TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-362-5p
miRNA Sequence: AAUCCUUGGAACCUAGGUGUGAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000555chrX87451 7150 6539 4837 2431 1940 1367 1351 12916 1251 --
NM_000813chr595514 4232 3736 1731 1412 1311 1154 1133 27 ------
NM_001003652chr1877321 6410 6057 1962 1956 1943 705 ----1985
NM_001031695chr22104950 3535 3504 2169 2038 1942 1651 966 915 343 14729 44298 4162 3426 1416 13445
NM_001040152chr784899 4809 4178 1771 1660 1584 1010 202 23745 3239 ----
NM_001042355chr1685003 4921 2005 1961 1820 1576 682 132 34037 3493 3336 12040 24722 383
NM_001042599chr297514 7084 4773 2559 2429 1660 1362 1316 1262 11481 27704 6757 --
NM_001100108chr1117157 6452 5155 2414 2366 2044 1578 1344 1008 963 278 26345 2515 22287 1754 --
NM_001167chrX96234 5979 5367 5017 4410 2430 2422 2332 1189 --16508 15972
NM_001969chr14103876 3711 3427 3267 3026 3018 2520 1253 842 733 ------
NM_002025chrX138791 6390 6290 3232 3037 2649 2561 2507 2359 2348 896 686 401 27735 2702 ----
NM_002336chr1274780 4711 3926 3357 1842 1470 96 24736 172 24904 1861 --
NM_002709chr292929 2876 2612 2210 1305 1047 139 125 41 ------
NM_002737chr17126238 5924 5843 5240 5084 4653 4555 4170 1825 1210 727 458 11094 25211 4615 24477 769
NM_003326chr172601 2461 2199 814 787 761 426 ----22108 163
NM_004171chr11159042 7516 7321 7257 6811 6684 6394 5875 5818 2274 1794 1608 1339 1284 368 39107 7287 1901 18368 --
NM_004464chr491469 1197 1032 823 816 783 770 296 201 23147 257 ----
NM_005955chr1105003 4430 3386 2187 1726 1604 1504 327 170 91 --21717 1092 --
NM_007249chr13129182 8808 7786 6826 3143 2704 2090 1938 1490 1244 1083 874 28848 7799 --21462 1373
NM_012199chr164322 4090 3494 2847 451 85 --13730 23981 3522
NM_014423chr575172 5009 1272 939 921 806 500 33480 1756 591 13673 15542
NM_014730chr12104877 4837 4789 4742 4492 4466 3572 3409 1242 370 21940 252 21015 286 --
NM_014747chr1125181 4806 4790 4689 4665 4642 4249 4080 3932 1039 1001 966 12151 1345 13573
NM_014953chr1363894 3275 1352 1023 449 406 --1266 22682 1452
NM_015076chr683866 3577 3088 1375 878 798 570 299 --13463 13189
NM_015090chr1146118 5022 4763 4700 4454 4424 4151 2363 2149 2037 1064 684 573 500 13849 --24997 112
NM_015092chr1664096 3992 3917 3832 3400 445 14056 33855 797 222 1184
NM_015310chr8178370 7485 7479 7236 7196 7055 6709 6446 6271 2985 2718 2667 2312 1045 756 679 592 13249 16834 --
NM_015313chr1184577 4032 2967 1665 1546 1012 1006 106 23029 1191 21200 451 --
NM_016206chr3158522 7983 7487 7296 6730 6573 3480 2912 2821 2536 1374 929 451 333 44 26682 5540 18972 --
NM_017637chr9159381 9157 8656 7540 7348 7232 6884 6820 6419 6169 6120 2655 2278 1883 840 37257 3726 3378 39238 7812 7531 --
NM_017643chr1762718 2274 2109 824 528 35 21205 356 11960 11213
NM_017919chr9105831 4465 4151 3875 3839 2131 1880 939 301 249 --25728 1429 --
NM_018373chr1496333 6018 5373 4910 4381 2367 668 608 376 24716 1721 ----
NM_018566chr194904 4774 4521 3858 3559 3548 3304 1677 1640 196 21416 677 --
NM_020440chr1103264 3232 2397 2145 1136 903 834 828 817 807 22417 1233 ----
NM_022469chr192843 2784 2658 2211 1312 1277 1007 916 416 21261 532 1360 --
NM_024548chr371723 1367 1124 558 532 452 410 21177 1090 --11356
NM_030786chr141317 314 253 56 --11355 1519
NM_030806chr1129356 8595 8474 8380 7644 7214 6999 6932 6634 5815 2515 1844 36828 6137 2597 27336 3368 18435
NM_033656chr2195598 4600 3989 3802 2401 1673 817 625 96 11336 --14087
NM_133264chr1793934 3560 3435 1518 1203 786 669 530 34 13914 --23357 608
NM_138473chr1294789 4602 4459 4170 4024 3685 3677 1552 1264 22023 140 23833 3148 14539
NM_144599chr15115131 4901 4861 4507 4500 4182 3995 3948 1889 1745 30 15261 14420 --
NM_152455chr1542472 2412 2270 2097 12086 --12870
NM_173468chr4105768 5393 4582 4191 2382 2291 2196 1121 944 707 25940 213 ----
NM_180989chr1362423 1978 696 688 459 54 ----1930
NM_213606chr1061055 832 269 170 107 94 1302 --1632