TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3619-3p
miRNA Sequence: GGGACCAUCCUGCCUGCUGUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr53580 201 175 --1487 1547
NM_000092chr244529 4053 154 114 ----14578
NM_000208chr1984434 4039 3347 1529 1160 1100 611 492 21810 1270 11264 --
NM_000259chr1522308 1706 35479 1569 500 --11752
NM_000297chr431809 785 563 ----1171
NM_000332chr686376 5320 4609 2730 2695 2658 1707 1161 --17045 16020
NM_000461chr354275 1758 743 610 232 1306 1521 --
NM_000899chr1251702 1370 666 657 418 --1934 --
NM_000959chr163981 3911 1419 515 490 365 --23818 3397 --
NM_001001396chr164165 3590 3576 3390 3245 1108 23972 3206 14330 --
NM_001001481chr843318 2317 1203 767 1177 12926 --
NM_001001928chr2288347 8145 6508 5931 5113 2825 2582 1452 36377 3237 2562 1259 --
NM_001009899chr376485 5564 5491 5254 2189 1234 892 --34076 2519 1543 --
NM_001009909chr1122594 253 1417 --21578 1477
NM_001010888chrX44381 3561 1316 626 --13143 13692
NM_001011666chr774945 2339 2163 2124 1554 910 294 1586 ----
NM_001018065chr965757 4765 4655 1326 305 90 --15565 11315
NM_001018066chr965757 4765 4655 1326 305 90 --15565 11315
NM_001018067chr165304 3845 3647 1525 461 27 24999 4276 ----
NM_001018068chr165304 3845 3647 1525 461 27 24999 4276 ----
NM_001018069chr165304 3845 3647 1525 461 27 24999 4276 ----
NM_001018111chr723843 3585 14048 11614 13409
NM_001025068chr321275 585 1211 1521 11660
NM_001025069chr321275 585 1211 1521 11660
NM_001030055chr1433933 3721 3564 --1789 1718
NM_001035003chr431056 385 281 ----1218
NM_001035004chr431056 385 281 ----1218
NM_001039199chr2074543 1772 1576 1251 708 604 306 11273 --11108
NM_001039585chr164238 4168 1676 772 747 622 --24075 3654 --
NM_001042494chr1532729 819 449 ----1388
NM_001042495chr1532729 819 449 ----1388
NM_001042496chr1532729 819 449 ----1388
NM_001042497chr1532729 819 449 ----1388
NM_001042550chr92666 612 ----1194
NM_001042599chr265935 5734 2691 2334 385 75 35531 2258 972 ----
NM_001042603chr1244709 4317 4020 1473 14145 43499 3441 3383 3325 --
NM_001099678chr365099 4374 4330 544 237 50 15581 12308 --
NM_001173chr1433933 3721 3564 --1789 1718
NM_001684chr163882 3307 3293 3107 2962 825 23689 2923 14047 --
NM_001759chr1275292 4559 3464 1906 1836 1008 47 23838 931 ----
NM_001904chr3------21079 860
NM_002025chrX76926 6190 6073 3051 2100 370 64 17886 17515 18470
NM_002481chr157871 7554 1600 1433 506 67530 5440 2999 1917 1845 341 25575 1985 --
NM_002594chr2012269 --1391 11779
NM_003017chr621173 177 ----11329
NM_003034chr1287964 7576 6966 6569 5948 5438 1433 75 ----1271
NM_003583chr1243726 3479 2595 1189 --13050 1354
NM_003848chr32189 80 1280 --160
NM_003948chr462541 2421 2266 2105 1682 98 --1286 --
NM_003994chr1251702 1370 666 657 418 --1934 --
NM_004171chr11109355 8391 3470 2609 2452 1893 1852 1626 920 679 38036 6404 2953 12155 --
NM_004232chr1823470 186 12599 11509 1419
NM_004726chrX34967 1054 961 ----25423 4427
NM_004904chr774945 2339 2163 2124 1554 910 294 1586 ----
NM_005036chr2288347 8145 6508 5931 5113 2825 2582 1452 36377 3237 2562 1259 --
NM_005056chr1254953 4561 4264 3435 1717 14389 43743 3685 3627 3569 --
NM_005121chr1723248 914 1551 --13679
NM_005135chr1532729 819 449 ----1388
NM_005235chr265935 5734 2691 2334 385 75 35531 2258 972 ----
NM_005397chr723843 3585 14048 11614 13409
NM_005604chr6------21809 845
NM_006139chr211889 11803 11862 12702
