4712 3860 2275 1410 21965 1160 25670 4531 25286 5156
NM_006561chr1065365 4752 4667 2052 1548 1319 25800 4082 11981 --
NM_006599chr16117968 7869 7317 7074 6881 2981 2945 2826 1914 1544 411 --12306 16331
NM_006654chr1254670 4377 1073 322 61 13990 14236 --
NM_006729chrX54352 4222 4086 4069 100 21529 574 --11157
NM_006731chr965062 4399 3760 1240 315 90 44915 1354 774 490 ----
NM_006924chr1764049 3984 3445 3153 2697 1167 1192 1498 --
NM_007011chr15125814 5764 1736 1676 1426 1236 1035 1011 707 638 549 289 21403 236 22662 1314 11704
NM_007033chr172097 1666 1530 478 388 290 213 --21594 313 1852
NM_007038chr2175687 5674 5198 2082 1501 1313 1252 13876 ----
NM_007050chr20107358 7102 6975 6856 6690 5663 5472 1821 1309 350 --37525 7154 2739 --
NM_007172chr223384 167 34 --1548 2899 277
NM_007249chr1379223 9047 7477 6327 6283 3497 2053 46738 2722 2367 1378 11437 13571
NM_007347chr1592866 2678 2318 2175 1219 926 507 359 116 23139 2463 ----
NM_012164chr987290 5994 5907 5316 4844 2505 2330 823 46494 2306 1833 1226 ----
NM_012250chr1161386 1332 1189 1181 1011 268 --11304 --
NM_012334chr594570 4051 3980 3113 2907 1734 1288 1163 578 --14212 --
NM_013269chr1243928 3105 1488 1274 --1495 12791
NM_013302chr16114700 4122 4089 4046 3954 3801 3422 785 565 413 108 44385 3437 524 389 ----
NM_013372chr1543326 2265 2249 953 23135 2674 --1793
NM_014048chr1674659 4608 4173 3700 1767 705 154 24030 3528 ----
NM_014112chr874936 4512 4119 3441 1957 1829 804 ------
NM_014155chr1186987 6952 6068 5826 2826 2786 2033 1308 16433 17180 11484
NM_014372chr152095 1868 1760 820 613 129 ----
NM_014423chr585631 5344 4476 4437 4421 4238 3932 1770 14248 ----
NM_014636chr974289 3350 3248 3118 2774 1148 514 --1413 11750
NM_014721chr6117257 7073 6768 6098 5191 4597 2784 2735 2347 1435 1161 --27044 1860 --
NM_014730chr1265017 4996 4712 3778 1337 834 14385 11426 11137
NM_014730chr1265017 4996 4712 3778 1337 834 14385 11426 11137
NM_014840chr1242882 1273 529 136 12676 12914 22866 2211
NM_014877chr1746334 6027 2869 2152 16003 15821 12913
NM_014923chr1341858 883 860 499 --11629 1378
NM_014946chr262453 2398 985 537 244 93 1455 ----
NM_014982chr1433345 1561 1052 --11084 13408
NM_015035chr2095626 5237 4477 4304 4239 2620 2393 917 469 21923 595 26383 4512 --
NM_015056chr2162665 2522 2300 2176 842 423 --12314 --
NM_015076chr663872 3347 2860 2828 1029 782 12836 --13266
NM_015156chr1453452 3444 3179 2630 919 13419 23697 646 1487
NM_015265chr242332 2299 2130 396 ----22631 2351
NM_015271chr464077 3460 3090 2797 2751 1023 --13625 --
NM_015278chr673140 3078 2980 2701 2342 1380 1348 11356 ----
NM_015310chr888167 7495 6038 5420 2921 1868 1469 1160 28192 6698 27243 1651 --
NM_015365chrX53907 3158 3117 2620 893 21668 1568 --13546
NM_015564chr543207 1214 1078 180 12259 1117 1672
NM_015635chr952215 763 277 267 228 11603 ----
NM_015852chr753545 2268 560 476 56 --32676 591 507 --
NM_015879chr18108566 7742 7703 7379 7100 7007 3137 2672 1803 1450 --22616 1105 22055 1114
NM_015906chr174277 4253 3877 3167 3077 478 86 --11245 --
NM_016018chr841124 1093 775 279 --176 1718
NM_016072chr1242280 2261 724 666 1191 --1586
NM_016076chr143116 2248 1260 882 12019 2868 627 12432
NM_016083chr631296 1154 973 1224 --12642
NM_016206chr388427 8147 8086 5487 2952 1958 1029 280 12448 16843 --
NM_016255chr652803 1050 795 683 197 32887 540 125 ----
