TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3619-5p
miRNA Sequence: UCAGCAGGCAGGCUGGUGCAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511257 ------
NM_000020chr122198 130 12320 21890 187 22173 572
NM_000021chr141293 11109 11034 --
NM_000024chr51338 ------
NM_000037chr852279 2207 1819 725 174 ------
NM_000038chr542076 1502 514 341 ------
NM_000044chrX2155 63 ------
NM_000055chr31319 ------
NM_000067chr82541 190 ------
NM_000074chrX2201 82 ------
NM_000080chr171829 --1775 2263 100
NM_000081chr121364 1327 ------
NM_000084chrX146544 6154 6082 5677 5020 4954 4929 4733 4709 1654 678 670 540 410 11857 15390 16204
NM_000088chr1741374 1157 362 290 ------
NM_000089chr72242 120 ------
NM_000090chr22637 172 ------
NM_000097chr321209 490 ------
NM_000109chrX22370 826 --11070 --
NM_000110chr12771 23 ------
NM_000112chr5105564 5288 4210 3704 1927 1673 1479 1322 433 305 --15109 --
NM_000125chr6103743 3454 2706 1338 1270 1115 872 244 185 151 --140 --
NM_000129chr621141 85 ------
NM_000141chr1031441 1146 1055 11198 ----
NM_000151chr1731835 1689 1370 --1458 --
NM_000163chr522096 2087 ------
NM_000165chr61474 ------
NM_000167chrX51595 1388 1274 421 284 --1124 --
NM_000168chr762740 2511 2293 2275 943 372 ------
NM_000170chr91210 ------
NM_000176chr583949 3846 3699 3530 793 557 395 118 22810 1332 1868 --
NM_000188chr10--1180 ----
NM_000189chr271972 1927 1907 1901 1500 828 49 11494 --12229
NM_000194chrX2160 91 ------
NM_000208chr19114767 3850 3657 1299 1285 581 449 397 359 323 232 --23133 1108 --
NM_000210chr271808 1649 738 715 385 359 267 --1579 --
NM_000214chr2021710 538 192 --11594
NM_000216chrX63628 3097 2844 1575 865 244 ------
NM_000217chr1215321 ----14725
NM_000220chr111706 ------
NM_000232chr42815 119 12901 12677 --
NM_000238chr73305 77 52 ------
NM_000240chrX61989 1420 801 584 314 24 --1728 --
NM_000245chr741942 1768 1430 551 ------
NM_000248chr31680 --12964 --
NM_000252chrX----11522 --
NM_000253chr42762 73 ------
NM_000259chr1585351 5211 4966 4880 4398 4155 636 380 ----13963
NM_000264chr933061 2250 353 22734 2297 --13075
NM_000267chr1763516 3155 2766 2652 1256 108 ------
NM_000276chrX41953 1450 800 779 --22077 382 --
NM_000278chr1032195 1694 1550 --3847 790 370 --
NM_000282chr131216 ------
NM_000286chr172814 179 --1819 --
NM_000291chrX1270 ------
NM_000301chr61161 ------
NM_000304chr17--1150 ----
NM_000307chrX--1339 ----
NM_000309chr1135 ------
NM_000314chr1033037 2753 2341 --11020 --
NM_000315chr11131 ------
NM_000319chr123942 434 253 --1485 --
NM_000332chr6106327 6184 5557 4863 4613 2764 2440 2419 735 460 25205 1283 1792 --
NM_000333chr331084 266 147 ------
NM_000334chr1741844 1811 1756 1564 --2861 637 --
NM_000335chr311916 21418 273 ----
NM_000337chr5106504 5736 5448 4521 4239 1904 1252 699 691 504 --25571 5022 --
NM_000345chr42912 321 137 ----
NM_000346chr1731655 1246 367 --1638 --
NM_000353chr1631153 205 139 ------
NM_000362chr2253437 2959 1258 364 98 --12806 1450
NM_000368chr9114805 4126 4019 3927 3795 1633 1409 800 649 371 83 --1893 --
NM_000376chr1243184 2581 872 225 1322 12548 23059 596
NM_000378chr111417 ------
NM_000380chr92483 22 ------
NM_000382chr1721886 365 11493 11541 --
NM_000386chr172596 567 ------
NM_000390chrX32948 2453 199 --22596 986 --
NM_000398chr22151 ------
NM_000399chr101290 ------
NM_000403chr1285 45 ------
NM_000408chr2123414 2697 2671 2630 2409 2157 2140 802 762 706 273 172 13290 ----
NM_000411chr2122577 2229 11239 ----
NM_000430chr17103459 3057 2639 2538 2480 2406 1231 364 356 344 13591 22857 2310 12499
NM_000434chr6175 ------
NM_000435chr191768 --1691 --
NM_000445chr82941 152 --2837 200 --
NM_000449chr151054 1026 465 162 74 ------
NM_000451chrX2791 319 ------
NM_000459chr91231 ----165
NM_000461chr344076 3677 3467 3113 24503 918 --13183
NM_000462chr151564 ------
NM_000484chr212746 701 ------
NM_000489chrX62913 2271 2245 950 525 313 22378 986 1861 --
NM_000493chr641085 957 400 273 ------
NM_000495chrX3967 823 98 --1406 --
NM_000503chr821650 126 1192 ----
NM_000522chr741224 933 450 405 ------
NM_000533chrX21505 223 ------
NM_000539chr331288 1034 297 ------
NM_000552chr12188 --129 --
NM_000555chrX87335 7006 6875 6204 5351 2750 1586 68 37561 6213 1777 11643 --
NM_000594chr61728 1719 ----
NM_000599chr234551 3558 3101 ------
NM_000601chr72280 162 ------
NM_000602chr721242 297 ------
NM_000617chr1232240 748 233 ------
NM_000618chr12116351 5555 4948 4649 4085 2570 2440 2035 1378 366 70 21412 223 ----
NM_000618chr12116351 5555 4948 4649 4085 2570 2440 2035 1378 366 70 21412 223 ----
NM_000635chr191295 ------
NM_000663chr1642667 1048 752 238 13012 11123 --
NM_000673chr41317 ------
NM_000675chr221260 --2598 543 --
NM_000679chr51520 ------
NM_000680chr8----1116 --
NM_000682chr271790 1606 1445 596 385 98 55 --2471 68 --
NM_000684chr1021211 1061 ----1191
NM_000685chr34828 768 319 308 ------
NM_000685chr34828 768 319 308 ------
NM_000687chr203534 150 33 ------
NM_000719chr12136492 6380 6236 5063 4769 4265 2008 1933 1849 1699 1346 361 126 24218 1561 11958 --
NM_000721chr132245 520 230 ------
NM_000724chr1041655 449 287 133 --11420 --
NM_000726chr22513 117 132 1376 --
NM_000757chr1----1577 1830
NM_000767chr1941387 1060 255 107 11529 11364 --
NM_000780chr82192 139 1795 ----
NM_000794chr53369 120 67 ------
NM_000801chr2041055 1021 945 31 1971 ----
NM_000806chr531229 80 22 ------
NM_000809chr4109034 8698 6220 5739 3534 3209 1549 1392 538 472 27760 6376 ----
NM_000813chr52167 123 1393 ----
NM_000814chr1574056 3194 3128 2801 1355 1064 767 --1647 --
NM_000816chr51204 ------
NM_000817chr241043 979 961 426 178 ----
NM_000818chr102470 190 ------
NM_000826chr422446 434 ------
NM_000827chr542524 1714 754 171 ------
NM_000828chrX21977 1683 3602 533 118 1559 --
NM_000829chr1151920 742 586 351 39 ------
NM_000831chr196272 5242 5015 4365 4073 1321 938 925 584 --21423 120 --
NM_000832chr9----2165 61 --
NM_000833chr1641477 1288 1144 91 ------
NM_000844chr3----11005 11045
NM_000849chr143069 2581 2027 65 23092 563 11032 --
NM_000859chr531538 1142 578 --11664 --
NM_000868chrX61804 1689 506 464 100 75 11815 ----
NM_000872chr101110 21485 38 ----
NM_000875chr15177034 6937 6919 6863 6616 5801 5068 4426 2803 2356 1612 1482 1447 1346 950 344 320 34292 1876 1031 42122 1917 725 131 --
NM_000877chr262990 2294 2264 2239 1168 780 ----11142
NM_000880chr82312 63 ------
NM_000883chr73512 291 157 --1282 --
NM_000883chr73512 291 157 --1282 --
NM_000891chr1763608 3188 2817 1273 997 48 --22971 1189 --
NM_000899chr1233766 3269 134 ------
NM_000901chr462391 1006 844 700 246 78 12359 1497 --
NM_000902chr353072 3036 2817 689 633 1296 11304 --
NM_000908chr51290 ------
NM_000912chr852786 2325 895 598 315 --12652 23567 1246
NM_000919chr51395 ------
NM_000922chr113879 298 147 ------
NM_000924chr1251364 1278 1241 1080 85 ------
NM_000926chr1199067 8266 8051 6713 6259 5826 3733 3677 3402 23370 1271 38002 7952 7429 --
NM_000933chr201454 --11205 --
NM_000935chr32948 184 ------
NM_000939chr2160 --176 --
NM_000944chr442080 1881 1749 72 ----1821
NM_000945chr251866 1780 781 689 60 1666 ----
NM_000949chr51217 ------
NM_000956chr141363 --1458 1290
NM_000962chr9103079 2393 2366 2244 2028 1925 876 764 500 340 11898 ----
NM_000964chr1731367 1360 196 ------
NM_000965chr32478 82 ------
NM_000966chr123428 217 93 11070 ----
NM_000971chr8154 ------
NM_000983chr14562 514 334 178 ------
NM_000984chr172433 139 ------
NM_001001132chr2111149 --11195 --
NM_001001323chr1251118 830 769 682 235 1195 ----
NM_001001331chr31952 ------
NM_001001342chr1041352 1125 1081 1028 ------
NM_001001344chrX32494 2251 2164 ------
NM_001001395chr1232787 2772 241 --12089 --
NM_001001396chr194476 3799 3676 3258 3142 1725 1074 1054 385 24454 3603 33903 3891 172 --
NM_001001419chr555056 3424 1979 792 541 --14195 --
NM_001001420chr555056 3424 1979 792 541 --14195 --
NM_001001433chr2062950 2851 915 876 233 163 12478 ----
NM_001001436chr161748 123 ----
NM_001001483chr111420 ------
NM_001001484chr1022266 654 --1413 --
NM_001001523chr121199 1099 --140 --
NM_001001549chr72947 179 --1976 12363
NM_001001550chr72947 179 --1976 12363
NM_001001555chr72947 179 --1976 12363
NM_001001560chr224737 526 312 168 ----1187
NM_001001664chr232735 2643 2637 14091 ----
NM_001001669chr582751 2181 1750 1740 857 849 746 722 ------
NM_001001706chr61167 1230 ----
NM_001001715chr132118 21 1430 ----
NM_001001740chr11230 ----138
NM_001001740chr11230 ----138
NM_001001852chr222764 267 ------
NM_001001890chr21114220 3788 3219 3105 3037 2985 598 587 467 209 70 11673 13042 --
NM_001001924chr841773 1471 612 468 --11864 --
NM_001001925chr841773 1471 612 468 --11864 --
NM_001001931chr841773 1471 612 468 --11864 --
NM_001001933chr12512 129 ------
NM_001001936chr103829 330 58 ------
NM_001001971chr102524 72 ------
NM_001001974chr1012267 ------
NM_001001995chrX21242 135 1633 11563 --
NM_001002026chr32432 88 1620 ----
NM_001002032chr172724 24 ------
NM_001002233chr842017 1721 674 52 --1798 --
NM_001002243chr22252 74 ------
NM_001002295chr1021128 755 ------
NM_001002762chr1042016 1176 811 258 22356 323 22679 197 --
NM_001002814chr883849 3126 3096 3002 2867 2730 674 52 --1798 --
NM_001002838chrX2659 379 --1546 --
NM_001002843chr1521269 81 1298 ----
NM_001002860chr1454245 3920 3051 1241 654 --24293 1224 --
NM_001002909chr1741924 754 338 325 --1408 --
NM_001002914chr172802 79 11061 21080 966 --
NM_001002919chr21489 ------
NM_001003406chr2262991 2926 2864 2777 2116 923 13229 23247 2262 --
NM_001003407chr10115044 5023 4113 3417 2049 1229 1009 966 759 734 314 14770 35058 1705 1247 --
NM_001003408chr10115044 5023 4113 3417 2049 1229 1009 966 759 734 314 14770 35058 1705 1247 --
NM_001003652chr18138544 8293 8053 6438 5596 3059 2329 2238 2194 1766 1433 1089 817 21835 927 23349 2323 12696
NM_001003665chr163077 2727 1147 346 201 162 22981 2161 1309 --
NM_001003674chr18117037 6448 5730 5443 5294 4667 4644 4594 2202 1949 896 36500 1312 1101 25472 2358 --
NM_001003675chr18117037 6448 5730 5443 5294 4667 4644 4594 2202 1949 896 36500 1312 1101 25472 2358 --
NM_001003682chr131395 1017 21 ------
NM_001003688chr44893 764 203 128 1188 ----
NM_001003694chr3----1440 --
NM_001003698chr611240 189 21609 1587 --
NM_001003699chr611240 189 21609 1587 --
NM_001003712chr1221523 781 13527 13440 1754
NM_001003800chr963217 3140 1451 615 346 38 13228 ----
NM_001003810chr4190 ------
NM_001003891chr221116 --1646 1601
NM_001003940chr1543615 2985 2951 831 1225 11261 12725
NM_001003942chr1543615 2985 2951 831 1225 11261 12725
NM_001003943chr1543619 2989 2955 835 1229 11265 12729
NM_001004019chr3--1118 ----
NM_001004065chr963929 2957 2943 1397 731 312 11155 ----
NM_001004105chr5----133 --
NM_001004196chr331096 945 213 ------
NM_001004317chr643567 3421 1678 1405 11622 11563 --
NM_001004329chr121259 21355 1157 ----
NM_001004342chr1125892 5686 5667 5223 4891 3716 1844 1821 1634 1617 1548 1092 --14117 --
NM_001004346chr42454 169 ------
NM_001004354chr9149 ------
NM_001004360chr221601 297 ------
NM_001004419chr1244110 1597 267 243 11057 11047 --
NM_001004439chr152306 148 11065 1848 --
NM_001005158chr34392 326 119 62 --1193 --
NM_001005159chr34392 326 119 62 --1193 --
NM_001005217chr43450 395 57 ------
NM_001005271chr1721051 746 --21070 75 --
NM_001005273chr1721051 746 --21070 75 --
NM_001005291chr171135 ------
NM_001005354chr123460 198 43 --1134 --
NM_001005360chr191853 ------
NM_001005361chr191853 ------
NM_001005362chr191853 ------
NM_001005366chr122668 239 ------
NM_001005375chrY2124 87 11842 ----
NM_001005386chr232007 487 238 1437 ----
NM_001005404chr1743760 3737 3598 789 12931 13508 --
NM_001005463chr1041929 1862 734 699 ------
NM_001005473chr556379 5936 2343 379 367 14392 15655 --
NM_001005476chr2------174
NM_001005505chr331424 1142 315 --1251 11174
NM_001005609chrX103221 2740 2413 1538 1188 657 564 407 166 79 13061 2638 296 --
NM_001005732chr212664 600 ------
NM_001005733chr212621 557 ------
NM_001005746chr22513 117 132 1376 --
NM_001005747chr22513 117 132 1376 --
NM_001005845chr831316 477 353 ------
NM_001005861chr31656 ------
NM_001005910chr32586 562 ----1184
NM_001005911chr32586 562 ----1184
NM_001006115chr382628 2073 2010 1925 1722 1043 856 89 --1638 1354
NM_001006600chr522447 1692 1195 ----
NM_001006612chrX146 --1101 --
NM_001006613chrX146 --1101 --
NM_001006614chrX146 --1101 --
NM_001006617chr931362 934 205 ------
NM_001006618chr9158 ------
NM_001006619chr931362 934 205 ------
NM_001006620chr931362 934 205 ------
NM_001006621chr931362 934 205 ------
NM_001006634chr161557 --1481 1290
NM_001006636chr21960 --1296 --
NM_001006665chr13549 524 204 1818 1574 --
NM_001006681chrX1135 ------
NM_001006682chrX1135 ------
NM_001006683chrX1135 ------
NM_001006933chrX253 45 ------
NM_001006938chrX4748 558 503 103 ------
NM_001007024chr1764173 3746 3095 2850 2717 510 11765 --23369 1525
NM_001007025chr1764173 3746 3095 2850 2717 510 11765 --23369 1525
NM_001007027chr113228 91 65 ------
NM_001007072chr152183 56 ------
NM_001007097chr9104941 4901 4444 4342 4049 1352 1237 1076 905 84 23348 1174 11015 15082
NM_001007098chr11150 165 1328 --
NM_001007102chr631597 1576 35 11060 11480 --
NM_001007156chr1531695 403 330 11234 --11739
NM_001007224chr741646 1579 1525 886 21702 424 1476 --
NM_001007226chr1731160 107 54 --1205 --
NM_001007227chr1731160 107 54 --1205 --
NM_001007228chr1731160 107 54 --1205 --
NM_001007229chr1731160 107 54 --1205 --
NM_001007230chr1731160 107 54 --1205 --
NM_001007237chr131746 916 909 52806 2586 2140 1865 852 12001 --
NM_001007246chr2141862 1696 1312 1262 1687 ----
NM_001007257chr141476 1234 373 176 ------
NM_001007271chr103979 150 80 --2413 71 --
NM_001007277chr113931 748 186 ------
NM_001007278chr13115271 3819 3561 3524 3425 2105 1508 1465 1359 580 392 ------
NM_001007466chr674982 4127 3756 2072 1764 1666 435 23294 847 34955 1641 356 --
NM_001007471chr9193 --1230 --
NM_001007553chr11448 --1789 --
NM_001007559chr1811646 ------
NM_001007565chr31156 ------
NM_001007794chr11604 ------
NM_001008216chr1285 45 ------
NM_001008220chr5103899 3816 3645 3544 2636 1518 1089 761 309 33 --13534 --
NM_001008222chrX51267 1256 1098 389 322 --1157 --
NM_001008239chr1893581 3350 3229 3130 2892 2857 2757 2573 1481 11525 1842 1587
NM_001008392chr383461 3368 3226 2611 2398 1254 828 143 --1996 --
NM_001008407chr7--1324 1624 --
NM_001008408chr7236344 6278 6246 6198 5946 5836 5670 5436 5429 4815 4645 3935 2545 2138 1667 1633 1590 1551 1175 957 855 821 601 ------
NM_001008495chr852258 2233 1754 1655 312 ------
NM_001008528chr1721832 226 11642 1231 11809
NM_001008539chr885355 5134 4606 1213 1194 663 657 103 --34999 2074 770 --
NM_001008540chr22383 363 ------
NM_001008541chr1021889 640 11548 1717 --
NM_001008541chr1021889 640 11548 1717 --
NM_001008566chr222341 93 1119 ----
NM_001008567chr9183 1246 ----
NM_001008657chr52874 93 ------
NM_001008660chr112275 84 11160 ----
NM_001008701chr1992548 2313 2004 1201 1040 897 622 524 423 --22608 1910 --
NM_001008711chr811645 162 ----
NM_001008738chr562834 2565 2454 2271 933 508 ------
NM_001008783chr62718 251 ------
NM_001008860chr15----1668 --
NM_001008892chr15----1668 --
NM_001008894chr15----1668 --
NM_001008938chr111168 --1190 --
NM_001009185chr51645 ------
NM_001009552chr8----1236 --
NM_001009566chr131059 45 30 --21133 911 --
NM_001009567chr101589 ------
NM_001009571chr721131 274 --11662 --
NM_001009881chr1----159 --
NM_001009882chr1----159 --
NM_001009899chr3136375 6236 5465 5379 5269 5221 4441 4259 4080 2475 2417 1363 1287 ------
NM_001009955chr11116 --1505 --
NM_001009955chr11116 --1505 --
NM_001009993chr2164211 3576 3545 3441 3215 2883 1672 1657 1390 1288 1026 942 793 564 417 323 11233 ----
NM_001010853chr652699 2297 1254 921 543 ------
NM_001010857chr11110 ------
NM_001010861chr132777 2169 635 --22118 1898 --
NM_001010862chrX52853 2519 2486 1260 979 12007 --1362
NM_001010867chr1116037 4725 4093 2462 2049 2016 2010 1546 791 464 91 12414 22658 765 16623
NM_001010888chrX44213 3775 1832 480 14622 11753 13455
NM_001010891chr595643 4979 4856 4283 2293 1734 1174 1146 1114 45691 1095 668 311 ----
NM_001010895chr932051 1649 75 1294 1461 --
NM_001010898chr1103552 3482 3209 3073 2740 2518 2290 515 289 165 --22649 2545 --
NM_001010924chr1031084 998 137 ------
NM_001010932chr72280 162 ------
NM_001010934chr741061 930 381 162 ------
NM_001010971chr11928 ------
NM_001010989chr163552 367 23 --1388 --
NM_001010990chr163552 367 23 --1388 --
NM_001011537chr331890 1837 410 ------
NM_001011546chr203740 220 53 ------
NM_001011553chr72852 286 ------
NM_001011645chrX2155 63 ------
NM_001011666chr776013 5629 5121 4650 1175 809 592 11292 16405 --
NM_001011705chr131276 ------
NM_001011713chr1421438 1406 1276 ----
NM_001011724chr13--1284 ----
NM_001011725chr13--1284 ----
NM_001011885chr1511727 --1105 11127
NM_001012267chr921875 86 ------
NM_001012329chr162406 2372 2309 2202 1869 707 3957 478 35 2684 600 --
NM_001012338chr152129 34 ------
NM_001012393chr1193460 3374 3160 1806 1499 287 261 255 34 ------
NM_001012398chr162994 37 ------
NM_001012410chr31455 ------
NM_001012415chr92747 108 ------
NM_001012420chr1552914 928 699 654 419 127 1331 --
NM_001012423chr1562914 928 699 654 419 25 --1331 --
NM_001012426chr653179 3015 1156 697 570 13068 12456 --
NM_001012427chr653179 3015 1156 697 570 13068 12456 --
NM_001012513chr181193 --1253 --
NM_001012614chr41483 ----1699
NM_001012643chr192524 103 ------
NM_001012751chr10--1181 11628 --
NM_001012761chr52877 259 --12736 --
NM_001012968chrX62147 961 922 693 562 514 12724 ----
NM_001012977chrX21424 1117 --11178 --
NM_001012979chrX153 ------
NM_001012989chrX3585 254 38 ------
NM_001013031chr1042625 1318 656 508 1797 11021 --
NM_001013406chr711406 ----11587
NM_001013415chr461199 1087 617 370 362 212 ------
NM_001013438chr321022 404 ------
NM_001013439chr32868 250 ------
NM_001013615chr11203 --1890 1802
NM_001013635chr122845 339 1459 ----
NM_001013659chr1944166 2125 1633 1391 ------
NM_001013699chr121179 ------
NM_001013843chr152177 91 ------
NM_001014283chr1332144 1821 1517 11425 11472 --
NM_001014442chr131129 ------
NM_001014445chr174998 723 710 249 --2265 138 --
NM_001014765chr14754 542 512 49 125 ----
NM_001014797chr10137919 7809 7456 7438 7306 7024 6241 2214 1430 1231 944 822 660 ------
NM_001014839chr131032 895 742 ------
NM_001014841chr131032 895 742 ------
NM_001015045chr442467 2075 506 147 11568 1443 --
NM_001015053chr1731533 184 124 11065 ----
NM_001015055chr22118 110 ------
NM_001015056chr22118 110 ------
NM_001015056chr22118 110 ------
NM_001015877chrX83030 2803 2749 2044 809 777 558 320 --1828 11152
NM_001015880chr1011654 ----1332
NM_001015881chrX1932 --1887 --
NM_001015882chr931076 389 88 ------
NM_001017368chr1762821 2178 1095 722 669 485 32567 2189 1019 1771 --
NM_001017369chr4----11080 --
NM_001017371chr211219 ------
NM_001017395chr373415 3087 2958 2652 2641 2629 1058 --1998 --
NM_001017396chr22830 119 11457 1158 --
NM_001017405chr41691 ------
NM_001017406chr1122 ------
