TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3618
miRNA Sequence: UGUCUACAUUAAUGAAAAGAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000217chr1284131 3862 3835 2137 1684 1587 632 114 15014 13256 199
NM_000337chr586475 6368 4169 2250 1857 1555 1266 566 --11657 25621 5286
NM_000461chr343260 1648 1565 237 24626 1444 12855 13786
NM_000806chr521499 662 ----31951 1205 341
NM_001001323chr1242699 2350 1147 537 --1423 2919 752
NM_001001331chr321050 559 1676 --1818
NM_001001668chr1932772 1301 878 23119 2869 11133 1156
NM_001003674chr1896403 6357 5682 5653 4656 2121 1732 658 459 ----24799 1966
NM_001003675chr1896403 6357 5682 5653 4656 2121 1732 658 459 ----24799 1966
NM_001008408chr775858 5040 2162 1626 1217 1093 45 12091 34920 4082 501 1291
NM_001012968chrX62610 2282 1860 1129 1012 30 12271 1476 1752
NM_001013659chr1995306 5278 5054 4813 4731 1682 1489 345 29 24863 4791 ----
NM_001014797chr10157672 7366 6783 6715 6530 6437 6417 5685 5290 5237 5183 5097 1898 1042 902 46493 1844 1778 264 --11599
NM_001030055chr1434132 933 863 ----24145 454
NM_001037132chr742049 1830 1799 637 --11562 21526 471
NM_001037133chr742049 1830 1799 637 --11562 21526 471
NM_001039547chr344943 1794 1185 475 --16940 25195 1627
NM_001039585chr123130 149 1469 --23914 2818
NM_001039840chrX65904 5427 4335 784 756 693 --23802 61 11395
NM_001042599chr256863 5228 5212 2860 1216 16321 --37289 6590 6259
NM_001106chr3149255 9111 8116 7706 6656 6561 6226 6196 6096 5978 3423 1663 764 268 21781 1185 18016 13599
NM_001173chr1434132 933 863 ----24145 454
NM_001417chr1231602 1404 475 21564 1421 11895 11702
NM_001663chr14--22247 777 32684 1900 432 1951
NM_001682chr1242413 2064 861 251 --1137 2633 466
NM_001683chr321050 559 1676 --1818
NM_002092chr453347 1650 1123 756 162 --24851 3099 14098
NM_002137chr751702 902 465 307 219 12178 --22390 670
NM_002737chr1776526 5531 2131 1157 341 240 130 26034 4589 16190 11480
NM_002977chr22286 217 --22459 622 22793 1371
NM_003108chr2117035 6860 6220 6170 5777 5585 5154 4608 4460 1332 1218 15202 --15033
NM_003199chr1875331 5275 4435 4246 3728 2241 316 --34094 1961 1365 1969
NM_003468chr212743 13612 --34343 4018 1749
NM_003615chr363887 1376 899 760 552 268 --33299 1007 499 --
NM_004171chr11159679 8831 8444 8082 7476 7115 6143 5924 3725 3454 3161 2745 1867 1556 318 39184 8175 1386 29552 7038 1760
NM_004338chr1896403 6357 5682 5653 4656 2121 1732 658 459 ----24799 1966
NM_004501chr152642 1591 683 641 74 --13171 13147
NM_004866chr585011 4680 3984 3893 3707 1981 1806 659 1519 ----
NM_005010chr742049 1830 1799 637 --11562 21526 471
NM_005188chr1158064 2285 2018 988 252 35365 1872 749 36882 6199 3216 --
NM_005235chr256863 5228 5212 2860 1216 16321 --37289 6590 6259
NM_005596chr985975 5936 5826 5774 1870 1266 798 330 ----13971
NM_005840chrX107457 7334 7126 6598 6113 5180 1699 1534 1520 425 11493 --15589
NM_006095chr444302 3867 880 110 13827 --12780
NM_006544chr1435200 4965 246 25932 4186 --1638
NM_006717chr941252 881 501 31 --12979 23291 57
NM_006729chrX55563 4128 3500 1910 1428 14391 --11466
NM_006924chr1794123 3288 3106 3088 1754 1576 1476 413 25 ----2954 367
NM_007114chr332921 2873 113 --33096 2772 66 1332
NM_007175chr862914 2744 1124 942 906 328 13343 13326 12667
NM_012214chr255964 5658 4867 4457 492 13894 1838 25991 116