NM_016260chr2117600 6244 6111 6017 5793 5339 5225 3042 2777 1817 1615 15308 17160 11602
NM_016418chr22103756 3174 2953 2466 1460 1216 1202 969 611 31 23063 67 33588 1379 39 --
NM_016530chr1544005 3272 2699 762 13244 1147 14100
NM_016575chr1274743 4257 1932 1581 1526 1375 750 1593 14021 1501
NM_017412chr821202 110 ----1472
NM_017447chr2154293 4019 3797 3581 2911 --13391 --
NM_017637chr997182 6474 6386 3133 2384 1856 1771 1110 899 28387 6903 17689 18688
NM_017658chr1484290 4241 3913 3207 1630 1333 763 298 34310 3306 1872 13789 --
NM_017719chr311564 12094 --12425
NM_017761chr151472 571 226 216 191 ------
NM_017769chr1473177 3113 3009 2980 2800 1995 996 ------
NM_017919chr964383 3938 1738 1670 652 121 15035 1380 --
NM_018036chr1464339 3413 3396 2862 638 246 ------
NM_018084chr222071 325 --2412 310 136
NM_018191chr1371865 1820 1389 810 667 461 211 21835 1551 ----
NM_018247chr673040 2738 2586 2507 1997 941 844 22385 783 ----
NM_018299chr8113354 3263 3235 2846 1366 1006 872 652 626 295 227 ------
NM_018361chr842799 2568 870 788 32757 2529 1564 ----
NM_018370chr1221428 227 21504 753 21701 729 1616
NM_018374chr744791 4483 3948 1294 14301 34736 1425 1324 --
NM_018403chr384138 3569 3402 2826 2700 797 611 443 22711 536 13651 1150
NM_019008chr2283566 3459 3265 3163 3067 2438 1480 517 21168 946 ----
NM_019072chr554103 3569 1449 908 507 21592 1425 --14022
NM_019084chr1042495 499 360 238 ----1678
NM_019555chr351741 1582 1345 1243 1219 11603 1226 --
NM_020116chr431508 649 88 ----1155
NM_020228chr1152550 1935 1641 368 324 11982 1940 --
NM_020243chr223789 660 51 ----1769
NM_020390chr374125 1820 1236 1059 1042 1010 66 11155 --14117
NM_020651chr211824 ----148
NM_020673chr20107110 6055 5635 4977 2988 2912 1223 953 836 461 25271 3042 17534 --
NM_020739chr1543980 3396 782 242 34154 747 288 ----
NM_020772chr17158669 8333 8098 8023 7837 7760 7168 6893 6744 5400 5243 3270 1835 335 297 1310 ----
NM_020778chr1544437 3943 3550 3176 23561 1805 44371 3740 3725 258 1798
NM_020782chr1254741 3599 3152 3068 39 1398 --13226
NM_020871chrX21873 240 11782 22170 24 --
NM_020935chr2114452 4321 4201 4194 3752 3668 3603 3231 1794 1271 499 ------
NM_020956chr19174433 4406 4076 3809 3801 3766 3670 3607 3281 3266 3251 3011 2996 1080 957 907 692 --54213 4084 2899 1090 518 13776
NM_021061chr883839 3368 3157 3008 1560 1528 762 730 21671 873 31153 558 537 --
NM_021813chr685514 5421 5319 5211 4222 4088 1260 920 1989 34956 1160 741 15622
NM_021961chr11107386 7334 6426 5941 5564 2990 1619 1555 1486 305 15732 37171 2779 2030 --
NM_022048chr1566409 5945 5110 4793 2456 695 55496 5489 5196 4787 4441 22407 504 --
NM_022166chr1696296 5799 4240 1238 778 734 422 369 255 --14496 --
NM_022351chr82751 45 13194 33612 126 34 --
NM_022459chr1376311 4379 2538 2043 1964 1435 191 --25781 5505 --
NM_022491chr1252559 2458 1027 924 809 63546 3331 3167 2480 1306 714 ----
NM_022818chr1631649 298 274 --11044 1181
NM_022898chr1474827 4810 4374 3660 1290 709 653 11927 --13318
NM_024345chr955256 4982 4682 1462 185 --21113 1010 --
NM_024665chr353575 1752 1731 1576 1444 13546 1213 --
NM_024761chr984458 3925 3919 3288 3259 1822 1714 428 24190 3528 ----
NM_024989chr2107840 6443 6382 6216 6134 5867 2553 2301 1961 1735 12277 12270 --
NM_025054chr854203 3476 2587 1542 147 --23712 899 --
NM_025191chr153382 2823 2705 691 443 --1497 1489
NM_030627chr593775 3391 2850 2775 2705 2626 1356 1231 41 ------