NM_001017424chr131525 1373 67 --1601 --
NM_001017425chr131525 1373 67 --1601 --
NM_001017440chr7148016 7733 7267 6430 5354 5178 2846 2515 2465 2150 1964 1617 1475 902 1430 57442 3111 2354 1974 1934 16846
NM_001017523chr1221482 95 1689 --1145
NM_001017535chr1243184 2581 872 225 1322 12548 23059 596
NM_001017916chr1762063 1746 1603 1397 228 170 1410 1763 155
NM_001017917chr1762063 1746 1603 1397 228 170 1410 1763 155
NM_001017969chr91660 184 ----
NM_001017979chr42287 128 ------
NM_001017989chr19136 ------
NM_001017995chr5114634 4555 4104 3888 3280 3143 3063 1285 1267 716 489 1869 141 --
NM_001017999chr152133 1772 1711 641 422 1901 123 --
NM_001017999chr152133 1772 1711 641 422 1901 123 --
NM_001018000chr152133 1772 1711 641 422 1901 123 --
NM_001018000chr152133 1772 1711 641 422 1901 123 --
NM_001018001chr152133 1772 1711 641 422 1901 123 --
NM_001018003chr82683 254 --1705 --
NM_001018004chr15162 ------
NM_001018006chr15162 ------
NM_001018007chr15162 ------
NM_001018020chr15162 ------
NM_001018050chr2252495 1367 678 217 172 1698 12143 --
NM_001018052chr2252495 1367 678 217 172 1698 12143 --
NM_001018054chr11370 1278 ----
NM_001018064chr951946 1795 1518 499 288 ------
NM_001018072chr1221482 95 1689 --1145
NM_001018074chr583949 3846 3699 3530 793 557 395 118 22810 1332 1868 --
NM_001018075chr583949 3846 3699 3530 793 557 395 118 22810 1332 1868 --
NM_001018076chr583949 3846 3699 3530 793 557 395 118 22810 1332 1868 --
NM_001018077chr583949 3846 3699 3530 793 557 395 118 22810 1332 1868 --
NM_001018108chr1551791 1498 1431 668 614 11807 2896 640 --
NM_001018111chr783798 2453 1426 1351 948 774 413 228 11166 11393 --
NM_001018676chr82439 157 ------
NM_001018677chr82439 157 ------
NM_001020658chr11306 --1232 --
NM_001020658chr11306 --1232 --
NM_001020818chr1961737 1644 1462 516 446 241 --31852 1725 204 --
NM_001020819chr1961737 1644 1462 516 446 241 --31852 1725 204 --
NM_001020820chr1961737 1644 1462 516 446 241 --31852 1725 204 --
NM_001020821chr1961737 1644 1462 516 446 241 --31852 1725 204 --
NM_001020825chr541424 1321 1174 1005 1285 ----
NM_001023567chr1542306 936 657 419 ------
NM_001023587chr321035 203 --11104 --
NM_001024071chr143801 394 210 ------
NM_001024094chr583949 3846 3699 3530 793 557 395 118 22810 1332 1868 --
NM_001024226chr1139 ------
NM_001024227chr1139 ------
NM_001024228chr1139 ------
NM_001024455chrX102327 2214 2189 2169 1919 1894 287 246 66 59 22220 88 22243 1742 --
NM_001024463chr153777 733 206 1453 ----
NM_001024593chr105830 792 198 192 56 ------
NM_001024649chr562922 2514 2285 2154 919 202 1959 ----
NM_001024666chrX1117 ------
NM_001024668chr122741 207 ----1984
NM_001024808chr122297 183 --11024 --
NM_001024809chr1731367 1360 196 ------
NM_001024855chr33351 158 132 ------
NM_001024912chr1931387 453 149 ------
NM_001024934chr61263 ------
NM_001024935chr61263 ------
NM_001024936chr61263 ------
NM_001024937chr172744 655 --1129 --
NM_001024947chr52119 82 ------
NM_001024948chr123534 2257 23493 2193 12619 --
NM_001024957chr112289 21 ----1126
NM_001024959chr33801 787 148 ------
NM_001024960chr33801 787 148 ------
NM_001025068chr341754 1620 1130 206 --21271 526 --
NM_001025069chr341754 1620 1130 206 --21271 526 --
NM_001025076chr10206113 6024 5909 5890 5868 5859 5556 5204 5075 4845 4834 4326 4159 3801 2432 2272 1241 643 258 24 1682 22157 2109 15677
NM_001025077chr10197471 7382 7267 7248 7226 7217 6914 6562 6433 6203 6192 5684 5517 5159 4868 2599 2001 1616 24 12040 --17035
NM_001025079chr3104014 2649 2622 1515 1256 1070 754 748 741 95 --23348 3219 11674
NM_001025081chr1831076 373 79 1439 ----
NM_001025090chr1831076 373 79 1439 ----
NM_001025092chr1831076 373 79 1439 ----
NM_001025101chr1831076 373 79 1439 ----
NM_001025105chr531347 1168 582 ------
NM_001025108chr253010 2708 1256 624 475 23951 488 ----
NM_001025203chr21128 ------
NM_001025204chr21128 ------
NM_001025205chr33399 106 100 ------
NM_001025232chr121135 ------
NM_001025233chr1231843 1076 444 ------
NM_001025248chr1531288 1261 256 ------
NM_001025249chr1531288 1261 256 ------
NM_001025266chr374789 3020 1263 1201 1092 906 431 185 11615 --
NM_001025366chr621361 488 --1280 --
NM_001025366chr621361 488 --1280 --
NM_001025367chr621361 488 --1280 --
NM_001025367chr621361 488 --1280 --
NM_001025368chr621361 488 --1280 --
NM_001025368chr621361 488 --1280 --
NM_001025369chr621377 504 --1296 --
NM_001025369chr621377 504 --1296 --
NM_001025370chr621361 488 --1280 --
NM_001025370chr621361 488 --1280 --
NM_001025579chr171421 ------
NM_001025580chrX54052 3253 348 288 196 ------
NM_001025595chr441686 1498 1376 1245 ------
NM_001025603chr151054 1026 465 162 74 ------
NM_001025616chr431547 1209 334 1434 ----
NM_001025777chr251416 1253 1200 1073 192 190 ----
NM_001025780chr911517 --1498 142
NM_001029858chr672919 2124 836 720 703 561 314 --1550 --
NM_001029863chr653109 2795 983 72 61 ------
NM_001029870chr4147 184 ----
NM_001029875chr552396 2162 1164 1093 257 --12662 1377
NM_001029882chr12625 603 --1493 --
NM_001029882chr12625 603 --1493 --
NM_001029884chr642655 2429 876 339 3826 592 426 11865 --
NM_001029998chr431233 945 134 --1928 --
NM_001030002chr172347 142 ------
NM_001030006chr1762644 2534 2493 1761 795 80 --32328 231 161 --
NM_001030007chr1683982 2987 1540 1425 935 597 404 71 3196 151 124 ----
NM_001030055chr1454425 1722 1214 382 242 11558 14672 --
NM_001030272chr111191 ------
NM_001030273chr111191 ------
NM_001031679chr1223387 3203 ------
NM_001031680chr152519 2016 1040 650 580 11933 22411 1871 --
NM_001031684chr211454 --11241 --
NM_001031685chr12692 276 ----1349
NM_001031690chr7102654 2360 2334 1901 843 815 727 502 429 394 --12002 --
NM_001031695chr22125377 5150 5142 4759 3944 3855 3718 2073 1377 1193 1098 877 --11850 --
NM_001031702chr33822 808 779 --1114 --
NM_001031732chr433312 3210 2412 --1929 --
NM_001031738chr22200 101 ------
NM_001031743chr6--1182 ----
NM_001031746chr101164 2497 284 ----
NM_001031806chr1731942 421 70 11549 11597 --
NM_001031812chr552321 2100 1734 314 48 1928 ----
NM_001032280chr61110 --198 --
NM_001032282chr821007 329 ------
NM_001032283chr12--2413 53 ----
NM_001032284chr12--2413 53 ----
NM_001032288chr2021320 1225 --21337 347 --
NM_001032289chrX2167 103 ------
NM_001032296chr1362875 2637 2440 931 887 372 --22689 1064 --
NM_001032380chr1031420 693 363 21453 567 ----
NM_001033026chr19--1692 133 --
NM_001033044chr141205 553 516 145 31640 1282 24 ----
NM_001033047chr432179 593 156 12209 11032 --
NM_001033056chr141205 553 516 145 31640 1282 24 ----
NM_001033057chr331800 1577 1446 1354 21553 1344 --
NM_001033059chr61431 --1236 --
NM_001033081chr121703 1195 --21820 1425 --
NM_001033082chr121703 1195 --21820 1425 --
NM_001033087chr2083258 3103 2863 2442 2040 906 786 339 ------
NM_001033112chr51728 ------
NM_001033117chr354749 4377 4244 3891 1734 --34878 4430 4167 --
NM_001033503chr5195 ------
NM_001033518chr762788 2422 2321 424 205 69 12245 --1790
NM_001033519chr762788 2422 2321 424 205 69 12245 --1790
NM_001033520chr762788 2422 2321 424 205 69 12245 --1790
NM_001033551chr17133930 3549 3518 3333 3094 2745 2584 2493 1365 1291 1026 552 137 22853 754 12965 --
NM_001033557chr22340 26 1136 --1569
NM_001033561chr172763 330 ------
NM_001033566chr172984 71 1769 ----
NM_001033568chr172984 71 1769 ----
NM_001033677chr122390 279 ------
NM_001033756chr631295 726 422 --1214 --
NM_001033756chr631295 726 422 --1214 --
NM_001033925chr1012074 --1335 --
NM_001033952chr111252 ------
NM_001034837chr54773 718 294 272 1141 ----
NM_001034838chr54773 718 294 272 1141 ----
NM_001034845chr411440 1277 1232 --
NM_001034850chr511468 ------
NM_001034852chr143755 394 261 --21761 423 --
NM_001034915chr831568 1158 476 1256 ----
NM_001034954chr1043246 2059 968 464 --32043 609 339 1553
NM_001034955chr1043246 2059 968 464 --32043 609 339 1553
NM_001034956chr1043246 2059 968 464 --32043 609 339 1553
NM_001034957chr1043246 2059 968 464 --32043 609 339 1553
NM_001035chr121292 68 189 ----
NM_001035003chr421339 1220 ------
NM_001035004chr421339 1220 ------
NM_001035254chr972524 2335 1933 1706 457 314 34 --2773 577 --
NM_001035256chr2160 --176 --
NM_001035260chr1011384 --11249 --
NM_001035511chr12694 324 ------
NM_001035512chr12801 431 ------
NM_001035513chr12801 431 ------
NM_001035521chr23752 590 584 ------
NM_001035534chr991278 1002 455 439 271 247 192 185 22 --11186 --
NM_001037132chr751712 626 556 273 109 1588 ----
NM_001037133chr751712 626 556 273 109 1588 ----
NM_001037164chr731816 1743 151 11672 --11859
NM_001037172chr361341 1041 1033 924 909 167 ------
NM_001037277chr131631 433 317 ------
NM_001037278chr131631 433 317 ------
NM_001037317chr132777 2169 635 --22118 1898 --
NM_001037324chr31175 1509 1563 --
NM_001037331chr184929 343 176 51 ------
NM_001037334chr182501 382 --1319 --
NM_001037339chr12715 230 --1638 1443
NM_001037340chr12715 230 --1638 1443
NM_001037341chr12715 230 --1638 1443
NM_001037341chr12715 230 --1638 1443
NM_001037494chr12195 ------
NM_001037495chr12195 ------
NM_001037535chrX31319 1131 527 ------
NM_001037536chrX31319 1131 527 ------
NM_001037540chrX31319 1131 527 ------
NM_001037633chr52293 141 ------
NM_001037738chr51206 ------
NM_001037954chr1163401 3305 2996 2508 2501 2288 --12335 --
NM_001038493chr231371 1062 31 ------
NM_001038640chr1521003 724 ------
NM_001038707chr162191 1824 1771 1646 575 347 1423 3844 702 463 --
NM_001038707chr162191 1824 1771 1646 575 347 1423 3844 702 463 --
NM_001039199chr20174881 4768 4712 4646 4589 4521 4207 3939 3360 3296 3208 1939 983 536 494 383 93 1898 ----
NM_001039457chr12190 45 1197 ----
NM_001039459chr72853 178 --1897 --
NM_001039465chr142490 73 ------
NM_001039479chr1462125 1805 1682 977 876 173 1383 22375 326 --
NM_001039538chr253674 3593 2465 1008 250 ----12929
NM_001039547chr367212 3069 2648 1729 1657 1405 --11809 --
NM_001039548chr11165 ------
NM_001039550chr2----1712 --
NM_001039574chr13910 718 353 1363 21067 1058 --
NM_001039577chr133872 807 249 --23880 139 --
NM_001039583chr221126 --2372 102 --
NM_001039584chr221126 --2372 102 --
NM_001039585chr163681 3394 2877 1615 1533 213 21271 554 ----
NM_001039590chrX73244 3108 2562 1410 1119 1036 156 33787 3475 1438 12469 --
NM_001039591chrX73244 3108 2562 1410 1119 1036 156 33787 3475 1438 12469 --
NM_001039618chr11135712 5392 5045 4688 2211 1751 1468 1410 1395 1368 756 600 326 ----13720
NM_001039619chr142126 49 ------
NM_001039690chr1632136 1944 107 --11825 --
NM_001039711chr1--1730 ----
NM_001039712chr1--1730 ----
NM_001039771chr145923 875 808 340 310 --1230 --
NM_001039775chr1140 ------
NM_001039802chr121064 975 ------
NM_001039840chrX96017 5015 4576 4492 4249 3786 1387 445 88 --25815 1766 --
NM_001039847chr19----2146 22 --
NM_001039888chr14658 640 598 518 ------
NM_001039935chr5--2380 341 ----
NM_001039937chr1394135 4070 3902 2763 1227 1010 608 258 67 12846 ----
NM_001040001chr621911 1602 ------
NM_001040056chr16----131 1505
NM_001040057chr711403 11298 2994 180 --
NM_001040092chr81359 ------
NM_001040101chr41473 --2362 156 --
NM_001040110chr731541 1238 1216 --1602 --
NM_001040134chr1941443 1428 583 454 ------
NM_001040142chr211725 1240 ----
NM_001040143chr211725 1240 ----
NM_001040144chr1632136 1944 107 --11825 --
NM_001040146chr1632136 1944 107 --11825 --
NM_001040152chr785119 5070 4996 3616 3167 1514 1197 112 --14431 --
NM_001040153chr131971 ------
NM_001040157chr41717 12541 1359 --
NM_001040158chr52533 208 ------
NM_001040159chr421084 461 ----11328
NM_001040167chr751192 255 226 184 172 --164 1388
NM_001040181chr31425 ------
NM_001040182chr31425 ------
NM_001040183chr31425 ------
NM_001040199chr31425 ------
NM_001040200chr31425 ------
NM_001040260chr451090 1046 1015 871 56 --279 31 --
NM_001040261chr451090 1046 1015 871 56 --279 31 --
NM_001040272chr912315 --1795 --
NM_001040284chr1623624 1089 45490 4269 3818 2324 21019 730 11442
NM_001040402chr462614 891 823 263 158 69 22648 2352 1163 --
NM_001040424chr21170 --1915 --
NM_001040427chr16----164 --
NM_001040429chr1322971 1198 2167 48 ----
NM_001040431chr17189 --133 --
NM_001040439chr1621464 1009 ------
NM_001040440chr51174 ------
NM_001040441chr144061 3929 3424 194 ------
NM_001040455chr1141264 1214 246 212 ------
NM_001040624chr862506 2475 2453 2043 1755 408 ------
NM_001040625chr862506 2475 2453 2043 1755 408 ------
NM_001040626chr862506 2475 2453 2043 1755 408 ------
NM_001040627chr862506 2475 2453 2043 1755 408 ------
NM_001040628chr862506 2475 2453 2043 1755 408 ------
NM_001040629chr862506 2475 2453 2043 1755 408 ------
NM_001040630chr862506 2475 2453 2043 1755 408 ------
NM_001040633chr71750 1883 ----
NM_001040694chr1171151 1064 937 914 186 158 82 --1358 --
NM_001040697chr11195 --1479 --
NM_001040708chr821136 59 ------
NM_001040712chr933182 882 412 23575 529 1683 --
NM_001040715chr163985 829 803 1251 ----
NM_001042353chr20--1400 1112 --
NM_001042355chr1665370 3811 3600 3587 3301 539 23356 517 13982 13727
NM_001042357chr104580 487 202 108 1975 1612 --
NM_001042358chr104580 487 202 108 1975 1612 --
NM_001042360chr104580 487 202 108 1975 1612 --
NM_001042361chr105611 518 233 139 46 11006 1643 --
NM_001042363chr104580 487 202 108 1975 1612 --
NM_001042364chr105611 518 233 139 46 11006 1643 --
NM_001042365chr105611 518 233 139 46 11006 1643 --
NM_001042371chr1651753 689 652 413 87 ------
NM_001042387chr105611 518 233 139 46 11006 1643 --
NM_001042388chr183831 621 29 1646 ----
NM_001042389chr104580 487 202 108 1975 1612 --
NM_001042390chr104580 487 202 108 1975 1612 --
NM_001042392chr104580 487 202 108 1975 1612 --
NM_001042393chr105611 518 233 139 46 11006 1643 --
NM_001042395chr104580 487 202 108 1975 1612 --
NM_001042396chr105611 518 233 139 46 11006 1643 --
NM_001042397chr105611 518 233 139 46 11006 1643 --
NM_001042404chr121838 643 ------
NM_001042406chr6182 ------
NM_001042412chr1665370 3811 3600 3587 3301 539 23356 517 13982 13727
NM_001042413chr922596 278 13456 1434 --
NM_001042414chr13168 ------
NM_001042425chr61110 --198 --
NM_001042453chrX----11515 --
NM_001042473chr1032104 2012 807 1199 ----
NM_001042475chr6149 --135 --
NM_001042476chr1642001 1873 1804 1415 --11851 --
NM_001042481chr1422311 866 12217 ----
NM_001042486chr2011450 --21405 254 --
NM_001042492chr1763516 3155 2766 2652 1256 108 ------
NM_001042494chr1553396 2337 853 530 30 ----23337 1155
NM_001042495chr1553396 2337 853 530 30 ----23337 1155
NM_001042496chr1553396 2337 853 530 30 ----23337 1155
NM_001042497chr1553396 2337 853 530 30 ----23337 1155
NM_001042506chrX31385 1127 576 --11188 --
NM_001042510chr841545 1350 539 435 195 ----
NM_001042511chr841545 1350 539 435 195 ----
NM_001042517chr131979 ------
NM_001042537chrX72079 1663 1623 962 886 628 463 --42176 1995 592 509 --
NM_001042539chr1621112 360 ------
NM_001042550chr971972 1911 1848 1646 1572 753 32 --11517 --
NM_001042555chr1264632 4363 3535 3520 1288 604 14784 ----
NM_001042599chr256650 5962 5557 5066 39 --27633 7107 --
NM_001042601chr353080 2840 863 563 374 ------
NM_001042603chr1275148 4915 3614 2039 1460 1299 992 34606 3799 1042 21554 754 --
NM_001042604chr334035 3151 3038 21396 1119 23526 562 --
NM_001042616chr41211 ------
NM_001042632chr2042530 1974 1740 500 1816 11934 1387
NM_001042633chr2042530 1974 1740 500 1816 11934 1387
NM_001042669chr431547 1209 334 1434 ----
NM_001042681chr12860 823 11837 12047 --
NM_001042682chr12860 823 11837 12047 --
NM_001042682chr12860 823 11837 12047 --
NM_001042683chr62713 592 ------
NM_001042728chr123428 217 93 11070 ----
NM_001042749chrX1390 11672 11809 --
NM_001042750chrX1390 11672 11809 --
NM_001042751chrX1390 11672 11809 --
NM_001043318chr14124006 3931 3595 3476 1618 1386 1268 1120 1102 776 768 396 --21188 1109 14089
NM_001044305chr651539 1321 1220 509 72 ----151
NM_001044385chr293201 2819 2717 1424 1254 1232 1169 947 164 22686 1017 11210 12570
NM_001044722chr552321 2100 1734 314 48 1928 ----
NM_001044723chr552321 2100 1734 314 48 1928 ----
NM_001046chr522998 2902 1226 ----
NM_001066chr142193 2177 1952 207 ------
NM_001068chr31285 ------
NM_001069chr6143 ------
NM_001077628chr1--1660 ----
NM_001079874chr121760 1498 --11895 --
NM_001083620chr422444 433 ------
NM_001087chr22259 142 ------
NM_001095chr1251609 1337 1277 677 342 ------
NM_001096chr172249 88 --1257 --
NM_001100108chr1178248 7709 7179 6864 6711 5986 5795 5744 5284 5161 2224 2016 923 819 520 502 481 37826 6505 1856 22343 757 --
NM_001106chr3189654 9637 9352 9040 8646 8591 7787 7246 7202 7168 6954 6737 3803 3376 3144 3104 1286 1257 28122 6289 38022 2102 836 17443
NM_001107chr141205 ------
NM_001113490chrX33073 2306 871 ------
NM_001116chr1663044 2424 2355 1891 423 69 12484 12096 --
NM_001117chr182637 493 1532 ----
NM_001119chr451278 1229 995 451 379 11041 1353 --
NM_001121chr1021821 362 ------
NM_001122679chr511257 ------
NM_001123chr101337 ------
NM_001124chr112469 200 ------
NM_001128chr1683982 2987 1540 1425 935 597 404 71 3196 151 124 ----
NM_001135chr151715 ------
NM_001146chr82591 484 1268 1276 --
NM_001148chr442059 1983 818 228 1652 11700 --
NM_001149chr1021266 488 ------
NM_001154chr4----127 --
NM_001157chr10----1230 --
NM_001167chrX96708 5113 2615 2462 2204 1920 1882 1208 1052 21800 916 ----
NM_001173chr1454425 1722 1214 382 242 11558 14672 --
NM_001174chrX1421 --1159 --
NM_001177chr1231523 733 225 12387 ----
NM_001178chr111191 ------
NM_001186chr2162072 1223 1132 987 284 83 ------
NM_001191chr2041272 1183 1129 45 --1982 --
NM_001197chr22--1144 169 --
NM_001199chr8----1235 --
NM_001200chr2011076 ------
NM_001204chr247516 2285 1141 132 37190 1915 330 17757 --
NM_001206chr983069 2469 2175 2113 1108 884 758 250 --1467 --
NM_001217chr191103 ------
NM_001222chr1061717 1232 651 480 192 94 --1599 --
NM_001241chr2--1862 1195 --
NM_001241chr2--1862 1195 --
NM_001249chr141150 ------
NM_001256chr1732667 1054 675 ----11943
NM_001259chr7146100 5600 5467 2459 2338 1980 1820 1554 1211 1203 1002 837 139 119 24908 273 16378 --
NM_001260chr13131 ------
NM_001261chr93887 802 46 --2792 206 --
NM_001265chr132818 63 ------
NM_001271chr1533243 416 113 22237 480 11097 23129 969
NM_001273chr121441 ------
NM_001282chr1762644 2534 2493 1761 795 80 --32328 231 161 --
NM_001284chr53388 179 171 ------
NM_001290chr41431 1749 ----
NM_001293chr112409 30 ------
NM_001299chr19243 21 ------
NM_001304chr1752934 1450 808 586 94 42815 2643 1416 1231 13019 --
NM_001308chr10145 ------
NM_001310chr1272992 2725 2447 1015 695 620 172 1965 12565 --
NM_001315chr65815 690 553 301 261 2657 23 --11647
NM_001328chr41483 ----1699
NM_001329chr1041022 537 331 175 ------
NM_001331chr1172724 2191 2052 1875 703 618 271 1764 ----
NM_001332chr531078 985 108 ------
NM_001343chr53654 482 127 --11252 --
NM_001345chr122253 83 ------
NM_001346chr342129 996 967 899 --12454 1581
NM_001347chr421059 40 --11383 --
NM_001351chr3136 11821 ----
NM_001352chr19------147
NM_001356chrX31777 219 190 --1351 12364
NM_001363chrX3664 295 183 174 1730 --
NM_001364chr1144577 3806 3502 2969 --13849 --