NM_012262chr135172 1809 558 1155 1891 13464
NM_012287chr344415 4058 3880 647 1106 23359 884 24009 240
NM_013255chr798824 8424 6962 6571 5398 3116 1817 1222 1019 47077 2658 722 600 ----
NM_013943chr162945 2369 2246 2034 671 79 12425 22645 1039 22886 606
NM_015310chr878052 7762 6724 6134 5941 5837 1368 23065 797 16542 18187
NM_015906chr144777 3331 2929 1639 --13181 24435 4342
NM_015986chr1711414 ----21458 175
NM_016083chr62983 506 --12434 23012 1511
NM_016953chr234237 2026 1062 21947 1731 16019 21111 301
NM_017628chr475253 4768 4563 4107 3837 3528 1935 14665 21445 817 --
NM_018243chr453690 3210 1407 670 490 21080 503 13798 --
NM_018440chr858067 6033 6025 1881 61 ----27806 947
NM_020116chr461795 1631 1601 1310 1247 407 ----11812
NM_020673chr2087484 5579 5490 2312 1788 1483 465 383 17645 --26286 5385
NM_020766chrX34077 3939 344 11728 21431 1394 2545 430
NM_020772chr1777897 7172 3429 1854 1517 1111 909 --38648 7821 3402 --
NM_020782chr1254669 3200 1833 1468 1381 13607 2996 285 1723
NM_020843chr15------2160 122
NM_021116chr7108917 8798 8323 7637 6019 3195 2229 2010 1862 1251 32665 1316 1234 21537 1380 --
NM_021229chr121465 --11204 2924 836
NM_021961chr11127002 6965 6429 6072 5957 5695 5394 5060 4613 4529 1200 1133 37443 5344 849 26648 1319 --
NM_022114chr154721 4665 4594 3333 305 11889 14460 21859 640
NM_022458chr72398 74 ----2484 262
NM_024947chr357811 6127 1889 1834 1462 13182 29600 2319 28659 2995
NM_024989chr298101 8055 7007 6987 6942 5899 1518 329 195 11006 37363 5162 1293 11493
NM_031243chr751702 902 465 307 219 12178 --22390 670
NM_031427chr1475614 5305 4444 3993 2399 1101 1020 12049 2758 297 14013
NM_031844chr152642 1591 683 641 74 --13171 13147
NM_032160chr1873134 1578 1250 1171 704 261 56 ----13200
NM_032373chr10----21016 84 25707 602
NM_033020chr144777 3331 2929 1639 --13181 24435 4342
NM_033181chr62983 506 --12434 23012 1511
NM_052907chr1231228 326 108 1386 23534 3462 11491
NM_053016chr9127736 6306 6025 2301 1594 1586 1124 652 619 500 428 58 16949 ----
NM_053043chr775858 5040 2162 1626 1217 1093 45 12091 34920 4082 501 1291
NM_080647chr22------5423 414 405 395 362
NM_080867chr1424432 237 25005 330 24306 1875 11355
NM_133334chr466346 5919 5817 5298 4274 373 --25928 248 1478
NM_138444chr1323439 897 --13395 23309 1537
NM_144571chr456566 4397 4339 2375 71 ----37020 4454 2098
NM_145799chrX----23055 913 22783 60
NM_152624chr5126759 5859 5315 5089 4519 2620 2105 1932 1386 1367 817 802 16677 --15442
NM_152857chr6------2759 289
NM_152858chr6------2759 289
NM_173468chr455518 4124 3967 582 47 14984 1760 12120
NM_173582chr11116278 5800 4728 4266 2192 2131 1203 1160 1023 810 403 --25879 2257 23825 2108
NM_173642chr1108519 7413 6647 3638 3406 2482 1178 985 941 579 ----11136
NM_181481chr1896403 6357 5682 5653 4656 2121 1732 658 459 ----24799 1966
NM_181482chr1896403 6357 5682 5653 4656 2121 1732 658 459 ----24799 1966
NM_181483chr1896403 6357 5682 5653 4656 2121 1732 658 459 ----24799 1966
NM_182515chr1966206 6002 2492 1195 837 554 --14442 11184
NM_199421chr1424432 237 25005 330 24306 1875 11355
NM_199454chr154721 4665 4594 3333 305 11889 14460 21859 640
NM_203463chr234701 1854 712 ----44667 3796 286 195
NM_206909chr878052 7762 6724 6134 5941 5837 1368 23065 797 16542 18187
NM_213589chr275157 4311 3968 3565 1985 452 343 25148 2169 15122 11002