TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-362-3p
miRNA Sequence: AACACACCUAUUCAAGGAUUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000212chr1772311 2264 815 202 191 181 159 2213 164 ----
NM_000337chr564246 2405 1830 155 145 127 1114 ----
NM_000461chr354005 3023 2995 2985 634 ----13820
NM_000875chr1535761 5749 5521 12543 22557 2534 14276
NM_001004065chr954001 2823 1288 1262 1168 21334 1275 21323 1250 --
NM_002843chr1163244 3099 2757 2437 2095 1043 11048 --11387
NM_002886chr324438 901 2894 876 2908 887 --
NM_003028chr92518 504 1112 --2667 495
NM_003043chr333137 179 158 1171 --14146
NM_005937chr17113778 3606 3198 3181 2935 2884 2860 1508 780 762 754 ------
NM_013261chr441313 329 313 299 1318 1336 --
NM_014936chr631970 790 782 12877 --12363
NM_015138chr153884 615 601 2608 594 ----
NM_017633chr633473 1144 1038 32811 1043 1022 ----
NM_017789chr25625 334 320 290 178 1327 ----
NM_017848chrX64421 3703 1013 897 890 838 41038 1026 1018 938 13160 --
NM_017902chr10115025 4708 3956 1728 952 934 875 865 853 336 263 1301 1912 --
NM_020951chr1952394 2049 885 742 727 2878 717 ----
NM_025090chr176289 279 167 147 100 90 5378 257 228 111 82 7357 270 241 212 185 159 64 1298
NM_170665chr1231517 1115 367 31259 1108 1098 ----
NM_194247chr254468 1609 793 648 635 ----13052