NM_001365chr171254 --1145 --
NM_001379chr19124 ------
NM_001385chr81167 ------
NM_001386chr842131 2017 1727 710 1671 12124 11641
NM_001389chr211169 ------
NM_001390chr18103519 3251 3163 3136 2828 2702 1384 979 436 375 12417 ----
NM_001396chr2132266 1926 1106 --12554 --
NM_001399chrX103221 2740 2413 1538 1188 657 564 407 166 79 13061 2638 296 --
NM_001401chr911364 ------
NM_001402chr622031 1769 1521 12011 --
NM_001406chr1721547 135 ------
NM_001407chr331081 577 102 --11591 --
NM_001408chr151628 1438 1090 419 64 ------
NM_001412chrX53326 3199 2613 2472 280 ------
NM_001415chrX41613 722 657 628 11581 --11605
NM_001416chr171343 ------
NM_001417chr1231492 1384 164 ------
NM_001418chr112299 41 ------
NM_001418chr112299 41 ------
NM_001419chr1964091 3254 1948 1942 817 516 --13305 --
NM_001420chr1922951 1926 12095 12562 --
NM_001421chrX41571 1355 1164 1132 ------
NM_001426chr2188 ------
NM_001427chr741877 763 625 388 ----1365
NM_001429chr2221008 897 ------
NM_001430chr22807 215 ------
NM_001431chr641055 914 399 315 ------
NM_001438chr121395 531 1536 ----
NM_001447chr531328 577 128 --1903 --
NM_001448chrX51757 1549 1399 507 206 ------
NM_001449chrX21060 1017 ------
NM_001451chr161954 1336 --1275
NM_001453chr651759 1718 1673 347 332 ------
NM_001455chr6114617 3353 3174 3140 1609 1274 1151 1134 988 855 85 13315 13982 21844 1623
NM_001460chr132341 1152 808 22840 133 1154 --
NM_001461chr13550 163 24 ------
NM_001463chr24780 307 163 59 ------
NM_001483chr71110 ----1968
NM_001493chrX3570 250 71 --125 1608
NM_001494chr10186 ------
NM_001495chr811132 --1898 --
NM_001497chr942492 2376 70 49 22601 2279 12663 --
NM_001498chr631241 866 853 ------
NM_001508chr21928 ------
NM_001521chr23752 590 584 ------
NM_001523chr192243 59 --182 --
NM_001527chr694736 4352 4137 4088 1785 1006 767 735 470 13797 ----
NM_001530chr14----1850 --
NM_001542chr131746 916 909 52806 2586 2140 1865 852 12001 --
NM_001546chr641238 1196 1074 248 ------
NM_001553chr4162 ------
NM_001554chr11126 ------
NM_001555chrX295 43 ------
NM_001560chrX62072 1934 1870 1057 875 325 ------
NM_001570chr351320 1263 1240 1175 117 1434 ----
NM_001587chrX41953 1450 800 779 --22077 382 --
NM_001609chr10139 24403 1395 --14181
NM_001614chr172526 30 1176 ----
NM_001614chr172526 30 1176 ----
NM_001616chr273409 2968 2601 1167 1133 509 443 ------
NM_001619chr111342 --2422 165 --
NM_001622chr33338 319 91 ------
NM_001624chr631871 1364 1240 ------
NM_001629chr132251 83 ------
NM_001634chr61431 --1236 --
NM_001649chrX82469 2187 1995 1831 1812 1796 464 247 1200 ----
NM_001650chr1833051 1331 1073 12606 ----
NM_001654chrX1447 ------
NM_001656chr521649 1329 ------
NM_001658chr1139 ------
NM_001660chr3--1726 ----
NM_001661chr171277 ------
NM_001662chr74392 158 134 128 ------
NM_001663chr141858 --21908 427 --
NM_001664chr32278 130 ------
NM_001665chr112481 201 1512 ----
NM_001668chr161844 852 739 483 158 152 21513 801 ----
NM_001677chr12421 313 ------
NM_001679chr31193 --1185 --
NM_001681chr121260 ------
NM_001682chr1251080 832 544 483 396 ------
NM_001683chr31952 ------
NM_001684chr194193 3516 3393 2975 2859 1442 791 771 102 24171 3320 33620 3608 1605 --
NM_001690chr342303 1916 883 145 ------
NM_001693chr84952 496 483 255 --11095 --
NM_001694chr161312 --1389 --
NM_001695chr8103920 2898 2751 2717 1523 1489 1353 605 341 103 1406 --13319
NM_001701chr921216 1003 --11348 --
NM_001704chr61558 ------
NM_001707chr74320 295 195 74 1597 ----
NM_001709chr1162554 2326 2084 1798 941 504 --22647 2599 --
NM_001718chr611150 ------
NM_001722chr83234 50 44 --1215 --
NM_001730chr1321497 1012 --1208 --
NM_001730chr1321497 1012 --1208 --
NM_001735chr92292 143 --149 --
NM_001741chr111252 ------
NM_001742chr72699 169 2740 637 ----
NM_001743chr23537 504 465 ------
NM_001746chr562922 2514 2285 2154 919 202 1959 ----
NM_001753chr771542 1493 1412 1306 1162 1145 667 11797 ----
NM_001754chr21114220 3788 3219 3105 3037 2985 598 587 467 209 70 11673 13042 --
NM_001755chr1612007 1561 ----
NM_001759chr12105257 4838 4598 3392 3288 3282 2075 1291 704 562 --1610 11163
NM_001773chr141325 1262 144 107 11419 ----
NM_001777chr3104014 2649 2622 1515 1256 1070 754 748 741 95 --23348 3219 11674
NM_001788chr72852 286 ------
NM_001789chr391735 1660 1522 1364 678 610 372 202 63 --1179 --
NM_001791chr121064 975 ------
NM_001792chr18----1113 --
NM_001797chr161763 1542 ----
NM_001798chr1211101 1256 1384 --
NM_001800chr192468 99 ------
NM_001810chr203542 532 191 ------
NM_001823chr14--1167 132 --
NM_001825chr5137 ------
NM_001826chr1----1334 --
NM_001827chr91224 ------
NM_001829chr41978 1954 1356 --
NM_001830chrX83287 596 585 579 572 450 342 246 ------
NM_001839chr12721 665 ------
NM_001842chr92500 474 --1563 --
NM_001845chr132550 155 11051 --1176
NM_001851chr62626 283 ------
NM_001855chr9----1640 --
NM_001858chr664705 4223 3368 2065 1623 1255 24028 1286 --1479
NM_001859chr993952 3195 3063 2941 1238 343 146 92 73 21437 1389 --11286
NM_001860chr941123 400 239 148 ------
NM_001863chr191111 ------
NM_001872chr133409 385 24 ------
NM_001880chr21302 ------
NM_001892chr531347 1168 582 ------
NM_001895chr2031048 783 340 --11176 --
NM_001896chr163331 293 25 ------
NM_001901chr62799 337 ------
NM_001903chr51591 ------
NM_001904chr31279 1363 11034 --
NM_001913chr71626 ------
NM_001915chr1762063 1746 1603 1397 228 170 1410 1763 155
NM_001920chr121774 1221 ----
NM_001923chr11--126 152 --
NM_001933chr142947 111 11208 ----
NM_001935chr21812 1259 ----
NM_001938chr121212 133 11577 ----
NM_001939chrX53848 2919 2815 1476 268 12351 23685 3634 23622 870
NM_001946chr12----124 --
NM_001948chr1531288 1261 256 ------
NM_001949chr673194 2495 2129 694 634 455 223 --2382 334 11053
NM_001956chr13505 250 88 ------
NM_001964chr51329 ----1796
NM_001967chr31209 143 1518 --
NM_001968chr41379 ------
NM_001970chr17----1404 --
NM_001977chr421242 579 --11408 --
NM_001978chr821033 199 --141 --
NM_001981chr13883 356 237 ------
NM_001991chr1722058 70 --12088 --
NM_001995chr45602 510 400 371 325 --1379 157
NM_001998chr3--1118 ----
NM_001999chr521266 329 ------
NM_002006chr475603 4095 1517 755 590 514 216 --11117 --
NM_002009chr151361 12570 ----
NM_002010chr132217 106 ------
NM_002014chr123548 541 63 1629 ----
NM_002015chr1382869 2729 1138 604 593 552 479 223 ------
NM_002017chr1111264 ------
NM_002023chr141395 1220 1076 74 1183 ----
NM_002024chrX22061 1791 ------
NM_002025chrX58638 6976 6715 3634 2570 17179 28325 1536 --
NM_002026chr23904 379 219 ------
NM_002027chr82439 157 ------
NM_002028chr1431264 1111 421 1354 ----
NM_002031chr62830 347 1595 ----
NM_002035chr1873876 3795 2702 1391 1188 945 614 --153 --
NM_002040chr2142818 2599 469 403 --12987 --
NM_002045chr31102 ------
NM_002046chr12160 ------
NM_002051chr1021128 755 ------
NM_002052chr841457 1230 985 384 --1975 --
NM_002054chr2141 ------
NM_002056chr2--1849 ----
NM_002063chrX1978 ------
NM_002065chr141205 553 516 145 31640 1282 24 ----
NM_002069chr721488 1202 ------
NM_002071chr182539 178 ------
NM_002074chr151525 1281 1268 1162 384 1159 ----
NM_002076chr1273257 3249 3196 2928 2595 2522 129 22097 1191 12367 --
NM_002077chr932103 863 722 ------
NM_002079chr101453 ------
NM_002086chr1772054 1986 1688 1566 600 486 237 ----12154
NM_002092chr4105024 3804 3618 3144 1646 1425 1164 1028 940 528 ------
NM_002095chr82260 92 ----158
NM_002103chr19141 ------
NM_002107chr1166 ------
NM_002111chr4113856 3298 3203 1464 1428 1335 1022 1015 762 378 367 23376 1400 32713 1076 299 --
NM_002114chr6--1352 ----
NM_002126chr1763767 3657 3137 2837 1661 391 ------
NM_002128chr1322523 2444 12469 ----
NM_002130chr511301 1187 1201 --
NM_002136chr122515 455 ------
NM_002137chr72593 480 11713 11914 --
NM_002138chr4190 ------
NM_002139chrX1123 ------
NM_002140chr951083 347 177 135 106 ------
NM_002141chr73577 61 40 --1230 --
NM_002146chr1741178 1081 920 578 ------
NM_002147chr172815 250 --1642 --
NM_002148chr21146 ------
NM_002156chr21178 ------
NM_002158chr232327 1243 165 1412 ----
NM_002166chr21656 ------
NM_002181chr23533 285 33 1646 ----
NM_002188chr51568 ------
NM_002193chr23557 536 112 --11876 --
NM_002196chr204981 920 402 338 ------
NM_002196chr204981 920 402 338 ------
NM_002199chr43675 403 138 --1217 --
NM_002202chr5--1954 133 --
NM_002203chr553782 1072 777 633 54 ------
NM_002205chr123985 841 712 ------
NM_002207chr32780 743 --1492 --
NM_002211chr102716 434 1776 ----
NM_002214chr765555 4101 3542 2056 318 115 1178 ----
NM_002221chr142873 2518 1937 1090 1285 1367 --
NM_002222chr321125 482 ------
NM_002223chr1283731 3219 3069 2959 1573 942 325 205 12716 ----
NM_002226chr14--1578 2749 653 --
NM_002227chr12950 415 --1390 11182
NM_002232chr12945 176 --1151 --
NM_002235chr1221198 1169 11147 1431 --
NM_002240chr21187 ------
NM_002241chr152616 1970 1129 949 559 1519 22100 140 --
NM_002242chr221567 255 ----1208
NM_002246chr22400 153 1794 3323 77 52 --
NM_002247chr1032317 594 85 --11777 --
NM_002252chr2121 1137 ----
NM_002254chr282336 1997 1515 1463 868 658 508 156 12280 ----
NM_002264chr394909 4873 4475 3709 3229 1240 1173 809 145 --1451 11679
NM_002267chr1362307 1904 1711 953 816 258 --1763 --
NM_002268chr32447 131 11298 ----
NM_002270chr524335 1826 25557 5353 ----
NM_002271chr1331776 1574 982 ------
NM_002276chr17125 ------
NM_002285chr253010 2708 1256 624 475 23951 488 ----
NM_002290chr611375 1959 ----
NM_002293chr182704 2573 2203 2154 2092 2082 1054 106 11880 ----
NM_002294chrX1162 ------
NM_002298chr1331508 452 426 1605 ----
NM_002309chr2252607 2252 420 298 118 22337 2195 ----
NM_002310chr576380 5632 4935 2347 1915 743 345 --21900 694 24195 1946
NM_002313chr10115044 5023 4113 3417 2049 1229 1009 966 759 734 314 14770 35058 1705 1247 --
NM_002332chr121199 1738 ----
NM_002333chr1911105 ------
NM_002334chr1141717 599 336 31 ------
NM_002336chr1274324 1694 1666 1635 893 610 205 24529 4371 21563 739 --
NM_002349chr23550 164 86 ------
NM_002350chr831213 492 240 ------
NM_002355chr1261113 1036 1019 989 564 116 --1481 --
NM_002356chr662806 2482 2234 2059 1949 749 ------
NM_002359chr17114264 4044 3842 3760 3279 3187 3163 1293 1133 967 487 12902 73933 3648 3518 3385 3315 1335 1302 --
NM_002360chr742249 2165 1007 232 --32620 692 411 --
NM_002373chr1551342 1325 1305 1296 843 165 ----
NM_002374chr253674 3593 2465 1008 250 ----12929
NM_002375chr362291 1859 750 372 299 59 --31994 1914 686 --
NM_002381chr2294 76 ------
NM_002382chr141842 11199 ----
NM_002384chr18----1682 --
NM_002385chr1831076 373 79 1439 ----
NM_002387chr5105073 4889 4738 4514 4198 4133 898 429 275 254 2907 480 11058 --
NM_002395chr63980 562 254 ------
NM_002397chr51267 11668 ----
NM_002398chr231089 957 141 ------
NM_002399chr1511279 ------
NM_002401chr17101898 1816 1759 1694 991 803 675 77 56 38 --12238 --
NM_002407chr11--2124 59 ----
NM_002408chr142227 95 ------
NM_002427chr111235 11179 ----
NM_002428chr1631283 1180 240 ------
NM_002430chr2262413 1902 944 782 373 152 1112 1734 --
NM_002436chrX3446 159 65 ------
NM_002438chr101589 ------
NM_002442chr123419 395 252 --1168 --
NM_002444chrX61796 1440 1331 1290 590 323 ------
NM_002445chr83375 191 32 ------
NM_002449chr54927 484 190 93 --11034 1837
NM_002457chr111125 ------
NM_002460chr663376 1515 1361 1248 1045 74 33688 3609 2583 1514 1688
NM_002472chr17190 ------
NM_002473chr2251242 461 214 186 101 ------
NM_002480chr1221141 569 1248 ----
NM_002481chr1137809 6702 6509 6042 5423 5037 3155 1628 1405 1017 853 181 45 --45326 5205 3194 308 --
NM_002486chr932432 2335 82 ------
NM_002489chr71335 ------
NM_002495chr5124 ------
NM_002499chr1542379 1876 1807 635 21730 835 --1227
NM_002500chr22183 95 ------
NM_002501chr1943895 3649 1317 1129 --11017 --
NM_002505chr6--1229 ----
NM_002509chr202687 604 ------
NM_002515chr142603 443 ------
NM_002516chr191102 ------
NM_002518chr221084 433 1821 1166 --
NM_002519chr111583 11398 ----
NM_002522chr1783899 3295 2932 2651 2594 1500 174 43 22873 2804 1741 13927
NM_002524chr14834 395 240 125 1423 194 --
NM_002527chr121288 ------
NM_002530chr152129 34 ------
NM_002536chrX61349 1294 1213 287 204 157 ------
NM_002537chr152951 759 --1384 --
NM_002539chr21311 1250 ----
NM_002541chr74865 765 134 58 1210 ----
NM_002545chr1193460 3374 3160 1806 1499 287 261 255 34 ------
NM_002556chr1151972 1828 1413 666 354 11670 ----
NM_002568chr81421 ------
NM_002575chr183571 127 108 ------
NM_002576chr1131100 411 99 ------
NM_002577chr374022 3944 2968 804 563 440 398 1302 ----
NM_002578chrX160 ------
NM_002579chr1941443 1428 583 454 ------
NM_002581chr9105550 5528 5344 5145 4152 4106 837 804 763 670 15650 34200 1274 852 --
NM_002586chr61634 --11081 --
NM_002588chr51236 --1609 --
NM_002589chr4----168 --
NM_002595chr1241847 1575 432 319 ------
NM_002600chr12715 230 --1638 1443
NM_002603chr81150 ------
NM_002605chr1511050 --1216 --
NM_002607chr751278 1257 1122 900 439 ------
NM_002608chr2251534 1346 1256 1222 52 ------
NM_002609chr52494 133 11855 ----
NM_002610chr233126 2658 395 ------
NM_002613chr1685097 4885 4340 1722 1479 1204 529 227 44618 4317 980 909 43678 1248 628 398 --
NM_002618chr21125 ------
NM_002623chr201152 ------
NM_002628chr32988 125 11125 ----
NM_002634chr173909 633 77 --2787 280 2709 612
NM_002635chr122130 32 1159 ----
NM_002636chr61158 ------
NM_002645chr113366 219 169 --1150 --
NM_002648chr641025 956 848 261 21148 346 21242 505 --
NM_002655chr855276 5222 5056 4123 103 14838 1570 11131
NM_002660chr2011163 --3973 743 402 --
NM_002663chr172415 36 ----1508
NM_002667chr61175 1249 ----
NM_002670chr351509 1279 1210 344 143 ------
NM_002673chr33564 440 214 --2159 24 --
NM_002687chr1411035 ------
NM_002693chr151397 ------
NM_002698chr1942627 1126 1055 102 ------
NM_002699chr131084 950 267 ------
NM_002707chr21355 ------
NM_002710chr122154 90 1425 ----
NM_002714chr64853 137 65 21 1236 ----
NM_002716chr1163472 3160 2518 1463 868 851 --43581 3386 898 649 --
NM_002717chr82197 36 ------
NM_002719chr1432013 1524 737 ------
NM_002721chr9--1103 ----
NM_002729chr101625 ------
NM_002730chr1961376 1083 1066 522 429 293 --1334 --
NM_002731chr142976 2879 1157 1146 151 ----
NM_002734chr172919 226 --11969 --
NM_002736chr721816 730 ------
NM_002737chr17136155 5804 5102 5096 4624 4489 4455 4303 4287 2633 1417 902 291 21806 736 34499 1883 1846 --
NM_002738chr164921 811 462 302 ------
NM_002739chr192728 495 ------
NM_002742chr141683 1135 ----
NM_002745chr2294463 4450 4406 4203 3591 3580 2951 1603 272 11174 --1356
NM_002747chr1821840 95 ------
NM_002748chr1511226 ------
NM_002752chr51157 ------
NM_002753chr42543 292 ------
NM_002755chr153801 329 321 ------
NM_002756chr174975 803 764 307 2656 262 1235 --
NM_002760chrY115782 5692 4583 4536 4427 2213 2155 1836 1728 1649 1438 35684 5562 5059 --15271
NM_002761chr161112 ------
NM_002779chr10----2449 30 --
NM_002787chr72581 211 --1591 --
NM_002806chr141242 ------
NM_002808chr31109 --159 --
NM_002813chr1231469 1329 1282 --2485 341 --
NM_002814chrX2278 218 1202 --1150
NM_002819chr193995 166 135 --11217 --
NM_002822chr12--11676 ----
NM_002823chr23620 600 228 1676 ----
NM_002824chr12196 ------
NM_002826chr16764 651 628 345 289 89 --1216 --
NM_002827chr2011760 --21229 569 --
NM_002830chr21141 ------
NM_002833chr1551334 1218 1210 1150 229 --126 --
NM_002834chr1253620 3552 2772 1491 199 2816 696 ----
NM_002835chr73621 232 132 --1495 --
NM_002837chr1284000 3081 3075 495 453 445 379 65 1100 13550 --
NM_002839chr933182 882 412 23575 529 1683 --
NM_002840chr131570 619 268 1497 --11354
NM_002843chr1173386 3183 2769 2279 2183 1326 775 13034 ----
NM_002844chr631234 74 66 1906 --1993
NM_002845chr181185 ------
NM_002848chr1251217 830 309 104 50 1879 ----
NM_002849chr1221037 714 1362 ----
NM_002855chr11143577 3449 3392 3379 3044 2705 2597 2591 2487 1485 1284 823 761 299 23172 776 13467 22978 629
NM_002865chr8169 ------
NM_002867chr16547 513 133 97 63 53 ------
NM_002868chr1262277 1585 844 395 378 186 12449 ----
NM_002869chr1152225 2077 1554 386 132 --1534 11635
NM_002871chr151669 590 330 191 161 ------
NM_002874chr972245 2188 935 701 500 339 178 ------
NM_002880chr34319 220 111 67 ------
NM_002886chr385196 4433 4229 4139 3469 1377 1112 80 1748 33282 1335 1182 --
NM_002890chr53931 350 152 ------
NM_002892chr143486 388 34 ------
NM_002893chrX--129 1299 --
NM_002897chr21510 1753 ----
NM_002900chr10------1116
NM_002902chr151505 ------
NM_002904chr61179 ------
NM_002906chr1122120 1866 21755 275 ----
NM_002912chr62631 60 --1700 --
NM_002923chr11487 ------
NM_002924chr13490 195 189 ------
NM_002930chr18172 ------
NM_002931chr61204 ------
NM_002938chr441998 1983 598 322 ------
NM_002941chr351267 1067 522 277 224 ------
NM_002942chr32359 328 ------
NM_002945chr171861 ------
NM_002948chr331056 368 59 11127 ----
NM_002950chr32331 47 ------
NM_002953chr13549 524 204 1818 1574 --
NM_002955chr611240 189 21609 1587 --
NM_002956chr122519 30 ------
NM_002957chr9123769 3763 3572 3233 2405 1298 1117 828 734 445 379 107 --33779 994 919 --
NM_002958chr31656 ------
NM_002959chr183555 3392 3078 1033 1017 788 432 119 --14103 --
NM_002968chr163318 203 37 --2450 286 --
NM_002970chrX163 ------
NM_002994chr441357 258 244 236 21823 436 ----
NM_002996chr1621305 247 11401 21656 432 --
NM_002998chr862169 2115 1398 777 590 392 ------
NM_002999chr2051923 1545 1266 1202 773 --21787 1677 --
NM_003001chr12801 431 ------
NM_003002chr11152 ------
NM_003010chr1751948 1676 594 539 227 ------
NM_003011chr971701 1433 1364 1278 320 306 119 ------
NM_003013chr43853 59 33 ------
NM_003016chr1721681 300 --1250 --
NM_003020chr152169 36 ------
NM_003026chr921200 255 11373 ----
NM_003028chr982930 2791 1546 1475 866 152 85 21 23831 2589 21216 784 --
NM_003032chr362180 2143 1946 1801 772 98 --11980 --
NM_003034chr12158022 7976 7960 7480 6829 6663 6211 6075 5592 5229 5118 5073 2704 776 254 47970 5871 550 374 26255 1421 --
NM_003036chr11260 --2265 250 --
NM_003042chr342107 753 483 349 --1758 --
NM_003043chr333870 3096 985 --138 11084
NM_003045chr1384870 4856 4569 3722 3098 1710 1214 705 34954 4090 3111 31720 786 546 --
NM_003046chr885355 5134 4606 1213 1194 663 657 103 --34999 2074 770 --
NM_003047chr171435 1425 1051 927 427 228 63 1482 31119 1044 912 --
NM_003051chr191982 1715 1621 1580 1246 739 731 567 426 21868 340 ----
NM_003060chr52133 103 11209 ----
NM_003063chr113140 76 52 ------
NM_003068chr821076 344 1238 ----
NM_003069chrX----1732 --
NM_003070chr91338 ------
NM_003071chr341965 1752 1697 1399 --1688 --
NM_003072chr192295 283 ------
NM_003076chr1251377 1318 160 113 88 --1597 11540
NM_003077chr174562 307 259 104 --165 --
NM_003081chr201883 31042 322 286 1921 --
NM_003087chr101226 ------
NM_003089chr19123 --157 1161
NM_003091chr203207 96 79 ------
NM_003093chr6271 44 ------
NM_003099chr1585622 5070 1573 1526 771 575 523 211 35846 4929 1215 11294 --
NM_003107chr622293 879 ------
NM_003108chr297084 6925 6235 5660 5527 5105 1978 1669 1520 --21640 1003 --
NM_003110chr1731100 707 116 ------
NM_003111chr211219 ------
NM_003112chr7--12896 ----