NM_030647chr785109 4925 4862 2386 2379 1498 991 685 26156 1466 14468 15344
NM_030674chr1285116 4561 4055 3836 2062 2046 668 46 15751 11492 --
NM_030806chr199115 8313 8278 7549 7497 6498 2680 1853 269 28575 2474 18142 11902
NM_031468chr796892 6023 5542 5188 2205 1697 1328 559 336 28025 3155 16081 --
NM_031469chr693716 3682 2870 758 651 416 296 268 192 1639 ----
NM_032012chr974823 4768 4381 3970 3866 2007 800 15142 1777 --
NM_032221chr2041942 1368 302 190 ----1517
NM_032373chr1055889 5642 3944 3821 804 25094 2009 35349 4029 185 12316
NM_032438chr641640 520 450 190 ----187
NM_032445chr1562097 1990 1915 1845 1773 948 --1150 1632
NM_032458chrX73006 2560 2360 1149 1040 781 222 ------
NM_033020chr174277 4253 3877 3167 3077 478 86 --11245 --
NM_033143chr494624 4223 3500 3400 1428 1309 1202 1177 317 14167 ----
NM_033181chr631296 1154 973 1224 --12642
NM_033224chr786717 6023 5726 5455 2850 1532 359 195 16829 17468 --
NM_033285chr854086 4064 3812 680 321 31650 874 489 1967 11103
NM_033656chr2175692 4624 4320 2390 2281 333 198 --24915 599 --
NM_053016chr997605 7469 7020 5660 5162 4917 1959 1887 1227 12384 12989 --
NM_080867chr1464907 3685 3654 1500 1002 581 13796 1211 14069
NM_130847chr1185103 4871 4743 4124 2361 1621 1541 1237 24595 3970 13898 --
NM_133170chr20107358 7102 6975 6856 6690 5663 5472 1821 1309 350 --37525 7154 2739 --
NM_133334chr475426 4712 4680 3995 3925 255 34 35963 4916 1740 36361 2450 760 15997
NM_133372chr552844 2709 2229 1942 1925 22037 1902 1564 --
NM_133445chr953247 1423 1231 1080 130 --23038 298 23104 1411
NM_133646chr255527 4945 4191 1202 1044 11956 1777 --
NM_138444chr1353760 3366 3346 1476 1146 23259 1714 ----
NM_138468chr252077 1868 1672 1158 783 --22324 1293 --
NM_138473chr1295034 4827 4768 4391 4380 4213 3428 1818 1173 13706 ----
NM_138576chr1474827 4810 4374 3660 1290 709 653 11927 --13318
NM_138713chr16117968 7869 7317 7074 6881 2981 2945 2826 1914 1544 411 --12306 16331
NM_138714chr16117968 7869 7317 7074 6881 2981 2945 2826 1914 1544 411 --12306 16331
NM_138782chr552075 1758 617 526 451 1583 ----
NM_139279chr273477 3106 2720 2425 951 938 558 12865 32587 1076 201 --
NM_144571chr456104 4833 4645 2014 734 15577 --15177
NM_144578chr14124449 4207 4094 3938 3838 3380 1802 1337 1301 1218 1083 371 14553 ----
NM_145176chr653185 3022 2319 2166 389 11221 --1208
NM_145259chr266174 5719 5524 4938 4616 124 1545 ----
NM_145307chr1044010 3938 3865 3164 21051 197 12834 --
NM_145686chr262564 2318 1275 712 266 257 13190 22508 2378 --
NM_145687chr262564 2318 1275 712 266 257 13190 22508 2378 --
NM_145735chr1372088 1882 895 845 565 451 432 --1376 --
NM_152263chr196021 5404 4886 2259 1936 1585 1326 1012 462 35659 2370 794 ----
NM_152352chr1862792 2600 2485 1999 1211 1179 22751 1187 ----
NM_152424chrX103717 3422 3395 1758 1355 1270 694 524 313 193 --14534 13739
NM_152624chr596755 6036 5168 4781 1899 1024 327 319 87 46894 6405 2405 465 ----
NM_152734chr6125409 5274 4568 4491 4463 3980 3337 2099 2053 1828 195 47 23856 1395 44710 1153 833 412 --
NM_152758chr842772 2449 1078 484 32654 2180 2130 --11041
NM_152793chr7114723 4639 3316 1802 1792 1659 1638 851 582 506 439 31855 450 374 13568 --
NM_152924chr15125814 5764 1736 1676 1426 1236 1035 1011 707 638 549 289 21403 236 22662 1314 11704
NM_153262chr162917 2855 2373 1953 700 73 1336 1596 --