NM_006482chr1243726 3479 2595 1189 --13050 1354
NM_006717chr943124 3108 2438 1117 --12162 1908
NM_006885chr1632878 2694 275 ----1956
NM_007249chr1343054 1120 732 159 12739 13209 13599
NM_014155chr1197450 7028 4979 2636 2441 1807 1464 1028 324 16065 16647 14808
NM_014157chr1673852 3636 2994 2582 2448 1086 224 21225 765 1682 --
NM_014331chr4107223 6780 6691 5795 5672 3123 2386 1826 380 292 17151 ----
NM_014423chr574984 4324 4291 2072 1508 486 239 1126 ----
NM_014730chr1274819 3466 2026 1960 1480 1068 184 24928 3351 1589 --
NM_014730chr1274819 3466 2026 1960 1480 1068 184 24928 3351 1589 --
NM_014787chr132534 404 396 12215 ----
NM_014810chr122390 729 1398 --11109
NM_014946chr263048 2535 2266 2221 273 219 ------
NM_015035chr20136507 6167 5761 5741 5634 4612 4515 4323 2262 1886 1212 1090 1002 14933 ----
NM_015059chr1583676 3542 2588 2434 1524 1458 917 333 --13211 1454
NM_015192chr2042908 2604 2045 582 ----1921
NM_015225chr942620 2136 1062 644 138 144 --
NM_015554chr1532085 1833 584 ----11805
NM_015640chr165304 3845 3647 1525 461 27 24999 4276 ----
NM_015906chr164716 4503 4050 3980 1333 599 11405 13306 1671
NM_016023chr821878 439 --1245 12011
NM_016075chr1322968 1138 --22783 2668 1155
NM_016260chr244747 4734 2688 1958 ----1803
NM_016530chr1532544 462 449 32591 1263 455 ----
NM_016946chr1103077 3039 2429 2306 1317 1301 1287 1017 469 389 --12513 --
NM_017637chr967013 6649 2640 2594 575 366 18480 2937 709 --
NM_017769chr1452492 2272 2210 303 270 ----12977
NM_017813chr895423 3854 2156 1268 1050 1035 753 94 44 1841 ----
NM_017919chr965116 4880 4387 1502 1043 690 35313 4235 522 14706 --
NM_018299chr843318 2317 1203 767 1177 12926 --
NM_020727chr2173844 3825 2489 1161 551 228 203 11239 1278 --
NM_020772chr1732671 341 239 27884 7757 28198 6513 --
NM_021090chr2264747 4651 3394 1551 899 365 11744 --11264
NM_022085chr641011 480 283 217 ----11453
NM_022462chr19153543 3080 2739 2494 1519 1486 1388 1362 1306 1097 814 788 467 224 196 --22722 687 --
NM_024947chr348963 8701 6399 665 2852 79 13105 --
NM_025221chr431056 385 281 ----1218
NM_030648chr455344 4976 2159 1467 652 1266 --11802
NM_030810chr641011 480 283 217 ----11453
NM_032221chr201549 --11266 21743 1318
NM_032557chr42266 219 --1904 1311
NM_032873chr1121816 1657 --11347 14553
NM_033020chr164716 4503 4050 3980 1333 599 11405 13306 1671
NM_033224chr767923 6984 6808 2624 2412 660 --13077 12923
NM_033290chrX32920 1430 1395 23784 3136 --11343
NM_033393chr41685 1406 12525 12895
NM_033426chr1452703 2540 886 783 35 1122 12798 --
NM_033505chr266130 5961 5783 4529 4084 616 --34552 1544 258 1696
NM_052885chr1221330 92 14266 --23944 409
NM_133647chr1532729 819 449 ----1388
NM_138459chr643169 1226 1106 1069 ----11462
NM_144571chr476613 6560 6279 5368 4478 581 348 15493 --15211
NM_145259chr244604 2312 931 570 25521 2485 15813 --
NM_147181chr431056 385 281 ----1218
NM_147182chr431056 385 281 ----1218
NM_147183chr431056 385 281 ----1218
NM_152624chr596714 5979 5545 5514 4498 2758 2389 2062 1744 ----14926
NM_153050chr2264747 4651 3394 1551 899 365 11744 --11264
NM_153051chr2264747 4651 3394 1551 899 365 11744 --11264
NM_182734chr2043155 2851 2292 829 ----11168
NM_182898chr774945 2339 2163 2124 1554 910 294 1586 ----
NM_182899chr774945 2339 2163 2124 1554 910 294 1586 ----
NM_198273chr532603 613 30 12713 12186 21057 952
NM_198399chr321275 585 1211 1521 11660
NM_199436chr263048 2535 2266 2221 273 219 ------