NM_003114chr82778 171 ------
NM_003127chr91104 --152 --
NM_003128chr251944 1138 883 839 319 1688 1499 --
NM_003131chr641883 1714 516 231 ----1412
NM_003136chr141105 149 ----
NM_003137chr632166 1494 500 --1462 --
NM_003144chr641993 1506 557 317 2652 155 ----
NM_003150chr1752377 2269 398 201 140 --22140 1605 1467
NM_003153chr1241028 758 71 58 --11014 --
NM_003155chr842482 1921 785 279 ------
NM_003156chr1151188 363 321 272 231 ------
NM_003161chr1743544 1131 1055 913 33330 330 206 ----
NM_003162chr22751 191 1109 --1320
NM_003164chr113506 109 28 ------
NM_003165chr981519 1503 1332 615 580 226 190 51 ------
NM_003173chrX91288 1201 1194 547 377 351 134 124 66 --21085 396 --
NM_003178chr371693 1603 1459 866 181 175 102 ------
NM_003179chrX21291 121 ------
NM_003185chr201122 ------
NM_003188chr61132 ------
NM_003189chr162522 2389 951 668 595 48 23154 970 ----
NM_003199chr1854511 3578 1852 1769 845 15137 ----
NM_003200chr191677 --31497 303 111 --
NM_003202chr53528 308 49 ------
NM_003204chr1751578 1357 1209 602 273 11805 ----
NM_003211chr1231396 610 23 ------
NM_003216chr22103288 2983 2360 2306 2145 2064 1103 1033 840 730 --1124 12785
NM_003220chr61110 --198 --
NM_003223chr161527 ------
NM_003236chr253154 2906 934 266 175 1710 ----
NM_003244chr181128 ------
NM_003246chr152563 271 ------
NM_003247chr631664 1274 796 1417 ----
NM_003250chr172188 180 ------
NM_003253chr2121507 566 ------
NM_003255chr1761862 1819 872 847 803 137 22494 1870 22472 989 --
NM_003257chr151214 ------
NM_003262chr363993 3732 3673 3480 1298 1052 24935 3199 ----
NM_003263chr4143 ----135
NM_003269chr631170 825 241 ------
NM_003272chr12740 199 ------
NM_003275chr931547 1106 603 1974 1324 --
NM_003290chr192416 103 ------
NM_003291chr132565 222 ------
NM_003295chr13154 ------
NM_003298chr3105667 5200 5061 4226 2448 2117 1795 1527 1363 1265 14521 45040 2466 1613 1144 25984 1214
NM_003304chr311364 --11086 --
NM_003305chr41292 ------
NM_003309chr681790 631 578 374 343 314 126 50 1109 ----
NM_003317chr142792 162 ------
NM_003319chr23875 328 292 1367 ----
NM_003324chr1211392 --21177 1084 --
NM_003330chr1231358 578 21 11126 ----
NM_003336chrX3909 249 111 1380 ----
NM_003337chr52227 203 11175 ----
NM_003338chr10--1314 ----
NM_003340chr41902 ------
NM_003341chr31167 ------
NM_003342chr1763215 2778 2697 2275 104 93 12288 ----
NM_003344chr771741 1422 1381 1132 1101 679 638 --1463 11457
NM_003345chr161529 ------
NM_003347chr2292336 2277 2210 2088 1948 862 758 500 212 ------
NM_003348chr1251330 1308 575 254 38 11191 ----
NM_003349chr2021320 1225 --21337 347 --
NM_003359chr441131 184 135 71 11240 ----
NM_003367chr192447 47 ------
NM_003369chr1152763 2092 1123 735 290 ------
NM_003370chr193263 165 58 1186 ----
NM_003371chr91425 --2715 463 --
NM_003373chr106692 543 480 443 324 86 11213 ----
NM_003374chr51717 ------
NM_003376chr621361 488 --1280 --
NM_003376chr621361 488 --1280 --
NM_003380chr101299 ------
NM_003385chr21141 ------
NM_003387chr24242 212 78 46 1442 ----
NM_003390chr112283 222 ------
NM_003392chr374300 4060 2820 1144 859 537 137 13539 11610 --
NM_003399chrX21024 52 --198 --
NM_003400chr21740 ------
NM_003403chr142760 207 ------
NM_003404chr2031857 549 539 11677 ----
NM_003405chr221176 ----1266
NM_003406chr821590 1486 --1619 --
NM_003407chr191558 ------
NM_003410chrX53028 699 554 506 309 1572 ----
NM_003411chrY41619 1515 1234 400 ------
NM_003412chr342800 2528 2366 2310 22351 396 21166 1056 --
NM_003413chrX51451 506 436 314 260 ------
NM_003418chr31777 ------
NM_003423chr1932006 1054 1017 ------
NM_003427chr63681 621 169 ------
NM_003432chr51134 --1121 --
NM_003442chr111559 ------
NM_003458chr383445 3248 1566 1503 1032 1021 220 48 --23577 3434 --
NM_003462chr141762 1284 367 248 ------
NM_003463chr633128 1020 493 --1213 --
NM_003467chr22383 363 ------
NM_003468chr254130 3486 3155 454 102 ------
NM_003469chr22150 88 1465 ----
NM_003470chr1641653 1183 709 114 ------
NM_003471chr361762 902 671 532 241 147 --1103 --
NM_003473chr1031051 310 34 ------
NM_003478chr1132801 1245 937 ------
NM_003482chr1252092 1904 1009 984 704 --21881 374 --
NM_003483chr1282951 2859 2831 2781 2663 2261 1904 238 ------
NM_003485chr1451049 276 238 125 77 ----1137
NM_003487chr17----168 --
NM_003488chr174880 790 391 306 141 ----
NM_003489chr2153323 2633 2622 1031 337 --12973 --
NM_003498chr1652517 592 285 81 28 3992 682 376 2232 108 --
NM_003506chr8--2998 362 ----
NM_003507chr271676 1324 658 591 315 89 75 --1369 --
NM_003513chr6125 ------
NM_003551chr51474 ------
NM_003557chr151428 1394 1287 1120 338 ------
NM_003558chr91212 ----1223
NM_003559chr1783924 3902 3007 2858 1446 631 227 201 1428 23149 540 --
NM_003563chr1731160 107 54 --1205 --
NM_003564chr11483 --1159 --
NM_003566chr1252839 2524 2332 1061 411 --12461 --
NM_003569chr62616 295 1208 ----
NM_003574chr1874595 3611 3555 1659 1574 610 363 44695 2173 2063 2032 14148 --
NM_003576chr1362875 2637 2440 931 887 372 --22689 1064 --
NM_003583chr1273777 3576 1477 828 787 443 84 147 ----
NM_003590chr253547 3032 1324 751 457 33504 2742 1389 1639 --
NM_003591chr103421 121 114 ------
NM_003592chr71380 ------
NM_003595chr222341 93 1119 ----
NM_003597chr241727 1561 916 179 22011 817 1776 --
NM_003603chr441940 1369 228 163 21885 627 ----
NM_003607chr194377 4254 3896 3204 3025 2837 1694 815 86 --11429 --
NM_003613chr151670 ------
NM_003615chr313198 13084 13130 --
NM_003618chr2--1265 ----
NM_003620chr173808 204 158 1935 ----
NM_003622chr1272637 2274 2268 911 834 119 51 ------
NM_003624chr1941353 920 150 33 --1391 --
NM_003626chr1121238 851 ------
NM_003628chr2------174
NM_003629chr1153499 3399 3244 3150 3130 3117 3038 3019 2397 2180 1382 1113 931 823 403 ------
NM_003632chr174601 311 221 103 ------
NM_003633chr572324 1843 1661 787 547 445 140 1773 1335 --
NM_003635chr102379 37 ------
NM_003637chr161167 1052 483 425 229 159 ------
NM_003644chr17166506 6253 5931 5899 5530 5380 4826 4681 4644 4632 4389 4148 2463 2365 1324 1081 16444 34475 2584 32 --
NM_003648chr252626 2422 2370 1789 487 --22008 1019 --
NM_003654chr112586 72 ------
NM_003656chr3156 ------
NM_003659chr221158 289 1835 ----
NM_003660chr191295 ------
NM_003663chr352893 2262 986 389 306 --22150 320 --
NM_003664chr52139 64 ------
NM_003668chr121116 ------
NM_003670chr331324 1177 545 11149 121 --
NM_003671chr993123 2713 2275 1024 1007 610 515 340 236 ------
NM_003672chr1--1700 2426 90 --
NM_003673chr17179 ------
NM_003680chr13512 62 46 ------
NM_003684chr16990 887 781 315 283 99 180 11011 --
NM_003690chr23560 520 472 ------
NM_003692chr91120 ------
NM_003709chr21338 ------
NM_003711chr52113 35 ------
NM_003713chr121134 305 143 21077 59 --
NM_003714chr553019 2791 2543 2425 304 22206 1195 ----
NM_003716chr34978 935 283 23 ------
NM_003718chr71485 ------
NM_003735chr51236 --1609 --
NM_003736chr51236 --1609 --
NM_003740chr651819 1374 1350 1211 568 --11247 --
NM_003741chr3----1342 --
NM_003743chr242127 791 782 537 ------
NM_003746chr12195 ------
NM_003749chr1352353 2304 2269 1598 909 ----11883
NM_003750chr101705 --1954 --
NM_003758chr1511611 --1183 --
NM_003758chr1511611 --1183 --
NM_003759chr463265 2950 638 632 275 148 23428 791 ----
NM_003760chr11560 ------
NM_003762chr131180 953 56 ------
NM_003763chr2062950 2851 915 876 233 163 12478 ----
NM_003766chr172612 529 ------
NM_003768chr131799 1482 1398 ------
NM_003774chr1233238 2454 183 1975 ----
NM_003778chr3197 1611 ----
NM_003779chr11147 ------
NM_003787chr1821561 1271 ------
NM_003792chr9----1139 --
NM_003794chr331074 1037 762 ------
NM_003795chr6----1224 --
NM_003796chr191422 ------
NM_003797chr112175 69 ------
NM_003799chr18103516 3385 3187 2991 2822 2756 1748 995 987 155 2486 93 13138 --
NM_003800chr641804 818 459 57 ------
NM_003812chr2137 ------
NM_003816chr8191 ------
NM_003818chr2021037 915 1829 1822 --
NM_003819chr11198 ------
NM_003821chr8156 ------
NM_003822chr141228 830 125 24 22759 841 11085 --
NM_003825chr152585 180 1167 ----
NM_003827chr194568 443 172 44 --2435 72 --
NM_003831chr1831793 400 383 ------
NM_003835chr17185 --1256 --
NM_003846chr11622 --1710 --
NM_003861chr1432419 467 425 12859 ----
NM_003870chr1532082 1700 752 11332 ----
NM_003872chr232382 1989 245 ------
NM_003873chr103942 822 800 2691 71 3808 597 214 --
NM_003877chr122978 954 --1810 1233
NM_003888chr1531462 1259 52 --11531 --
NM_003893chr10----1468 --
NM_003895chr2132080 1601 32 11925 ----
NM_003899chr1352587 1940 1840 765 118 126 22168 650 12506
NM_003901chr1052663 2079 1682 925 95 ------
NM_003902chr12704 330 ------
NM_003907chr31331 ------
NM_003908chr2041321 973 530 448 1167 --11070
NM_003913chr653520 2741 2626 1562 794 23130 1657 ----
NM_003924chr421143 105 --11551 1283
NM_003927chr181690 11030 ----
NM_003930chr7129 --1224 --
NM_003931chr61263 ------
NM_003932chr2241652 1405 1353 280 --1590 130
NM_003934chr92356 104 1183 ----
NM_003936chr22403 188 ------
NM_003939chr1063650 1388 823 698 483 375 33311 2849 1041 32825 418 155 --
NM_003941chr762212 2159 1697 624 204 106 11571 ----
NM_003947chr311329 1232 1347 --
NM_003951chrX1281 ------
NM_003953chr132341 1808 829 1816 21851 250 --
NM_003954chr1751285 411 332 287 49 ----1205
NM_003956chr102422 39 ------
NM_003957chr113845 839 47 --175 --
NM_003958chr683881 3817 3414 3180 3142 3045 934 523 --43922 3822 2442 178 --
NM_003966chr5187496 7133 6882 6649 5654 5402 5285 5231 5184 5136 5043 1149 787 721 653 626 402 142 27671 6615 27416 1160 --
NM_003970chr81449 ------
NM_003971chr172640 129 ------
NM_003972chr10128 152 ----
NM_003975chr12236 63 ------
NM_003980chr641374 1018 458 71 11076 ----
NM_003983chr16124194 4064 4033 4015 3245 3053 1534 1429 1069 1037 847 740 ----13093
NM_003987chr1032195 1694 1550 --3847 790 370 --
NM_003988chr1042272 1771 1627 54 --3924 867 447 --
NM_003989chr1032131 1630 1486 --3783 726 306 --
NM_003990chr1032131 1630 1486 --3783 726 306 --
NM_003994chr1233766 3269 134 ------
NM_003998chr41276 1565 ----
NM_004006chrX22370 826 --11070 --
NM_004007chrX22370 826 --11070 --
NM_004009chrX22370 826 --11070 --
NM_004010chrX22370 826 --11070 --
NM_004011chrX22370 826 --11070 --
NM_004012chrX22370 826 --11070 --
NM_004013chrX22370 826 --11070 --
NM_004014chrX22370 826 --11070 --
NM_004015chrX22370 826 --11070 --
NM_004016chrX22284 740 --1984 --
NM_004017chrX22370 826 --11070 --
NM_004018chrX22284 740 --1984 --
NM_004020chrX22370 826 --11070 --
NM_004021chrX22284 740 --1984 --
NM_004022chrX22284 740 --1984 --
NM_004023chrX22284 740 --1984 --
NM_004028chr1833051 1331 1073 12606 ----
NM_004035chr17124990 4715 4334 4199 3307 1503 736 545 525 417 207 28 2561 265 ----
NM_004036chr22675 169 ------
NM_004037chr13834 713 177 --1239 --
NM_004040chr21469 1130 ----
NM_004041chr11175 ------
NM_004047chr12190 45 1197 ----
NM_004050chr1462465 2129 2060 1731 676 307 31941 1039 819 1781 --
NM_004055chr1162252 2001 900 700 691 478 --31393 297 122 1213
NM_004061chr52436 241 ------
NM_004065chrX1209 ------
NM_004067chr761419 1293 626 522 251 224 11351 ----
NM_004068chr33399 106 100 ------
NM_004075chr12125 ------
NM_004076chr221114 ------
NM_004077chr121315 11287 21217 508 --
NM_004080chr731023 529 94 11257 ----
NM_004081chrY2124 87 11842 ----
NM_004087chr331912 1850 1296 ------
NM_004089chrX1932 --1887 --
NM_004090chr1782733 2305 2114 721 221 205 96 21 ------
NM_004093chr1383180 3032 2691 2053 1100 1048 767 247 1842 ----
NM_004094chr1442647 1066 927 177 12973 ----
NM_004096chr1092135 1920 1887 1610 1483 858 812 797 200 11701 1241 --
NM_004100chr622071 249 1155 ----
NM_004103chr82736 249 --167 --
NM_004112chr1741537 1421 643 77 1178 190 --
NM_004113chr321961 186 ------
NM_004114chrX21066 1010 156 ----
NM_004115chr132143 124 ------
NM_004116chr25399 189 81 58 39 ------
NM_004124chr1423518 964 ------
NM_004136chr15--23044 1109 ----
NM_004143chrX147 ------
NM_004152chr191231 ------
NM_004156chr8----1236 --
NM_004157chr34629 356 123 114 1569 1345 --
NM_004161chr211419 ------
NM_004162chr3136 ------
NM_004169chr172648 551 1104 ----
NM_004170chr931849 1361 1349 ------
NM_004171chr11107919 6017 3657 3476 1971 1965 1690 1486 637 248 18694 16357 13689
NM_004176chr171135 ------
NM_004177chr1141358 1186 506 21 --21492 300 --
NM_004181chr4--2349 25 ----
NM_004183chr111735 ------
NM_004185chr11693 --1687 --
NM_004186chr32935 899 --1298 --
NM_004187chrX2119 79 ------
NM_004188chr96644 615 602 589 478 145 --1197 --
NM_004200chr1153286 3267 810 733 228 ------
NM_004202chrY1169 ----1149
NM_004227chr732207 208 115 32996 2889 993 12667 12372
NM_004228chr191149 ------
NM_004231chr72261 104 ------
NM_004232chr1863883 3562 3181 657 306 94 --13039 --
NM_004235chr91545 ------
NM_004236chr152454 159 ------
NM_004238chr22279 30 ------
NM_004240chr19140 ------
NM_004241chr101732 ------
NM_004242chr6------1402
NM_004253chr93953 351 322 1169 ----
NM_004262chr41547 11305 122 --
NM_004263chr271626 1488 1393 1331 1314 1279 421 ----11525
NM_004267chr3----1145 --
NM_004272chr531324 662 376 21995 492 11365 --
NM_004274chr1442944 2875 2669 2491 --1750 --
NM_004276chr122390 279 ------
NM_004279chr732028 803 727 --32293 2077 1982 --
NM_004290chr531115 882 388 ------
NM_004291chr5----1137 --
NM_004293chr953646 3179 2398 1038 1008 ------
NM_004294chr131700 ------
NM_004295chr1731278 307 101 ------
NM_004302chr1232940 1925 654 --21826 713 12389
NM_004309chr1751120 949 388 271 224 11036 ----
NM_004311chr10102844 2765 2702 1904 1182 1110 1013 525 458 68 21225 389 ----
NM_004316chr1221148 415 ------
NM_004319chr172545 2217 1046 569 494 146 24 ----12758
NM_004323chr972321 2309 2239 2141 2072 1052 95 ------
NM_004327chr2251848 1679 778 423 402 --11777 21620 943
NM_004329chr102558 326 ------
NM_004331chr832353 239 111 1168 ----
NM_004338chr18117037 6448 5730 5443 5294 4667 4644 4594 2202 1949 896 36500 1312 1101 25472 2358 --
NM_004341chr2142 ------
NM_004342chr71217 12021 ----
NM_004349chr821047 293 1383 ----
NM_004350chr152519 2016 1040 650 580 11933 22411 1871 --
NM_004354chr41722 ------
NM_004356chr112164 111 ------
NM_004359chr192496 341 ------
NM_004360chr1641539 433 389 61 ------
NM_004362chr4196 ------
NM_004364chr1921016 142 ------
NM_004370chr672123 1697 659 653 530 487 55 ------
NM_004379chr241271 1194 243 25 ------
NM_004380chr1632167 1638 303 --12185 --
NM_004384chr552321 2100 1734 314 48 1928 ----
NM_004385chr52670 494 ------
NM_004386chr1942231 1726 1641 1610 --12222 --
NM_004392chr1352260 2053 2032 1751 795 --2909 264 --
NM_004393chr342236 1532 745 506 --12164 --
NM_004397chr1163958 3748 1719 1241 1072 242 14264 ----
NM_004405chr21147 ------
NM_004407chr42370 136 ------
NM_004408chr92199 122 --1488 --
NM_004411chr73586 259 105 1594 ----
NM_004414chr2121442 364 --11010 --
NM_004416chr12130 1977 1945 1287
NM_004417chr5--2562 179 ----
NM_004420chr1192404 2286 2278 1942 1754 1638 1607 1532 445 1315 ----
NM_004422chr172106 72 ------
NM_004423chr32892 668 12302 1533 --
NM_004426chr1261398 711 692 636 594 163 ------
NM_004427chr11473 1979 ----
NM_004428chr13841 709 607 ------
NM_004429chrX31373 1025 936 --11080 --
NM_004430chr841742 1097 758 132 22742 2090 1458 --
NM_004431chr11847 --166 --
NM_004432chr942339 1806 880 451 12362 ----
NM_004436chr12592 85 --1150 --
NM_004437chr153188 3130 1156 647 569 1612 ----
NM_004438chr262802 2242 1179 929 834 316 1161 12114 1862
NM_004440chr611424 ------
NM_004441chr321294 1129 --1147 --
NM_004442chr121620 1067 11287 2640 462 --
NM_004450chr14194 ------
NM_004451chr111710 --1105 --
NM_004454chr311483 --22038 1477 --
NM_004457chr231289 1246 506 ------
NM_004458chrX22147 1005 11012 11763 --
NM_004459chr1741530 688 428 340 ------
NM_004461chr191183 --144 --
NM_004469chrX163 ------
NM_004481chr162679 2578 2389 796 562 506 --1852 --
NM_004482chr2--1740 ----
NM_004483chr161479 ------
NM_004487chr351188 928 431 225 191 ------
NM_004491chr1933883 1255 326 13702 53150 3026 3008 874 432 1548
NM_004494chr15964 510 301 112 34 11265 141 --
NM_004499chr5------1156
NM_004500chr1421831 1270 ------
NM_004501chr134082 3518 501 ----1986
NM_004504chr242962 2699 2675 72 --1652 --
NM_004505chr1731965 560 114 ------
NM_004515chr1158 1289 ----
NM_004520chr51669 ------
NM_004525chr231146 283 116 31523 1462 313 ----
NM_004529chr941235 1223 983 962 ------
NM_004537chr1221038 51 ------
NM_004540chr211191 ------
NM_004571chr2182998 2838 2248 1325 910 683 538 417 --1582 --
NM_004575chr431455 1447 227 --1620 --
NM_004576chr51322 ------
NM_004578chr15927 904 845 834 694 1640 ----
NM_004582chr1--1423 ----
NM_004583chr172646 245 --2544 292 --
NM_004586chrX105253 4988 4734 4241 4047 3591 3403 1287 147 127 1638 1136 --
NM_004588chr1184000 3987 3200 3155 3066 819 465 73 --23663 3651 13690
NM_004593chr31866 1261 ----
NM_004595chrX1366 ------
NM_004598chr543130 2990 1101 1003 ------
NM_004603chr72337 60 --1775 --
NM_004606chrX137 ------
NM_004612chr984616 4410 3680 3102 2965 310 286 44 2691 353 ----
NM_004613chr2071588 1570 1448 1257 1100 654 200 --1607 125
NM_004615chrX5700 627 170 116 39 --1221 --
NM_004620chr113495 152 61 1645 ----
NM_004622chr272022 1941 1885 1740 727 701 292 1307 --129
NM_004625chr3143 1109 ----
NM_004626chr11296 40 ------
NM_004630chr11--11078 ----
NM_004631chr11370 1278 ----
NM_004634chr3----1440 --
NM_004637chr331268 1232 1007 ------
NM_004642chr122462 69 ------
NM_004643chr142277 182 1169 ----
NM_004650chrX1243 1518 ----
NM_004651chrX2393 361 ------
NM_004654chrY31309 1177 374 11399 ----
NM_004655chr17130 ------
NM_004656chr31942 --1500 --
NM_004660chrY41709 863 615 242 12232 1349 --
NM_004663chr1531432 1354 1055 ------
NM_004667chr15160 ------
NM_004670chr1011654 ----1332
NM_004673chr11982 ------
NM_004685chr1362629 2523 2230 2120 976 606 ------
NM_004687chr1732013 1848 1432 2825 687 ----
NM_004689chr14--1318 ----
NM_004694chr171594 --2780 599 --
NM_004703chr1762580 2494 1910 551 401 289 11802 ----
NM_004705chr115837 593 184 153 138 1239 1572 --
NM_004714chr192328 98 ------
NM_004719chr1222750 1158 ------
NM_004723chr11396 ------
NM_004725chr1041493 1447 401 205 ------
NM_004726chrX74910 4692 4584 3610 1858 1687 765 15125 14972 --
NM_004729chrX62178 1962 767 542 519 58 11745 ----
NM_004730chr561748 1561 1462 828 440 363 ------
NM_004733chr31608 1503 ----
NM_004734chr1331052 855 313 ------
NM_004736chr12836 579 ------
NM_004737chr2221273 1089 ------
NM_004739chr111244 ------
NM_004742chr341562 1337 1270 135 ------
NM_004745chr875559 4274 2328 2112 1316 539 196 16119 12553 --
NM_004748chr1554259 3766 2686 1666 1391 12749 --13786
NM_004755chr1421213 142 ------
NM_004758chr1721133 1041 1276 2982 859 --
NM_004759chr172146 1681 572 423 362 294 152 1577 ----
NM_004760chr762017 2000 1950 961 570 263 1969 ----
NM_004762chr173286 78 47 ------
NM_004765chr16----124 --
NM_004772chr531365 1162 127 11504 ----
NM_004774chr1763153 3115 2533 2448 2259 251 ------
NM_004779chr51838 --1348 --
NM_004781chr141105 597 66 26 21535 1232 ----
NM_004781chr141105 597 66 26 21535 1232 ----
NM_004783chr161679 ------