NM_153365chr462380 2295 2251 1968 1010 48 12108 32648 2393 940 --
NM_153499chr1273055 2971 2869 2721 964 731 96 --22785 1210 1441
NM_153500chr1273055 2971 2869 2721 964 731 96 --22785 1210 1441
NM_153607chr553159 2187 953 316 136 33135 2350 147 ----
NM_153645chr223384 167 34 --1548 2899 277
NM_171998chrX62318 2302 2284 1817 572 304 11866 --1113
NM_172226chr1273055 2971 2869 2721 964 731 96 --22785 1210 1441
NM_172240chr1241360 1260 1238 955 --21323 1282 --
NM_173214chr16117968 7869 7317 7074 6881 2981 2945 2826 1914 1544 411 --12306 16331
NM_173468chr4105834 5807 5704 4049 3743 2151 2015 1734 956 382 13702 ----
NM_173470chrX32502 2442 1044 1888 --12385
NM_173495chrX2908 303 --11961 22079 644
NM_173519chr841874 436 395 384 12003 ----
NM_173582chr1166099 5148 2523 1290 592 110 24897 831 15900 15935
NM_173642chr188661 8623 7241 7218 6700 5834 5677 1845 27948 2613 47501 2424 1148 423 12117
NM_173808chr173261 3094 2992 1762 1092 734 711 ------
NM_175736chr1286967 6473 5628 5389 4923 2309 2244 2151 47053 6510 5163 2493 ----
NM_177538chr2198421 8395 8321 7797 7569 7439 7418 6660 6189 5881 3557 3426 3071 2349 2300 2152 1574 1555 436 66564 6336 3494 3179 3000 1780 37889 7822 3136 --
NM_177972chr1193210 2759 1766 1238 1034 889 685 618 592 13404 23899 3626 --
NM_178140chr552721 2674 1989 985 858 --1998 --
NM_178509chr1773440 3356 2765 2527 1108 914 682 14003 --14089
NM_181521chr16147044 6895 6803 6790 5059 4407 2074 2016 2000 1414 851 429 234 54 24880 4567 26349 147 --
NM_181828chr22103756 3174 2953 2466 1460 1216 1202 969 611 31 23063 67 33588 1379 39 --
NM_181829chr22103756 3174 2953 2466 1460 1216 1202 969 611 31 23063 67 33588 1379 39 --
NM_181830chr22103756 3174 2953 2466 1460 1216 1202 969 611 31 23063 67 33588 1379 39 --
NM_181832chr22103771 3189 2968 2481 1475 1231 1217 984 626 46 33078 2329 82 33603 1394 54 --
NM_182493chr1695111 5045 4895 4862 3830 3715 3283 420 265 34870 4005 2152 ----
NM_182503chr674946 4544 4392 3409 584 310 293 --14442 22154 27
NM_182972chr132632 1817 494 --1451 1942
NM_183004chr1453670 3087 2459 1148 1052 22673 1247 --13357
NM_194071chr7125370 4832 4758 4681 3673 3410 3388 2109 1791 1410 807 595 13820 14925 --
NM_198581chr2147488 7193 7134 7024 6532 6503 5277 5228 4963 4931 1245 1211 672 475 45701 5373 4939 1520 11563 15073
NM_198900chr1286967 6473 5628 5389 4923 2309 2244 2151 47053 6510 5163 2493 ----
NM_199050chr2193815 3408 3218 3211 3082 973 695 671 379 1307 1910 --
NM_199421chr1464907 3685 3654 1500 1002 581 13796 1211 14069
NM_199436chr262453 2398 985 537 244 93 1455 ----
NM_199437chr1152550 1935 1641 368 324 11982 1940 --
NM_199438chr1152550 1935 1641 368 324 11982 1940 --
NM_199439chr1152550 1935 1641 368 324 11982 1940 --
NM_206853chr663974 3961 3737 3574 3566 1341 1345 1229 --
NM_206854chr6115235 5222 4998 4835 4827 3389 1191 1049 937 336 282 11606 11490 --
NM_206855chr6136200 6187 5963 5800 5792 4354 3942 2156 2014 1902 1301 1247 647 --12455 1389
NM_206876chr221264 63 ----13403
NM_206909chr888167 7495 6038 5420 2921 1868 1469 1160 28192 6698 27243 1651 --
NM_207361chr1386159 6020 5756 5492 3866 2459 338 35 25715 5252 26312 6002 --
NM_212471chr1742287 2065 1605 1541 22150 363 192 --
NM_212472chr1742287 2065 1605 1541 22150 363 192 --
NM_212558chr953658 2918 1532 866 640 23048 1369 1785 --
NM_213589chr2105478 5213 4248 3756 3444 1896 1329 1144 390 78 14128 15008 13398