NM_004785chr161320 ----1339
NM_004788chr1152236 705 449 343 268 32569 1971 622 --1152
NM_004792chr2158 ------
NM_004794chrX186 ------
NM_004796chr1472325 2200 2161 1660 1603 754 97 1781 21892 255 --
NM_004798chr20103184 3103 2649 895 637 608 564 496 356 284 ------
NM_004800chr13163 ------
NM_004801chr261550 1476 1395 1082 267 251 ------
NM_004805chr221099 154 2280 95 ----
NM_004807chr252268 1866 637 612 106 ------
NM_004808chr1053390 2276 2184 1045 383 1203 ----
NM_004817chr92264 257 ------
NM_004818chr122486 54 ------
NM_004824chr611070 ------
NM_004826chr21230 --2295 55 --
NM_004830chr6--2919 155 ----
NM_004834chr243397 2579 2221 155 --12522 --
NM_004835chr34828 768 319 308 ------
NM_004835chr34828 768 319 308 ------
NM_004836chr22836 246 ------
NM_004837chr131631 433 317 ------
NM_004840chrX52343 1894 1770 1764 197 12097 22324 1775 11698
NM_004842chr651443 1133 493 434 45 2160 57 --11249
NM_004845chrX124149 4132 3942 3829 3505 3477 1383 587 376 312 257 132 ----11364
NM_004846chr2164 ------
NM_004857chr1433795 3261 3245 12934 ----
NM_004859chr1731909 848 292 13028 12204 --
NM_004860chr17----142 --
NM_004861chr22132 ------
NM_004863chr1485088 4528 4521 3970 3846 1033 1019 377 1578 ----
NM_004865chr6----2169 52 --
NM_004866chr584825 3476 3378 3354 1328 971 466 117 ------
NM_004871chr1764173 3746 3095 2850 2717 510 11765 --23369 1525
NM_004872chr11372 ------
NM_004874chr8129 ----190
NM_004879chr114809 626 384 64 ------
NM_004884chr1551745 1274 583 435 219 --31772 554 373 --
NM_004887chr511072 1853 ----
NM_004890chr17165 ------
NM_004893chr52533 208 ------
NM_004896chr1011299 --11164 --
NM_004898chr462731 2629 1966 1960 804 688 ------
NM_004902chr201125 ------
NM_004904chr776013 5629 5121 4650 1175 809 592 11292 16405 --
NM_004906chr62627 618 ------
NM_004912chr711406 ----11587
NM_004922chr104985 963 229 202 --1851 1185
NM_004926chr1411435 --11753 1699
NM_004929chr82262 24 ------
NM_004930chr12192 72 ------
NM_004938chr941258 323 303 147 ------
NM_004945chr191853 ------
NM_004947chr332606 1815 433 11767 1596 --
NM_004949chr1852082 1958 675 635 583 11762 ----
NM_004952chr12959 888 ------
NM_004953chr31347 --1383 --
NM_004955chr61115 ------
NM_004956chr773105 1391 1308 1111 1061 566 90 33403 3066 69 2740 141 --
NM_004961chrX41312 980 560 160 ------
NM_004965chr212496 192 1564 ----
NM_004966chr102903 879 1934 ----
NM_004973chr621325 326 1161 21589 73 --
NM_004976chr1183887 3648 2019 1581 1360 1280 284 158 1250 13314 1679
NM_004977chr191559 ------
NM_004978chr131573 1381 427 1516 21730 1721 --
NM_004979chrX21084 748 ------
NM_004985chr1254022 3575 930 713 108 ----11165
NM_004992chrX167617 6790 6778 6228 5658 5552 5370 5211 2529 2177 1804 1486 1405 1183 640 53 32536 1437 309 56362 5568 1944 1383 280 15834
NM_004992chrX167617 6790 6778 6228 5658 5552 5370 5211 2529 2177 1804 1486 1405 1183 640 53 32536 1437 309 56362 5568 1944 1383 280 15834
NM_004993chr1421049 571 --11275 --
NM_004995chr1441206 1058 367 122 --21081 1065 --
NM_004998chr154887 635 333 296 ------
NM_004999chr663995 3640 3058 983 909 681 ------
NM_005003chr16--126 ----
NM_005010chr751712 626 556 273 109 1588 ----
NM_005011chr731541 1238 1216 --1602 --
NM_005016chr12134 ------
NM_005017chr31221 163 ----
NM_005023chr511202 1415 --1124
NM_005025chr32215 190 ------
NM_005032chrX41002 353 307 291 1842 ----
NM_005037chr3--1206 ----
NM_005044chrX54534 4248 3102 3055 2946 54560 4240 4118 3790 1783 11516 --
NM_005045chr71239 ------
NM_005053chr192229 173 ------
NM_005054chr2--11392 ----
NM_005055chr11142 ------
NM_005056chr1265392 5159 3858 1704 1543 1236 34850 4043 1286 21798 998 --
NM_005060chr121199 1099 --140 --
NM_005063chr1072904 2640 2604 1208 963 798 395 32803 2573 2419 13385 1460
NM_005065chr1465410 5090 4790 3970 1094 50 ------
NM_005067chr32942 278 --1196 --
NM_005068chr611375 ------
NM_005077chr91110 ------
NM_005080chr224917 391 304 199 ----1817
NM_005087chr32868 250 ------
NM_005095chr13620 313 68 12065 ----
NM_005099chr12505 74 ------
NM_005103chr11----1226 --
NM_005105chr111976 --3460 297 86 --
NM_005109chr372142 2065 1960 1681 982 376 56 1594 --11646
NM_005110chr53798 730 553 ------
NM_005113chr141393 ------
NM_005116chr2094158 3029 1311 781 507 401 307 233 146 1538 23902 3790 23543 59
NM_005117chr117685 288 270 258 243 224 31 --2841 668 --
NM_005120chrX2204 164 ------
NM_005121chr1753734 2701 1103 534 167 ------
NM_005124chr6149 ------
NM_005134chr183831 621 29 1646 ----
NM_005135chr1553396 2337 853 530 30 ----23337 1155
NM_005137chr2262467 2100 805 747 495 45 --32299 1641 438 32343 872 390
NM_005149chr131222 450 396 21418 1199 11017 --
NM_005151chr182501 382 --1319 --
NM_005153chr165744 737 722 514 218 1174 ----
NM_005154chr152571 236 ------
NM_005156chr974690 4569 3516 3442 3345 1968 1439 45323 4793 4631 3308 11753 --
NM_005157chr941883 750 569 249 ------
NM_005160chr22116621 5880 5688 5637 4653 4347 2403 2030 1852 1400 419 34324 1664 391 25838 1880 --
NM_005168chr221339 1243 11693 ----
NM_005174chr10145 ------
NM_005180chr1061545 1534 1497 1222 548 528 ------
NM_005184chr1921343 1216 --2508 409 --
NM_005187chr163809 773 150 ------
NM_005188chr11167623 6980 6907 5534 5518 5449 3086 3030 2880 2807 1898 1663 1300 771 670 315 26414 2592 37372 6917 423 27032 1278
NM_005194chr20--1448 ----
NM_005197chr1434857 2352 1606 22465 1720 45281 5202 4051 2152 --
NM_005202chr12283 141 11545 52321 908 600 374 21 --
NM_005206chr1721298 96 1153 ----
NM_005207chr22103550 3451 2827 2767 2716 966 415 381 331 302 --124 --
NM_005208chr17149 1112 ----
NM_005219chr581632 1606 1531 484 473 331 269 240 --3629 384 142 --
NM_005220chr1741460 475 339 275 --11259 --
NM_005221chr7149 ------
NM_005222chr7162 ------
NM_005225chr2051109 1074 1020 441 91 ------
NM_005231chr1131290 922 463 1169 ----
NM_005235chr256650 5962 5557 5066 39 --27633 7107 --
NM_005238chr1123514 3072 1993 12405 21314 32
NM_005241chr3--2220 81 ----
NM_005242chr52150 50 ------
NM_005250chr162451 442 11823 11621 --
NM_005254chr1521231 1118 ------
NM_005263chr1381 74 59 ------
NM_005266chr151515 1341 712 674 488 11644 ----
NM_005271chr103940 354 284 ------
NM_005273chr71226 ------
NM_005276chr1251489 1320 666 394 298 21169 499 --11622
NM_005276chr1251489 1320 666 394 298 21169 499 --11622
NM_005284chr61458 1371 --174
NM_005296chrX3845 220 153 11070 ----
NM_005310chr172347 142 ------
NM_005311chr72947 179 --1976 12363
NM_005312chr941889 816 280 79 22359 1880 ----
NM_005313chr151137 ------
NM_005316chr111119 ------
NM_005318chr2211258 ----1800
NM_005324chr1741853 1304 235 182 ------
NM_005326chr16----164 --
NM_005328chr83585 202 108 ------
NM_005329chr1662311 1883 1803 1556 798 246 ------
NM_005334chrX61406 1204 698 511 189 45 --11636 --
NM_005339chr4104055 4023 3847 3581 3469 1729 1670 1021 710 158 13049 13852 --
NM_005342chrX62217 2129 596 449 286 86 11897 12634 1528
NM_005354chr192628 203 ------
NM_005358chr1331774 53 28 ----2725 233
NM_005359chr18106420 6114 5362 1721 750 257 141 134 98 63 35063 728 374 35784 2279 2109 14565
NM_005370chr1941244 1178 1074 51 1237 ----
NM_005374chr1741956 1777 945 728 --1813 11879
NM_005376chr121119 228 ------
NM_005378chr23762 752 161 1275 ----
NM_005382chr81462 ------
NM_005385chr3112616 2445 2182 2144 2055 2012 1939 1843 489 348 77 ------
NM_005386chr201728 ------
NM_005387chr111264 2664 616 1188 1254
NM_005388chr91538 ------
NM_005392chr921572 27 1334 ----
NM_005393chrX----1256 --
NM_005397chr783798 2453 1426 1351 948 774 413 228 11166 11393 --
NM_005398chr10----11149 --
NM_005399chr184069 3271 2886 2811 1676 885 293 144 33494 3175 1497 13473 --
NM_005400chr272832 2386 2253 1103 593 410 381 ------
NM_005401chr1177 ------
NM_005402chr71531 --11296 --
NM_005406chr1831111 144 128 1566 ----
NM_005407chr141426 --21068 22 --
NM_005414chr32268 61 ------
NM_005418chr113476 175 85 ------
NM_005424chr13327 49 30 ------
NM_005426chr12692 276 ----1349
NM_005433chr1832133 1106 288 ------
NM_005436chr1073133 2727 1640 1347 1229 820 405 ------
NM_005442chr35621 610 456 167 122 ------
NM_005455chr131539 1342 203 ------
NM_005458chr941940 1791 993 64 ------
NM_005460chr5--151 ----
NM_005461chr2081905 1686 1677 1481 1233 600 392 114 ------
NM_005471chr561169 1155 1081 984 910 280 ------
NM_005474chr1731533 184 124 11065 ----
NM_005475chr122500 464 ----1163
NM_005476chr921214 309 ------
NM_005479chr1031507 1376 407 ------
NM_005483chr192226 98 ------
NM_005493chr64672 649 627 576 170 ----
NM_005497chr1796040 5346 4994 4674 2468 1443 907 366 114 ------
NM_005502chr973302 2555 919 826 631 568 474 21993 843 ----
NM_005504chr1286647 6555 6176 5122 4993 2602 347 66 12634 15227 24487 1691
NM_005509chr511190 ------
NM_005517chr1--1407 ----
NM_005522chr72509 252 ------
NM_005537chr132743 61 --2787 432 --
NM_005539chr1041381 1325 1275 117 11155 1260 --
NM_005544chr21378 31044 711 383 ----
NM_005550chr161546 --154 --
NM_005552chr143528 495 178 ----1380
NM_005561chr132879 109 1860 ----
NM_005562chr141444 1390 345 187 11362 1632 1508
NM_005563chr12894 802 ------
NM_005565chr5143 ------
NM_005573chr51707 ------
NM_005578chr394854 4770 4684 4039 3977 1318 491 347 110 ------
NM_005581chr19165 --2367 343 --
NM_005586chr61641 1264 ----
NM_005587chr151888 ------
NM_005595chr12274 168 --1290 --
NM_005596chr966001 5688 5108 4946 4689 1571 15709 12487 --
NM_005599chr171470 1424 1365 1050 1004 535 150 ------
NM_005600chr1--1257 ----
NM_005602chr32425 273 11215 ----
NM_005604chr61437 ------
NM_005607chr8125 ------
NM_005610chr12890 873 ------
NM_005611chr162378 110 21217 332 ----
NM_005614chr71768 1747 ----
NM_005618chr6--2113 82 ----
NM_005626chr12185 94 ------
NM_005627chr61663 ------
NM_005628chr191167 --2575 30 --
NM_005630chr321827 25 ------
NM_005634chrX2145 107 ------
NM_005637chr1811646 ------
NM_005638chrX21400 1340 ------
NM_005639chr122273 137 ------
NM_005647chrX53123 2751 2370 694 646 ------
NM_005652chr165888 876 472 385 67 --11192 --
NM_005655chr821007 329 ------
NM_005657chr15133 1125 ----
NM_005664chr154748 250 59 49 2100 33 ----
NM_005668chr524464 692 33474 3408 3337 ----
NM_005669chr532052 1992 859 ------
NM_005676chrX1188 ------
NM_005677chr331400 239 130 1304 --1982
NM_005678chr155812 675 648 404 198 1922 ----
NM_005686chr131551 521 187 1615 1482 --
NM_005688chr361236 1162 1155 1092 931 427 11307 1905 --
NM_005698chr14251 236 199 28 ------
NM_005717chr141265 1250 121 44 --1309 --
NM_005718chr33801 787 148 ------
NM_005721chr2164 ------
NM_005722chr232007 487 238 1437 ----
NM_005724chr152299 66 ------
NM_005725chr141601 263 184 114 --1823 --
NM_005730chr12153534 3494 3238 3104 3091 2955 2454 2304 1386 1295 1175 1143 983 965 519 --22283 1075 --
NM_005731chr2153 ------
NM_005732chr53485 205 193 21494 325 ----
NM_005734chr112749 261 ------
NM_005735chr24788 642 296 251 ------
NM_005737chr242870 2048 1990 600 --1322 1582
NM_005738chr731816 1743 151 11672 --11859
NM_005739chr1531686 412 127 12293 ----
NM_005746chr722303 827 ------
NM_005748chr1243376 3119 1250 444 --1488 --
NM_005749chr171546 ------
NM_005751chr7--1317 ----
NM_005754chr52796 272 ------
NM_005759chr2104683 4322 3744 3409 3341 1428 1150 1071 878 714 --13311 14407
NM_005766chr1321118 396 --1880 --
NM_005768chr123659 197 136 ------
NM_005775chr82683 254 --1705 --
NM_005776chr141616 --1844 --
NM_005777chr3----180 --
NM_005779chr561468 1206 1100 705 379 364 ------
NM_005780chr131810 ------
NM_005782chr173233 192 51 ------
NM_005783chr22635 40 ------
NM_005786chr181100 ------
NM_005795chr232760 2469 2290 22094 628 1568 --
NM_005796chr161134 ------
NM_005798chr13115271 3819 3561 3524 3425 2105 1508 1465 1359 580 392 ------
NM_005808chr383461 3368 3226 2611 2398 1254 828 143 --1996 --
NM_005819chr193233 3000 1340 796 475 378 337 275 115 21192 303 ----
NM_005822chr611701 1640 160 --
NM_005826chr11110 ------
NM_005828chr17104660 4542 4174 3761 1931 1617 1515 1028 534 361 --13783 --
NM_005833chr91166 ------
NM_005839chr11279 ------
NM_005840chrX175270 4764 4724 3060 2822 2766 2451 2357 2231 1883 1799 1614 1597 853 552 468 376 36818 5566 2771 37218 5346 2845 --
NM_005841chr41101 11093 1124 --
NM_005842chr132715 124 ------
NM_005850chr1124 ------
NM_005852chr1721051 746 --21070 75 --
NM_005853chr161432 ------
NM_005859chr531575 1176 132 1426 11532 --
NM_005862chr32881 336 --1394 --
NM_005869chr51291 --2117 30 --
NM_005877chr2232213 2160 938 --32202 713 540 --
NM_005880chr1621424 112 ------
NM_005882chr41691 ------
NM_005885chr53597 191 160 --1330 --
NM_005886chr163257 221 63 --1108 --
NM_005888chr122130 32 1159 ----
NM_005896chr22747 739 1821 --1549
NM_005898chr1131069 873 261 --11002 --
NM_005899chr173306 145 84 11074 132 --
NM_005900chr44893 764 203 128 1188 ----
NM_005901chr18138544 8293 8053 6438 5596 3059 2329 2238 2194 1766 1433 1089 817 21835 927 23349 2323 12696
NM_005902chr15104541 4356 4289 3573 3120 1581 1495 906 249 142 1740 ----
NM_005903chr555056 3424 1979 792 541 --14195 --
NM_005904chr183922 86 59 ------
NM_005907chr641657 1490 374 26 ------
NM_005909chr533695 3622 295 2252 173 ----
NM_005910chr17114122 3349 3024 2663 2623 2507 1167 958 929 913 141 13292 33626 716 408 --
NM_005911chr21181 ------
NM_005916chr7----143 --
NM_005920chr173499 2391 1459 1447 1200 1180 1167 13747 11494 23325 126
NM_005922chr62376 155 --1147 --
NM_005928chr153482 230 31 ------
NM_005930chr142715 64 ------
NM_005933chr1152678 2474 2283 2218 797 --1815 12025
NM_005935chr485237 4509 3933 3690 3568 1086 1060 824 1863 ----
NM_005937chr1753940 3908 3411 3359 1411 --12967 11676
NM_005938chrX41047 322 101 28 --11328 --
NM_005941chr863597 2980 2735 634 206 146 13838 ----
NM_005943chr651647 1487 1148 648 267 --11384 --
NM_005944chr331096 945 213 ------
NM_005955chr1115482 4664 4558 4462 3927 3916 3615 1626 1102 698 474 55148 3943 3936 2202 706 24982 4801 --
NM_005962chr1021889 640 11548 1717 --
NM_005962chr1021889 640 11548 1717 --
NM_005964chr1731522 1089 154 11417 ----
NM_005966chr242400 2375 2155 355 ------
NM_005967chr121131 ------
NM_005969chr111984 --1894 --
NM_005973chr1--1332 ----
NM_005977chr13--165 ----
NM_005984chr222435 52 --1547 --
NM_005985chr202563 544 ------
NM_005994chr173678 221 195 --157 --
NM_006007chr954166 4153 4140 4033 1249 ------
NM_006010chr31186 ------
NM_006011chr1584014 3692 3526 2907 1628 1181 933 790 24127 2655 1390 --
NM_006015chr14538 308 150 67 1462 11050 --
NM_006016chr632238 771 245 1901 ----
NM_006022chr1331064 354 30 1868 ----
NM_006024chr71213 1374 ----
NM_006030chr331424 1142 315 --1251 11174
NM_006035chr1411198 ------
NM_006036chr242572 2071 1602 164 11887 ----
NM_006040chr163442 359 268 11228 2428 92 --
NM_006043chr164680 651 219 38 ------
NM_006047chr2073306 1132 1089 572 559 185 42 1378 1543 --
NM_006048chr13454 402 25 ------
NM_006049chr151409 ------
NM_006054chr1111477 ------
NM_006060chr763702 3584 2728 1219 1196 807 --2757 449 12850
NM_006062chr22128 104 1200 21094 378 11108
NM_006068chr42296 276 ------
NM_006070chr31156 ------
NM_006076chr753057 2023 1086 603 49 --12130 1502
NM_006077chr104785 563 173 84 ------
NM_006079chr62188 170 ------
NM_006080chr723006 2970 ------
NM_006086chr162281 95 --182 --
NM_006090chr11604 ------
NM_006094chr841832 936 477 168 22285 2002 ----
NM_006095chr4104298 4138 3755 3568 2946 1789 1480 964 781 71 ----14290
NM_006100chr31113 ------
NM_006106chr1152989 999 913 288 166 1184 ----
NM_006107chr171420 ------
NM_006109chr142126 49 ------
NM_006113chr121760 1498 --11895 --
NM_006122chr1552537 2439 816 261 149 ------
NM_006133chr1162409 1511 960 809 536 317 1137 52147 743 470 361 261 11785
NM_006134chr2111569 --11654 --
NM_006135chr141473 1313 978 343 1146 ----
NM_006136chr731354 476 100 11148 ----
NM_006139chr242774 2384 2152 47 --1111 --
NM_006141chr1642759 2363 857 57 ------
NM_006142chr12452 108 1187 ----
NM_006148chr1762911 2591 2352 2187 1825 931 --32244 589 282 --
NM_006153chr33645 237 25 ------
NM_006156chr14----1179 --
NM_006157chr11----1430 --
NM_006158chr831682 1391 445 --1219 --
NM_006160chr1731114 1084 154 ------
NM_006162chr1821791 1185 --21291 613 --
NM_006166chr1271825 1691 1606 920 666 619 503 ------
NM_006167chr892347 2303 2292 2164 1969 1809 804 791 246 11912 1454 --
NM_006177chr141739 11033 1837 --
NM_006180chr951946 1795 1518 499 288 ------
NM_006186chr22481 179 ------
NM_006190chr211034 --1253 --
NM_006191chr123881 769 313 --127 --
NM_006194chr1411191 --11217 --
NM_006195chr921114 487 ------
NM_006196chr22382 35 ------
NM_006197chr81476 12056 11532 --
NM_006201chrX5906 884 434 192 84 --1138 --
NM_006203chr535373 3501 1138 13702 ----
NM_006206chr432903 2757 2283 21948 477 ----
NM_006209chr81359 ------
NM_006211chr8--168 ----
NM_006212chr1104850 4786 4733 4493 3499 3444 3282 1966 1623 1542 25281 2022 ----
NM_006216chr22614 600 ------
NM_006224chr1762098 1680 859 555 250 220 --32399 1981 717 --
NM_006228chr81293 ------
NM_006237chr1361940 1619 1567 833 174 71 12105 1892 --
NM_006241chr351756 924 812 660 522 11651 11589 1558
NM_006243chr12389 347 ------
NM_006245chr63757 272 73 ------
NM_006246chr1421102 393 1281 ----
NM_006251chr512341 --12098 --
NM_006252chr135421 355 349 26556 1119 11824 --
NM_006256chr142691 2564 1916 902 ------
NM_006258chr102506 284 --1353 132
NM_006265chr81471 ------
NM_006267chr231879 1247 140 ------
NM_006268chr1151040 893 817 274 249 ------
NM_006275chr2042278 1837 1670 332 1976 ----
NM_006281chr82906 179 1926 ----
NM_006281chr82906 179 1926 ----
NM_006283chr8104750 4677 3652 3620 1958 1510 816 544 153 136 1269 23684 1716 --
NM_006285chr9--1217 173 --
NM_006293chr1511025 --1373 1360
NM_006301chr121604 ------
NM_006304chr72108 41 ------
NM_006306chrX75105 4388 3952 3868 1732 1544 403 ----11118
NM_006310chr1741013 901 148 31 ------
NM_006312chr123844 768 748 ------
NM_006313chr1221214 271 --140 --
NM_006315chr4114505 4394 4296 4077 3183 1704 1502 1008 935 861 316 21804 874 ----
NM_006320chr4--1827 195 --
NM_006321chr332220 1430 497 --11768 --
NM_006325chr122660 255 --1821 --
NM_006328chr112207 154 1484 1500 1536
NM_006330chr811366 ------
NM_006345chr42948 295 11263 ----
NM_006352chr131665 1549 444 ------
NM_006357chr22416 118 ------
NM_006359chrX72079 1663 1623 962 886 628 463 --42176 1995 592 509 --
NM_006364chr141350 ------
NM_006366chr62960 886 --1973 --
NM_006367chr11114 ------
NM_006369chr1----1364 --
NM_006371chr3104352 3856 3817 3802 3315 1635 1500 1392 1218 318 35191 1735 82 14155 --
NM_006372chr61509 ------
NM_006375chrX41638 1428 744 310 --11595 --
NM_006377chr921232 879 --1442 --
NM_006378chr931037 323 74 --1438 --
NM_006379chr731747 1685 350 12045 ----
NM_006380chr1733306 2967 1348 --23300 3068 13715
NM_006383chr152542 478 ------
NM_006386chr2262120 1975 1816 843 568 554 22491 692 22348 2326 --
NM_006389chr1171162 1077 874 866 523 362 233 11322 ----
NM_006390chr1241493 1483 553 367 --2563 108 --
NM_006391chr11----122 --
NM_006393chr1034216 3518 1328 24296 4004 31403 928 767 --
NM_006400chr121371 ------
NM_006403chr611434 11654 ----
NM_006405chr14125 ----153
NM_006411chr61944 1866 1728 --
NM_006415chr921233 991 ------
NM_006416chr62729 196 ------
NM_006420chr2073127 2563 1233 693 452 228 193 ----22882 2131
NM_006421chr83914 221 41 ------
NM_006434chr1043246 2059 968 464 --32043 609 339 1553
NM_006451chr541044 1015 807 705 ------
NM_006454chr4102797 2182 2070 1201 1046 816 638 314 128 102 11220 ----
NM_006459chr1031865 1790 1702 1338 ----
NM_006460chr1741747 1242 620 177 ------
NM_006461chr17123 ------
NM_006464chr234231 4203 1391 33887 2926 374 34059 3863 3052 1107
NM_006465chr1552183 1683 772 704 427 1661 1165 --
NM_006466chr2011077 --1126 --
NM_006469chr111159 --11091 --
NM_006471chr18----1102 --
NM_006482chr1273777 3576 1477 828 787 443 84 147 ----
NM_006483chr192328 98 ------
NM_006484chr192328 98 ------
NM_006486chr224573 441 224 52 1536 ----
NM_006489chr142603 443 ------
NM_006494chr192629 53 ------
NM_006495chr171129 ------
NM_006496chr12622 63 1753 ----
NM_006500chr114517 442 105 53 ------
NM_006504chr1062849 2145 2083 756 228 139 12878 ----
NM_006516chr171509 1273 1055 1032 469 199 29 ------
NM_006517chrX31959 570 57 2503 409 ----
NM_006520chrX41694 1687 1572 1270 ------
NM_006526chr2041599 1540 497 434 1335 11742 --
NM_006532chr1961526 1310 724 606 541 205 --11609 --
NM_006534chr2052678 2650 2220 330 210 23414 2730 12594 --
NM_006537chr152577 211 1492 1396 --
NM_006538chr274147 4035 3591 2878 1368 992 626 13211 13482 13741
NM_006540chr861462 1053 394 369 116 46 ------
NM_006542chr11168 ------
NM_006544chr1466047 5473 3793 1206 665 302 14748 ----
NM_006545chr3131 ------
NM_006546chr17126660 5619 5115 4786 4453 4311 4297 2431 2043 2033 1189 757 12202 14099 11736
NM_006548chr311336 ------
NM_006549chr1252711 1913 639 419 55 ------
NM_006552chr11189 ------
NM_006555chr7101950 1913 1896 1556 1488 1385 1327 606 587 481 11406 21903 1530 --
NM_006557chr92612 368 41450 538 353 171 ----
NM_006558chr81499 ------
NM_006559chr12362 337 1969 176 --
NM_006561chr10206113 6024 5909 5890 5868 5859 5556 5204 5075 4845 4834 4326 4159 3801 2432 2272 1241 643 258 24 1682 22157 2109 15677
NM_006565chr1621271 852 --1180 --
NM_006572chr1762815 1093 968 858 609 200 1176 12193 --
NM_006574chr31244 ------
NM_006575chr14----21196 490 --
NM_006589chr12484 170 --2158 108 --
NM_006590chr21466 ------
NM_006593chr21221 ------
NM_006595chr1132010 519 153 1396 ----
NM_006599chr16137961 7835 7528 7365 7283 6940 6708 6066 2285 2207 1562 1388 486 27703 6382 ----
NM_006601chr123873 446 139 1256 11003 --
NM_006602chr202560 83 ------
NM_006603chrX1390 11672 11809 --
NM_006608chr1195 ------
NM_006609chr222573 698 13003 ----
NM_006612chr172475 41 ------
NM_006618chr131466 1384 1004 ------
NM_006621chr151340 691 620 501 171 1392 11783 --
NM_006622chr51231 --1136 --
NM_006624chr1031611 1469 490 11841 ----
NM_006625chr12449 336 ------
NM_006625chr12449 336 ------
NM_006625chr12449 336 ------
NM_006626chr932404 2349 419 ------
NM_006628chr1574389 4029 3859 1333 1165 527 28 1697 ----
NM_006629chr1812417 ------
NM_006634chr21225 --1176 --
NM_006646chr1362966 2166 1117 902 527 258 1576 32251 1145 334 1677
NM_006650chr5103899 3816 3645 3544 2636 1518 1089 761 309 33 --13534 --
NM_006654chr1264632 4363 3535 3520 1288 604 14784 ----
NM_006658chr72361 83 --1419 --
NM_006667chrX2950 112 ------
NM_006670chr6174 ------
NM_006675chr1273341 2149 1242 1178 1145 1088 1002 --21263 35 --
NM_006677chr3122 --1199 --
NM_006690chr2041485 857 574 506 --31574 544 450 --
NM_006691chr11--21032 871 ----
NM_006693chr72298 45 --1803 --
NM_006698chr20--1528 21271 1208 --
NM_006703chr62324 152 ------
NM_006706chr51772 ------
NM_006711chr163518 310 172 ------
NM_006713chr52780 255 ------
NM_006717chr943301 2545 2347 1230 ------
NM_006720chr10115044 5023 4113 3417 2049 1229 1009 966 759 734 314 14770 35058 1705 1247 --
NM_006721chr101337 ------
NM_006722chr31680 --12964 --
NM_006724chr62376 155 --1147 --
NM_006726chr43878 802 198 ------
NM_006727chr52502 392 ------
NM_006729chrX115227 5215 4677 4245 4142 3417 2218 1964 1583 1136 595 13701 ----
NM_006732chr1942142 1997 855 281 ------
NM_006734chr651388 1217 1121 565 322 ------
NM_006736chr251449 573 503 435 171 1341 11722 --
NM_006738chr1574401 4329 3723 3394 1442 1223 198 --43925 1271 978 61 --
NM_006744chr101163 ------
NM_006745chr4----11080 --
NM_006746chrX31319 1131 527 ------
NM_006750chr16107708 7673 7346 6656 3041 2718 2500 1798 1260 1038 36700 226 133 34894 2652 456 --
NM_006751chr22383 343 ------
NM_006754chr71132 --11204 --
NM_006756chr831212 1186 209 11012 ----
NM_006758chr21128 ------
NM_006761chr171679 1563 1138 --
NM_006763chr141751 1387 1334 227 11988 11551 --
NM_006766chr832509 2041 105 12012 ----
NM_006769chr1--1689 ----
NM_006772chr651624 1573 1466 1215 691 ------
NM_006775chr633036 864 207 ----163
NM_006777chrX52112 1118 757 538 511 1380 ----
NM_006778chr651423 1286 509 243 232 ------
NM_006788chr1861940 1891 1499 1312 858 454 --21462 403 --
NM_006791chr151205 ------
NM_006802chr14925 887 391 55 --11126 --
NM_006803chr851869 1585 1471 438 312 --1729 --
NM_006805chr541415 1145 684 108 --1677 1349
NM_006806chr211273 ------
NM_006807chr171246 ------
NM_006810chr3149 ------
NM_006814chr2062444 2312 2247 881 508 108 --1171 --
NM_006815chr1211293 ------
NM_006816chr5--1290 ----
NM_006822chr171238 ------
NM_006823chr831285 476 127 ------
NM_006824chr1180 ------
NM_006826chr21204 ------
NM_006833chr71304 --1125 --
NM_006841chr33678 197 65 1562 ----
NM_006842chr111119 ------
NM_006846chr51269 ------
NM_006848chr11----2204 159 --
NM_006851chr1222830 2068 ------
NM_006852chr1752590 2570 1048 709 130 ------
NM_006854chr721652 1622 --21717 688 --
NM_006856chr1221030 1024 ------
NM_006870chr203740 220 53 ------
NM_006873chr252625 954 927 668 72 --1378 --
NM_006874chr43890 826 466 ------
NM_006875chrX1257 --1745 --
NM_006876chr111265 ------
NM_006885chr1694244 3391 3352 2861 2748 2639 466 436 243 21575 694 ----
NM_006887chr22732 525 1270 180 --
NM_006888chr1453241 2974 2785 2647 805 32679 2160 1236 ----
NM_006896chr741101 788 324 285 ------
NM_006899chr201292 --1112 --
NM_006901chr152342 213 --1183 --
NM_006906chr11188 1901 2684 338 --
NM_006910chr162372 127 1354 ----
NM_006912chr13251 201 86 --1515 --
NM_006914chr911457 ----1354
NM_006920chr211604 2471 239 ----
NM_006922chr242055 868 842 207 1233 11757 --
NM_006924chr1764455 4340 2878 1395 344 142 --23888 787 --
NM_006925chr142490 73 ------
NM_006936chr2161259 1219 1182 1122 426 373 2889 46 1476 11200
NM_006939chr141834 11083 ----
NM_006940chr122640 625 --11604 11306
NM_006941chr2281092 1047 929 832 387 316 239 60 ------
NM_006946chr112186 111 --198 --
NM_006947chr431219 452 254 ------
NM_006948chr2152378 1572 724 566 185 ------
NM_006951chr102722 332 ----1576
NM_006955chr1021395 606 23144 206 --22924 81
NM_006963chr1031231 991 918 ------
NM_006965chr1811126 ------
NM_006981chr952916 2877 1864 914 46 ------
NM_006982chr122224 86 ------
NM_006990chr142200 1613 912 315 --41848 1769 1008 259 --
NM_006993chr10147 ------
NM_006997chr103182 61 32 1404 ----
NM_006999chr541422 1397 822 352 --1797 --
NM_007005chr961262 1162 1051 513 342 159 11244 ----
NM_007006chr1641047 710 383 216 13344 ----
NM_007007chr1264623 3024 1775 1563 1539 684 1725 23888 949 --
NM_007008chr21148 ------
NM_007011chr15186664 6520 6413 6345 6191 5965 5936 4544 4525 4256 2722 2181 2048 1494 1369 942 590 65 21021 597 24486 2253 --
NM_007015chr131276 ------
NM_007023chr221026 239 1270 ----
NM_007026chr173554 61 47 ------
NM_007027chr31114 ------
NM_007034chr12953 753 ------
NM_007035chr121620 ------
NM_007038chr2165721 5489 4656 2182 1373 144 13685 21757 556 --
NM_007040chr1941055 372 354 261 ------
NM_007045chr6195 ------
NM_007050chr20147183 7140 5239 2953 2709 2494 2434 2418 1733 748 463 414 304 41 --87440 6920 5754 5103 2864 2782 2049 179 --
NM_007067chr1751591 1239 521 187 79 ------
NM_007068chr2211061 ------
NM_007073chr6114031 3916 3580 3481 3325 2926 2634 2589 1640 1251 94 13466 ----
NM_007078chr1052996 2548 1225 1189 320 11944 147 --
NM_007084chr131568 --1306 --
NM_007087chr162285 279 --1794 --
NM_007106chr1352845 1762 631 305 51 ------
NM_007107chr332141 1947 1809 ------
NM_007111chr132626 587 2314 305 1362 --
NM_007118chr53899 745 227 ------
NM_007124chr631841 1651 413 1685 ----
NM_007125chrY51320 1115 1040 160 37 190 ----
NM_007126chr93422 163 104 ------
NM_007129chr133914 326 293 ------
NM_007137chrX65060 4816 4725 3962 3512 1587 11849 35098 4279 900 23716 986
NM_007145chr1921395 273 ------
NM_007146chr1712731 --12124 22032 954
NM_007150chrX71604 1497 1413 738 700 113 81 1400 ----
NM_007152chr11148 ------
NM_007158chr11448 --1789 --
NM_007159chr311536 ------
NM_007166chr112275 84 11160 ----
NM_007172chr2232062 510 39 ------
NM_007174chr1272264 2033 1718 1541 866 624 602 21884 73 31798 816 486 --
NM_007175chr843533 3443 1425 813 --12412 --
NM_007178chr12186 ------
NM_007184chr31358 --2545 396 --
NM_007185chr13673 357 292 ------
NM_007187chr131376 ------
NM_007195chr1872842 2798 2787 2773 2766 2281 929 ------
NM_007197chr1211049 ------
NM_007200chr1574401 4329 3723 3394 1442 1223 198 --43925 1271 978 61 --
NM_007202chr173689 118 29 ------
NM_007203chr963929 2957 2943 1397 731 312 11155 ----
NM_007207chr1127 1949 ----
NM_007212chr12792 353 1712 ----
NM_007214chr62465 52 ------
NM_007216chr111263 ------
NM_007218chr81200 ------
NM_007221chr11133 --2374 302 --
NM_007225chr17--21003 680 1786 --
NM_007232chr20--1673 2290 69 --
NM_007235chr12--1345 ----
NM_007236chr1592135 2119 1859 1829 709 690 480 263 115 2859 268 1367 --
NM_007238chr20104902 4891 4594 4556 4485 4161 3697 3484 3218 982 1128 23156 370 --
NM_007245chr163831 714 107 ------
NM_007249chr13119260 9021 7888 7414 7164 7006 6300 3299 2393 1165 1150 35837 2430 2244 17498 --
NM_007260chr11489 ------
NM_007268chrX3458 189 78 129 ----
NM_007269chr12187 69 ------
NM_007271chr651655 1442 1219 710 226 --11405 --
NM_007275chr341169 355 322 120 ------
NM_007277chr52338 21 ------
NM_007282chr31799 ------
NM_007285chr161405 ------
NM_007287chr353072 3036 2817 689 633 1296 11304 --
NM_007288chr353072 3036 2817 689 633 1296 11304 --
NM_007289chr353072 3036 2817 689 633 1296 11304 --
NM_007292chr17124990 4715 4334 4199 3307 1503 736 545 525 417 207 28 2561 265 ----
NM_007294chr1741259 1127 329 184 --11165 11204
NM_007295chr1741259 1127 329 184 --11165 11204
NM_007296chr1741259 1127 329 184 --11165 11204
NM_007297chr1741259 1127 329 184 --11165 11204
NM_007298chr1741259 1127 329 184 --11165 11204
NM_007299chr1741259 1127 329 184 --11165 11204
NM_007300chr1741259 1127 329 184 --11165 11204
NM_007302chr1741259 1127 329 184 --11165 11204
NM_007303chr1741259 1127 329 184 --11165 11204
NM_007304chr1741259 1127 329 184 --11165 11204
NM_007305chr1741259 1127 329 184 --11165 11204
NM_007313chr941883 750 569 249 ------
NM_007322chr192150 33 --1391 --
NM_007325chrX21977 1683 3602 533 118 1559 --
NM_007326chr22151 ------
NM_007327chr9----2480 376 --
NM_007331chr462642 2191 2149 2099 849 620 --1424 22143 939
NM_007345chr1822352 1757 --11877 --
NM_007347chr1523106 2814 12657 ----
NM_007349chr72333 72 ------
NM_007351chr42817 77 ------
NM_007353chr742049 1142 925 278 ----12314
NM_007358chr12757 751 ------
NM_007363chrX1867 1249 ----
NM_007365chr152114 2091 1652 1545 575 178 --1215
NM_007371chr92518 108 ------
NM_007372chr171889 1779 ----
NM_007373chr1071788 1588 1581 1479 566 227 130 21136 204 ----
NM_007374chr14----1469 --
NM_007375chr142154 1102 1001 238 ------
NM_009585chr34828 768 319 308 ------
NM_009585chr34828 768 319 308 ------
NM_012062chr123360 111 44 ------
NM_012064chr1231048 867 158 --1399 --
NM_012069chrX52543 1853 896 381 253 --1260 --
NM_012074chr144971 804 790 120 ------
NM_012081chr553733 3264 3199 2574 2312 21247 102 ----
NM_012082chr81707 ------
NM_012084chrX1555 ------
NM_012090chr181085 1060 1048 971 893 385 333 45 ------
NM_012092chr241217 700 289 119 1559 ----
NM_012095chr1053412 2851 2169 787 575 13503 1669 --
NM_012096chr352952 2946 727 402 231 2569 255 ----
NM_012102chr12860 823 11837 12047 --
NM_012104chr1163403 2692 2588 1437 270 222 --1437 --
NM_012104chr1163403 2692 2588 1437 270 222 --1437 --
NM_012110chr4158 ------
NM_012111chr141156 --129 --
NM_012120chr682743 2702 2640 2137 891 556 548 95 --1876 --
NM_012127chr9145 ------
NM_012129chr722470 329 ------
NM_012134chr121247 424 --41763 757 668 101 --
NM_012137chr152386 2238 2221 684 368 --172 --
NM_012141chr1394135 4070 3902 2763 1227 1010 608 258 67 12846 ----
NM_012142chr15163 --190 --
NM_012153chr1142391 1766 733 328 1457 ----
NM_012156chr2053325 3205 1343 344 210 11348 1698 --
NM_012158chr133695 411 65 ------
NM_012189chr183559 478 465 ------
NM_012192chr1162396 1483 627 590 244 126 12276 ----
NM_012193chr11135422 5338 5289 5155 4800 4542 3955 3423 3356 1646 718 540 183 13496 12003 --
NM_012197chr941458 646 471 202 1343 --11394
NM_012199chr194546 4152 3624 3540 3126 2977 1766 1601 1466 11032 12986 --
NM_012200chr11----1151 --
NM_012202chr112329 295 ------
NM_012207chr101944 ----11063
NM_012214chr2126309 5763 5068 5010 4375 4129 3978 2298 1584 934 532 234 21652 939 12337 16343
NM_012215chr1041844 1330 581 539 ------
NM_012218chr1982996 2842 2137 1874 1002 830 606 126 --12018 --
NM_012229chr10175 ------
NM_012232chr1752226 2192 1923 1902 356 ------
NM_012233chr241185 1065 798 421 1211 1767 --
NM_012234chr3113745 3713 3661 3485 2956 2630 2615 2306 894 289 136 13175 11287 --
NM_012238chr1021357 248 ------
NM_012243chr11278 1678 ----
NM_012247chr101176 1250 ----
NM_012250chr1111158 --21048 558 --
NM_012256chr731169 1087 211 1796 1199 1769
NM_012257chr71375 ------
NM_012262chr1124701 4676 4502 4378 3877 3819 3780 3427 3333 1475 1338 529 185 24265 1316 --
NM_012272chr122369 313 ------
NM_012281chr741758 763 383 195 11825 ----
NM_012282chrX4839 803 257 21 1721 ----
NM_012288chr685542 5480 5334 4835 4331 1380 337 309 --1739 --
NM_012290chr21249 21561 483 ----
NM_012293chr221605 32 ------
NM_012294chr793722 3463 2882 2823 1594 1470 1441 1367 1348 2503 97 --1872
NM_012296chr1163885 3807 3771 1491 669 504 --13528 --
NM_012297chr452519 960 594 360 324 12401 2927 599 --
NM_012302chr161200 1171 971 821 261 88 ------
NM_012304chr532487 2345 1645 ------
NM_012307chr181802 ------
NM_012308chr1172423 2376 1810 668 264 187 115 21775 539 12290 --
NM_012309chr1133695 3298 397 33066 3058 1114 ----
NM_012316chr1174489 3874 2247 1995 1943 1911 1899 1797 1645 1602 1477 1448 1321 1000 515 141 113 11467 35662 4471 4106 --
NM_012317chrX4605 327 281 132 --1196 --
NM_012320chr1641295 904 512 248 1234 144 --
NM_012321chr193160 77 23 ------
NM_012324chr224762 210 175 33 ------
NM_012326chr25759 309 283 252 54 ------
NM_012329chr1721491 1317 --11576 --
NM_012330chr1021789 301 ------
NM_012333chr121447 469 --21400 1303 --
NM_012334chr594757 4680 4642 4460 3550 1817 848 782 594 ------
NM_012342chr103526 444 57 ------
NM_012343chr52910 887 --1295 --
NM_012347chr632166 481 370 --12133 --
NM_012382chr564265 1331 1226 884 434 421 24449 3961 ----
NM_012383chr9137 ------
NM_012394chr1182 ------
NM_012395chr793408 2361 1131 939 908 651 521 505 170 --1567 --
NM_012399chr2231703 1621 1517 11498 ----
NM_012402chr112487 191 ------
NM_012405chr183674 3092 2666 2583 2531 2355 2345 1306 13264 1772 --
NM_012406chr1251258 1205 1079 311 211 1421 2830 362 --
NM_012407chr221126 --2372 102 --
NM_012412chr71659 ------
NM_012425chr101861 1381 ----
NM_012428chr1541021 361 66 53 ------
NM_012429chr221391 ------
NM_012430chr31106 ------
NM_012431chr763371 3161 2852 2606 2297 2286 ------
NM_012433chr2154 ------
NM_012445chr42532 209 ------
NM_012446chr51138 ------
NM_012448chr1742061 1798 890 493 ----11958
NM_012459chr111119 ------
NM_012461chr143579 470 74 ------
NM_012463chr1221619 473 --1523 --
NM_012464chr422292 884 1432 ----
NM_012465chr1063136 2529 1340 720 370 314 2973 740 13076 --
NM_012470chr71193 ------
NM_012471chrX31846 342 55 ----11347
NM_013227chr151715 ------
NM_013230chrY2559 221 ------
NM_013231chr1453080 2794 2744 1399 1030 32784 348 253 12817 --
NM_013233chr231152 259 200 ------
NM_013235chr53303 52 34 ------
NM_013246chr113295 223 41 ----183
NM_013254chr122689 174 ------
NM_013255chr7148806 8080 7810 7579 7250 6453 6003 5494 2298 1950 1863 1803 1013 406 15349 26029 5357 --
NM_013261chr433612 2628 2414 33564 1324 200 ----
NM_013267chr122464 25 ------
NM_013269chr1244037 1524 194 170 1984 1974 --
NM_013275chr161740 161 ----
NM_013279chr1152292 1523 558 164 107 --11963 --
NM_013281chr2041444 1248 187 73 11406 1347 --
NM_013283chr53780 293 183 1361 ----
NM_013286chr362889 2785 2671 428 332 245 1767 13493 --
NM_013293chr71154 ------
NM_013302chr1684450 4033 3583 2953 2945 1306 1276 318 ------
NM_013305chr181264 --147 --
NM_013316chr72335 311 1227 ----
NM_013320chr12--1148 ----
NM_013325chr251200 1086 591 354 310 --11047 --
NM_013354chr82460 362 ------
NM_013365chr224737 526 312 168 ----1187
NM_013372chr1573219 939 849 411 247 213 135 11134 13271 --
NM_013373chr221979 ------
NM_013374chr353069 2863 2773 2139 190 ------
NM_013381chr1222237 901 --1274 --
NM_013382chr1482293 2209 1723 1674 905 882 418 116 ------
NM_013392chr21418 ------
NM_013396chr2131510 552 85 --21410 275 --
NM_013400chr74988 879 830 156 ------
NM_013423chrX1291 ------
NM_013427chrX1291 ------
NM_013433chr1941665 1417 1350 569 ------
NM_013434chr251970 1286 609 406 318 ------
NM_013434chr251970 1286 609 406 318 ------
NM_013436chr2--1716 2680 652 --
NM_013437chr811017 21303 296 ----
NM_013438chr941695 1545 1336 70 ------
NM_013443chr931106 927 171 --198 --
NM_013446chr71363 133 --1191
NM_013449chr12102870 2804 2606 2251 2101 1983 1113 536 332 191 1883 --177
NM_013450chr2----11132 --
NM_013943chr153290 2853 2670 2146 868 1885 ----
NM_013958chr8135 ------
NM_013959chr8135 ------
NM_013960chr82671 295 ------
NM_013961chr8135 ------
NM_013962chr8135 ------
NM_014000chr106692 543 480 443 324 86 11213 ----
NM_014007chr96901 862 800 517 395 89 ------
NM_014010chr92559 521 ------
NM_014011chr231994 1758 727 1895 1144 --
NM_014016chr351536 1511 1449 1202 311 ------
NM_014021chr163187 3072 2175 1359 1286 1245 --23005 2839 --
NM_014023chr1082556 2297 2264 1942 1830 952 627 402 11156 22254 1779 --
NM_014028chr632406 1234 968 ------
NM_014030chr171874 --21037 472 --
NM_014038chr71377 ------
NM_014043chr31409 ------
NM_014048chr16105116 5005 4889 4632 4541 4103 3831 3294 1659 1627 21976 922 ----
NM_014071chr201142 1176 ----
NM_014106chr1521830 414 ------
NM_014109chr82935 877 ------
NM_014112chr8104743 4010 3924 3917 3363 2142 1963 1745 1310 240 --33865 993 861 14155
NM_014117chr1642564 1963 936 528 --1378 --
NM_014141chr795017 4096 3847 3525 1835 1163 1084 824 75 13325 11234 13623
NM_014153chr163667 628 97 1237 ----
NM_014155chr11146540 6448 6097 5740 5633 4598 2880 2396 2262 1781 1513 1282 1016 689 15400 1727 15612
NM_014157chr1663391 1357 947 855 518 459 11203 ----
NM_014159chr31202 ------
NM_014181chr262769 1858 728 670 158 54 12915 ----
NM_014184chr11136 ------
NM_014188chr12390 91 --2343 41 --
NM_014189chr451278 1229 995 451 379 11041 1353 --
NM_014190chr441630 1581 1347 731 11393 1705 --
NM_014191chr121135 ------
NM_014206chr11272 42 --190 --
NM_014211chr531422 1160 135 ------
NM_014212chr122960 939 --1314 --
NM_014214chr182106 45 1353 ----
NM_014217chr131525 1373 67 --1601 --
NM_014225chr19----1294 --
NM_014231chr1241941 1355 865 244 11381 124 --
NM_014232chr171326 --21319 1188 --
NM_014232chr171326 --21319 1188 --
NM_014233chr1741897 1833 1659 670 ------
NM_014234chr6126 ----160
NM_014240chr383293 3148 3099 2930 2643 891 210 51 12935 ----
NM_014241chr101353 ------
NM_014243chr421840 472 ------
NM_014245chr321117 733 ------
NM_014248chr221122 --161 --
NM_014251chr71839 --1791 --
NM_014253chrX51701 728 559 369 41 ------
NM_014263chr10----127 --
NM_014268chr182270 131 --11000 --
NM_014271chrX2183 82 ------
NM_014275chr52923 571 ------
NM_014278chr41177 ------
NM_014279chr92305 64 ------
NM_014280chr13378 52 37 ------
NM_014283chr111326 ------
NM_014284chr131032 895 742 ------
NM_014292chr2261235 553 450 318 311 61 ------
NM_014294chr82369 43 --1335 --
NM_014296chr31450 --11332 --
NM_014305chr131700 ------
NM_014309chr22125367 5140 5132 4749 3934 3845 3708 2063 1367 1183 1088 867 --11840 --
NM_014316chr1642001 1873 1804 1415 --11851 --
NM_014319chr1241961 1777 467 53 21246 438 11704 11296
NM_014322chr141141 1133 1069 416 ------
NM_014323chr223949 687 45 ------
NM_014325chr1232259 2148 1459 11921 ----
NM_014333chr1171055 964 702 626 584 186 144 --1415 --
NM_014342chr1111465 ------
NM_014345chr63910 665 402 ------
NM_014346chr22--1432 1357 --
NM_014350chr531155 433 389 157 ----
NM_014351chr2241463 1218 983 533 --185 --
NM_014352chr1121404 1084 11497 1334 --
NM_014363chr1321258 59 ------
NM_014365chr121821 ------
NM_014368chr961972 1608 1555 1361 456 263 --11348 1174
NM_014372chr131725 606 412 ------
NM_014374chr74988 879 830 156 ------
NM_014382chr3--11292 1156 --
NM_014390chr7--1415 ----
NM_014392chr41473 --2362 156 --
NM_014393chr852271 1709 1579 206 85 ------
NM_014395chr441953 1907 260 171 1159 1715 --
NM_014397chr951379 1353 525 475 231 1916 11291 --
NM_014399chr7--1180 ----
NM_014405chr1741797 1503 1461 690 ------
NM_014408chr12125 41 --1541 --
NM_014415chr331635 442 87 ------
NM_014417chr192881 329 ------
NM_014421chr431412 789 540 1356 ----
NM_014423chr534678 1950 521 1382 14343 15137
NM_014426chr203619 458 182 ------
NM_014437chr16962 950 751 660 346 49 ------
NM_014445chr312344 1890 ----
NM_014447chr441685 1497 1375 1244 ------
NM_014452chr63970 852 254 ------
NM_014454chr64839 829 162 137 --2418 302 --
NM_014455chr1------1418
NM_014456chr101418 1425 ----
NM_014462chr8121 ------
NM_014469chr112225 128 --164 --
NM_014482chr2----1103 --
NM_014491chr7----1938 --
NM_014494chr1611842 ------
NM_014496chrX190 ------
NM_014504chr731498 718 476 ------
NM_014506chr91101 --1543 --
NM_014515chr121851 --1787 --
NM_014517chr33730 444 311 --1264 --
NM_014520chr173360 154 132 ------
NM_014521chr221838 598 1352 264 23 --
NM_014547chr151200 ------
NM_014547chr151200 ------
NM_014550chr221592 --1210 --
NM_014552chr241424 1140 371 312 1946 ----
NM_014554chr1241767 794 597 97 ------
NM_014562chr22747 173 --164 --
NM_014564chr92761 69 --1284 1316
NM_014572chr1351642 1122 460 333 137 ------
NM_014573chr172652 207 11429 ----
NM_014574chr1431539 1265 1241 11477 ----
NM_014575chr32519 68 ------
NM_014577chr221242 ------
NM_014584chr1441602 1219 444 26 ------
NM_014585chr2126 ------
NM_014587chr1611405 --31513 544 138 1113
NM_014588chr202303 142 ------
NM_014591chr1051213 1095 861 848 335 11299 ----
NM_014592chr54773 718 294 272 1141 ----
NM_014607chr23201 190 128 ------
NM_014612chr951470 1097 1072 998 962 2597 518 ----
NM_014613chr572701 2482 2286 2240 430 363 149 --1749 12272
NM_014614chr21418 1103 ----
NM_014615chr1693619 3538 2888 2663 2379 981 962 903 464 13309 ----
NM_014616chr32399 67 1297 12695 --
NM_014618chr91328 --133 --
NM_014620chr12----1254 --
NM_014621chr2----175 --
NM_014629chr871339 1007 953 902 849 288 21 ----21138 882
NM_014630chr1573602 3302 987 822 738 630 306 --22996 363 --
NM_014635chr211630 11360 ----
NM_014636chr9104294 4115 4105 3686 3104 827 820 769 752 589 23913 3148 ----
NM_014646chr18102565 2530 2248 2152 2132 964 865 794 507 437 175 2870 270 12226
NM_014647chr1631924 1884 1726 ------
NM_014649chr19--144 ----
NM_014655chr152314 704 485 442 353 --2722 26 1165
NM_014659chr153777 733 206 1453 ----
NM_014660chr71373 11077 ----
NM_014661chr10123525 2830 2573 2454 1310 1141 1050 744 724 519 412 323 --43352 3323 2592 151 --
NM_014665chr8153426 3152 2578 2535 1440 1431 1058 699 601 417 255 194 157 129 65 --1116 12709
NM_014667chr352394 2285 947 289 168 21575 553 ----
NM_014670chr231592 469 156 --11222 --
NM_014671chr73500 437 326 11146 11071 --
NM_014674chr3103982 3297 2725 1359 1179 619 347 338 198 181 13350 1100 --
NM_014676chr11306 --1232 --
NM_014677chr81115 ------
NM_014679chr1141387 1002 387 251 ------
NM_014682chr81676 --1446 --
NM_014685chr163552 367 23 --1388 --
NM_014686chr1952483 2369 1897 775 250 1744 2805 348 --
NM_014690chr7102654 2360 2334 1901 843 815 727 502 429 394 --12002 --
NM_014693chr31175 1509 1563 --
NM_014699chr161391 ------
NM_014701chr1553095 2664 2645 1232 820 ------
NM_014702chr633243 2949 85 ------
NM_014703chr361215 1155 1008 375 280 146 --21198 119 --
NM_014705chr741841 595 584 130 32126 1407 168 ----
NM_014706chr1241124 1047 840 495 ----1783
NM_014707chr741571 335 264 198 ------
NM_014709chr21110 ------
NM_014713chr21351 ------
NM_014720chr1041288 1186 405 291 1482 11322 --
NM_014721chr6147379 7238 7028 6992 5714 5300 5076 5019 1796 1376 1083 370 313 56 --25862 215 15129
NM_014723chr2082510 2235 2141 2048 1281 1021 579 317 --11090 --
NM_014726chr1751423 1135 470 229 126 ------
NM_014729chr821853 261 11503 21524 922 --
NM_014730chr1294508 4350 4305 4057 3755 3654 1929 880 279 --43207 1812 1000 741 --
NM_014730chr1294508 4350 4305 4057 3755 3654 1929 880 279 --43207 1812 1000 741 --
NM_014732chr1695826 5712 5619 5419 5379 4964 3924 3610 2323 14306 24527 124 --
NM_014735chrX2613 601 ------
NM_014740chr17153 --141 --
NM_014741chr1151640 767 515 318 93 --2379 328 11724
NM_014742chr2051267 409 281 94 27 ------
NM_014743chr481966 936 737 653 379 178 148 72 22550 1081 --12597
NM_014747chr1145295 5116 4595 3954 3825 2166 1293 1270 1249 1230 992 884 444 428 23677 1035 53662 1371 118 107 49 --
NM_014748chr21405 ------
NM_014751chr841980 1587 822 640 --11478 --
NM_014752chr1131249 544 117 2372 219 --2625 41
NM_014754chr83951 761 606 1844 1325 --
NM_014755chr233874 535 89 11711 23745 1203 --
NM_014756chr111168 --1190 --
NM_014757chr531823 570 216 2635 405 11916 --
NM_014761chr163897 169 154 1189 ----
NM_014765chr172405 1922 1070 1014 797 519 402 1752 ----
NM_014767chr1073347 3169 3111 2820 2488 497 105 13433 23036 1073 --
NM_014771chr161772 ------
NM_014772chr1843596 2869 2854 2456 1783 11338 --
NM_014774chr162997 2978 2854 2829 2810 2553 1540 12885 22948 845
NM_014779chr31819 1184 ----
NM_014781chr82948 328 ------
NM_014782chrX192 ------
NM_014784chr121081 170 --1723 --
NM_014786chr1131234 881 51 ------
NM_014787chr161790 1781 1076 903 824 24 ------
NM_014790chr5----1347 1169
NM_014795chr2270 56 ------
NM_014797chr612422 ------
NM_014800chr72853 178 --1897 --
NM_014806chr91136 ------
NM_014807chr112816 606 ----1286
NM_014812chr121838 643 ------
NM_014819chr541980 1913 770 358 11679 ----
NM_014820chr311550 21599 171 12003 --
NM_014822chr41100 ------
NM_014824chr1111243 ----11582
NM_014826chr194377 4254 3896 3204 3025 2837 1694 815 86 --11429 --
NM_014827chr131275 1205 600 ------
NM_014828chr1462389 1995 899 183 61 38 ----12225
NM_014829chr52204 57 ----1111
NM_014830chr12103808 3327 3304 2648 1369 1082 851 549 215 173 23157 572 22585 1133 --
NM_014832chr1342112 1852 842 613 11800 ----
NM_014835chr2032086 1839 185 2628 163 1783 --
NM_014836chr1031420 693 363 21453 567 ----
NM_014839chr141872 977 747 665 --11941 --
NM_014840chr1272906 2593 2103 853 780 221 86 --32982 2111 821 --
NM_014841chr62538 318 11146 ----
NM_014847chr1----1178 --
NM_014848chr152904 866 ----12435
NM_014849chr13311 303 286 --1487 --
NM_014850chr354749 4377 4244 3891 1734 --34878 4430 4167 --
NM_014868chr124851 674 368 78 ------
NM_014871chr12------1548
NM_014872chr941559 941 644 161 21981 833 1880 --
NM_014873chr184254 3659 2954 1787 529 506 315 193 24442 1103 ----
NM_014874chr141819 1450 1438 671 21792 628 31480 509 183 --
NM_014875chr15907 829 744 284 55 --1809 --
NM_014876chr2232193 1775 343 1330 11470 11858
NM_014877chr17127243 7052 6794 6617 6577 5938 5679 5179 2603 2424 1710 138 --15601 --
NM_014883chr442467 2075 506 147 11568 1443 --
NM_014893chrY22326 2265 --11955 --
NM_014897chr1752929 2497 933 883 318 21235 1042 ----
NM_014899chr552696 1018 819 708 553 --1265 --
NM_014900chr22452 404 --11031 --
NM_014901chr552230 1994 1786 759 544 12274 1296 --
NM_014902chr2011450 --21405 254 --
NM_014903chr1212030 ------
NM_014905chr232064 1475 356 1329 ----
NM_014906chr1774017 3352 3121 2772 1235 1150 711 13265 --12490
NM_014907chr91125 ------
NM_014909chr1473446 2991 2802 2614 733 350 342 1280 63974 3932 2619 944 754 57 --
NM_014912chr103886 693 249 --12871 13471
NM_014913chr1821444 155 ------
NM_014915chr1011031 11074 ----
NM_014917chr1--1222 ----
NM_014918chr1561612 1203 1171 544 369 215 ----1194
NM_014920chr653198 808 586 542 521 ------
NM_014921chr1992548 2313 2004 1201 1040 897 622 524 423 --22608 1910 --
NM_014925chr122900 179 ------
NM_014926chr32716 74 ------
NM_014927chrX----135 --
NM_014932chr311801 1653 11344 --
NM_014933chr4--1139 ----
NM_014938chr1242357 2216 446 373 22024 839 61998 1948 915 697 311 212 1179
NM_014939chr1851235 450 375 297 46 ------
NM_014942chr622409 211 1516 1425 --
NM_014944chr131059 45 30 --21133 911 --
NM_014945chr551822 1244 793 336 118 ----11504
NM_014946chr251087 881 800 643 439 22561 1126 ----
NM_014947chr183108 2967 2954 2051 696 327 237 94 --1947 --
NM_014950chr141670 1242 11222 --
NM_014962chr2052416 2200 2019 1123 195 ------
NM_014964chr1731812 1613 201 12418 12261 --
NM_014969chr131145 214 205 ------
NM_014974chr1011254 ------
NM_014978chr1031661 1545 670 --1701 --
NM_014988chr462403 1778 854 848 348 174 --1968 --
NM_014991chr433004 2656 840 ------
NM_014994chr1541476 815 713 187 --22025 1541 --
NM_014996chr31151 1373 1737 --
NM_014997chr742182 1999 1934 1137 --22575 2232 --
NM_015000chr12160 13025 ----
NM_015002chr1222180 29 --21539 98 --
NM_015008chr383415 3087 2958 2652 2641 2629 2217 1058 --1998 --
NM_015017chr11251 ------
NM_015020chr1693732 3631 3200 2589 2375 1179 824 135 58 22927 707 ----
NM_015023chr181711 1539 1512 1144 434 266 120 30 --31527 423 167 1585
NM_015024chr841446 1358 1259 195 --1946 --
NM_015025chr252639 2054 151 57 29 1254 12329 --
NM_015026chr1264717 3577 3158 3071 1701 111 1773 11183 --
NM_015027chr166789 596 429 301 209 102 11350 11989 --
NM_015032chr13--1112 22656 2606 --
NM_015033chr9103247 3204 2908 2742 2549 2431 700 487 302 54 ------
NM_015035chr20146308 6242 4928 4450 2531 1726 1481 1351 744 625 584 458 110 80 16232 46040 5038 2217 659 --
NM_015039chr184081 3418 3237 3132 1612 1588 1203 56 --13594 1115
NM_015040chr253172 2987 2715 2276 599 22965 414 12382 12163
NM_015042chr15114376 3912 3690 3656 3597 3377 2657 1728 1338 357 113 33739 3624 3413 1819 --
NM_015044chr16103232 2962 2920 2816 2198 2115 1275 439 285 54 --12758 12585
NM_015045chr105765 376 356 341 301 ------
NM_015046chr952061 1827 704 376 111 --22684 2083 1633
NM_015049chr252439 2392 2076 1099 501 --1334 --
NM_015051chr932962 389 201 ------
NM_015053chr162132 2013 1797 1756 421 69 --1870 --
NM_015057chr132169 78 ------
NM_015063chr1931266 159 62 11179 21300 251 --
NM_015064chr1272307 1419 1102 914 547 484 372 21393 1114 22237 1262 --
NM_015068chr773971 3922 3848 2468 1494 366 49 11599 23283 1565 --
NM_015069chr162603 217 ------
NM_015071chr5146367 4666 4640 4529 4156 4130 2279 2145 1892 1885 1586 1370 1097 115 55775 1779 1160 55 25 36380 1901 386 15259
NM_015074chr1114903 4511 4325 4167 4149 1964 1915 1672 935 897 405 24650 2003 13577 --
NM_015075chrX32007 1539 190 --11496 --
NM_015076chr684453 4405 4279 3665 3278 1180 1052 493 --11802 --
NM_015077chr17104612 4020 3805 3644 3638 3390 1367 713 684 277 11525 33283 693 27 1336
NM_015080chr116914 883 730 686 641 363 ------
NM_015082chr562148 2087 783 502 311 237 --1524 --
NM_015086chr122531 117 ------
NM_015087chr1372436 2376 1926 1860 782 588 330 ------
NM_015089chr61112 1118 ----
NM_015090chr1135800 5527 5398 4840 4430 3985 2478 2109 1999 1904 1095 746 339 1637 34001 3826 708 --
NM_015091chr142738 271 ------
NM_015092chr1674678 4009 3660 3190 3023 2940 1333 23149 1424 ----
NM_015093chr641203 658 453 128 1217 ----
NM_015094chr2254179 4168 1786 585 37 11716 23151 2871 --
NM_015097chr332298 1591 729 22351 1968 ----
NM_015099chr173279 155 103 ------
NM_015100chr131579 1480 237 ------
NM_015103chr32293 28 --1318 1730
NM_015106chr31156 ------
NM_015107chrX62377 1979 1780 927 498 118 --1720 --
NM_015110chr952511 2462 2382 1934 118 ------
NM_015115chr462614 891 823 263 158 69 22648 2352 1163 --
NM_015130chr431305 1137 158 --1308 --
NM_015132chr721615 85 ------
NM_015133chr1621464 1009 ------
NM_015137chr842309 789 681 517 1585 1230 --
NM_015138chr1572742 2101 1726 1029 933 775 154 1102 1348 --
NM_015143chr44482 322 272 233 ------
NM_015144chr1673359 3345 3286 3259 3229 2677 1331 186 ----
NM_015151chr211311 ------
NM_015153chr62241 80 ------
NM_015155chr1073252 2644 2473 1191 1008 825 368 ------
NM_015156chr1463873 3842 3375 3305 1473 1380 14017 2975 437 11342
NM_015157chr1161104 793 470 269 255 146 ------
NM_015158chr92249 233 1240 159 --
NM_015161chr1661355 1064 420 407 270 61 ------
NM_015163chr1491901 1796 1755 1321 1294 481 389 198 31 ------
NM_015170chr821535 1452 3264 231 155 ----
NM_015171chr162442 33 ------
NM_015172chr151364 1114 530 168 110 ------
NM_015173chr431742 1592 1269 ------
NM_015176chr13378 227 160 ------
NM_015178chr82346 61 --2413 29 --
NM_015184chr31211 ----1453
NM_015185chrX42555 1099 668 212 185 22899 2696 --
NM_015192chr201206 2825 575 ----
NM_015194chr1741475 470 200 66 --3798 353 98 --
NM_015197chr1472911 2143 2134 1175 823 347 189 --53237 2412 2197 1373 958 --
NM_015199chr372860 2788 2746 1187 800 793 304 12318 ----
NM_015200chr422093 596 ------
NM_015206chr1561269 1024 810 804 750 462 --12738 11306
NM_015208chr1843043 3018 1416 288 11421 ----
NM_015209chr152133 1772 1711 641 422 1901 123 --
NM_015213chr11--1176 1607 --
NM_015215chr153184 3109 2284 2171 260 13094 ----
NM_015221chr1041465 1388 1002 84 --130 --
NM_015225chr962613 2425 2074 1925 872 443 22824 50 ----
NM_015236chr431078 600 361 ------
NM_015238chr51162 ------
NM_015247chr1665370 3811 3600 3587 3301 539 23356 517 13982 13727
NM_015250chr931519 1442 213 11530 ----
NM_015252chr22600 45 ------
NM_015256chr51645 ------
NM_015263chr152364 71 2408 344 ----
NM_015265chr262113 1066 1032 837 582 50 12166 ----
NM_015267chr122426 219 11925 22052 1881 --
NM_015269chr1----159 --
NM_015270chr1232153 941 108 1906 1898 --
NM_015271chr423532 3167 12660 12952 --
NM_015272chr1621641 1337 ------
NM_015277chr1821182 45 --21543 1316 --
NM_015278chr663260 3086 2213 532 373 350 ------
NM_015282chr262497 2482 2355 2226 2107 857 21121 837 --1271
NM_015284chr142120 1619 431 156 --11461 --
NM_015288chr5133801 3772 3203 2662 2436 2366 1531 1080 1054 949 444 275 166 32388 1538 87 32604 1066 648 --
NM_015292chr121245 ------
NM_015294chr1731051 146 53 ----11103
NM_015296chr131155 11256 11210 --
NM_015305chr1471896 1826 1593 1462 1440 1374 1283 ------
NM_015308chr112772 678 ------
NM_015310chr8108160 7955 7877 7228 6662 2512 2209 1216 646 303 --32698 1627 582 17266
NM_015313chr1184805 4696 4505 4079 3611 1369 583 554 11104 ----
NM_015314chr731602 1042 381 2660 255 11864 --
NM_015315chr5113426 3386 2752 2246 1277 1189 1174 1165 1044 957 397 --31194 1123 554 --
NM_015317chr252553 2536 2390 1092 237 --11755 --
NM_015319chr121173 ------
NM_015326chr172527 2148 2142 1918 1904 708 197 ----11993
NM_015327chr121316 1184 --1276 --
NM_015328chr792801 2690 2145 2023 1193 879 733 706 399 --22074 2003 --
NM_015335chr12167 ------
NM_015336chr122733 601 131 ----
NM_015338chr2071858 1621 1503 1248 756 654 422 1578 31289 1191 180 1512
NM_015339chr2031044 976 179 ------
NM_015344chr831596 824 283 ----2255 172
NM_015345chr622411 290 12182 ----
NM_015346chr1441621 1502 587 423 ------
NM_015347chr1252706 2640 1979 846 585 ----1785
NM_015349chr652647 974 576 160 117 --12273 --
NM_015353chr1762767 2405 2306 1925 1032 225 ------
NM_015355chr1721232 628 11795 ----
NM_015359chr832579 2400 616 ------
NM_015360chr5145 ------
NM_015365chrX54052 3253 348 288 196 ------
NM_015374chr222231 77 --122 --
NM_015375chr113992 --34696 500 120 --
NM_015385chr1043246 2059 968 464 --32043 609 339 1553
NM_015387chr272076 1992 1774 1682 451 273 240 ------
NM_015392chr92203 28 ------
NM_015393chr4103509 3163 2645 2478 1006 710 670 643 530 110 ------
NM_015396chr311403 --1480 --
NM_015397chr921419 1187 ------
NM_015409chr1252650 2633 2460 2319 1854 --1978 --
NM_015415chr11247 ------
NM_015416chr122741 207 ----1984
NM_015419chrX11074 --1412 1205
NM_015429chr321035 293 1157 11027 --
NM_015435chr811495 ------
NM_015443chr1721387 454 1284 1252 --
NM_015446chr121617 1552 ------
NM_015447chr91261 1274 1623 --
NM_015455chr562699 1510 697 609 555 97 ------
NM_015458chr894420 3822 3388 1783 1624 1510 1378 1178 197 24976 2112 ----
NM_015460chr371620 1484 1453 1427 587 392 295 --11838 11548
NM_015461chr181143 ------
NM_015464chr73116 85 42 1279 ----
NM_015466chr32245 186 ------
NM_015470chr2101193 1158 1088 1037 872 481 242 149 118 46 --11108 1982
NM_015475chr22941 118 --11019 --
NM_015477chr151176 ------
NM_015481chr1211033 ------
NM_015483chr72787 327 1792 1924 --
NM_015484chr13774 743 52 ------
NM_015488chr251511 1303 1174 1157 338 --1191 --
NM_015493chr1951732 1441 208 143 67 ------
NM_015497chr154980 734 712 231 --1928 --
NM_015508chr321412 987 --11405 --
NM_015511chr2011027 --11105 --
NM_015515chr17----125 --
NM_015520chr332498 2275 2144 21720 1052 22251 2042 --
NM_015527chr162656 633 1147 3832 609 106 --
NM_015530chr22988 635 --2336 251 --
NM_015534chr121002 91 ------
NM_015535chr2103655 3553 3211 3132 2589 1374 1121 1036 907 165 41650 627 396 198 13005 13075
NM_015541chr331305 496 335 ------
NM_015548chr61366 ------
NM_015549chr141505 1634 ----
NM_015559chr181360 --1733 --
NM_015560chr341111 681 454 86 ----1776
NM_015564chr543444 3281 1045 378 --31437 420 220 --
NM_015567chr1321275 272 ------
NM_015568chr20143912 3761 3676 3599 3178 3112 3072 1620 660 544 521 249 188 113 11517 1196 13291
NM_015569chr144579 4476 4300 433 44674 3912 3760 3639 ----
NM_015570chr731734 1486 736 ------
NM_015571chr622357 2216 ------
NM_015575chr252680 2425 1391 632 346 1860 23384 1007 --
NM_015576chr32638 434 1338 1465 --
NM_015577chr531399 580 491 --1717 --
NM_015578chr1921740 1684 ------
NM_015584chr1751083 447 405 346 67 ------
NM_015589chr14146 ------
NM_015601chr101943 ------
NM_015605chr105611 518 233 139 46 11006 1643 --
NM_015609chr192895 2797 2724 2699 2634 2411 2003 139 31 ------
NM_015610chr762788 2422 2321 424 205 69 12245 --1790
NM_015626chr1741161 1147 922 352 ------
NM_015627chr181630 1261 1210 511 433 418 310 178 11319 31829 272 61 --
NM_015630chr211136 ------
NM_015638chr20276 28 --193 --
NM_015645chr112338 309 --1140 --
NM_015649chr192378 254 ------
NM_015652chr10173 ------
NM_015670chr171453 ------
NM_015678chr1311466 --1549 --
NM_015686chrX22507 852 ------
NM_015691chrX72850 2306 2207 2201 2035 747 39 ------
NM_015695chr631980 820 526 1750 21945 191 --
NM_015702chr22255 23 ------
NM_015716chr172744 655 --1129 --
NM_015726chr131792 1733 1557 ------
NM_015832chr18147 ------
NM_015844chr18----1682 --
NM_015845chr181196 ------
NM_015846chr18----1682 --
NM_015847chr18----1682 --
NM_015850chr862149 2056 1990 890 826 226 1531 52414 1893 195 103 65 --
NM_015853chr11163 ------
NM_015866chr141476 1234 373 176 ------
NM_015869chr3--1206 ----
NM_015872chr151551 1308 1262 1216 597 --1109 --
NM_015885chr11144 ------
NM_015888chr133412 2727 2167 1892 ----
NM_015889chr221116 --1646 1601
NM_015891chr632002 1790 1443 ----11566
NM_015895chr6--124 1249 --
NM_015898chr1922071 496 ----11791
NM_015899chr12145 ------
NM_015902chr82323 23 1285 --1147
NM_015904chr22264 221 ------
NM_015906chr194680 4483 4418 4319 3696 1552 1028 557 92 33571 1930 1021 ----
NM_015913chr14671 592 503 156 ------
NM_015915chr141282 ------
NM_015920chr151587 ------
NM_015975chrX31756 1306 1234 11219 ----
NM_015981chr5103130 2318 2155 633 626 296 154 92 69 29 --22474 1984 --
NM_015984chr13550 466 31 ------
NM_015994chr142712 283 ------
NM_015995chr1585437 4750 2107 2005 1746 1644 1271 426 14164 24418 3551 --
NM_015999chr12667 490 165 ----
NM_016003chr762788 2422 2321 424 205 69 12245 --1790
NM_016009chr164561 4383 4154 4128 1021 964 --24825 4635 --
NM_016018chr832307 1129 731 --11144 --
NM_016019chr72869 155 ----1988
NM_016021chr662983 2098 810 669 232 185 11868 11993 --
NM_016022chr11288 11052 ----
NM_016032chrX51267 1256 1098 389 322 --1157 --
NM_016038chr7189 ------
NM_016045chr2011576 --1396 --
NM_016047chr21117 ------
NM_016048chr52999 270 ----1728
NM_016057chr122321 53 ------
NM_016061chr231663 1470 652 11126 ----
NM_016072chr1252356 1849 1676 1508 329 12145 ----
NM_016073chr152974 156 ------
NM_016078chr172971 856 ------
NM_016081chr422098 450 12091 11472 --
NM_016083chr633099 2870 937 --21175 215 13186
NM_016087chr711139 ------
NM_016090chr111339 ------
NM_016096chr841545 1350 539 435 195 ----
NM_016098chr61168 155 ----
NM_016100chr202337 297 ------
NM_016103chr5195 ------
NM_016107chr511172 11238 ----
NM_016118chr72425 32 ------
NM_016120chrX21218 62 ------
NM_016121chr11904 ------
NM_016131chr241949 1741 884 242 1687 154 1165
NM_016132chr1583354 3078 2960 2335 1362 1350 1228 757 142 ----
NM_016133chr231665 1430 475 ------
NM_016147chr113265 227 40 --11112 --
NM_016152chr32478 82 ------
NM_016162chr121321 --1612 --
NM_016172chr92289 138 ------
NM_016188chr7125 ------
NM_016195chr101118 ------
NM_016201chr372285 1777 1512 1471 489 283 212 --1594 --
NM_016203chr71750 1883 ----
NM_016206chr3138597 8261 8172 7416 7183 7015 3007 2891 2423 1840 1478 503 259 28640 8356 27174 2641 --
NM_016211chr4--1139 ----
NM_016217chr623444 2865 33335 1129 812 ----
NM_016221chr551707 837 187 176 72 --1407 1201
NM_016227chr111326 ------
NM_016231chr1721478 1063 ------
NM_016234chr102944 111 1753 ----
NM_016248chr1373669 3496 3050 2876 2562 1229 490 ------
NM_016250chr141797 ------
NM_016255chr632289 1174 187 31244 1001 300 ----
NM_016257chr162414 1400 1386 1062 1009 529 --13298 12758
NM_016258chr1------1817
NM_016260chr276800 6700 6203 6143 5221 4807 2328 25774 127 24999 1653 --
NM_016271chr18----1258 --
NM_016272chr224845 598 350 341 ------
NM_016277chr621018 239 ------
NM_016281chr123889 461 154 ------
NM_016284chr161138 ------
NM_016287chr12825 748 --22052 288 --
NM_016289chr241611 170 104 44 ------
NM_016300chr32195 117 ------
NM_016302chr32626 56 ------
NM_016303chrX146 --1101 --
NM_016308chr122003 531 ------
NM_016315chr221765 1474 ------
NM_016319chr122588 285 ------
NM_016320chr111806 1936 1126 1741
NM_016322chr982027 1168 1004 948 432 411 128 49 --1504 1960
NM_016329chr34392 326 119 62 --1193 --
NM_016337chr141120 ------
NM_016338chr51283 ----182
NM_016339chr1781710 1571 1553 1318 1310 646 215 111 11579 --1170
NM_016351chr7191 ------
NM_016374chr1--142 ----
NM_016374chr1--142 ----
NM_016377chr651443 1133 493 434 45 2160 57 --11249
NM_016395chr1521919 1352 ------
NM_016396chr1582544 2054 2020 943 921 608 464 113 22131 84 ----
NM_016422chr112476 24 ----12310
NM_016424chr1731925 1821 781 ------
NM_016431chr224762 210 175 33 ------
NM_016436chr2032116 1004 530 ------
NM_016441chr252129 677 436 84 52 11834 12268 --
NM_016454chr152318 300 ------
NM_016463chr51137 ------
NM_016467chr22998 546 11124 ----
NM_016470chr201108 ------
NM_016472chr1431126 391 117 ------
NM_016480chr51728 ------
NM_016485chr63786 493 262 ------
NM_016492chr171141 130 ----
NM_016505chr11703 ------
NM_016506chr114666 258 215 173 1709 ----
NM_016507chr1753222 2127 839 150 142 32053 1063 765 ----
NM_016513chr653198 808 586 542 521 ------
NM_016519chr41171 ------
NM_016522chr1111398 ------
NM_016525chr94676 652 618 385 1339 ----
NM_016530chr1541517 1225 620 49 1104 1262 --
NM_016531chr464101 3852 3403 3193 1186 1027 13079 ----
NM_016536chr19393 82 76 ------
NM_016538chr171162 ------
NM_016542chrX----11515 --
NM_016559chr34971 596 562 510 ------
NM_016562chrX31693 1282 1034 ------
NM_016570chr12------1315
NM_016575chr12165264 4949 4634 4624 4118 4109 3891 3855 2183 1875 1695 1549 1514 924 834 474 ----24994 4677
NM_016577chr3113971 3918 3850 3306 3272 3078 2774 1506 811 404 39 12887 23173 1480 --
NM_016578chr111190 ------
NM_016582chr11126 ------
NM_016588chr61686 ------
NM_016592chr2031253 499 393 ------
NM_016603chr522211 410 ------
NM_016604chr5181 ------
NM_016605chr532167 1950 1069 22295 917 12592 --
NM_016607chrX21653 681 ------
NM_016612chr82274 118 ------
NM_016613chr432753 2092 1747 1434 ----
NM_016618chr21151 ------
NM_016621chr1174163 3370 3123 1651 726 669 460 13999 53631 3511 3430 3396 1588 11447
NM_016623chr81103 1639 124 --
NM_016626chr1811726 ------
NM_016628chr105910 791 766 653 51 ------
NM_016630chr151387 ------
NM_016631chr21------1845
NM_016651chr1411141 ----21042 424
NM_016654chr1521231 1118 ------
NM_016823chr1711168 123 ----
NM_016824chr1021821 362 ------
NM_016834chr17114122 3349 3024 2663 2623 2507 1167 958 929 913 141 13292 33626 716 408 --
NM_016835chr17114122 3349 3024 2663 2623 2507 1167 958 929 913 141 13292 33626 716 408 --
NM_016836chr21510 1753 ----
NM_016839chr21510 1753 ----
NM_016841chr17114122 3349 3024 2663 2623 2507 1167 958 929 913 141 13292 33626 716 408 --
NM_016848chr9173 ------
NM_016929chr654487 2968 805 636 150 --23906 126 --
NM_016931chr111319 1272 ----
NM_016936chr1631540 1482 91 11704 1184 --
NM_016946chr153136 1448 1391 1264 1150 1206 ----
NM_016950chr421084 461 ----11328
NM_016953chr255690 5283 5249 4353 1632 ----15002
NM_017409chr122581 551 ------
NM_017413chrX72480 2024 1706 1694 901 152 68 --1114 --
NM_017420chr1433260 2893 1352 ----11298
NM_017423chr422049 1992 --2427 77 --
NM_017425chr111122 ------
NM_017437chr14127 --22344 885 --
NM_017447chr2194447 4376 4278 4170 3837 3180 1330 796 580 21551 1346 ----
NM_017449chr121620 1067 11287 2640 462 --
NM_017450chr1711436 --1266 --
NM_017455chr1541021 361 66 53 ------
NM_017456chr173286 78 47 ------
NM_017457chr191149 ------
NM_017488chr221325 1174 ------
NM_017514chrX3740 286 175 ------
NM_017519chr62253 190 ------
NM_017522chr11370 1278 ----
NM_017534chr17----195 --
NM_017540chr573046 2821 2421 2368 2081 710 427 12651 --1250
NM_017544chrX1221 ------
NM_017548chr351562 575 493 347 82 1606 ----
NM_017551chr1062406 2265 1941 745 527 367 --1429 --
NM_017558chr162396 163 ------
NM_017563chr396142 5669 5463 5318 4840 1950 1734 371 39 1981 31426 769 280 14626
NM_017577chr321659 171 ------
NM_017582chr161547 1309 582 550 291 244 --21240 233 --
NM_017588chr941920 1741 448 190 --11788 --
NM_017590chr2242676 2098 629 315 ------
NM_017593chr4--1179 ----
NM_017594chr92575 563 1265 ----
NM_017596chr154158 3942 3148 1691 1250 --34541 4147 3777 1874
NM_017599chr1231383 346 229 --1816 --
NM_017602chrX3650 109 48 --2762 220 --
NM_017610chr1551488 764 698 506 125 ----12067
NM_017612chr122545 88 ------
NM_017613chr211353 ------
NM_017617chr921309 515 ------
NM_017626chr101612 11194 11517 --
NM_017628chr495258 4730 4189 2084 1313 1221 1022 848 781 1839 22017 1993 --
NM_017629chr111691 21879 1853 11921 --
NM_017633chr6103766 3750 3195 2682 2506 2434 1525 569 332 324 --43711 3675 2592 828 --
NM_017635chr111510 --1241 --
NM_017637chr9149313 7487 6135 6019 5762 3021 2622 2108 1419 1364 1149 726 645 403 15979 48830 8752 7720 2944 --
NM_017641chr1221043 315 1136 ----
NM_017643chr1742485 1163 975 468 12447 22037 412 --
NM_017644chr354990 3694 3545 1536 604 --23512 1512 --
NM_017645chr923177 2209 --1850 --
NM_017649chr1031126 900 412 ------
NM_017650chr7115635 4080 2036 1699 1493 1375 811 804 606 562 64 36107 5116 797 ----
NM_017657chr22252 74 ------
NM_017658chr1443253 1559 1385 568 12923 ----
NM_017660chr19103037 2662 2342 2200 1204 1121 986 910 727 316 --33113 2764 571 --
NM_017661chr1521269 81 1298 ----
NM_017666chrX52110 797 515 335 260 22185 1731 ----
NM_017668chr16159 ------
NM_017670chr118861 727 328 313 237 207 178 22 --130 --
NM_017672chr15--1121 ----
NM_017679chr17190 --144 1661
NM_017684chr1541721 431 78 68 11876 ----
NM_017693chr1341287 1270 530 277 ------
NM_017694chr2----11807 --
NM_017700chr42625 122 --1111 --
NM_017709chr143257 2815 1632 121 1678 22829 1179 --
NM_017712chr19185960 5723 5437 5139 4906 4898 4885 4599 4113 2544 2356 2156 1236 1135 1092 550 534 345 25526 1800 21595 35 15596
NM_017714chr201145 ------
NM_017715chr73230 97 25 ------
NM_017719chr332197 578 36 ------
NM_017721chr191336 ------
NM_017728chr1753072 2657 2527 755 451 --21993 1081 --
NM_017730chr31251 --1184 --
NM_017736chr1652591 1992 218 153 57 ------
NM_017737chr142243 701 438 274 12202 1451 --
NM_017738chr921128 91 1154 ----
NM_017739chr12426 161 ------
NM_017740chr1631744 320 28 11482 --1397
NM_017741chr422749 337 22438 234 ----
NM_017742chr1811296 --2779 298 --
NM_017744chr132484 956 276 12369 ----
NM_017745chrX1458 ------
NM_017746chr9122 ------
NM_017749chr11193 ------
NM_017752chrX21693 827 41878 1776 1633 629 ----
NM_017753chr91376 ------
NM_017754chr654561 3617 915 854 820 --21014 836 --
NM_017758chr174483 419 231 156 ------
NM_017761chr11548 1437 ----
NM_017762chr1552348 1943 957 626 260 --42353 2226 2128 904 --
NM_017763chr173256 182 73 ------
NM_017766chr14554 163 103 80 ------
NM_017772chr611414 --1105 --
NM_017778chr81532 ------
NM_017780chr82917 267 ------
NM_017784chr331186 169 38 11085 ----
NM_017789chr23569 147 97 --1754 --
NM_017790chr9125 ------
NM_017793chr152657 222 --1584 --
NM_017798chr2031119 952 863 ----1906
NM_017799chr142176 25 --21877 738 --
NM_017810chr162274 61 ------
NM_017811chr942685 2380 2209 926 12690 22809 397 1133
NM_017813chr895752 5300 4790 3829 3693 2024 1789 1236 721 ------
NM_017816chr4156 137 ----
NM_017824chr1042673 2663 103 49 ------
NM_017831chr1863865 3327 1771 1696 1297 435 24320 1483 ----
NM_017845chr41101 ------
NM_017848chrX74631 3865 3827 3244 3153 1282 160 --11774 --
NM_017849chr262661 815 617 580 500 170 1335 ----
NM_017866chr83450 428 422 ------
NM_017873chr953054 2458 667 616 559 --2724 53 --
NM_017880chr2294 28 1156 ----
NM_017905chr13--1209 ----
NM_017907chr112338 103 ------
NM_017913chr91348 ------
NM_017919chr984692 4130 2010 1840 1683 1070 163 55 25813 5099 ----
NM_017921chr1772272 1628 1586 1546 1448 564 500 168 12018 1263
NM_017926chr143300 262 238 143 ----
NM_017933chr2----1194 --
NM_017934chr6176 --185 --
NM_017935chr42174 82 ------
NM_017938chrX52070 1993 1966 583 51 ------
NM_017944chr11102427 2280 2197 2109 2081 1948 1930 1893 1106 664 13130 --1760
NM_017946chr74476 423 356 95 ------
NM_017952chr274207 3951 3409 2985 756 391 44 --1355 --
NM_017953chr1171 ------
NM_017954chr721131 274 --11662 --
NM_017955chr1431142 931 472 1112 199 --
NM_017958chr252984 2203 1896 622 274 ----11161
NM_017964chr21376 ------
NM_017972chr143300 262 238 143 ----
NM_017982chr131324 406 31 ------
NM_017987chr1031986 1935 736 ----1584
NM_017988chr121928 ------
NM_017994chr742821 2562 1199 892 --22925 2609 158
NM_017998chr931170 1015 946 ------
NM_018004chr32388 337 ------
NM_018011chr132494 239 1647 ----
NM_018014chr231382 497 74 ------
NM_018017chr1032749 2287 165 ------
NM_018018chr1251413 762 746 595 273 11322 ----
NM_018027chr1033233 2826 2039 1939 ----
NM_018028chr194873 518 395 171 1203 ----
NM_018030chr1831060 282 257 ------
NM_018032chr162292 244 2839 67 ----
NM_018045chr152648 1201 1059 815 33 11997 22026 990 --
NM_018046chr521215 592 ------
NM_018047chr53857 247 217 --1794 --
NM_018048chr1211414 11959 --11716
NM_018054chr161557 --1481 1290
NM_018061chr1153 ------
NM_018063chr101404 ------
NM_018064chr61237 ------
NM_018067chr11130 ------
NM_018070chr11116 --1505 --
NM_018071chr141113 ------
NM_018084chr24879 802 407 355 ------
NM_018085chr1116926 6526 5579 5163 2757 2456 2387 944 548 478 287 32699 2323 2141 28115 2113 --
NM_018086chr261855 1633 1395 344 323 58 1689 ----
NM_018087chr1--135 ----
NM_018095chr114666 258 215 173 1709 ----
NM_018096chr174998 723 710 249 --2265 138 --
NM_018098chr33954 341 170 ------
NM_018103chr11321 ------
NM_018107chr142993 251 1198 ----
NM_018110chr164882 477 416 31 --3968 404 45 --
NM_018112chr92231 53 ------
NM_018116chr11511 ------
NM_018117chr10--1756 ----
NM_018121chr1062692 2668 1217 1001 691 193 --12245 --
NM_018124chr1642472 2433 82 33 ------
NM_018126chr431171 270 61 ------
NM_018128chr172947 366 1548 ----
NM_018133chr321837 71 --1455 --
NM_018144chr10----1265 --
NM_018155chr341271 1202 1039 878 1589 11033 --
NM_018157chr1263245 2836 2206 2184 851 95 ------
NM_018159chrX2688 172 21646 650 ----
NM_018171chr121745 ------
NM_018178chr14797 657 538 438 --134 --
NM_018179chr121234 ------
NM_018181chr1821712 107 --11402 --
NM_018182chr1741784 1734 755 315 --21811 406 --
NM_018184chr381736 1682 1675 1547 1343 856 716 656 1143 ----
NM_018189chr351781 1762 1682 340 105 176 1168 --
NM_018191chr1311329 147 --1605
NM_018195chr111695 --1617 --
NM_018200chr1562161 1803 1767 1596 693 335 32524 838 811 2739 579 1608
NM_018201chr982378 1987 1006 854 776 731 688 338 22509 972 ----
NM_018202chr11118 --1796 --
NM_018211chr131706 1615 50 --11853 --
NM_018214chr641169 139 62 41 11212 ----
NM_018216chr12104 28 ------
NM_018221chr2133 ------
NM_018227chr432246 1260 561 12096 ----
NM_018230chr11379 1483 ----
NM_018243chr493814 3449 3375 1206 1102 813 284 256 38 23076 150 13528 --
NM_018244chr2021065 179 11292 2367 67 --
NM_018245chr103349 153 41 --1452 --
NM_018246chr852703 2352 1759 592 330 2778 169 ----
NM_018247chr663133 2878 2014 2007 648 419 1229 12040 --
NM_018254chr11860 --12219 --
NM_018263chr262416 2238 1792 1046 689 675 --22085 711 --
NM_018275chr72579 65 1145 ----
NM_018287chr1021028 177 11277 ----
NM_018293chr372696 2498 2453 2329 1896 1072 503 ------
NM_018307chr172984 71 1769 ----
NM_018310chr83569 56 31 ------
NM_018312chr1141955 1937 1706 96 123 ----
NM_018313chr31905 ------
NM_018314chr111247 --1631 --
NM_018315chr461199 1087 617 370 362 212 ------
NM_018323chr421391 75 ------
NM_018325chr951451 1168 1044 671 103 ------
NM_018327chr20----1650 --
NM_018332chr1631365 1189 540 ------
NM_018339chr911446 --11646 --
NM_018340chr1664999 4748 3955 3787 1436 1028 24459 1427 14979 185
NM_018348chr161314 --165 --
NM_018351chr1234563 837 587 24308 454 13809 --
NM_018354chr202249 59 ------
NM_018361chr873288 1474 1452 1073 944 242 209 ------
NM_018362chr1143198 3192 2698 516 1370 ----
NM_018364chr143228 780 367 222 1728 ----
NM_018367chr1142110 2016 1015 754 --1170 12416
NM_018369chr5139 ------
NM_018371chr851500 1443 1057 574 149 --1304 --
NM_018374chr785127 4929 1953 1923 1737 1452 1234 442 ------
NM_018375chr1441717 1214 1204 405 ------
NM_018387chr9180 ------
NM_018388chrX1519 11280 ----
NM_018394chr351490 1345 1215 1160 180 11594 ----
NM_018398chr31288 ------
NM_018403chr363675 3477 2683 1594 1568 324 ------
NM_018416chr1292571 2511 2346 2245 2053 1639 808 769 205 ------
NM_018419chr202317 82 --1280 --
NM_018424chr931927 1501 766 1187 ----
NM_018425chr1092219 1054 866 706 699 314 271 135 123 22650 2404 11837 --
NM_018426chr61114 ------
NM_018427chr1641477 517 497 356 ------
NM_018429chr532822 2257 2085 11920 ----
NM_018440chr8128156 8001 7300 6907 6858 6777 5828 5628 3141 2158 551 420 26713 3371 37628 1821 247 --
NM_018444chr852388 2092 1967 1593 884 --1338 --
NM_018452chr6_random83073 2854 2822 2681 2431 1232 1222 584 22994 114 ----
NM_018457chr123460 198 43 --1134 --
NM_018462chr32635 21 ------
NM_018469chr17----1202 --
NM_018476chrX145 ------
NM_018482chr841617 305 89 49 12391 ----
NM_018489chr14796 595 446 65 ------
NM_018490chr112748 413 ------
NM_018509chr1741465 1201 482 66 --121 --
NM_018553chr1761817 1556 1367 1290 132 107 ------
NM_018555chr194843 742 570 246 ------
NM_018557chr221465 527 3491 240 161 ----
NM_018566chr185014 3275 3144 3127 1280 1027 730 227 11207 ----
NM_018569chr41203 11107 11252 --
NM_018571chr2----150 --
NM_018584chr141060 863 848 106 ------
NM_018593chr62553 33 --1516 --
NM_018602chr1521242 553 1134 ----
NM_018638chr1295370 4100 3909 3608 1335 649 573 114 94 12056 14808 --
NM_018640chr1232787 2772 241 --12089 --
NM_018644chr1142087 533 514 37 --1198 --
NM_018649chr101384 --1228 --
NM_018650chr131786 842 361 12244 ----
NM_018653chr172394 352 ------
NM_018660chr882903 2885 1145 1042 831 547 355 126 11891 --1364
NM_018667chr1642387 1965 449 365 11845 11862 12611
NM_018682chr7167 ------
NM_018684chrX41290 1020 973 163 ------
NM_018689chr1592572 2105 2082 1800 1786 1081 925 894 653 ----1989
NM_018695chr522447 1692 1195 ----
NM_018700chr521353 651 1305 ----
NM_018703chr162372 127 1354 ----
NM_018704chr142020 1577 800 772 --11582 --
NM_018710chr82417 185 ----1325
NM_018712chr1131508 409 64 11416 ----
NM_018715chr121640 233 ------
NM_018717chr442405 940 734 665 --1779 --
NM_018718chr732130 2056 570 --22141 240 --
NM_018841chr153510 3473 3253 2931 1013 --1692 --
NM_018896chr171252 ------
NM_018898chr541892 1712 653 77 ------
NM_018899chr541892 1712 653 77 ------
NM_018900chr541892 1712 653 77 ------
NM_018901chr541892 1712 653 77 -